*HEADER    RNA                                     26-AUG-01   1JUR              
*TITLE     SOLUTION STRUCTURE OF HELIX III IN XENOPUS OOCYTE 5S RRNA.            
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: 5'-                                                        
*COMPND   3 R(*GP*GP*CP*CP*UP*GP*AP*GP*GP*AP*GP*AP*CP*UP*CP*AP*GP*AP*AP          
*COMPND   4 *GP*CP*C)-3';                                                        
*COMPND   5 CHAIN: A;                                                            
*COMPND   6 ENGINEERED: YES;                                                     
*COMPND   7 OTHER_DETAILS: HELIX III DOMAIN OF XENOPUS OOCYTE 5 S RRNA           
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES;                                                      
*SOURCE   3 OTHER_DETAILS: THE STEM OF THIS HAIRPIN OCCURS NATURALLY             
*SOURCE   4 IN XENOPUS OOCYTES.                                                  
*KEYWDS    RNA, 5 S RRNA, BULGE                                                  
*EXPDTA    NMR, 9 STRUCTURES                                                     
*AUTHOR    P.W.HUBER, J.P.RIFE, P.B.MOORE                                        
*REVDAT   1   16-JAN-02 1JUR    0                                                
!file cdih_std.dat 

! Backbone restraints are from Arnott fiber 
! coordinates as reported by Altona (1982).
!  First segment name: A
!      First sequence: GGCCUGAGGAGACUCAGAAGCC end
!              Length: 22 nucleotides

!------------------------------------------------
! Torsional angle alpha
! defined: O3'(n-1)-P-O5'-C5'
!------------------------------------------------
!G2 
assign ( resid 1 and name O3') ( resid 2 and name P  ) 
       ( resid 2 and name O5') ( resid 2 and name C5') 
       1 295  30  2
!C3 
assign ( resid 2 and name O3') ( resid 3 and name P  ) 
       ( resid 3 and name O5') ( resid 3 and name C5') 
       1 295  30  2
!C4 
!assign ( resid 3 and name O3') ( resid 4 and name P  ) 
!       ( resid 4 and name O5') ( resid 4 and name C5') 
!       1 295  30  2
!U5 
assign ( resid 4 and name O3') ( resid 5 and name P  ) 
       ( resid 5 and name O5') ( resid 5 and name C5') 
       1 295  30  2
!G6 
assign ( resid 5 and name O3') ( resid 6 and name P  ) 
       ( resid 6 and name O5') ( resid 6 and name C5') 
       1 295  30  2
!A7 
assign ( resid 6 and name O3') ( resid 7 and name P  ) 
       ( resid 7 and name O5') ( resid 7 and name C5') 
       1 295  30  2
!G8 
assign ( resid 7 and name O3') ( resid 8 and name P  ) 
       ( resid 8 and name O5') ( resid 8 and name C5') 
       1 295  30  2
!G9 
!assign ( resid 8 and name O3') ( resid 9 and name P  ) 
!       ( resid 9 and name O5') ( resid 9 and name C5') 
!       1 295  30  2
!A10 
!assign ( resid 9 and name O3') ( resid 10 and name P  ) 
!       ( resid 10 and name O5') ( resid 10 and name C5') 
!       1 295  30  2
!G11 
!assign ( resid 10 and name O3') ( resid 11 and name P  ) 
!       ( resid 11 and name O5') ( resid 11 and name C5') 
!       1 295  30  2
!A12 
!assign ( resid 11 and name O3') ( resid 12 and name P  ) 
!       ( resid 12 and name O5') ( resid 12 and name C5') 
!       1 295  30  2
!C13 
!assign ( resid 12 and name O3') ( resid 13 and name P  ) 
!       ( resid 13 and name O5') ( resid 13 and name C5') 
!       1 295  30  2
!U14 
assign ( resid 13 and name O3') ( resid 14 and name P  ) 
       ( resid 14 and name O5') ( resid 14 and name C5') 
       1 295  30  2
!C15 
assign ( resid 14 and name O3') ( resid 15 and name P  ) 
       ( resid 15 and name O5') ( resid 15 and name C5') 
       1 295  30  2
!A16 
assign ( resid 15 and name O3') ( resid 16 and name P  ) 
       ( resid 16 and name O5') ( resid 16 and name C5') 
       1 295  30  2
!G17 
!assign ( resid 16 and name O3') ( resid 17 and name P  ) 
!       ( resid 17 and name O5') ( resid 17 and name C5') 
!       1 295  30  2
!A18 
!assign ( resid 17 and name O3') ( resid 18 and name P  ) 
!       ( resid 18 and name O5') ( resid 18 and name C5') 
!       1 295  30  2
!A19 
!assign ( resid 18 and name O3') ( resid 19 and name P  ) 
!       ( resid 19 and name O5') ( resid 19 and name C5') 
!       1 295  30  2
!G20 
!assign ( resid 19 and name O3') ( resid 20 and name P  ) 
!       ( resid 20 and name O5') ( resid 20 and name C5') 
!       1 295  30  2
!C21 
assign ( resid 20 and name O3') ( resid 21 and name P  ) 
       ( resid 21 and name O5') ( resid 21 and name C5') 
       1 295  30  2
!C22 
assign ( resid 21 and name O3') ( resid 22 and name P  ) 
       ( resid 22 and name O5') ( resid 22 and name C5') 
       1 295  30  2

!------------------------------------------------
! Torsion angle beta
! defined: P-O5'-C5'-C4'
!------------------------------------------------
!G1 
!assign  ( resid 1 and name P  ) ( resid 1 and name O5')
!        ( resid 1 and name C5') ( resid 1 and name C4')
!       1 185  30  2 
!G2 
assign  ( resid 2 and name P  ) ( resid 2 and name O5')
        ( resid 2 and name C5') ( resid 2 and name C4')
        1 185  30  2 
!C3 
assign  ( resid 3 and name P  ) ( resid 3 and name O5')
        ( resid 3 and name C5') ( resid 3 and name C4')
        1 185  30  2 
!C4 
!assign  ( resid 4 and name P  ) ( resid 4 and name O5')
!        ( resid 4 and name C5') ( resid 4 and name C4')
!        1 185  30  2 
!U5 
assign  ( resid 5 and name P  ) ( resid 5 and name O5')
        ( resid 5 and name C5') ( resid 5 and name C4')
        1 185  30  2 
!G6 
assign  ( resid 6 and name P  ) ( resid 6 and name O5')
        ( resid 6 and name C5') ( resid 6 and name C4')
        1 185  30  2 
!A7 
assign  ( resid 7 and name P  ) ( resid 7 and name O5')
        ( resid 7 and name C5') ( resid 7 and name C4')
        1 185  30  2 
!G8 
assign  ( resid 8 and name P  ) ( resid 8 and name O5')
        ( resid 8 and name C5') ( resid 8 and name C4')
        1 185  30  2 
!G9 
!assign  ( resid 9 and name P  ) ( resid 9 and name O5')
!        ( resid 9 and name C5') ( resid 9 and name C4')
!        1 185  30  2 
!A10 
!assign  ( resid 10 and name P  ) ( resid 10 and name O5')
!        ( resid 10 and name C5') ( resid 10 and name C4')
!        1 185  30  2 
!G11 
!assign  ( resid 11 and name P  ) ( resid 11 and name O5')
!        ( resid 11 and name C5') ( resid 11 and name C4')
!        1 185  30  2 
!A12 
!assign  ( resid 12 and name P  ) ( resid 12 and name O5')
!        ( resid 12 and name C5') ( resid 12 and name C4')
!        1 185  30  2 
!C13 
!assign  ( resid 13 and name P  ) ( resid 13 and name O5')
!        ( resid 13 and name C5') ( resid 13 and name C4')
!        1 185  30  2 
!U14 
assign  ( resid 14 and name P  ) ( resid 14 and name O5')
        ( resid 14 and name C5') ( resid 14 and name C4')
        1 185  30  2 
!C15 
assign  ( resid 15 and name P  ) ( resid 15 and name O5')
        ( resid 15 and name C5') ( resid 15 and name C4')
        1 185  30  2 
!A16 
assign  ( resid 16 and name P  ) ( resid 16 and name O5')
        ( resid 16 and name C5') ( resid 16 and name C4')
        1 185  30  2 
!G17 
!assign  ( resid 17 and name P  ) ( resid 17 and name O5')
!        ( resid 17 and name C5') ( resid 17 and name C4')
!        1 185  30  2 
!A18 
!assign  ( resid 18 and name P  ) ( resid 18 and name O5')
!        ( resid 18 and name C5') ( resid 18 and name C4')
!        1 185  30  2 
!A19 
!assign  ( resid 19 and name P  ) ( resid 19 and name O5')
!        ( resid 19 and name C5') ( resid 19 and name C4')
!        1 185  30  2 
!G20 
!assign  ( resid 20 and name P  ) ( resid 20 and name O5')
!        ( resid 20 and name C5') ( resid 20 and name C4')
!        1 185  30  2 
!C21 
assign  ( resid 21 and name P  ) ( resid 21 and name O5')
        ( resid 21 and name C5') ( resid 21 and name C4')
        1 185  30  2 
!C22 
assign  ( resid 22 and name P  ) ( resid 22 and name O5')
        ( resid 22 and name C5') ( resid 22 and name C4')
        1 185  30  2 

!--------------------------------------------------
! Torsion angle gamma
! Stem constrained to A-form => gamma= 45 +/- 30
! defined: O5'-C5'-C4'-C3'
!--------------------------------------------------
!G1 
assign  ( resid 1 and name O5') ( resid 1 and name C5')
        ( resid 1 and name C4') ( resid 1 and name C3')
        1 45  30  2 
!G2 
assign  ( resid 2 and name O5') ( resid 2 and name C5')
        ( resid 2 and name C4') ( resid 2 and name C3')
        1 45  30  2 
!C3 
assign  ( resid 3 and name O5') ( resid 3 and name C5')
        ( resid 3 and name C4') ( resid 3 and name C3')
        1 45  30  2 
!C4 
!assign  ( resid 4 and name O5') ( resid 4 and name C5')
!        ( resid 4 and name C4') ( resid 4 and name C3')
!        1 45  30  2 
!U5 
assign  ( resid 5 and name O5') ( resid 5 and name C5')
        ( resid 5 and name C4') ( resid 5 and name C3')
        1 45  30  2 
!G6 
assign  ( resid 6 and name O5') ( resid 6 and name C5')
        ( resid 6 and name C4') ( resid 6 and name C3')
        1 45  30  2 
!A7 
assign  ( resid 7 and name O5') ( resid 7 and name C5')
        ( resid 7 and name C4') ( resid 7 and name C3')
        1 45  30  2 
!G8 
assign  ( resid 8 and name O5') ( resid 8 and name C5')
        ( resid 8 and name C4') ( resid 8 and name C3')
        1 45  30  2 
!G9 
!assign  ( resid 9 and name O5') ( resid 9 and name C5')
!        ( resid 9 and name C4') ( resid 9 and name C3')
!        1 45  30  2 
!A10 
!assign  ( resid 10 and name O5') ( resid 10 and name C5')
!        ( resid 10 and name C4') ( resid 10 and name C3')
!        1 45  30  2 
!G11 
!assign  ( resid 11 and name O5') ( resid 11 and name C5')
!        ( resid 11 and name C4') ( resid 11 and name C3')
!        1 45  30  2 
!A12 
!assign  ( resid 12 and name O5') ( resid 12 and name C5')
!        ( resid 12 and name C4') ( resid 12 and name C3')
!        1 45  30  2 
!C13 
!assign  ( resid 13 and name O5') ( resid 13 and name C5')
!        ( resid 13 and name C4') ( resid 13 and name C3')
!        1 45  30  2 
!U14 
assign  ( resid 14 and name O5') ( resid 14 and name C5')
        ( resid 14 and name C4') ( resid 14 and name C3')
        1 45  30  2 
!C15 
assign  ( resid 15 and name O5') ( resid 15 and name C5')
        ( resid 15 and name C4') ( resid 15 and name C3')
        1 45  30  2 
!A16 
assign  ( resid 16 and name O5') ( resid 16 and name C5')
        ( resid 16 and name C4') ( resid 16 and name C3')
        1 45  30  2 
!G17 
!assign  ( resid 17 and name O5') ( resid 17 and name C5')
!        ( resid 17 and name C4') ( resid 17 and name C3')
!        1 45  30  2 
!A18 
!assign  ( resid 18 and name O5') ( resid 18 and name C5')
!        ( resid 18 and name C4') ( resid 18 and name C3')
!        1 45  30  2 
!A19 
!assign  ( resid 19 and name O5') ( resid 19 and name C5')
!        ( resid 19 and name C4') ( resid 19 and name C3')
!        1 45  30  2 
!G20 
!assign  ( resid 20 and name O5') ( resid 20 and name C5')
!        ( resid 20 and name C4') ( resid 20 and name C3')
!        1 45  30  2 
!C21 
assign  ( resid 21 and name O5') ( resid 21 and name C5')
        ( resid 21 and name C4') ( resid 21 and name C3')
        1 45  30  2 
!C22 
assign  ( resid 22 and name O5') ( resid 22 and name C5')
        ( resid 22 and name C4') ( resid 22 and name C3')
        1 45  30  2 

!-------------------------------------------------
! Torsion angle delta
! A-RNA angle 85
! (Use nu 3)
! defined: O4'-C4'-C3'-C2'
!-------------------------------------------------

!-------------------------------------------------
! Torsion angle epsilon
! defined: C4'-C3'-O3'-P(n+1)
!-------------------------------------------------
!G1 
assign  ( resid 1 and name C4') ( resid 1 and name C3')
        ( resid 1 and name O3') ( resid 2 and name P  )
        1 195  30  2 
!G2 
assign  ( resid 2 and name C4') ( resid 2 and name C3')
        ( resid 2 and name O3') ( resid 3 and name P  )
        1 195  30  2 
!C3 
assign  ( resid 3 and name C4') ( resid 3 and name C3')
        ( resid 3 and name O3') ( resid 4 and name P  )
        1 -120 120  2 
!C4 
assign  ( resid 4 and name C4') ( resid 4 and name C3')
        ( resid 4 and name O3') ( resid 5 and name P  )
        1 195  30  2 
!U5 
assign  ( resid 5 and name C4') ( resid 5 and name C3')
        ( resid 5 and name O3') ( resid 6 and name P  )
        1 195  30  2 
!G6 
assign  ( resid 6 and name C4') ( resid 6 and name C3')
        ( resid 6 and name O3') ( resid 7 and name P  )
        1 195  30  2 
!A7 
assign  ( resid 7 and name C4') ( resid 7 and name C3')
        ( resid 7 and name O3') ( resid 8 and name P  )
        1 195  30  2 
!G8 
assign  ( resid 8 and name C4') ( resid 8 and name C3')
        ( resid 8 and name O3') ( resid 9 and name P  )
        1 -120 120  2 
!G9 
assign  ( resid 9 and name C4') ( resid 9 and name C3')
        ( resid 9 and name O3') ( resid 10 and name P  )
        1 -120 120  2 
!A10 
assign  ( resid 10 and name C4') ( resid 10 and name C3')
        ( resid 10 and name O3') ( resid 11 and name P  )
        1 -120 120  2 
!G11 
assign  ( resid 11 and name C4') ( resid 11 and name C3')
        ( resid 11 and name O3') ( resid 12 and name P  )
        1 -120 120  2 
!A12 
assign  ( resid 12 and name C4') ( resid 12 and name C3')
        ( resid 12 and name O3') ( resid 13 and name P  )
        1 -120 120  2 
!C13 
assign  ( resid 13 and name C4') ( resid 13 and name C3')
        ( resid 13 and name O3') ( resid 14 and name P  )
        1 195  30  2 
!U14 
assign  ( resid 14 and name C4') ( resid 14 and name C3')
        ( resid 14 and name O3') ( resid 15 and name P  )
        1 195  30  2 
!C15 
assign  ( resid 15 and name C4') ( resid 15 and name C3')
        ( resid 15 and name O3') ( resid 16 and name P  )
        1 195  30  2 
!A16 
assign  ( resid 16 and name C4') ( resid 16 and name C3')
        ( resid 16 and name O3') ( resid 17 and name P  )
        1 -120 120  2 
!G17 
assign  ( resid 17 and name C4') ( resid 17 and name C3')
        ( resid 17 and name O3') ( resid 18 and name P  )
        1 -120 120  2 
!A18 
assign  ( resid 18 and name C4') ( resid 18 and name C3')
        ( resid 18 and name O3') ( resid 19 and name P  )
        1 -120 120  2 
!A19 
assign  ( resid 19 and name C4') ( resid 19 and name C3')
        ( resid 19 and name O3') ( resid 20 and name P  )
        1 -120 120  2 
!G20 
assign  ( resid 20 and name C4') ( resid 20 and name C3')
        ( resid 20 and name O3') ( resid 21 and name P  )
        1 195  30  2 
!C21 
assign  ( resid 21 and name C4') ( resid 21 and name C3')
        ( resid 21 and name O3') ( resid 22 and name P  )
        1 195  30  2 

!-------------------------------------------------
! Torsion angle zeta
! defined: C3'-O3'-P(n+1)-O5'(n+1)
!-------------------------------------------------
!G1 
assign  ( resid 1 and name C3') ( resid 1 and name O3')
        ( resid 2 and name P  ) ( resid 2 and name O5')
        1 295  30  2 
!G2 
assign  ( resid 2 and name C3') ( resid 2 and name O3')
        ( resid 3 and name P  ) ( resid 3 and name O5')
        1 295  30  2 
!C3 
!assign  ( resid 3 and name C3') ( resid 3 and name O3')
!        ( resid 4 and name P  ) ( resid 4 and name O5')
!        1 295  30  2 
!C4 
assign  ( resid 4 and name C3') ( resid 4 and name O3')
        ( resid 5 and name P  ) ( resid 5 and name O5')
        1 295  30  2 
!U5 
assign  ( resid 5 and name C3') ( resid 5 and name O3')
        ( resid 6 and name P  ) ( resid 6 and name O5')
        1 295  30  2 
!G6 
assign  ( resid 6 and name C3') ( resid 6 and name O3')
        ( resid 7 and name P  ) ( resid 7 and name O5')
        1 295  30  2 
!A7 
assign  ( resid 7 and name C3') ( resid 7 and name O3')
        ( resid 8 and name P  ) ( resid 8 and name O5')
        1 295  30  2 
!G8 
!assign  ( resid 8 and name C3') ( resid 8 and name O3')
!        ( resid 9 and name P  ) ( resid 9 and name O5')
!        1 295  30  2 
!G9 
!assign  ( resid 9 and name C3') ( resid 9 and name O3')
!        ( resid 10 and name P  ) ( resid 10 and name O5')
!        1 295  30  2 
!A10 
!assign  ( resid 10 and name C3') ( resid 10 and name O3')
!        ( resid 11 and name P  ) ( resid 11 and name O5')
!        1 295  30  2 
!G11 
!assign  ( resid 11 and name C3') ( resid 11 and name O3')
!        ( resid 12 and name P  ) ( resid 12 and name O5')
!        1 295  30  2 
!A12 
!assign  ( resid 12 and name C3') ( resid 12 and name O3')
!        ( resid 13 and name P  ) ( resid 13 and name O5')
!        1 295  30  2 
!C13 
assign  ( resid 13 and name C3') ( resid 13 and name O3')
        ( resid 14 and name P  ) ( resid 14 and name O5')
        1 295  30  2 
!U14 
assign  ( resid 14 and name C3') ( resid 14 and name O3')
        ( resid 15 and name P  ) ( resid 15 and name O5')
        1 295  30  2 
!C15 
assign  ( resid 15 and name C3') ( resid 15 and name O3')
        ( resid 16 and name P  ) ( resid 16 and name O5')
        1 295  30  2 
!A16 
!assign  ( resid 16 and name C3') ( resid 16 and name O3')
!        ( resid 17 and name P  ) ( resid 17 and name O5')
!        1 295  30  2 
!G17 
!assign  ( resid 17 and name C3') ( resid 17 and name O3')
!        ( resid 18 and name P  ) ( resid 18 and name O5')
!        1 295  30  2 
!A18 
!assign  ( resid 18 and name C3') ( resid 18 and name O3')
!        ( resid 19 and name P  ) ( resid 19 and name O5')
!        1 295  30  2 
!A19 
!assign  ( resid 19 and name C3') ( resid 19 and name O3')
!        ( resid 20 and name P  ) ( resid 20 and name O5')
!        1 295  30  2 
!G20 
assign  ( resid 20 and name C3') ( resid 20 and name O3')
        ( resid 21 and name P  ) ( resid 21 and name O5')
        1 295  30  2 
!C21 
assign  ( resid 21 and name C3') ( resid 21 and name O3')
        ( resid 22 and name P  ) ( resid 22 and name O5')
        1 295  30  2 

!-----------------------------------------------
! Torsion angle chi  
!     200deg = _anti_; 60deg = _syn_
! Defined (pur): O4'-C1'-N9-C4
! Defined (pyr): O4'-C1'-N1-C2
!-----------------------------------------------
!G1 
assign ( resid 1 and name O4') ( resid 1 and name C1') 
       ( resid 1 and name N9 ) ( resid 1 and name C4 ) 
       1 200  30  2 
!G2 
assign ( resid 2 and name O4') ( resid 2 and name C1') 
       ( resid 2 and name N9 ) ( resid 2 and name C4 ) 
       1 200  30  2 
!C3 
assign ( resid 3 and name O4') ( resid 3 and name C1') 
       ( resid 3 and name N1 ) ( resid 3 and name C2 ) 
       1 200  60  2 
!C4 
assign ( resid 4 and name O4') ( resid 4 and name C1') 
       ( resid 4 and name N1 ) ( resid 4 and name C2 ) 
       1 200  60  2 
!U5 
assign ( resid 5 and name O4') ( resid 5 and name C1') 
       ( resid 5 and name N1 ) ( resid 5 and name C2 ) 
       1 200  30  2 
!G6 
assign ( resid 6 and name O4') ( resid 6 and name C1') 
       ( resid 6 and name N9 ) ( resid 6 and name C4 ) 
       1 200  30  2 
!A7 
assign ( resid 7 and name O4') ( resid 7 and name C1') 
       ( resid 7 and name N9 ) ( resid 7 and name C4 ) 
       1 200  30  2 
!G8 
assign ( resid 8 and name O4') ( resid 8 and name C1') 
       ( resid 8 and name N9 ) ( resid 8 and name C4 ) 
       1 200  30  2 
!G9 
assign ( resid 9 and name O4') ( resid 9 and name C1') 
       ( resid 9 and name N9 ) ( resid 9 and name C4 ) 
       1 200  60  2 
!A10 
assign ( resid 10 and name O4') ( resid 10 and name C1') 
       ( resid 10 and name N9 ) ( resid 10 and name C4 ) 
       1 200  60  2 
!G11 
assign ( resid 11 and name O4') ( resid 11 and name C1') 
       ( resid 11 and name N9 ) ( resid 11 and name C4 ) 
       1 200  60  2 
!A12 
assign ( resid 12 and name O4') ( resid 12 and name C1') 
       ( resid 12 and name N9 ) ( resid 12 and name C4 ) 
       1 200  60  2 
!C13 
assign ( resid 13 and name O4') ( resid 13 and name C1') 
       ( resid 13 and name N1 ) ( resid 13 and name C2 ) 
       1 200  30  2 
!U14 
assign ( resid 14 and name O4') ( resid 14 and name C1') 
       ( resid 14 and name N1 ) ( resid 14 and name C2 ) 
       1 200  30  2 
!C15 
assign ( resid 15 and name O4') ( resid 15 and name C1') 
       ( resid 15 and name N1 ) ( resid 15 and name C2 ) 
       1 200  30  2 
!A16 
assign ( resid 16 and name O4') ( resid 16 and name C1') 
       ( resid 16 and name N9 ) ( resid 16 and name C4 ) 
       1 200  30  2 
!G17 
assign ( resid 17 and name O4') ( resid 17 and name C1') 
       ( resid 17 and name N9 ) ( resid 17 and name C4 ) 
       1 200  60  2 
!A18 
assign ( resid 18 and name O4') ( resid 18 and name C1') 
       ( resid 18 and name N9 ) ( resid 18 and name C4 ) 
       1 200  60  2 
!A19 
assign ( resid 19 and name O4') ( resid 19 and name C1') 
       ( resid 19 and name N9 ) ( resid 19 and name C4 ) 
       1 200  60  2 
!G20 
assign ( resid 20 and name O4') ( resid 20 and name C1') 
       ( resid 20 and name N9 ) ( resid 20 and name C4 ) 
       1 200  60  2 
!C21 
assign ( resid 21 and name O4') ( resid 21 and name C1') 
       ( resid 21 and name N1 ) ( resid 21 and name C2 ) 
       1 200  30  2 
!C22 
assign ( resid 22 and name O4') ( resid 22 and name C1') 
       ( resid 22 and name N1 ) ( resid 22 and name C2 ) 
       1 200  30  2 

!-----------------------------------------------
! Torsion angle nu zero
! defined: C4'-O4'-C1'-C2'
!-----------------------------------------------
!G1 
assign  ( resid 1 and name C4') ( resid 1 and name O4')
        ( resid 1 and name C1') ( resid 1 and name C2')
        1 3  30  2 
!G2 
assign  ( resid 2 and name C4') ( resid 2 and name O4')
        ( resid 2 and name C1') ( resid 2 and name C2')
        1 3  30  2 
!C3 
assign  ( resid 3 and name C4') ( resid 3 and name O4')
        ( resid 3 and name C1') ( resid 3 and name C2')
        1 3  30  2 
!C4 
assign  ( resid 4 and name C4') ( resid 4 and name O4')
        ( resid 4 and name C1') ( resid 4 and name C2')
        1 3  30  2 
!U5 
assign  ( resid 5 and name C4') ( resid 5 and name O4')
        ( resid 5 and name C1') ( resid 5 and name C2')
        1 3  30  2 
!G6 
assign  ( resid 6 and name C4') ( resid 6 and name O4')
        ( resid 6 and name C1') ( resid 6 and name C2')
        1 3  30  2 
!A7 
assign  ( resid 7 and name C4') ( resid 7 and name O4')
        ( resid 7 and name C1') ( resid 7 and name C2')
        1 3  30  2 
!G8 
assign  ( resid 8 and name C4') ( resid 8 and name O4')
        ( resid 8 and name C1') ( resid 8 and name C2')
        1 3  30  2 
!G9 
assign  ( resid 9 and name C4') ( resid 9 and name O4')
        ( resid 9 and name C1') ( resid 9 and name C2')
        1 3  30  2 
!A10 
!assign  ( resid 10 and name C4') ( resid 10 and name O4')
!        ( resid 10 and name C1') ( resid 10 and name C2')
!        1 3  30  2 
!G11 
!assign  ( resid 11 and name C4') ( resid 11 and name O4')
!        ( resid 11 and name C1') ( resid 11 and name C2')
!        1 3  30  2 
!A12 
!assign  ( resid 12 and name C4') ( resid 12 and name O4')
!        ( resid 12 and name C1') ( resid 12 and name C2')
!        1 3  30  2 
!C13 
assign  ( resid 13 and name C4') ( resid 13 and name O4')
        ( resid 13 and name C1') ( resid 13 and name C2')
        1 3  30  2 
!U14 
assign  ( resid 14 and name C4') ( resid 14 and name O4')
        ( resid 14 and name C1') ( resid 14 and name C2')
        1 3  30  2 
!C15 
assign  ( resid 15 and name C4') ( resid 15 and name O4')
        ( resid 15 and name C1') ( resid 15 and name C2')
        1 3  30  2 
!A16 
assign  ( resid 16 and name C4') ( resid 16 and name O4')
        ( resid 16 and name C1') ( resid 16 and name C2')
        1 3  30  2 
!G17 
!assign  ( resid 17 and name C4') ( resid 17 and name O4')
!        ( resid 17 and name C1') ( resid 17 and name C2')
!        1 3  30  2 
!A18 
assign  ( resid 18 and name C4') ( resid 18 and name O4')
        ( resid 18 and name C1') ( resid 18 and name C2')
        1 -21.7  30  2 
!A19 
assign  ( resid 19 and name C4') ( resid 19 and name O4')
        ( resid 19 and name C1') ( resid 19 and name C2')
        1 -21.7  30  2 
!G20 
assign  ( resid 20 and name C4') ( resid 20 and name O4')
        ( resid 20 and name C1') ( resid 20 and name C2')
        1 3  30  2 
!C21 
assign  ( resid 21 and name C4') ( resid 21 and name O4')
        ( resid 21 and name C1') ( resid 21 and name C2')
        1 3  30  2 
!C22 
assign  ( resid 22 and name C4') ( resid 22 and name O4')
        ( resid 22 and name C1') ( resid 22 and name C2')
        1 3  30  2 

!------------------------------------------------
! Torsion angle nu one
! defined: O4'-C1'-C2'-C3'
!------------------------------------------------
!G1 
assign  ( resid 1 and name O4') ( resid 1 and name C1')
        ( resid 1 and name C2') ( resid 1 and name C3')
        1 -25  30  2 
!G2 
assign  ( resid 2 and name O4') ( resid 2 and name C1')
        ( resid 2 and name C2') ( resid 2 and name C3')
        1 -25  30  2 
!C3 
assign  ( resid 3 and name O4') ( resid 3 and name C1')
        ( resid 3 and name C2') ( resid 3 and name C3')
        1 -25  30  2 
!C4 
assign  ( resid 4 and name O4') ( resid 4 and name C1')
        ( resid 4 and name C2') ( resid 4 and name C3')
        1 -25  30  2 
!U5 
assign  ( resid 5 and name O4') ( resid 5 and name C1')
        ( resid 5 and name C2') ( resid 5 and name C3')
        1 -25  30  2 
!G6 
assign  ( resid 6 and name O4') ( resid 6 and name C1')
        ( resid 6 and name C2') ( resid 6 and name C3')
        1 -25  30  2 
!A7 
assign  ( resid 7 and name O4') ( resid 7 and name C1')
        ( resid 7 and name C2') ( resid 7 and name C3')
        1 -25  30  2 
!G8 
assign  ( resid 8 and name O4') ( resid 8 and name C1')
        ( resid 8 and name C2') ( resid 8 and name C3')
        1 -25  30  2 
!G9 
assign  ( resid 9 and name O4') ( resid 9 and name C1')
        ( resid 9 and name C2') ( resid 9 and name C3')
        1 -25  30  2 
!A10 
!assign  ( resid 10 and name O4') ( resid 10 and name C1')
!        ( resid 10 and name C2') ( resid 10 and name C3')
!        1 -25  30  2 
!G11 
!assign  ( resid 11 and name O4') ( resid 11 and name C1')
!        ( resid 11 and name C2') ( resid 11 and name C3')
!        1 -25  30  2 
!A12 
!assign  ( resid 12 and name O4') ( resid 12 and name C1')
!        ( resid 12 and name C2') ( resid 12 and name C3')
!        1 -25  30  2 
!C13 
assign  ( resid 13 and name O4') ( resid 13 and name C1')
        ( resid 13 and name C2') ( resid 13 and name C3')
        1 -25  30  2 
!U14 
assign  ( resid 14 and name O4') ( resid 14 and name C1')
        ( resid 14 and name C2') ( resid 14 and name C3')
        1 -25  30  2 
!C15 
assign  ( resid 15 and name O4') ( resid 15 and name C1')
        ( resid 15 and name C2') ( resid 15 and name C3')
        1 -25  30  2 
!A16 
assign  ( resid 16 and name O4') ( resid 16 and name C1')
        ( resid 16 and name C2') ( resid 16 and name C3')
        1 -25  30  2 
!G17 
!assign  ( resid 17 and name O4') ( resid 17 and name C1')
!        ( resid 17 and name C2') ( resid 17 and name C3')
!        1 -25  30  2 
!A18 
assign  ( resid 18 and name O4') ( resid 18 and name C1')
        ( resid 18 and name C2') ( resid 18 and name C3')
        1 35.2  30  2 
!A19 
assign  ( resid 19 and name O4') ( resid 19 and name C1')
        ( resid 19 and name C2') ( resid 19 and name C3')
        1 35.2  30  2 
!G20 
assign  ( resid 20 and name O4') ( resid 20 and name C1')
        ( resid 20 and name C2') ( resid 20 and name C3')
        1 -25  30  2 
!C21 
assign  ( resid 21 and name O4') ( resid 21 and name C1')
        ( resid 21 and name C2') ( resid 21 and name C3')
        1 -25  30  2 
!C22 
assign  ( resid 22 and name O4') ( resid 22 and name C1')
        ( resid 22 and name C2') ( resid 22 and name C3')
        1 -25  30  2 

!----------------------------------------------
! Torsion angle nu two
! defined: C1'-C2'-C3'-C4'
!----------------------------------------------
!G1 
assign  ( resid 1 and name C1') ( resid 1 and name C2')
        ( resid 1 and name C3') ( resid 1 and name C4')
        1 37  30  2 
!G2 
assign  ( resid 2 and name C1') ( resid 2 and name C2')
        ( resid 2 and name C3') ( resid 2 and name C4')
        1 37  30  2 
!C3 
assign  ( resid 3 and name C1') ( resid 3 and name C2')
        ( resid 3 and name C3') ( resid 3 and name C4')
        1 37  30  2 
!C4 
assign  ( resid 4 and name C1') ( resid 4 and name C2')
        ( resid 4 and name C3') ( resid 4 and name C4')
        1 37  30  2 
!U5 
assign  ( resid 5 and name C1') ( resid 5 and name C2')
        ( resid 5 and name C3') ( resid 5 and name C4')
        1 37  30  2 
!G6 
assign  ( resid 6 and name C1') ( resid 6 and name C2')
        ( resid 6 and name C3') ( resid 6 and name C4')
        1 37  30  2 
!A7 
assign  ( resid 7 and name C1') ( resid 7 and name C2')
        ( resid 7 and name C3') ( resid 7 and name C4')
        1 37  30  2 
!G8 
assign  ( resid 8 and name C1') ( resid 8 and name C2')
        ( resid 8 and name C3') ( resid 8 and name C4')
        1 37  30  2 
!G9 
assign  ( resid 9 and name C1') ( resid 9 and name C2')
        ( resid 9 and name C3') ( resid 9 and name C4')
        1 37  30  2 
!A10 
!assign  ( resid 10 and name C1') ( resid 10 and name C2')
!        ( resid 10 and name C3') ( resid 10 and name C4')
!        1 37  30  2 
!G11 
!assign  ( resid 11 and name C1') ( resid 11 and name C2')
!        ( resid 11 and name C3') ( resid 11 and name C4')
!        1 37  30  2 
!A12 
!assign  ( resid 12 and name C1') ( resid 12 and name C2')
!        ( resid 12 and name C3') ( resid 12 and name C4')
!        1 37  30  2 
!C13 
assign  ( resid 13 and name C1') ( resid 13 and name C2')
        ( resid 13 and name C3') ( resid 13 and name C4')
        1 37  30  2 
!U14 
assign  ( resid 14 and name C1') ( resid 14 and name C2')
        ( resid 14 and name C3') ( resid 14 and name C4')
        1 37  30  2 
!C15 
assign  ( resid 15 and name C1') ( resid 15 and name C2')
        ( resid 15 and name C3') ( resid 15 and name C4')
        1 37  30  2 
!A16 
assign  ( resid 16 and name C1') ( resid 16 and name C2')
        ( resid 16 and name C3') ( resid 16 and name C4')
        1 37  30  2 
!G17 
!assign  ( resid 17 and name C1') ( resid 17 and name C2')
!        ( resid 17 and name C3') ( resid 17 and name C4')
!        1 37  30  2 
!A18 
assign  ( resid 18 and name C1') ( resid 18 and name C2')
        ( resid 18 and name C3') ( resid 18 and name C4')
        1 -35.2  30  2 
!A19 
assign  ( resid 19 and name C1') ( resid 19 and name C2')
        ( resid 19 and name C3') ( resid 19 and name C4')
        1 -35.2  30  2 
!G20 
assign  ( resid 20 and name C1') ( resid 20 and name C2')
        ( resid 20 and name C3') ( resid 20 and name C4')
        1 37  30  2 
!C21 
assign  ( resid 21 and name C1') ( resid 21 and name C2')
        ( resid 21 and name C3') ( resid 21 and name C4')
        1 37  30  2 
!C22 
assign  ( resid 22 and name C1') ( resid 22 and name C2')
        ( resid 22 and name C3') ( resid 22 and name C4')
        1 37  30  2 

!---------------------------------------------
! Torsion angle nu three
! defined: C2'-C3'-C4'-O4'
!---------------------------------------------
!G1 
assign  ( resid 1 and name C2') ( resid 1 and name C3')
        ( resid 1 and name C4') ( resid 1 and name O4')
        1 -36  30  2 
!G2 
assign  ( resid 2 and name C2') ( resid 2 and name C3')
        ( resid 2 and name C4') ( resid 2 and name O4')
        1 -36  30  2 
!C3 
assign  ( resid 3 and name C2') ( resid 3 and name C3')
        ( resid 3 and name C4') ( resid 3 and name O4')
        1 -36  30  2 
!C4 
assign  ( resid 4 and name C2') ( resid 4 and name C3')
        ( resid 4 and name C4') ( resid 4 and name O4')
        1 -36  30  2 
!U5 
assign  ( resid 5 and name C2') ( resid 5 and name C3')
        ( resid 5 and name C4') ( resid 5 and name O4')
        1 -36  30  2 
!G6 
assign  ( resid 6 and name C2') ( resid 6 and name C3')
        ( resid 6 and name C4') ( resid 6 and name O4')
        1 -36  30  2 
!A7 
assign  ( resid 7 and name C2') ( resid 7 and name C3')
        ( resid 7 and name C4') ( resid 7 and name O4')
        1 -36  30  2 
!G8 
assign  ( resid 8 and name C2') ( resid 8 and name C3')
        ( resid 8 and name C4') ( resid 8 and name O4')
        1 -36  30  2 
!G9 
assign  ( resid 9 and name C2') ( resid 9 and name C3')
        ( resid 9 and name C4') ( resid 9 and name O4')
        1 -36  30  2 
!A10 
!assign  ( resid 10 and name C2') ( resid 10 and name C3')
!        ( resid 10 and name C4') ( resid 10 and name O4')
!        1 -36  30  2 
!G11 
!assign  ( resid 11 and name C2') ( resid 11 and name C3')
!        ( resid 11 and name C4') ( resid 11 and name O4')
!        1 -36  30  2 
!A12 
!assign  ( resid 12 and name C2') ( resid 12 and name C3')
!        ( resid 12 and name C4') ( resid 12 and name O4')
!        1 -36  30  2 
!C13 
assign  ( resid 13 and name C2') ( resid 13 and name C3')
        ( resid 13 and name C4') ( resid 13 and name O4')
        1 -36  30  2 
!U14 
assign  ( resid 14 and name C2') ( resid 14 and name C3')
        ( resid 14 and name C4') ( resid 14 and name O4')
        1 -36  30  2 
!C15 
assign  ( resid 15 and name C2') ( resid 15 and name C3')
        ( resid 15 and name C4') ( resid 15 and name O4')
        1 -36  30  2 
!A16 
assign  ( resid 16 and name C2') ( resid 16 and name C3')
        ( resid 16 and name C4') ( resid 16 and name O4')
        1 -36  30  2 
!G17 
!assign  ( resid 17 and name C2') ( resid 17 and name C3')
!        ( resid 17 and name C4') ( resid 17 and name O4')
!        1 -36  30  2 
!A18 
assign  ( resid 18 and name C2') ( resid 18 and name C3')
        ( resid 18 and name C4') ( resid 18 and name O4')
        1 21.7  30  2 
!A19 
assign  ( resid 19 and name C2') ( resid 19 and name C3')
        ( resid 19 and name C4') ( resid 19 and name O4')
        1 21.7  30  2 
!G20 
assign  ( resid 20 and name C2') ( resid 20 and name C3')
        ( resid 20 and name C4') ( resid 20 and name O4')
        1 -36  30  2 
!C21 
assign  ( resid 21 and name C2') ( resid 21 and name C3')
        ( resid 21 and name C4') ( resid 21 and name O4')
        1 -36  30  2 
!C22 
assign  ( resid 22 and name C2') ( resid 22 and name C3')
        ( resid 22 and name C4') ( resid 22 and name O4')
        1 -36  30  2 

!---------------------------------------------
! Torsion angle nu four
! defined: C3'-C4'-O4'-C1'
!---------------------------------------------
!G1 
assign  ( resid 1 and name C3') ( resid 1 and name C4')
        ( resid 1 and name O4') ( resid 1 and name C1')
        1 21  30  2 
!G2 
assign  ( resid 2 and name C3') ( resid 2 and name C4')
        ( resid 2 and name O4') ( resid 2 and name C1')
        1 21  30  2 
!C3 
assign  ( resid 3 and name C3') ( resid 3 and name C4')
        ( resid 3 and name O4') ( resid 3 and name C1')
        1 21  30  2 
!C4 
assign  ( resid 4 and name C3') ( resid 4 and name C4')
        ( resid 4 and name O4') ( resid 4 and name C1')
        1 21  30  2 
!U5 
assign  ( resid 5 and name C3') ( resid 5 and name C4')
        ( resid 5 and name O4') ( resid 5 and name C1')
        1 21  30  2 
!G6 
assign  ( resid 6 and name C3') ( resid 6 and name C4')
        ( resid 6 and name O4') ( resid 6 and name C1')
        1 21  30  2 
!A7 
assign  ( resid 7 and name C3') ( resid 7 and name C4')
        ( resid 7 and name O4') ( resid 7 and name C1')
        1 21  30  2 
!G8 
assign  ( resid 8 and name C3') ( resid 8 and name C4')
        ( resid 8 and name O4') ( resid 8 and name C1')
        1 21  30  2 
!G9 
assign  ( resid 9 and name C3') ( resid 9 and name C4')
        ( resid 9 and name O4') ( resid 9 and name C1')
        1 21  30  2 
!A10 
!assign  ( resid 10 and name C3') ( resid 10 and name C4')
!        ( resid 10 and name O4') ( resid 10 and name C1')
!        1 21  30  2 
!G11 
!assign  ( resid 11 and name C3') ( resid 11 and name C4')
!        ( resid 11 and name O4') ( resid 11 and name C1')
!        1 21  30  2 
!A12 
!assign  ( resid 12 and name C3') ( resid 12 and name C4')
!        ( resid 12 and name O4') ( resid 12 and name C1')
!        1 21  30  2 
!C13 
assign  ( resid 13 and name C3') ( resid 13 and name C4')
        ( resid 13 and name O4') ( resid 13 and name C1')
        1 21  30  2 
!U14 
assign  ( resid 14 and name C3') ( resid 14 and name C4')
        ( resid 14 and name O4') ( resid 14 and name C1')
        1 21  30  2 
!C15 
assign  ( resid 15 and name C3') ( resid 15 and name C4')
        ( resid 15 and name O4') ( resid 15 and name C1')
        1 21  30  2 
!A16 
assign  ( resid 16 and name C3') ( resid 16 and name C4')
        ( resid 16 and name O4') ( resid 16 and name C1')
        1 21  30  2 
!G17 
!assign  ( resid 17 and name C3') ( resid 17 and name C4')
!        ( resid 17 and name O4') ( resid 17 and name C1')
!        1 21  30  2 
!A18 
assign  ( resid 18 and name C3') ( resid 18 and name C4')
        ( resid 18 and name O4') ( resid 18 and name C1')
        1 0  30  2 
!A19 
assign  ( resid 19 and name C3') ( resid 19 and name C4')
        ( resid 19 and name O4') ( resid 19 and name C1')
        1 0  30  2 
!G20 
assign  ( resid 20 and name C3') ( resid 20 and name C4')
        ( resid 20 and name O4') ( resid 20 and name C1')
        1 21  30  2 
!C21 
assign  ( resid 21 and name C3') ( resid 21 and name C4')
        ( resid 21 and name O4') ( resid 21 and name C1')
        1 21  30  2 
!C22 
assign  ( resid 22 and name C3') ( resid 22 and name C4')
        ( resid 22 and name O4') ( resid 22 and name C1')
        1 21  30  2 
! 'UN'oes
assign (resid 18 and name H2)
       (resid 17 and name H*)   4.0 0.1 40
assign (resid 18 and name H2)
       (resid 19 and name H*)   4.0 0.1 40
assign (resid 18 and name H2)
       (resid 4 and name H*)   4.0 0.1 40 
assign (resid 18 and name H2)
       (resid 3 and name H*)   4.0 0.1 40      
assign (resid 18 and name H2)
       (resid 20 and name H*)   4.0 0.1 40      
assign (resid 18 and name H2)
       (resid 21 and name H*)   4.0 0.1 40      
assign (resid 18 and name H2)
       (resid 21 and name H*)   4.0 0.1 40      
assign (resid 18 and name H2)
       (resid 1 and name H*)   4.0 0.1 40      
assign (resid 18 and name H2)
       (resid 16 and name H*)   4.0 0.1 40 
assign (resid 18 and name H2)
       (resid 15 and name H*)   4.0 0.1 40      
assign (resid 18 and name H2)
       (resid 5 and name H*)   4.0 0.1 40      
assign (resid 18 and name H2)
       (resid 6 and name H*)   4.0 0.1 40      


assign (resid 19 and name H2)
       (resid 18 and name H*)   4.0 0.1 40
assign (resid 19 and name H2)
       (resid 20 and name H*)   4.0 0.1 40
assign (resid 19 and name H2)
       (resid 4 and name H*)   4.0 0.1 40 
assign (resid 19 and name H2)
       (resid 3 and name H*)   4.0 0.1 40 
assign (resid 19 and name H2)
       (resid 21 and name H*)   4.0 0.1 40      
assign (resid 19 and name H2)
       (resid 21 and name H*)   4.0 0.1 40      
assign (resid 19 and name H2)
       (resid 1 and name H*)   4.0 0.1 40      

assign (resid 18 and name H2)
       (resid 19 and name H2) 1.0 0.1 40 !must allow this possibility
!later there is distance that puts A19H2 close to G20H1'

! anomeric/aromatic
assign (resid 1 and name H1')
 (resid 1 and name H8)    3.0  1.0  1.2
assign (resid 1 and name H1')
 (resid 2 and name H8)    3.0  1.0  1.2 !from strong to medium 8/3/98
assign (resid 2 and name H1')
 (resid 2 and name H8)    3.0  1.0  1.2
assign (resid 2 and name H1')
 (resid 3 and name H6)    4.0  1.0  1.5
assign (resid 3 and name H1')
 (resid 3 and name H6)    3.0  1.0  1.2
assign (resid 3 and name H1')
 (resid 4 and name H6)    4.0  1.0  1.5
assign (resid 4 and name H1')
 (resid 4 and name H6)    3.0  1.0  1.2
assign (resid 4 and name H1')
 (resid 5 and name H6)    4.0  1.0  1.5
assign (resid 5 and name H1')
 (resid 5 and name H6)    3.0  1.0  1.2
assign (resid 5 and name H1')
 (resid 6 and name H8)    4.0  1.0  1.5
assign (resid 6 and name H1')
 (resid 6 and name H8)    3.0  1.0  1.2
assign (resid 6 and name H1')
 (resid 7 and name H8)    3.0  1.0  1.2
assign (resid 7 and name H1')
 (resid 7 and name H8)    3.0  1.0  1.2
assign (resid 7 and name H1')
 (resid 8 and name H8)    4.0  1.0  1.5
assign (resid 8 and name H1')
 (resid 8 and name H8)    4.0  2.4  1.5
assign (resid 8 and name H1')
 (resid 9 and name H8)    4.0  2.4  1.5
assign (resid 9 and name H1')
 (resid 9 and name H8)    3.0  1.0  1.2
assign (resid 10 and name H1')
 (resid 10 and name H8)    3.0  1.0  1.2
assign (resid 10 and name H1')
 (resid 11 and name H8)    4.0  1.0  1.5
assign (resid 11 and name H1')
 (resid 11 and name H8)    3.0  1.0  1.2
assign (resid 11 and name H1')
 (resid 12 and name H8)    4.0  1.0  1.5
assign (resid 12 and name H1')
 (resid 12 and name H8)    3.0  1.0  1.2
assign (resid 14 and name H1')
 (resid 14 and name H6)    3.0  1.0  1.2
assign (resid 14 and name H1')
 (resid 15 and name H6)    3.0  1.0  1.2
assign (resid 15 and name H1')
 (resid 15 and name H6)    3.0  1.0  1.2
assign (resid 15 and name H1')
 (resid 16 and name H8)    4.0  2.4  1.5
assign (resid 16 and name H1')
 (resid 16 and name H8)    2.4  0.8  0.6
assign (resid 16 and name H1')
 (resid 17 and name H8)    4.0  1.0  1.5
assign (resid 17 and name H1')
 (resid 17 and name H8)    3.0  1.0  1.2
assign (resid 17 and name H1')
 (resid 18 and name H8)    4.0  1.0  1.5
assign (resid 18 and name H1')
 (resid 18 and name H8)    4.0  1.0  1.5
assign (resid 18 and name H1')
 (resid 19 and name H8)    4.0  1.0  1.5
assign (resid 19 and name H1')
 (resid 19 and name H8)    4.0  1.0  1.5
assign (resid 19 and name H1')
 (resid 20 and name H8)    4.0  1.0  1.5
assign (resid 20 and name H1')
 (resid 20 and name H8)    3.0  1.0  1.2
assign (resid 20 and name H1')
 (resid 21 and name H6)    4.0  2.4  1.5
assign (resid 21 and name H1')
 (resid 21 and name H6)    4.0  2.4  1.5
assign (resid 21 and name H1')
 (resid 22 and name H6)    4.0  2.4  1.5
assign (resid 22 and name H1')
 (resid 22 and name H6)    3.0  1.0  1.2
assign (resid 3 and name H6)
 (resid 4 and name H5)    4.0  1.0  1.5

! anomeric/H2
assign (resid 11 and name H1')
 (resid 10 and name H2)    2.4  0.8  0.6
assign (resid 15 and name H1')
 (resid 7 and name H2)    2.4  0.8  0.6
assign (resid 17 and name H1')
 (resid 16 and name H2)    2.4  0.8  0.6
assign (resid 6 and name H1')
 (resid 16 and name H2)    2.4  0.8  0.6
assign (resid 8 and name H1')
 (resid 7 and name H2)    2.4  0.8  0.6
assign (resid 20 and name H1')
 (resid 19 and name H2)    2.4  0.8  0.6

! H2'/aromatic
assign (resid 1 and name H2')
 (resid 1 and name H8)    2.4  0.8  0.6
assign (resid 1 and name H2')
 (resid 2 and name H8)    2.4  0.8  0.6
assign (resid 2 and name H2')
 (resid 2 and name H8)    4.0  2.4  1.5
assign (resid 2 and name H2')
 (resid 3 and name H6)    4.0  2.4  1.5
assign (resid 3 and name H2')
 (resid 3 and name H6)    4.0  2.4  1.5
assign (resid 3 and name H2')
 (resid 4 and name H6)    2.4  0.8  0.6
assign (resid 4 and name H2')
 (resid 4 and name H6)    4.0  1.0  1.5
assign (resid 4 and name H2')
 (resid 5 and name H6)    2.4  0.8  0.6
assign (resid 5 and name H2')
 (resid 5 and name H6)    4.0  2.4  1.5
assign (resid 5 and name H2')
 (resid 6 and name H8)    2.4  0.8  0.6
assign (resid 6 and name H2')
 (resid 6 and name H8)    3.0  1.0  1.2
assign (resid 6 and name H2')
 (resid 7 and name H8)    2.4  0.8  0.6
assign (resid 7 and name H2')
 (resid 7 and name H8)    3.0  1.0  1.2
assign (resid 7 and name H2')
 (resid 8 and name H8)    2.4  0.8  0.6
assign (resid 8 and name H2')
 (resid 8 and name H8)    4.0  2.4  1.5
assign (resid 8 and name H2')
 (resid 9 and name H8)    4.0  2.4  1.5
assign (resid 9 and name H2')
 (resid 9 and name H8)    3.0  1.0  1.2
assign (resid 9 and name H2')
 (resid 10 and name H8)    4.0  1.0  1.5
assign (resid 10 and name H2')
 (resid 10 and name H8)    4.0  2.4  1.5
assign (resid 10 and name H2')
 (resid 11 and name H8)    3.0  1.0  1.2
assign (resid 11 and name H2')
 (resid 11 and name H8)    3.0  1.0  1.2
assign (resid 11 and name H2')
 (resid 12 and name H8)    2.4  0.8  0.6
assign (resid 12 and name H2')
 (resid 12 and name H8)    3.0  1.0  1.2
assign (resid 14 and name H2')
 (resid 14 and name H6)    4.0  2.4  1.5
assign (resid 14 and name H2')
 (resid 15 and name H6)    4.0  2.4  1.5
assign (resid 15 and name H2')
 (resid 15 and name H6)    4.0  2.4  1.5
assign (resid 15 and name H2')
 (resid 16 and name H8)    4.0  2.4  1.5
assign (resid 16 and name H2')
 (resid 16 and name H8)    2.4  0.8  0.6
assign (resid 16 and name H2')
 (resid 17 and name H8)    2.4  0.8  0.6
assign (resid 17 and name H2')
 (resid 17 and name H8)    2.4  0.8  0.6
assign (resid 17 and name H2')
 (resid 18 and name H8)    2.4  0.8  0.6
assign (resid 18 and name H2')
 (resid 18 and name H8)    4.0  2.4  1.5
!assign (resid 18 and name H2')
 !(resid 19 and name H8) very weak, if there
assign (resid 19 and name H2')
 (resid 19 and name H8)    4.0  2.4  1.5
assign (resid 19 and name H2')
 (resid 20 and name H8)    4.0  2.4  1.5
assign (resid 20 and name H2')
 (resid 20 and name H8)    3.0  1.0  1.2
assign (resid 20 and name H2')
 (resid 21 and name H6)    2.4  0.8  0.6
assign (resid 21 and name H2')
 (resid 21 and name H6)    4.0  2.4  1.5
assign (resid 21 and name H2')
 (resid 22 and name H6)    4.0  2.4  1.5
assign (resid 22 and name H2')
 (resid 22 and name H6)    2.4  0.8  0.6

! H3'/aromatic
assign (resid 1 and name H3')
 (resid 1 and name H8)    3.0  1.0  1.2
assign (resid 1 and name H3')
 (resid 2 and name H8)    4.0  1.0  1.5
assign (resid 2 and name H3')
 (resid 2 and name H8)    4.0  2.4  1.5
assign (resid 2 and name H3')
 (resid 3 and name H6)    4.0  2.4  1.5
assign (resid 3 and name H3')
 (resid 3 and name H6)    2.4  0.8  0.6
assign (resid 3 and name H3')
 (resid 4 and name H6)    2.4  0.8  0.6
assign (resid 4 and name H3')
 (resid 4 and name H6)    4.0  2.4  1.5
!assign (resid 4 and name H3')
 !(resid 5 and name H6) overlapped, can't determine
assign (resid 5 and name H3')
 (resid 5 and name H6)    2.4  0.8  0.6
assign (resid 5 and name H3')
 (resid 6 and name H8)    2.4  0.8  0.6
assign (resid 7 and name H3')
 (resid 7 and name H8)    3.0  1.0  1.2
assign (resid 7 and name H3')
 (resid 8 and name H8)    4.0  1.0  1.5
assign (resid 8 and name H3')
 (resid 8 and name H8)    4.0  2.4  1.5
assign (resid 8 and name H3')
 (resid 9 and name H8)    4.0  2.4  1.5
assign (resid 9 and name H3')
 (resid 9 and name H8)    2.4  0.8  0.6
assign (resid 10 and name H3')
 (resid 10 and name H8)    3.0  1.0  1.2
assign (resid 10 and name H3')
 (resid 11 and name H8)    2.4  0.8  0.6
assign (resid 11 and name H3')
 (resid 11 and name H8)    3.0  1.0  1.2
assign (resid 11 and name H3')
 (resid 12 and name H8)    3.0  1.0  1.2
assign (resid 12 and name H3')
 (resid 12 and name H8)    2.4  0.8  0.6
assign (resid 12 and name H3')
 (resid 13 and name H6)    3.0  1.0  1.2
assign (resid 13 and name H3')
 (resid 13 and name H6)    4.0  2.4  1.5
assign (resid 13 and name H3')
 (resid 14 and name H6)    4.0  2.4  1.5
assign (resid 14 and name H3')
 (resid 14 and name H6)    4.0  2.4  1.5
assign (resid 14 and name H3')
 (resid 15 and name H6)    4.0  2.4  1.5
assign (resid 15 and name H3')
 (resid 15 and name H6)    4.0  2.4  1.5
assign (resid 15 and name H3')
 (resid 16 and name H8)    4.0  2.4  1.5
assign (resid 17 and name H3')
 (resid 17 and name H8)    3.0  1.0  1.2
assign (resid 17 and name H3')
 (resid 18 and name H8)    3.0  1.0  1.2
assign (resid 18 and name H3')
 (resid 18 and name H8)    3.0  1.0  1.2
assign (resid 19 and name H3')
 (resid 19 and name H8)    4.0  2.4  1.5
assign (resid 19 and name H3')
 (resid 20 and name H8)    4.0  2.4  1.5
assign (resid 20 and name H3')
 (resid 20 and name H8)    2.4  0.8  0.6
assign (resid 20 and name H3')
 (resid 21 and name H6)    4.0  2.4  1.5

!aromatic/aromatic
assign (resid 8 and name H8)
 (resid 7 and name H8)    4.0  1.0  1.5
assign (resid 17 and name H8)
 (resid 16 and name H8)    4.0  1.0  1.5
assign (resid 6 and name H8)
 (resid 5 and name H6)    4.0  1.0  1.5
assign (resid 11 and name H8)
 (resid 10 and name H8)    4.0  1.0  1.5
assign (resid 2 and name H8)
 (resid 1 and name H8)    4.0  1.0  1.5
assign (resid 20 and name H8)
 (resid 19 and name H8)    4.0  1.0  1.5
assign (resid 13 and name H6)
 (resid 12 and name H8)    3.0  1.0  1.2
assign (resid 3 and name H6)
 (resid 4 and name H6)    4.0  1.0  1.5
assign (resid 17 and name H8)
 (resid 18 and name H8)    4.0  1.0  1.5
assign (resid 9 and name H8)
 (resid 10 and name H8)    4.0  1.0  1.5
assign (resid 6 and name H8)
 (resid 7 and name H8)    4.0  1.0  1.5
assign (resid 2 and name H8)
 (resid 3 and name H6)    4.0  1.0  1.5
assign (resid 16 and name H2)
 (resid 6 and name H8)    4.0  1.0  1.5
assign (resid 11 and name H8)
 (resid 12 and name H8)    4.0  1.0  1.5
assign (resid 7 and name H2)
 (resid 8 and name H8)    4.0  1.0  1.5
assign (resid 18 and name H8) !try without this noe 8.5.98 no wait there are clear noes.ss
 (resid 19 and name H8)    4.0  1.0  1.5
assign (resid 16 and name H2)
 (resid 17 and name H8)    4.0  1.0  1.5

! anomeric/anomeric
assign (resid 10 and name H1')
 (resid 11 and name H1')    4.0  1.0  1.5
assign (resid 21 and name H5)
 (resid 22 and name H5)    4.0  1.0  1.5
assign (resid 4 and name H5)
 (resid 3 and name H5)    4.0  1.0  1.5
assign (resid 5 and name H5)
 (resid 4 and name H5)    4.0  1.0  1.5
assign (resid 14 and name H5)
 (resid 15 and name H5)    4.0  1.0  1.5
assign (resid 1 and name H1')
 (resid 2 and name H1')    4.0  1.0  1.5
assign (resid 20 and name H1')
 (resid 21 and name H5)    4.0  1.0  1.5
assign (resid 11 and name H1')
 (resid 12 and name H1')    4.0  1.0  1.5
assign (resid 13 and name H5)
 (resid 14 and name H5)    4.0  1.0  1.5
assign (resid 2 and name H1')
 (resid 3 and name H5)    4.0  1.0  1.5
assign (resid 15 and name H1')
 (resid 16 and name H1')    4.0  1.0  1.5

! anomeric/ribose
assign (resid 1 and name H1')
 (resid 1 and name H2')    2.4  0.8  0.6
assign (resid 1 and name H1')
 (resid 1 and name H3')    4.0  2.4  1.5
assign (resid 2 and name H1')
 (resid 2 and name H2')    2.4  0.8  0.6
assign (resid 2 and name H1')
 (resid 2 and name H3')    4.0  2.4  1.5
assign (resid 2 and name H1')
 (resid 1 and name H2')    4.0  1.0  1.5
assign (resid 3 and name H1')
 (resid 3 and name H2')    2.4  0.8  0.6
assign (resid 3 and name H1')
 (resid 3 and name H3')    4.0  1.0  1.5
assign (resid 4 and name H1')
 (resid 4 and name H2')    2.4  0.8  0.6
assign (resid 4 and name H1')
 (resid 4 and name H3')    4.0  1.0  1.5
assign (resid 4 and name H1')
 (resid 3 and name H2')    4.0  1.0  1.5
assign (resid 5 and name H1')
 (resid 5 and name H2')    2.4  0.8  0.6
assign (resid 5 and name H1')
 (resid 5 and name H3')    4.0  1.0  1.5
assign (resid 5 and name H1')
 (resid 4 and name H2')    4.0  1.0  1.5
assign (resid 6 and name H1')
 (resid 6 and name H2')    2.4  0.8  0.6
assign (resid 6 and name H1')
 (resid 6 and name H3')    4.0  1.0  1.5
assign (resid 7 and name H1')
 (resid 7 and name H2')    2.4  0.8  0.6
assign (resid 7 and name H1')
 (resid 7 and name H3')    4.0  1.0  1.5
assign (resid 8 and name H1')
 (resid 8 and name H2')    2.4  0.8  0.6
assign (resid 8 and name H1')
 (resid 8 and name H3')    4.0  1.0  1.5
assign (resid 9 and name H1')
 (resid 9 and name H2')    2.4  0.8  0.6
assign (resid 9 and name H1')
 (resid 9 and name H3')    4.0  1.0  1.5
assign (resid 9 and name H1')
 (resid 8 and name H2')    4.0  1.0  1.5
assign (resid 10 and name H1')
 (resid 10 and name H2')    2.4  0.8  0.6
assign (resid 10 and name H1')
 (resid 10 and name H3')    4.0  1.0  1.5
assign (resid 10 and name H2')
       (resid 11 and name H1')     3.0 1.0 1.2  !added on 9/7/98
assign (resid 11 and name H1')
 (resid 11 and name H2')    2.4  0.8  0.6
assign (resid 11 and name H1')
 (resid 11 and name H3')    4.0  1.0  1.5
assign (resid 12 and name H1')
 (resid 12 and name H2')    2.4  0.8  0.6
assign (resid 12 and name H1')
 (resid 12 and name H3')    2.4  0.8  0.6
assign (resid 12 and name H1')
 (resid 11 and name H2')    3.0  1.0  1.2
assign (resid 13 and name H1')
 (resid 13 and name H2')    4.0  1.0  1.5
assign (resid 13 and name H1')
 (resid 13 and name H3')    4.0  1.0  1.5
assign (resid 14 and name H1')
 (resid 14 and name H2')    2.4  0.8  0.6
assign (resid 14 and name H1')
 (resid 14 and name H3')    4.0  1.0  1.5
assign (resid 15 and name H1')
 (resid 15 and name H2')    2.4  0.8  0.6
assign (resid 15 and name H1')
 (resid 15 and name H3')    4.0  1.0  1.5
assign (resid 16 and name H1')
 (resid 16 and name H2')    2.4  0.8  0.6
assign (resid 16 and name H1')
 (resid 16 and name H3')    4.0  1.0  1.5
assign (resid 17 and name H1')
 (resid 17 and name H2')    2.4  0.8  0.6
assign (resid 17 and name H1')
 (resid 17 and name H3')    4.0  1.0  1.5
assign (resid 17 and name H1')
 (resid 16 and name H2')    3.0  1.0  1.2
assign (resid 18 and name H1')
 (resid 18 and name H2')    2.4  0.8  0.6
assign (resid 18 and name H1')
 (resid 18 and name H3')    4.0  1.0  1.5
assign (resid 19 and name H1')
 (resid 19 and name H2')    2.4  0.8  0.6
assign (resid 19 and name H1')
 (resid 19 and name H3')    4.0  1.0  1.5
assign (resid 20 and name H1')
 (resid 20 and name H2')    2.4  0.8  0.6
assign (resid 20 and name H1')
 (resid 20 and name H3')    4.0  1.0  1.5
assign (resid 20 and name H1')
 (resid 19 and name H2')    4.0  1.0  1.5
assign (resid 21 and name H1')
 (resid 21 and name H2')    2.4  0.8  0.6
assign (resid 21 and name H1')
 (resid 21 and name H3')    4.0  1.0  1.5
assign (resid 22 and name H1')
 (resid 22 and name H2')    2.4  0.8  0.6
assign (resid 22 and name H1')
 (resid 22 and name H3')    4.0  1.0  1.5
assign (resid 22 and name H1')
 (resid 21 and name H2')    4.0  1.0  1.5
assign (resid 20 and name H3')
 (resid 21 and name H5)    3.0  1.0  1.2
assign (resid 20 and name H2')
 (resid 21 and name H5)    3.0  1.0  1.2

! Exchangables
assign (resid 14 and name H3)
 (resid 14 and name H5)    4.0  2.4  1.5
assign (resid 14 and name H3)
 (resid 15 and name H5)    4.0  2.4  1.5
assign (resid 14 and name H3)
 (resid 13 and name H42)    4.0  2.4  1.5
assign (resid 14 and name H3)
 (resid 7 and name H2)    4.0  2.4  1.5
assign (resid 14 and name H3)
 (resid 15 and name H41)    4.0  2.4  1.5
assign (resid 14 and name H3)
 (resid 13 and name H41)    4.0  2.4  1.5
assign (resid 5 and name H3)
 (resid 16 and name H2)    4.0  2.4  1.5
!assign (resid 2 and name H1)
! (resid 22 and name H5)    4.0  2.4  1.5
!assign (resid 2 and name H1)
! (resid 22 and name H1')    4.0  2.4  1.5
!assign (resid 2 and name H1)
! (resid 21 and name H42)    4.0  2.4  1.5
!assign (resid 2 and name H1)
! (resid 21 and name H41)    4.0  2.4  1.5
!assign (resid 2 and name H1)
! (resid 22 and name H41)    4.0  2.4  1.5
assign (resid 20 and name H1)
 (resid 4 and name H1')    4.0  2.4  1.5
assign (resid 20 and name H1)
 (resid 21 and name H1')    4.0  2.4  1.5
assign (resid 8 and name H1)
 (resid 9 and name H1')    4.0  2.4  1.5
assign (resid 8 and name H1)
 (resid 8 and name H22)    4.0  2.4  1.5
assign (resid 8 and name H1)
 (resid 13 and name H42)    4.0  2.4  1.5
assign (resid 8 and name H1)
 (resid 7 and name H2)    4.0  2.4  1.5
assign (resid 8 and name H1)
 (resid 8 and name H21)    4.0  2.4  1.5
assign (resid 8 and name H1)
 (resid 13 and name H41)    4.0  2.4  1.5
assign (resid 17 and name H1)
 (resid 17 and name H22)    4.0  2.4  1.5
assign (resid 17 and name H1)
 (resid 4 and name H42)    4.0  2.4  1.5
assign (resid 17 and name H1)
 (resid 4 and name H41)    4.0  2.4  1.5
assign (resid 6 and name H1)
 (resid 6 and name H22)    4.0  2.4  1.5
assign (resid 6 and name H1)
 (resid 15 and name H42)    4.0  2.4  1.5
assign (resid 6 and name H1)
 (resid 6 and name H21)    4.0  2.4  1.5
assign (resid 6 and name H1)
 (resid 15 and name H41)    4.0  2.4  1.5
assign (resid 9 and name H1)
 (resid 9 and name H21)    4.0  2.4  1.5
assign (resid 9 and name H1)
 (resid 9 and name H22)    4.0  2.4  1.5
assign (resid 9 and name H1)
 (resid 13 and name H41)    4.0  2.4  1.5
assign (resid 8 and name H22)
 (resid 13 and name H41)    4.0  2.4  1.5
!assign (resid 2 and name H21)
! (resid 20 and name H1')    4.0  2.4  1.5
assign (resid 17 and name H22)
 (resid 4 and name H41)    4.0  2.4  1.5
assign (resid 8 and name H22)
 (resid 13 and name H42)    4.0  2.4  1.5
assign (resid 17 and name H22)
 (resid 4 and name H42)    4.0  2.4  1.5
assign (resid 12 and name H2)
 (resid 13 and name H5)    4.0  2.4  1.5

!define base pairs

!help define the sheared GA of GNRA.

assign ( resid 9 and name H21) (resid 12 and name N7)  4.0  2.4  1.5
assign ( resid 9 and name N3) (resid 12 and name H61)  4.0  2.4  1.5

!for G1-C22 base pair
assign (resid 1 and name N1) (resid 22 and name N3)     2.91 0.1 0.1
assign (resid 1 and name O6) (resid 22 and name N4)     2.71 0.1 0.1
assign (resid 1 and name N2) (resid 22 and name O2)     3.08 0.1 0.1
assign (resid 1 and name H1) (resid 22 and name N3)     1.89 0.1 0.1
assign (resid 1 and name O6) (resid 22 and name H42)    1.71 0.1 0.1
assign (resid 1 and name H22) (resid 22 and name O2)    2.08 0.1 0.1

!for G2-C21 base pair
assign (resid 2 and name N1) (resid 21 and name N3)     2.91 0.1 0.1
assign (resid 2 and name O6) (resid 21 and name N4)     2.71 0.1 0.1
assign (resid 2 and name N2) (resid 21 and name O2)     3.08 0.1 0.1
assign (resid 2 and name H1) (resid 21 and name N3)     1.89 0.1 0.1
assign (resid 2 and name O6) (resid 21 and name H42)    1.71 0.1 0.1
assign (resid 2 and name H22) (resid 21 and name O2)    2.08 0.1 0.1

!for G20-C3 base pair
assign (resid 20 and name N1) (resid 3 and name N3)     2.91 0.1 0.1
assign (resid 20 and name O6) (resid 3 and name N4)     2.71 0.1 0.1
assign (resid 20 and name N2) (resid 3 and name O2)     3.08 0.1 0.1
assign (resid 20 and name H1) (resid 3 and name N3)     1.89 0.1 0.1
assign (resid 20 and name O6) (resid 3 and name H42)    1.71 0.1 0.1
assign (resid 20 and name H22) (resid 3 and name O2)    2.08 0.1 0.1

!for C4-G17 base pair
assign (resid 17 and name N1) (resid 4 and name N3)     2.91 0.1 0.1
assign (resid 17 and name O6) (resid 4 and name N4)     2.71 0.1 0.1
assign (resid 17 and name N2) (resid 4 and name O2)     3.08 0.1 0.1
assign (resid 17 and name H1) (resid 4 and name N3)     1.89 0.1 0.1
assign (resid 17 and name O6) (resid 4 and name H42)    1.71 0.1 0.1
assign (resid 17 and name H22) (resid 4 and name O2)    2.08 0.1 0.1

!for G6-C15 base pair
assign (resid 6 and name N1) (resid 15 and name N3)     2.91 0.1 0.1
assign (resid 6 and name O6) (resid 15 and name N4)     2.71 0.1 0.1
assign (resid 6 and name N2) (resid 15 and name O2)     3.08 0.1 0.1
assign (resid 6 and name H1) (resid 15 and name N3)     1.89 0.1 0.1
assign (resid 6 and name O6) (resid 15 and name H42)    1.71 0.1 0.1
assign (resid 6 and name H22) (resid 15 and name O2)    2.08 0.1 0.1

!for G8-C13 base pair
assign (resid 8 and name N1) (resid 13 and name N3)     2.91 0.1 0.1
assign (resid 8 and name O6) (resid 13 and name N4)     2.71 0.1 0.1
assign (resid 8 and name N2) (resid 13 and name O2)     3.08 0.1 0.1
assign (resid 8 and name H1) (resid 13 and name N3)     1.89 0.1 0.1
assign (resid 8 and name O6) (resid 13 and name H42)    1.71 0.1 0.1
assign (resid 8 and name H22) (resid 13 and name O2)    2.08 0.1 0.1


!for A16-U5 base pair
assign (resid 16 and name N1) (resid 5 and name H3)     1.93 0.1 0.1
assign (resid 16 and name H62) (resid 5 and name O4)    1.82 0.1 0.1
assign (resid 16 and name N1) (resid 5 and name N3)     2.95 0.1 0.1
assign (resid 16 and name N6) (resid 5 and name O4)     2.83 0.1 0.1

!for A7-U14 base pair
assign (resid 7 and name N1) (resid 14 and name H3)     1.93 0.1 0.1
assign (resid 7 and name H62) (resid 14 and name O4)    1.82 0.1 0.1
assign (resid 7 and name N1) (resid 14 and name N3)     2.95 0.1 0.1
assign (resid 7 and name N6) (resid 14 and name O4)     2.83 0.1 0.1

!to make tetraloop work (base pairing distances)
assign (resid 9 and name N3) (resid 12 and name H62)    2.0  0.5 0.7
assign (resid 9 and name N3) (resid 12 and name N6)     3.0 0.5 0.7 
assign (resid 9 and name H21) (resid 12 and name N7)    2.0  0.5 0.7
assign (resid 9 and name N2) (resid 12 and name N7)     3.0 0.5 0.7

!from Diener's tetraloop
assign (resid 10 and name H8) (resid 11 and name H8)     4.41 0.1 0.1
assign (resid 10 and name H2) (resid 11 and name H8)     5.61 0.1 0.1
assign (resid 11 and name H8) (resid 12 and name H8)     5.11 0.1 0.1
assign (resid 11 and name H8) (resid 12 and name H2)     8.07 0.1 0.1

assign (resid 12 and name H1') (resid 13 and name H6) 4.25 1.25 1.25 !IF upfield coueld be assigned then this noe would be there
assign (resid 13 and name H1') (resid 12 and name H8) 3.75 1.75 1.75!IF upfield coueld be assigned then this noe would be there

!unoes from Diener's structure calculation
assign (resid 10 and  name H2  ) (resid 12 and  name H1'  ) 7.0 1.5 50.0
assign (resid 10 and  name H8  ) (resid 12 and  name H8   ) 7.0 1.5 50.0
assign (resid 10 and  name H2  ) (resid 12 and  name H2   ) 7.0 1.5 50.0
assign (resid 10 and  name H1' ) (resid 12 and  name H1'  ) 7.0 1.5 50.0
assign (resid 10 and  name H1' ) (resid 12 and  name H8   ) 7.0 1.5 50.0

  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1   1H5*    G   1          H5'         G   1  34.955   0.425  11.686
    2   2H5*    G   1          H5''        G   1  33.613   0.120  10.587
    3    H4*    G   1           H4'        G   1  33.101   2.006  11.946
    4    H3*    G   1           H3'        G   1  33.716   2.953   9.124
    5    H2*    G   1           H2'        G   1  32.876   4.929   9.813
    6   2HO*    G   1          2HO'        G   1  31.183   4.917  11.163
    7    H1*    G   1           H1'        G   1  34.053   4.812  12.373
    8    H8     G   1           H8         G   1  35.705   4.165   9.037
    9    H1     G   1           H1         G   1  35.330  10.359  10.528
   10   1H2     G   1          H21         G   1  33.181   9.258  12.953
   11   2H2     G   1          H22         G   1  33.870  10.620  12.084
   12    H5T    G   1           H5T        G   1  34.842   1.102   8.928
   13   1H5*    G   2          H5'         G   2  29.627   3.780  10.551
   14   2H5*    G   2          H5''        G   2  28.497   4.059   9.237
   15    H4*    G   2           H4'        G   2  28.623   5.853  10.987
   16    H3*    G   2           H3'        G   2  29.094   6.653   8.085
   17    H2*    G   2           H2'        G   2  28.938   8.873   8.886
   18   2HO*    G   2          2HO'        G   2  27.221   8.137  10.546
   19    H1*    G   2           H1'        G   2  30.490   8.297  11.221
   20    H8     G   2           H8         G   2  32.649   6.721   8.885
   21    H1     G   2           H1         G   2  32.578  12.982   7.648
   22   1H2     G   2          H21         G   2  29.845  13.069   9.713
   23   2H2     G   2          H22         G   2  30.956  13.975   8.693
   24   1H5*    C   3          H5'         C   3  25.807   8.782   8.731
   25   2H5*    C   3          H5''        C   3  24.611   8.539   7.456
   26    H4*    C   3           H4'        C   3  25.169  10.821   7.542
   27    H3*    C   3           H3'        C   3  26.519   9.637   5.090
   28    H2*    C   3           H2'        C   3  26.811  11.904   4.452
   29   2HO*    C   3          2HO'        C   3  25.032  13.037   5.354
   30    H1*    C   3           H1'        C   3  27.902  12.463   6.985
   31   1H4     C   3          H41         C   3  33.087   9.451   4.439
   32   2H4     C   3          H42         C   3  33.061  11.023   3.647
   33    H5     C   3           H5         C   3  31.219   8.620   5.778
   34    H6     C   3           H6         C   3  29.046   9.158   6.638
   35   1H5*    C   4          H5'         C   4  24.567  12.228   3.014
   36   2H5*    C   4          H5''        C   4  23.632  11.517   1.688
   37    H4*    C   4           H4'        C   4  25.153  13.088   0.767
   38    H3*    C   4           H3'        C   4  26.023  10.246   0.152
   39    H2*    C   4           H2'        C   4  27.713  11.208  -1.216
   40   2HO*    C   4          2HO'        C   4  27.879  13.468  -1.515
   41    H1*    C   4           H1'        C   4  28.638  12.790   0.850
   42   1H4     C   4          H41         C   4  30.296   7.051   3.524
   43   2H4     C   4          H42         C   4  31.503   7.219   2.264
   44    H5     C   4           H5         C   4  28.449   8.460   3.780
   45    H6     C   4           H6         C   4  27.338  10.378   2.987
   46   1H5*    U   5          H5'         U   5  25.885  11.636  -3.492
   47   2H5*    U   5          H5''        U   5  24.930  10.683  -4.642
   48    H4*    U   5           H4'        U   5  27.191  10.782  -5.393
   49    H3*    U   5           H3'        U   5  26.536   8.002  -4.332
   50    H2*    U   5           H2'        U   5  28.613   7.353  -5.186
   51   2HO*    U   5          2HO'        U   5  28.714   8.928  -7.023
   52    H1*    U   5           H1'        U   5  29.918   9.396  -3.830
   53    H3     U   5           H3         U   5  30.241   5.369  -1.543
   54    H5     U   5           H5         U   5  27.219   7.588   0.294
   55    H6     U   5           H6         U   5  27.236   9.011  -1.591
   56   1H5*    G   6          H5'         G   6  27.978   7.429  -8.037
   57   2H5*    G   6          H5''        G   6  27.025   6.309  -9.014
   58    H4*    G   6           H4'        G   6  29.314   5.595  -8.876
   59    H3*    G   6           H3'        G   6  27.429   3.730  -7.391
   60    H2*    G   6           H2'        G   6  29.284   2.274  -7.217
   61   2HO*    G   6          2HO'        G   6  30.266   3.277  -9.348
   62    H1*    G   6           H1'        G   6  30.860   4.175  -6.203
   63    H8     G   6           H8         G   6  27.499   5.202  -4.824
   64    H1     G   6           H1         G   6  30.371   0.295  -1.865
   65   1H2     G   6          H21         G   6  32.176   0.105  -4.826
   66   2H2     G   6          H22         G   6  31.844  -0.635  -3.269
   67   1H5*    A   7          H5'         A   7  29.524   1.412 -10.044
   68   2H5*    A   7          H5''        A   7  28.497   0.230 -10.855
   69    H4*    A   7           H4'        A   7  30.347  -0.859  -9.853
   70    H3*    A   7           H3'        A   7  27.785  -1.521  -8.378
   71    H2*    A   7           H2'        A   7  29.080  -3.218  -7.336
   72   2HO*    A   7          2HO'        A   7  30.550  -3.232  -9.487
   73    H1*    A   7           H1'        A   7  31.143  -1.432  -6.738
   74    H8     A   7           H8         A   7  28.358   0.757  -6.156
   75   1H6     A   7          H61         A   7  26.941  -0.627  -1.818
   76   2H6     A   7          H62         A   7  27.175  -2.048  -0.825
   77    H2     A   7           H2         A   7  29.834  -4.784  -3.221
   78   1H5*    G   8          H5'         G   8  29.114  -5.120  -9.746
   79   2H5*    G   8          H5''        G   8  27.855  -6.143 -10.449
   80    H4*    G   8           H4'        G   8  29.003  -7.276  -8.632
   81    H3*    G   8           H3'        G   8  26.106  -6.599  -7.959
   82    H2*    G   8           H2'        G   8  26.426  -7.891  -6.004
   83   2HO*    G   8          2HO'        G   8  28.080  -9.338  -7.284
   84    H1*    G   8           H1'        G   8  28.867  -6.610  -5.418
   85    H8     G   8           H8         G   8  26.851  -3.841  -6.733
   86    H1     G   8           H1         G   8  25.526  -5.552  -0.695
   87   1H2     G   8          H21         G   8  27.259  -8.375  -1.466
   88   2H2     G   8          H22         G   8  26.410  -7.448  -0.244
   89   1H5*    G   9          H5'         G   9  22.612  -7.336  -9.500
   90   2H5*    G   9          H5''        G   9  23.615  -6.330  -8.446
   91    H4*    G   9           H4'        G   9  21.798  -8.515  -7.522
   92    H3*    G   9           H3'        G   9  21.262  -5.559  -7.771
   93    H2*    G   9           H2'        G   9  20.301  -5.389  -5.767
   94   2HO*    G   9          2HO'        G   9  19.171  -7.717  -6.171
   95    H1*    G   9           H1'        G   9  21.874  -7.396  -4.375
   96    H8     G   9           H8         G   9  23.692  -4.933  -6.362
   97    H1     G   9           H1         G   9  20.863  -2.342  -1.198
   98   1H2     G   9          H21         G   9  19.844  -5.603  -0.621
   99   2H2     G   9          H22         G   9  19.827  -3.944  -0.066
  100   1H5*    A  10          H5'         A  10  15.972  -6.168  -7.323
  101   2H5*    A  10          H5''        A  10  17.577  -6.220  -6.613
  102    H4*    A  10           H4'        A  10  15.891  -8.559  -7.496
  103    H3*    A  10           H3'        A  10  16.963  -7.730  -4.762
  104    H2*    A  10           H2'        A  10  16.777  -9.939  -4.173
  105   2HO*    A  10          2HO'        A  10  14.738 -10.541  -4.838
  106    H1*    A  10           H1'        A  10  17.261 -10.788  -6.931
  107    H8     A  10           H8         A  10  20.489  -9.447  -6.294
  108   1H6     A  10          H61         A  10  22.550 -13.366  -4.221
  109   2H6     A  10          H62         A  10  21.878 -14.700  -3.291
  110    H2     A  10           H2         A  10  17.491 -14.119  -3.079
  111   1H5*    G  11          H5'         G  11  14.472  -7.248  -0.724
  112   2H5*    G  11          H5''        G  11  16.061  -7.227  -1.511
  113    H4*    G  11           H4'        G  11  14.583  -9.679  -0.542
  114    H3*    G  11           H3'        G  11  17.174  -8.349   0.391
  115    H2*    G  11           H2'        G  11  17.970 -10.505   0.880
  116   2HO*    G  11          2HO'        G  11  15.974 -11.442   1.704
  117    H1*    G  11           H1'        G  11  17.073 -11.643  -1.495
  118    H8     G  11           H8         G  11  18.205  -8.456  -2.780
  119    H1     G  11           H1         G  11  23.075 -12.313  -1.187
  120   1H2     G  11          H21         G  11  20.737 -13.849   0.820
  121   2H2     G  11          H22         G  11  22.410 -13.799   0.290
  122   1H5*    A  12          H5'         A  12  16.407 -10.633   3.755
  123   2H5*    A  12          H5''        A  12  16.785  -9.830   5.289
  124    H4*    A  12           H4'        A  12  18.306 -11.728   4.869
  125    H3*    A  12           H3'        A  12  19.833  -9.177   4.419
  126    H2*    A  12           H2'        A  12  21.750 -10.165   4.560
  127   2HO*    A  12          2HO'        A  12  21.518 -12.158   5.676
  128    H1*    A  12           H1'        A  12  20.686 -11.627   2.661
  129    H8     A  12           H8         A  12  19.097  -8.275   2.141
  130   1H6     A  12          H61         A  12  23.591  -7.289  -1.987
  131   2H6     A  12          H62         A  12  21.896  -6.943  -1.680
  132    H2     A  12           H2         A  12  24.993 -10.084   1.054
  133   1H5*    C  13          H5'         C  13  23.229  -7.935   8.246
  134   2H5*    C  13          H5''        C  13  22.592  -6.962   6.897
  135    H4*    C  13           H4'        C  13  24.199  -9.517   6.565
  136    H3*    C  13           H3'        C  13  25.073  -6.629   6.012
  137    H2*    C  13           H2'        C  13  26.505  -7.574   4.467
  138   2HO*    C  13          2HO'        C  13  27.286  -9.561   4.943
  139    H1*    C  13           H1'        C  13  24.311  -9.390   3.579
  140   1H4     C  13          H41         C  13  22.748  -4.058   0.239
  141   2H4     C  13          H42         C  13  24.411  -4.104  -0.299
  142    H5     C  13           H5         C  13  21.803  -5.604   1.741
  143    H6     C  13           H6         C  13  22.174  -7.198   3.403
  144   1H5*    U  14          H5'         U  14  28.761  -8.724   6.169
  145   2H5*    U  14          H5''        U  14  30.081  -7.685   6.699
  146    H4*    U  14           H4'        U  14  30.292  -8.720   4.444
  147    H3*    U  14           H3'        U  14  30.558  -5.678   4.436
  148    H2*    U  14           H2'        U  14  31.196  -6.036   2.172
  149   2HO*    U  14          2HO'        U  14  32.090  -8.352   2.845
  150    H1*    U  14           H1'        U  14  29.127  -7.677   1.625
  151    H3     U  14           H3         U  14  28.113  -3.754  -0.495
  152    H5     U  14           H5         U  14  26.560  -3.374   3.398
  153    H6     U  14           H6         U  14  27.783  -5.322   4.014
  154   1H5*    C  15          H5'         C  15  33.819  -7.164   2.287
  155   2H5*    C  15          H5''        C  15  35.259  -6.182   2.535
  156    H4*    C  15           H4'        C  15  34.596  -6.283   0.189
  157    H3*    C  15           H3'        C  15  34.426  -3.502   1.391
  158    H2*    C  15           H2'        C  15  34.076  -2.759  -0.767
  159   2HO*    C  15          2HO'        C  15  34.259  -3.999  -2.615
  160    H1*    C  15           H1'        C  15  32.197  -4.817  -1.365
  161   1H4     C  15          H41         C  15  28.902  -0.050   1.818
  162   2H4     C  15          H42         C  15  29.182   0.610   0.212
  163    H5     C  15           H5         C  15  29.875  -2.131   2.561
  164    H6     C  15           H6         C  15  31.218  -4.014   1.898
  165   1H5*    A  16          H5'         A  16  36.893  -3.333  -1.801
  166   2H5*    A  16          H5''        A  16  38.370  -2.385  -1.580
  167    H4*    A  16           H4'        A  16  36.942  -1.552  -3.443
  168    H3*    A  16           H3'        A  16  37.315   0.329  -1.082
  169    H2*    A  16           H2'        A  16  36.136   1.846  -2.162
  170   2HO*    A  16          2HO'        A  16  36.982   1.943  -4.273
  171    H1*    A  16           H1'        A  16  34.392  -0.170  -3.332
  172    H8     A  16           H8         A  16  34.798  -0.104  -0.232
  173   1H6     A  16          H61         A  16  31.329   3.144   1.476
  174   2H6     A  16          H62         A  16  30.548   4.470   0.636
  175    H2     A  16           H2         A  16  32.217   4.473  -3.537
  176   1H5*    G  17          H5'         G  17  38.510   2.532  -4.529
  177   2H5*    G  17          H5''        G  17  39.793   3.645  -4.068
  178    H4*    G  17           H4'        G  17  37.828   4.843  -4.914
  179    H3*    G  17           H3'        G  17  38.408   5.271  -1.974
  180    H2*    G  17           H2'        G  17  36.865   6.830  -1.938
  181   2HO*    G  17          2HO'        G  17  36.007   7.960  -3.696
  182    H1*    G  17           H1'        G  17  35.055   5.446  -3.743
  183    H8     G  17           H8         G  17  36.741   4.059  -0.703
  184    H1     G  17           H1         G  17  32.044   8.111   0.695
  185   1H2     G  17          H21         G  17  31.981   8.646  -2.670
  186   2H2     G  17          H22         G  17  31.411   9.129  -1.080
  187   1H5*    A  18          H5'         A  18  40.131   8.977  -4.522
  188   2H5*    A  18          H5''        A  18  41.747   8.995  -3.817
  189    H4*    A  18           H4'        A  18  41.489  11.044  -3.910
  190    H3*    A  18           H3'        A  18  41.282  10.449  -1.315
  191    H2*    A  18           H2'        A  18  39.043  10.179  -1.278
  192   2HO*    A  18          2HO'        A  18  39.809  12.640  -0.284
  193    H1*    A  18           H1'        A  18  38.639  12.779  -2.757
  194    H8     A  18           H8         A  18  37.267   9.318  -1.975
  195   1H6     A  18          H61         A  18  31.739  11.896  -3.395
  196   2H6     A  18          H62         A  18  32.492  10.537  -2.556
  197    H2     A  18           H2         A  18  34.914  14.615  -4.762
  198   1H5*    A  19          H5'         A  19  41.016  16.242  -1.662
  199   2H5*    A  19          H5''        A  19  40.040  14.992  -0.884
  200    H4*    A  19           H4'        A  19  39.151  16.517  -3.312
  201    H3*    A  19           H3'        A  19  38.929  17.367  -0.540
  202    H2*    A  19           H2'        A  19  36.837  17.079  -0.271
  203   2HO*    A  19          2HO'        A  19  36.553  19.125  -1.431
  204    H1*    A  19           H1'        A  19  36.358  16.236  -3.115
  205    H8     A  19           H8         A  19  36.495  13.396  -0.758
  206   1H6     A  19          H61         A  19  31.779  12.872   0.158
  207   2H6     A  19          H62         A  19  30.405  13.968   0.111
  208    H2     A  19           H2         A  19  31.938  17.851  -1.456
  209   1H5*    G  20          H5'         G  20  38.031  20.875   1.627
  210   2H5*    G  20          H5''        G  20  38.024  19.114   1.433
  211    H4*    G  20           H4'        G  20  35.593  20.854   0.964
  212    H3*    G  20           H3'        G  20  36.311  19.225   3.449
  213    H2*    G  20           H2'        G  20  33.979  18.879   3.704
  214   2HO*    G  20          2HO'        G  20  33.415  21.107   2.844
  215    H1*    G  20           H1'        G  20  33.622  18.281   0.997
  216    H8     G  20           H8         G  20  36.884  16.704   1.963
  217    H1     G  20           H1         G  20  31.722  13.228   3.491
  218   1H2     G  20          H21         G  20  30.080  16.266   3.327
  219   2H2     G  20          H22         G  20  29.966  14.544   3.647
  220   1H5*    C  21          H5'         C  21  33.296  21.424   4.953
  221   2H5*    C  21          H5''        C  21  33.686  22.058   6.556
  222    H4*    C  21           H4'        C  21  31.754  20.703   6.732
  223    H3*    C  21           H3'        C  21  34.137  19.216   7.920
  224    H2*    C  21           H2'        C  21  32.546  17.685   8.748
  225   2HO*    C  21          2HO'        C  21  30.870  19.691   8.776
  226    H1*    C  21           H1'        C  21  31.204  17.597   6.274
  227   1H4     C  21          H41         C  21  36.468  13.620   5.700
  228   2H4     C  21          H42         C  21  35.165  12.629   6.352
  229    H5     C  21           H5         C  21  36.202  16.012   5.300
  230    H6     C  21           H6         C  21  34.761  17.892   5.648
  231   1H5*    C  22          H5'         C  22  31.948  19.059  11.143
  232   2H5*    C  22          H5''        C  22  32.851  19.702  12.524
  233    H4*    C  22           H4'        C  22  32.272  17.489  13.068
  234    H3*    C  22           H3'        C  22  35.172  17.440  12.147
  235    H2*    C  22           H2'        C  22  35.229  15.313  12.878
  236   2HO*    C  22          2HO'        C  22  33.508  14.382  14.232
  237    H1*    C  22           H1'        C  22  32.402  14.876  12.170
  238   1H4     C  22          H41         C  22  37.187  12.482   8.165
  239   2H4     C  22          H42         C  22  36.473  11.069   8.910
  240    H5     C  22           H5         C  22  36.527  14.725   8.657
  241    H6     C  22           H6         C  22  35.007  16.109   9.973
  242    H3T    C  22           H3T        C  22  35.517  17.608  14.415
  Start of MODEL    2
    1   1H5*    G   1          H5'         G   1  43.628   2.073  12.767
    2   2H5*    G   1          H5''        G   1  42.325   1.092  12.100
    3    H4*    G   1           H4'        G   1  41.451   3.061  13.158
    4    H3*    G   1           H3'        G   1  41.110   3.243  10.139
    5    H2*    G   1           H2'        G   1  39.724   4.990  10.647
    6   2HO*    G   1          2HO'        G   1  38.530   4.856  12.447
    7    H1*    G   1           H1'        G   1  41.365   6.052  12.574
    8    H8     G   1           H8         G   1  42.310   4.779   9.091
    9    H1     G   1           H1         G   1  41.093  11.043   9.376
   10   1H2     G   1          H21         G   1  39.810  10.263  12.486
   11   2H2     G   1          H22         G   1  39.997  11.475  11.234
   12    H5T    G   1           H5T        G   1  43.929   2.907  10.608
   13   1H5*    G   2          H5'         G   2  37.258   3.407  12.172
   14   2H5*    G   2          H5''        G   2  35.935   3.065  11.072
   15    H4*    G   2           H4'        G   2  35.795   5.235  12.196
   16    H3*    G   2           H3'        G   2  35.864   5.393   9.153
   17    H2*    G   2           H2'        G   2  35.217   7.673   9.511
   18   2HO*    G   2          2HO'        G   2  34.021   6.948  11.641
   19    H1*    G   2           H1'        G   2  37.180   8.046  11.469
   20    H8     G   2           H8         G   2  38.987   5.933   9.082
   21    H1     G   2           H1         G   2  38.161  11.816   6.786
   22   1H2     G   2          H21         G   2  35.653  12.048   9.100
   23   2H2     G   2          H22         G   2  36.522  12.805   7.772
   24   1H5*    C   3          H5'         C   3  32.163   6.796   9.870
   25   2H5*    C   3          H5''        C   3  30.956   6.123   8.774
   26    H4*    C   3           H4'        C   3  31.041   8.481   8.494
   27    H3*    C   3           H3'        C   3  32.263   7.098   6.074
   28    H2*    C   3           H2'        C   3  32.310   9.235   5.082
   29   2HO*    C   3          2HO'        C   3  30.341  10.155   5.987
   30    H1*    C   3           H1'        C   3  33.430  10.415   7.380
   31   1H4     C   3          H41         C   3  38.569   7.329   4.629
   32   2H4     C   3          H42         C   3  38.454   8.882   3.821
   33    H5     C   3           H5         C   3  36.861   6.539   6.185
   34    H6     C   3           H6         C   3  34.794   7.093   7.245
   35   1H5*    C   4          H5'         C   4  29.575   8.975   4.020
   36   2H5*    C   4          H5''        C   4  28.360   7.892   3.323
   37    H4*    C   4           H4'        C   4  29.204   9.290   1.603
   38    H3*    C   4           H3'        C   4  30.117   6.402   1.324
   39    H2*    C   4           H2'        C   4  31.110   7.029  -0.707
   40   2HO*    C   4          2HO'        C   4  29.517   8.834  -1.176
   41    H1*    C   4           H1'        C   4  32.530   9.117   0.452
   42   1H4     C   4          H41         C   4  35.490   4.033   3.462
   43   2H4     C   4          H42         C   4  35.961   3.794   1.784
   44    H5     C   4           H5         C   4  33.994   5.773   4.170
   45    H6     C   4           H6         C   4  32.568   7.535   3.457
   46   1H5*    U   5          H5'         U   5  28.360   6.728  -2.279
   47   2H5*    U   5          H5''        U   5  27.286   5.365  -2.639
   48    H4*    U   5           H4'        U   5  29.135   5.516  -4.164
   49    H3*    U   5           H3'        U   5  29.383   2.941  -2.484
   50    H2*    U   5           H2'        U   5  31.044   2.409  -3.995
   51   2HO*    U   5          2HO'        U   5  29.845   4.143  -5.650
   52    H1*    U   5           H1'        U   5  32.338   4.842  -3.638
   53    H3     U   5           H3         U   5  34.381   1.415  -1.324
   54    H5     U   5           H5         U   5  31.907   3.370   1.419
   55    H6     U   5           H6         U   5  30.892   4.494  -0.418
   56   1H5*    G   6          H5'         G   6  29.239   1.895  -6.448
   57   2H5*    G   6          H5''        G   6  28.354   0.395  -6.739
   58    H4*    G   6           H4'        G   6  30.636   0.280  -7.520
   59    H3*    G   6           H3'        G   6  30.107  -1.602  -5.195
   60    H2*    G   6           H2'        G   6  32.227  -2.528  -5.770
   61   2HO*    G   6          2HO'        G   6  33.028  -2.203  -7.768
   62    H1*    G   6           H1'        G   6  33.435  -0.197  -5.634
   63    H8     G   6           H8         G   6  30.747   0.310  -3.041
   64    H1     G   6           H1         G   6  35.510  -3.638  -1.293
   65   1H2     G   6          H21         G   6  36.302  -3.539  -4.650
   66   2H2     G   6          H22         G   6  36.666  -4.223  -3.073
   67   1H5*    A   7          H5'         A   7  31.621  -3.618  -8.488
   68   2H5*    A   7          H5''        A   7  30.864  -5.179  -8.766
   69    H4*    A   7           H4'        A   7  33.282  -5.338  -8.745
   70    H3*    A   7           H3'        A   7  31.906  -6.829  -6.499
   71    H2*    A   7           H2'        A   7  33.982  -7.754  -6.023
   72   2HO*    A   7          2HO'        A   7  34.784  -7.780  -8.336
   73    H1*    A   7           H1'        A   7  35.287  -5.309  -6.024
   74    H8     A   7           H8         A   7  32.312  -4.149  -4.588
   75   1H6     A   7          H61         A   7  32.591  -5.760  -0.107
   76   2H6     A   7          H62         A   7  33.529  -6.983   0.725
   77    H2     A   7           H2         A   7  36.051  -8.922  -2.494
   78   1H5*    G   8          H5'         G   8  33.826  -9.998  -8.396
   79   2H5*    G   8          H5''        G   8  32.691 -11.328  -8.678
   80    H4*    G   8           H4'        G   8  34.569 -12.107  -7.406
   81    H3*    G   8           H3'        G   8  32.070 -11.991  -5.670
   82    H2*    G   8           H2'        G   8  33.347 -13.165  -4.066
   83   2HO*    G   8          2HO'        G   8  34.722 -14.509  -5.330
   84    H1*    G   8           H1'        G   8  35.446 -11.293  -4.260
   85    H8     G   8           H8         G   8  32.377  -9.299  -4.870
   86    H1     G   8           H1         G   8  33.373 -10.793   1.282
   87   1H2     G   8          H21         G   8  35.693 -12.945   0.065
   88   2H2     G   8          H22         G   8  34.960 -12.207   1.479
   89   1H5*    G   9          H5'         G   9  31.894 -15.576  -4.674
   90   2H5*    G   9          H5''        G   9  30.460 -16.325  -5.386
   91    H4*    G   9           H4'        G   9  30.227 -16.620  -3.198
   92    H3*    G   9           H3'        G   9  28.467 -14.292  -3.960
   93    H2*    G   9           H2'        G   9  27.721 -14.014  -1.856
   94   2HO*    G   9          2HO'        G   9  27.788 -16.591  -1.494
   95    H1*    G   9           H1'        G   9  30.193 -14.595  -0.531
   96    H8     G   9           H8         G   9  30.137 -12.571  -3.564
   97    H1     G   9           H1         G   9  27.905  -9.432   1.575
   98   1H2     G   9          H21         G   9  28.428 -12.502   3.113
   99   2H2     G   9          H22         G   9  27.857 -10.859   3.310
  100   1H5*    A  10          H5'         A  10  24.036 -16.386  -2.216
  101   2H5*    A  10          H5''        A  10  25.659 -15.764  -1.932
  102    H4*    A  10           H4'        A  10  24.742 -18.635  -1.801
  103    H3*    A  10           H3'        A  10  25.962 -16.812   0.328
  104    H2*    A  10           H2'        A  10  26.618 -18.778   1.382
  105   2HO*    A  10          2HO'        A  10  24.511 -19.859   1.077
  106    H1*    A  10           H1'        A  10  26.890 -20.135  -1.179
  107    H8     A  10           H8         A  10  29.455 -17.785  -1.795
  108   1H6     A  10          H61         A  10  33.222 -21.257   1.730
  109   2H6     A  10          H62         A  10  33.174 -20.112   0.396
  110    H2     A  10           H2         A  10  29.052 -21.998   3.037
  111   1H5*    G  11          H5'         G  11  24.419 -15.846   4.648
  112   2H5*    G  11          H5''        G  11  25.706 -15.715   3.437
  113    H4*    G  11           H4'        G  11  25.342 -17.992   5.392
  114    H3*    G  11           H3'        G  11  27.467 -15.804   5.170
  115    H2*    G  11           H2'        G  11  29.055 -17.381   5.825
  116   2HO*    G  11          2HO'        G  11  27.826 -18.561   7.416
  117    H1*    G  11           H1'        G  11  28.175 -19.393   4.127
  118    H8     G  11           H8         G  11  27.633 -16.571   1.950
  119    H1     G  11           H1         G  11  33.854 -17.949   2.631
  120   1H2     G  11          H21         G  11  34.174 -19.092   4.484
  121   2H2     G  11          H22         G  11  32.822 -19.551   5.506
  122   1H5*    A  12          H5'         A  12  28.490 -16.922   9.088
  123   2H5*    A  12          H5''        A  12  28.885 -15.524  10.105
  124    H4*    A  12           H4'        A  12  30.869 -16.949   9.602
  125    H3*    A  12           H3'        A  12  31.129 -14.341   8.114
  126    H2*    A  12           H2'        A  12  33.215 -14.662   7.701
  127   2HO*    A  12          2HO'        A  12  34.107 -16.140   9.206
  128    H1*    A  12           H1'        A  12  32.333 -16.881   6.717
  129    H8     A  12           H8         A  12  29.498 -14.483   6.095
  130   1H6     A  12          H61         A  12  32.279 -13.339   0.682
  131   2H6     A  12          H62         A  12  30.691 -13.376   1.440
  132    H2     A  12           H2         A  12  35.219 -14.785   3.574
  133   1H5*    C  13          H5'         C  13  35.639 -12.118  10.701
  134   2H5*    C  13          H5''        C  13  34.445 -11.181   9.802
  135    H4*    C  13           H4'        C  13  35.991 -13.570   8.734
  136    H3*    C  13           H3'        C  13  36.117 -10.623   7.879
  137    H2*    C  13           H2'        C  13  36.781 -11.440   5.819
  138   2HO*    C  13          2HO'        C  13  37.957 -13.375   7.141
  139    H1*    C  13           H1'        C  13  34.972 -13.793   6.151
  140   1H4     C  13          H41         C  13  30.686 -10.083   3.113
  141   2H4     C  13          H42         C  13  31.980  -9.738   1.989
  142    H5     C  13           H5         C  13  30.942 -11.545   4.981
  143    H6     C  13           H6         C  13  32.423 -12.468   6.512
  144   1H5*    U  14          H5'         U  14  39.747 -12.315   6.292
  145   2H5*    U  14          H5''        U  14  40.971 -11.052   6.198
  146    H4*    U  14           H4'        U  14  40.416 -12.072   4.044
  147    H3*    U  14           H3'        U  14  39.766  -9.099   4.139
  148    H2*    U  14           H2'        U  14  39.554  -9.343   1.800
  149   2HO*    U  14          2HO'        U  14  39.955 -11.293   0.706
  150    H1*    U  14           H1'        U  14  37.966 -11.542   2.050
  151    H3     U  14           H3         U  14  35.155  -8.272   0.654
  152    H5     U  14           H5         U  14  35.179  -8.024   4.850
  153    H6     U  14           H6         U  14  37.128  -9.410   4.854
  154   1H5*    C  15          H5'         C  15  42.221  -9.778   0.922
  155   2H5*    C  15          H5''        C  15  43.322  -8.446   0.621
  156    H4*    C  15           H4'        C  15  41.953  -8.929  -1.296
  157    H3*    C  15           H3'        C  15  41.379  -6.186  -0.127
  158    H2*    C  15           H2'        C  15  40.217  -5.820  -2.146
  159   2HO*    C  15          2HO'        C  15  40.958  -6.953  -3.874
  160    H1*    C  15           H1'        C  15  38.863  -8.233  -1.962
  161   1H4     C  15          H41         C  15  35.574  -4.370   2.239
  162   2H4     C  15          H42         C  15  35.104  -3.705   0.686
  163    H5     C  15           H5         C  15  37.291  -5.987   2.551
  164    H6     C  15           H6         C  15  38.842  -7.452   1.456
  165   1H5*    A  16          H5'         A  16  42.532  -5.571  -3.873
  166   2H5*    A  16          H5''        A  16  43.663  -4.234  -4.123
  167    H4*    A  16           H4'        A  16  41.516  -3.958  -5.372
  168    H3*    A  16           H3'        A  16  42.087  -1.921  -3.191
  169    H2*    A  16           H2'        A  16  40.318  -0.838  -3.825
  170   2HO*    A  16          2HO'        A  16  39.861  -0.554  -5.926
  171    H1*    A  16           H1'        A  16  38.873  -3.283  -4.372
  172    H8     A  16           H8         A  16  40.210  -2.907  -1.575
  173   1H6     A  16          H61         A  16  37.021  -0.098   1.171
  174   2H6     A  16          H62         A  16  35.692   0.906   0.613
  175    H2     A  16           H2         A  16  35.674   0.702  -3.841
  176   1H5*    G  17          H5'         G  17  43.175   2.122  -5.553
  177   2H5*    G  17          H5''        G  17  42.148   2.657  -4.266
  178    H4*    G  17           H4'        G  17  41.407   0.988  -6.608
  179    H3*    G  17           H3'        G  17  41.378   3.498  -6.619
  180    H2*    G  17           H2'        G  17  40.227   3.970  -4.580
  181   2HO*    G  17          2HO'        G  17  37.802   4.161  -5.201
  182    H1*    G  17           H1'        G  17  38.050   1.972  -5.168
  183    H8     G  17           H8         G  17  40.813   1.648  -2.833
  184    H1     G  17           H1         G  17  35.802   4.618  -0.240
  185   1H2     G  17          H21         G  17  34.854   4.984  -3.498
  186   2H2     G  17          H22         G  17  34.569   5.374  -1.800
  187   1H5*    A  18          H5'         A  18  41.872   5.450  -7.930
  188   2H5*    A  18          H5''        A  18  40.528   5.708  -6.828
  189    H4*    A  18           H4'        A  18  41.091   7.332  -9.270
  190    H3*    A  18           H3'        A  18  42.751   7.717  -7.276
  191    H2*    A  18           H2'        A  18  41.107   7.502  -5.665
  192   2HO*    A  18          2HO'        A  18  41.881  10.198  -6.045
  193    H1*    A  18           H1'        A  18  39.569   9.726  -7.011
  194    H8     A  18           H8         A  18  39.425   6.566  -4.905
  195   1H6     A  18          H61         A  18  34.865   7.251  -3.101
  196   2H6     A  18          H62         A  18  33.675   8.511  -3.382
  197    H2     A  18           H2         A  18  35.451  11.448  -6.203
  198   1H5*    A  19          H5'         A  19  40.811  11.737  -8.232
  199   2H5*    A  19          H5''        A  19  41.989  13.041  -8.305
  200    H4*    A  19           H4'        A  19  40.365  13.965  -7.166
  201    H3*    A  19           H3'        A  19  42.556  13.971  -5.626
  202    H2*    A  19           H2'        A  19  41.668  11.880  -4.466
  203   2HO*    A  19          2HO'        A  19  41.359  14.336  -3.110
  204    H1*    A  19           H1'        A  19  39.204  13.618  -4.537
  205    H8     A  19           H8         A  19  40.431  10.228  -3.136
  206   1H6     A  19          H61         A  19  34.920  10.303  -0.271
  207   2H6     A  19          H62         A  19  36.477   9.481  -0.372
  208    H2     A  19           H2         A  19  34.976  13.575  -3.236
  209   1H5*    G  20          H5'         G  20  40.652  18.086  -2.056
  210   2H5*    G  20          H5''        G  20  41.331  16.469  -1.986
  211    H4*    G  20           H4'        G  20  38.441  16.935  -2.710
  212    H3*    G  20           H3'        G  20  39.601  16.619   0.087
  213    H2*    G  20           H2'        G  20  37.506  15.698   0.664
  214   2HO*    G  20          2HO'        G  20  35.705  15.932  -0.567
  215    H1*    G  20           H1'        G  20  37.489  14.111  -1.661
  216    H8     G  20           H8         G  20  40.944  13.965  -0.374
  217    H1     G  20           H1         G  20  36.877  10.489   3.126
  218   1H2     G  20          H21         G  20  34.491  12.585   1.873
  219   2H2     G  20          H22         G  20  34.894  11.285   2.986
  220   1H5*    C  21          H5'         C  21  36.132  18.360   1.039
  221   2H5*    C  21          H5''        C  21  36.335  19.682   2.199
  222    H4*    C  21           H4'        C  21  34.892  18.069   3.168
  223    H3*    C  21           H3'        C  21  37.636  17.865   4.480
  224    H2*    C  21           H2'        C  21  36.623  16.424   6.020
  225   2HO*    C  21          2HO'        C  21  34.441  17.701   5.796
  226    H1*    C  21           H1'        C  21  35.261  15.023   4.002
  227   1H4     C  21          H41         C  21  41.284  12.416   3.931
  228   2H4     C  21          H42         C  21  40.360  11.504   5.122
  229    H5     C  21           H5         C  21  40.454  14.481   2.964
  230    H6     C  21           H6         C  21  38.559  15.952   2.818
  231   1H5*    C  22          H5'         C  22  35.694  18.387   7.794
  232   2H5*    C  22          H5''        C  22  36.406  19.698   8.745
  233    H4*    C  22           H4'        C  22  36.502  17.780  10.088
  234    H3*    C  22           H3'        C  22  39.281  18.097   8.889
  235    H2*    C  22           H2'        C  22  39.921  16.487  10.351
  236   2HO*    C  22          2HO'        C  22  38.852  17.218  12.310
  237    H1*    C  22           H1'        C  22  37.379  15.077  10.109
  238   1H4     C  22          H41         C  22  42.408  12.848   6.325
  239   2H4     C  22          H42         C  22  42.097  11.597   7.506
  240    H5     C  22           H5         C  22  41.245  14.960   6.308
  241    H6     C  22           H6         C  22  39.447  16.242   7.376
  242    H3T    C  22           H3T        C  22  38.501  19.926   9.980
  Start of MODEL    3
    1   1H5*    G   1          H5'         G   1  46.885   5.613  10.949
    2   2H5*    G   1          H5''        G   1  45.583   4.427  10.970
    3    H4*    G   1           H4'        G   1  44.868   6.507  11.929
    4    H3*    G   1           H3'        G   1  43.452   6.062   9.268
    5    H2*    G   1           H2'        G   1  42.115   7.794   9.979
    6   2HO*    G   1          2HO'        G   1  41.654   7.764  12.110
    7    H1*    G   1           H1'        G   1  44.255   9.235  11.106
    8    H8     G   1           H8         G   1  43.956   7.720   7.589
    9    H1     G   1           H1         G   1  42.733  14.003   7.972
   10   1H2     G   1          H21         G   1  42.896  13.465  11.370
   11   2H2     G   1          H22         G   1  42.594  14.595  10.069
   12    H5T    G   1           H5T        G   1  46.296   6.015   8.723
   13   1H5*    G   2          H5'         G   2  40.548   6.290  12.612
   14   2H5*    G   2          H5''        G   2  38.988   5.623  12.134
   15    H4*    G   2           H4'        G   2  38.984   8.030  12.829
   16    H3*    G   2           H3'        G   2  37.952   7.477  10.014
   17    H2*    G   2           H2'        G   2  37.267   9.720  10.053
   18   2HO*    G   2          2HO'        G   2  37.109  10.956  11.885
   19    H1*    G   2           H1'        G   2  39.634  10.551  11.448
   20    H8     G   2           H8         G   2  40.918   8.663   8.581
   21    H1     G   2           H1         G   2  38.705  14.426   6.944
   22   1H2     G   2          H21         G   2  37.122  14.335   9.993
   23   2H2     G   2          H22         G   2  37.461  15.240   8.526
   24   1H5*    C   3          H5'         C   3  34.912   9.259  12.126
   25   2H5*    C   3          H5''        C   3  33.333   8.572  11.774
   26    H4*    C   3           H4'        C   3  33.317  10.913  11.367
   27    H3*    C   3           H3'        C   3  33.227   9.448   8.745
   28    H2*    C   3           H2'        C   3  32.618  11.496   7.760
   29   2HO*    C   3          2HO'        C   3  31.537  12.398   9.860
   30    H1*    C   3           H1'        C   3  34.727  12.761   9.188
   31   1H4     C   3          H41         C   3  38.544  10.042   4.714
   32   2H4     C   3          H42         C   3  38.097  11.614   4.050
   33    H5     C   3           H5         C   3  37.439   9.081   6.615
   34    H6     C   3           H6         C   3  35.787   9.426   8.309
   35   1H5*    C   4          H5'         C   4  28.504   9.182   7.721
   36   2H5*    C   4          H5''        C   4  30.208   8.717   7.609
   37    H4*    C   4           H4'        C   4  28.845  10.877   5.984
   38    H3*    C   4           H3'        C   4  29.714   8.059   5.235
   39    H2*    C   4           H2'        C   4  30.065   8.901   3.049
   40   2HO*    C   4          2HO'        C   4  28.697  10.605   2.619
   41    H1*    C   4           H1'        C   4  31.664  10.949   3.980
   42   1H4     C   4          H41         C   4  35.611   5.847   5.245
   43   2H4     C   4          H42         C   4  35.645   5.944   3.489
   44    H5     C   4           H5         C   4  34.114   7.129   6.600
   45    H6     C   4           H6         C   4  32.371   8.748   6.599
   46   1H5*    U   5          H5'         U   5  26.818   8.868   2.547
   47   2H5*    U   5          H5''        U   5  25.678   7.578   2.148
   48    H4*    U   5           H4'        U   5  26.943   8.202   0.246
   49    H3*    U   5           H3'        U   5  27.816   5.359   1.096
   50    H2*    U   5           H2'        U   5  28.984   5.374  -0.912
   51   2HO*    U   5          2HO'        U   5  27.287   7.213  -1.718
   52    H1*    U   5           H1'        U   5  30.297   7.715  -0.287
   53    H3     U   5           H3         U   5  32.827   3.960   0.866
   54    H5     U   5           H5         U   5  31.075   5.388   4.375
   55    H6     U   5           H6         U   5  29.658   6.710   3.042
   56   1H5*    G   6          H5'         G   6  26.929   4.967  -2.567
   57   2H5*    G   6          H5''        G   6  25.824   3.646  -2.938
   58    H4*    G   6           H4'        G   6  27.876   3.419  -4.143
   59    H3*    G   6           H3'        G   6  27.531   1.246  -2.041
   60    H2*    G   6           H2'        G   6  29.372   0.231  -3.099
   61   2HO*    G   6          2HO'        G   6  28.625   1.470  -5.272
   62    H1*    G   6           H1'        G   6  30.833   2.495  -3.173
   63    H8     G   6           H8         G   6  29.266   2.876   0.172
   64    H1     G   6           H1         G   6  34.013  -1.469  -0.155
   65   1H2     G   6          H21         G   6  33.456  -1.236  -3.557
   66   2H2     G   6          H22         G   6  34.316  -2.059  -2.267
   67   1H5*    A   7          H5'         A   7  28.032  -0.568  -5.646
   68   2H5*    A   7          H5''        A   7  26.989  -1.961  -5.894
   69    H4*    A   7           H4'        A   7  29.290  -2.555  -6.204
   70    H3*    A   7           H3'        A   7  28.089  -3.872  -3.742
   71    H2*    A   7           H2'        A   7  30.055  -5.108  -3.646
   72   2HO*    A   7          2HO'        A   7  30.194  -5.069  -6.198
   73    H1*    A   7           H1'        A   7  31.724  -2.909  -4.195
   74    H8     A   7           H8         A   7  29.605  -1.334  -1.828
   75   1H6     A   7          H61         A   7  31.628  -2.777   2.248
   76   2H6     A   7          H62         A   7  32.692  -4.085   2.714
   77    H2     A   7           H2         A   7  33.489  -6.398  -1.066
   78   1H5*    G   8          H5'         G   8  29.214  -6.981  -6.030
   79   2H5*    G   8          H5''        G   8  28.062  -8.314  -6.036
   80    H4*    G   8           H4'        G   8  30.231  -9.003  -5.195
   81    H3*    G   8           H3'        G   8  28.101  -9.051  -3.015
   82    H2*    G   8           H2'        G   8  29.718 -10.165  -1.737
   83   2HO*    G   8          2HO'        G   8  31.486 -11.140  -2.581
   84    H1*    G   8           H1'        G   8  31.740  -8.391  -2.484
   85    H8     G   8           H8         G   8  28.651  -6.380  -1.871
   86    H1     G   8           H1         G   8  32.037  -7.880   3.379
   87   1H2     G   8          H21         G   8  33.432 -10.291   1.437
   88   2H2     G   8          H22         G   8  33.381  -9.511   3.001
   89   1H5*    G   9          H5'         G   9  28.796 -12.946  -2.687
   90   2H5*    G   9          H5''        G   9  27.273 -13.818  -2.452
   91    H4*    G   9           H4'        G   9  28.569 -13.928  -0.434
   92    H3*    G   9           H3'        G   9  26.254 -11.997  -0.027
   93    H2*    G   9           H2'        G   9  26.992 -11.926   2.296
   94   2HO*    G   9          2HO'        G   9  27.965 -13.855   2.914
   95    H1*    G   9           H1'        G   9  29.527 -11.365   1.591
   96    H8     G   9           H8         G   9  26.838 -10.224  -0.751
   97    H1     G   9           H1         G   9  27.220  -6.549   4.428
   98   1H2     G   9          H21         G   9  28.963  -9.230   5.706
   99   2H2     G   9          H22         G   9  28.169  -7.705   6.017
  100   1H5*    A  10          H5'         A  10  23.900 -11.328   2.240
  101   2H5*    A  10          H5''        A  10  25.040 -12.623   2.412
  102    H4*    A  10           H4'        A  10  22.132 -12.774   3.103
  103    H3*    A  10           H3'        A  10  24.717 -12.694   4.663
  104    H2*    A  10           H2'        A  10  23.873 -14.224   6.250
  105   2HO*    A  10          2HO'        A  10  21.683 -13.903   6.483
  106    H1*    A  10           H1'        A  10  23.054 -16.027   4.408
  107    H8     A  10           H8         A  10  25.886 -14.697   2.421
  108   1H6     A  10          H61         A  10  29.371 -18.690   5.674
  109   2H6     A  10          H62         A  10  29.302 -17.701   4.218
  110    H2     A  10           H2         A  10  25.594 -18.091   7.891
  111   1H5*    G  11          H5'         G  11  23.018 -12.360   8.173
  112   2H5*    G  11          H5''        G  11  23.676 -11.012   9.113
  113    H4*    G  11           H4'        G  11  24.261 -13.174  10.104
  114    H3*    G  11           H3'        G  11  26.697 -11.683   9.043
  115    H2*    G  11           H2'        G  11  28.001 -13.471   9.883
  116   2HO*    G  11          2HO'        G  11  26.813 -14.015  11.817
  117    H1*    G  11           H1'        G  11  26.388 -15.429   8.758
  118    H8     G  11           H8         G  11  26.182 -12.763   6.241
  119    H1     G  11           H1         G  11  31.631 -16.115   5.981
  120   1H2     G  11          H21         G  11  31.849 -17.329   7.808
  121   2H2     G  11          H22         G  11  30.674 -17.227   9.106
  122   1H5*    A  12          H5'         A  12  29.769 -10.634  13.164
  123   2H5*    A  12          H5''        A  12  29.929 -10.148  11.486
  124    H4*    A  12           H4'        A  12  30.997 -12.569  12.850
  125    H3*    A  12           H3'        A  12  31.912 -10.987  10.493
  126    H2*    A  12           H2'        A  12  33.555 -12.264   9.921
  127   2HO*    A  12          2HO'        A  12  33.908 -13.444  12.025
  128    H1*    A  12           H1'        A  12  31.618 -14.003   9.718
  129    H8     A  12           H8         A  12  29.603 -11.007   9.419
  130   1H6     A  12          H61         A  12  29.422 -10.657   4.516
  131   2H6     A  12          H62         A  12  30.718 -10.769   3.370
  132    H2     A  12           H2         A  12  34.110 -12.548   5.516
  133   1H5*    C  13          H5'         C  13  36.901  -9.630  11.484
  134   2H5*    C  13          H5''        C  13  35.298  -8.952  11.073
  135    H4*    C  13           H4'        C  13  36.625 -11.171   9.510
  136    H3*    C  13           H3'        C  13  36.463  -8.212   8.689
  137    H2*    C  13           H2'        C  13  36.499  -9.100   6.518
  138   2HO*    C  13          2HO'        C  13  37.899 -11.099   7.650
  139    H1*    C  13           H1'        C  13  34.757 -11.354   7.435
  140   1H4     C  13          H41         C  13  30.363  -6.766   6.041
  141   2H4     C  13          H42         C  13  31.254  -6.581   4.555
  142    H5     C  13           H5         C  13  30.841  -8.592   7.652
  143    H6     C  13           H6         C  13  32.564  -9.797   8.592
  144   1H5*    U  14          H5'         U  14  39.646  -9.793   6.277
  145   2H5*    U  14          H5''        U  14  40.748  -8.507   5.792
  146    H4*    U  14           H4'        U  14  39.713  -9.665   3.964
  147    H3*    U  14           H3'        U  14  38.890  -6.728   3.951
  148    H2*    U  14           H2'        U  14  38.099  -7.312   1.726
  149   2HO*    U  14          2HO'        U  14  39.839  -9.262   1.727
  150    H1*    U  14           H1'        U  14  36.651  -9.286   2.664
  151    H3     U  14           H3         U  14  33.798  -5.747   2.154
  152    H5     U  14           H5         U  14  35.150  -5.530   6.119
  153    H6     U  14           H6         U  14  36.850  -7.097   5.552
  154   1H5*    C  15          H5'         C  15  40.472  -7.614   0.332
  155   2H5*    C  15          H5''        C  15  41.500  -6.354  -0.351
  156    H4*    C  15           H4'        C  15  39.717  -6.937  -1.852
  157    H3*    C  15           H3'        C  15  39.538  -4.111  -0.757
  158    H2*    C  15           H2'        C  15  37.799  -3.775  -2.316
  159   2HO*    C  15          2HO'        C  15  38.326  -6.490  -3.128
  160    H1*    C  15           H1'        C  15  36.421  -5.939  -1.501
  161   1H4     C  15          H41         C  15  35.526  -1.899   3.655
  162   2H4     C  15          H42         C  15  34.603  -1.212   2.329
  163    H5     C  15           H5         C  15  37.056  -3.798   3.299
  164    H6     C  15           H6         C  15  37.853  -5.354   1.685
  165   1H5*    A  16          H5'         A  16  39.333  -3.367  -4.379
  166   2H5*    A  16          H5''        A  16  40.453  -2.158  -5.022
  167    H4*    A  16           H4'        A  16  38.086  -1.486  -5.278
  168    H3*    A  16           H3'        A  16  39.643   0.233  -3.309
  169    H2*    A  16           H2'        A  16  37.832   1.537  -3.220
  170   2HO*    A  16          2HO'        A  16  36.881   2.057  -5.105
  171    H1*    A  16           H1'        A  16  36.110  -0.825  -3.540
  172    H8     A  16           H8         A  16  38.110  -0.705  -1.157
  173   1H6     A  16          H61         A  16  35.761   1.748   2.548
  174   2H6     A  16          H62         A  16  34.414   2.869   2.446
  175    H2     A  16           H2         A  16  33.428   3.320  -1.904
  176   1H5*    G  17          H5'         G  17  38.294   2.646  -6.630
  177   2H5*    G  17          H5''        G  17  39.354   4.038  -6.839
  178    H4*    G  17           H4'        G  17  37.067   4.760  -6.467
  179    H3*    G  17           H3'        G  17  38.859   5.392  -4.107
  180    H2*    G  17           H2'        G  17  37.220   6.660  -3.332
  181   2HO*    G  17          2HO'        G  17  36.443   7.225  -5.738
  182    H1*    G  17           H1'        G  17  35.181   4.725  -3.910
  183    H8     G  17           H8         G  17  38.531   4.024  -2.532
  184    H1     G  17           H1         G  17  34.842   6.841   1.740
  185   1H2     G  17          H21         G  17  32.923   7.572  -0.970
  186   2H2     G  17          H22         G  17  33.216   7.798   0.743
  187   1H5*    A  18          H5'         A  18  40.474  10.476  -5.868
  188   2H5*    A  18          H5''        A  18  39.349   9.696  -4.769
  189    H4*    A  18           H4'        A  18  38.974   9.901  -7.737
  190    H3*    A  18           H3'        A  18  38.971  12.138  -6.354
  191    H2*    A  18           H2'        A  18  37.534  11.455  -4.716
  192   2HO*    A  18          2HO'        A  18  36.053  12.849  -6.716
  193    H1*    A  18           H1'        A  18  35.641  10.400  -6.819
  194    H8     A  18           H8         A  18  37.336   9.291  -3.654
  195   1H6     A  18          H61         A  18  31.663  10.234  -1.065
  196   2H6     A  18          H62         A  18  33.301   9.720  -0.653
  197    H2     A  18           H2         A  18  31.359  10.851  -5.372
  198   1H5*    A  19          H5'         A  19  39.180  15.741  -7.061
  199   2H5*    A  19          H5''        A  19  38.498  14.539  -5.953
  200    H4*    A  19           H4'        A  19  36.836  16.737  -7.134
  201    H3*    A  19           H3'        A  19  38.706  17.896  -5.756
  202    H2*    A  19           H2'        A  19  38.632  15.913  -4.139
  203   2HO*    A  19          2HO'        A  19  37.328  18.171  -2.937
  204    H1*    A  19           H1'        A  19  35.757  16.698  -3.733
  205    H8     A  19           H8         A  19  38.344  13.774  -3.561
  206   1H6     A  19          H61         A  19  35.937  10.992  -0.343
  207   2H6     A  19          H62         A  19  34.388  11.207   0.454
  208    H2     A  19           H2         A  19  32.530  14.916  -1.078
  209   1H5*    G  20          H5'         G  20  36.549  21.355  -2.083
  210   2H5*    G  20          H5''        G  20  37.652  19.975  -2.152
  211    H4*    G  20           H4'        G  20  34.703  19.781  -1.515
  212    H3*    G  20           H3'        G  20  37.038  19.636   0.457
  213    H2*    G  20           H2'        G  20  35.488  18.490   1.823
  214   2HO*    G  20          2HO'        G  20  33.558  19.830   1.127
  215    H1*    G  20           H1'        G  20  34.585  17.041  -0.551
  216    H8     G  20           H8         G  20  38.242  17.021  -0.437
  217    H1     G  20           H1         G  20  35.796  13.171   4.032
  218   1H2     G  20          H21         G  20  33.166  15.382   3.948
  219   2H2     G  20          H22         G  20  33.964  14.073   4.797
  220   1H5*    C  21          H5'         C  21  34.228  21.314   3.165
  221   2H5*    C  21          H5''        C  21  35.023  22.677   3.978
  222    H4*    C  21           H4'        C  21  34.335  21.139   5.653
  223    H3*    C  21           H3'        C  21  37.342  20.828   5.223
  224    H2*    C  21           H2'        C  21  37.325  19.539   7.167
  225   2HO*    C  21          2HO'        C  21  35.793  20.309   8.607
  226    H1*    C  21           H1'        C  21  35.027  18.138   6.275
  227   1H4     C  21          H41         C  21  40.015  15.233   3.143
  228   2H4     C  21          H42         C  21  39.809  14.339   4.638
  229    H5     C  21           H5         C  21  38.925  17.323   2.709
  230    H6     C  21           H6         C  21  37.279  18.893   3.511
  231   1H5*    C  22          H5'         C  22  37.833  21.824   9.044
  232   2H5*    C  22          H5''        C  22  39.050  23.113   9.110
  233    H4*    C  22           H4'        C  22  39.894  21.311  10.359
  234    H3*    C  22           H3'        C  22  41.267  21.212   7.643
  235    H2*    C  22           H2'        C  22  42.652  19.658   8.603
  236   2HO*    C  22          2HO'        C  22  43.184  19.676  10.706
  237    H1*    C  22           H1'        C  22  40.462  18.585  10.234
  238   1H4     C  22          H41         C  22  42.221  15.454   4.610
  239   2H4     C  22          H42         C  22  42.632  14.345   5.896
  240    H5     C  22           H5         C  22  41.259  17.602   4.954
  241    H6     C  22           H6         C  22  40.429  19.161   6.630
  242    H3T    C  22           H3T        C  22  42.163  22.409  10.030
  Start of MODEL    4
    1   1H5*    G   1          H5'         G   1  33.412   0.170   8.156
    2   2H5*    G   1          H5''        G   1  32.223  -0.289   6.940
    3    H4*    G   1           H4'        G   1  31.307   1.488   8.174
    4    H3*    G   1           H3'        G   1  32.241   2.577   5.488
    5    H2*    G   1           H2'        G   1  31.128   4.439   6.051
    6   2HO*    G   1          2HO'        G   1  29.196   4.070   7.033
    7    H1*    G   1           H1'        G   1  31.855   4.417   8.716
    8    H8     G   1           H8         G   1  34.098   3.968   5.688
    9    H1     G   1           H1         G   1  33.472  10.006   7.712
   10   1H2     G   1          H21         G   1  30.855   8.703   9.517
   11   2H2     G   1          H22         G   1  31.737  10.132   9.017
   12    H5T    G   1           H5T        G   1  33.493   0.969   5.422
   13   1H5*    G   2          H5'         G   2  28.017   3.404   5.873
   14   2H5*    G   2          H5''        G   2  27.328   3.680   4.282
   15    H4*    G   2           H4'        G   2  27.095   5.570   5.809
   16    H3*    G   2           H3'        G   2  28.695   6.214   3.301
   17    H2*    G   2           H2'        G   2  28.397   8.472   3.983
   18   2HO*    G   2          2HO'        G   2  26.167   7.993   4.944
   19    H1*    G   2           H1'        G   2  29.084   7.876   6.654
   20    H8     G   2           H8         G   2  31.532   5.911   4.770
   21    H1     G   2           H1         G   2  32.664  12.175   4.269
   22   1H2     G   2          H21         G   2  29.586  12.514   5.740
   23   2H2     G   2          H22         G   2  31.010  13.322   5.094
   24   1H5*    C   3          H5'         C   3  25.364   8.647   2.797
   25   2H5*    C   3          H5''        C   3  24.632   8.293   1.225
   26    H4*    C   3           H4'        C   3  24.996  10.618   1.307
   27    H3*    C   3           H3'        C   3  27.087   9.304  -0.450
   28    H2*    C   3           H2'        C   3  27.768  11.463  -1.035
   29   2HO*    C   3          2HO'        C   3  25.711  12.558  -1.094
   30    H1*    C   3           H1'        C   3  27.700  12.374   1.647
   31   1H4     C   3          H41         C   3  33.339   9.042   0.889
   32   2H4     C   3          H42         C   3  33.744  10.650   0.323
   33    H5     C   3           H5         C   3  31.186   8.366   1.588
   34    H6     C   3           H6         C   3  28.905   9.018   1.798
   35   1H5*    C   4          H5'         C   4  26.383  11.444  -3.253
   36   2H5*    C   4          H5''        C   4  25.999  10.616  -4.774
   37    H4*    C   4           H4'        C   4  28.140  11.735  -4.950
   38    H3*    C   4           H3'        C   4  28.407   8.690  -4.867
   39    H2*    C   4           H2'        C   4  30.688   9.039  -5.344
   40   2HO*    C   4          2HO'        C   4  30.130  11.140  -6.629
   41    H1*    C   4           H1'        C   4  30.946  11.006  -3.353
   42   1H4     C   4          H41         C   4  30.826   5.276   0.017
   43   2H4     C   4          H42         C   4  32.487   5.545  -0.454
   44    H5     C   4           H5         C   4  29.028   6.804  -0.684
   45    H6     C   4           H6         C   4  28.520   8.728  -2.020
   46   1H5*    U   5          H5'         U   5  29.999   9.206  -8.594
   47   2H5*    U   5          H5''        U   5  29.351   8.001  -9.714
   48    H4*    U   5           H4'        U   5  31.706   7.783  -9.459
   49    H3*    U   5           H3'        U   5  30.358   5.309  -8.227
   50    H2*    U   5           H2'        U   5  32.481   4.463  -8.177
   51   2HO*    U   5          2HO'        U   5  34.302   5.491  -9.024
   52    H1*    U   5           H1'        U   5  33.488   6.732  -6.895
   53    H3     U   5           H3         U   5  32.821   3.148  -4.030
   54    H5     U   5           H5         U   5  29.508   5.655  -3.615
   55    H6     U   5           H6         U   5  30.185   6.755  -5.609
   56   1H5*    G   6          H5'         G   6  32.790   4.119 -11.160
   57   2H5*    G   6          H5''        G   6  32.162   2.807 -12.157
   58    H4*    G   6           H4'        G   6  34.242   2.197 -11.172
   59    H3*    G   6           H3'        G   6  31.933   0.610  -9.979
   60    H2*    G   6           H2'        G   6  33.629  -0.740  -9.036
   61   2HO*    G   6          2HO'        G   6  35.171  -0.105 -10.966
   62    H1*    G   6           H1'        G   6  34.949   1.384  -8.030
   63    H8     G   6           H8         G   6  31.360   2.519  -7.666
   64    H1     G   6           H1         G   6  33.465  -1.738  -3.329
   65   1H2     G   6          H21         G   6  35.904  -2.351  -5.696
   66   2H2     G   6          H22         G   6  35.209  -2.805  -4.146
   67   1H5*    A   7          H5'         A   7  34.592  -2.111 -11.529
   68   2H5*    A   7          H5''        A   7  33.785  -3.369 -12.458
   69    H4*    A   7           H4'        A   7  35.206  -4.410 -10.911
   70    H3*    A   7           H3'        A   7  32.348  -4.711  -9.978
   71    H2*    A   7           H2'        A   7  33.236  -6.289  -8.442
   72   2HO*    A   7          2HO'        A   7  35.109  -7.301  -8.838
   73    H1*    A   7           H1'        A   7  35.321  -4.550  -7.697
   74    H8     A   7           H8         A   7  32.621  -2.157  -7.974
   75   1H6     A   7          H61         A   7  30.448  -2.719  -3.820
   76   2H6     A   7          H62         A   7  30.409  -3.929  -2.556
   77    H2     A   7           H2         A   7  33.218  -7.187  -3.987
   78   1H5*    G   8          H5'         G   8  33.568  -8.602 -10.477
   79   2H5*    G   8          H5''        G   8  32.328  -9.604 -11.228
   80    H4*    G   8           H4'        G   8  32.976 -10.531  -9.113
   81    H3*    G   8           H3'        G   8  30.145  -9.407  -8.991
   82    H2*    G   8           H2'        G   8  30.043 -10.403  -6.840
   83   2HO*    G   8          2HO'        G   8  31.865 -12.088  -7.769
   84    H1*    G   8           H1'        G   8  32.513  -9.280  -6.053
   85    H8     G   8           H8         G   8  30.954  -6.716  -8.250
   86    H1     G   8           H1         G   8  28.403  -7.160  -2.391
   87   1H2     G   8          H21         G   8  29.932 -10.203  -2.352
   88   2H2     G   8          H22         G   8  28.964  -9.038  -1.464
   89   1H5*    G   9          H5'         G   9  26.914  -9.969 -11.211
   90   2H5*    G   9          H5''        G   9  27.789  -9.049  -9.980
   91    H4*    G   9           H4'        G   9  25.533 -10.971  -9.482
   92    H3*    G   9           H3'        G   9  25.428  -7.958  -9.448
   93    H2*    G   9           H2'        G   9  23.758  -8.148  -7.756
   94   2HO*    G   9          2HO'        G   9  23.347 -10.390  -6.891
   95    H1*    G   9           H1'        G   9  25.380  -9.767  -6.183
   96    H8     G   9           H8         G   9  27.665  -7.779  -8.194
   97    H1     G   9           H1         G   9  24.165  -4.089  -4.269
   98   1H2     G   9          H21         G   9  22.742  -7.132  -3.354
   99   2H2     G   9          H22         G   9  22.776  -5.390  -3.123
  100   1H5*    A  10          H5'         A  10  21.923 -10.966 -11.522
  101   2H5*    A  10          H5''        A  10  20.290 -10.381 -11.201
  102    H4*    A  10           H4'        A  10  20.241 -12.491 -10.403
  103    H3*    A  10           H3'        A  10  21.147 -11.091  -7.888
  104    H2*    A  10           H2'        A  10  20.579 -13.084  -6.842
  105   2HO*    A  10          2HO'        A  10  18.662 -13.630  -8.314
  106    H1*    A  10           H1'        A  10  21.717 -14.477  -9.049
  107    H8     A  10           H8         A  10  24.629 -12.403  -8.347
  108   1H6     A  10          H61         A  10  26.682 -15.301  -5.022
  109   2H6     A  10          H62         A  10  26.028 -16.536  -3.950
  110    H2     A  10           H2         A  10  21.634 -16.673  -4.613
  111   1H5*    G  11          H5'         G  11  17.285 -10.692  -4.980
  112   2H5*    G  11          H5''        G  11  18.978 -10.453  -5.450
  113    H4*    G  11           H4'        G  11  17.851 -12.794  -3.874
  114    H3*    G  11           H3'        G  11  19.764 -10.574  -3.007
  115    H2*    G  11           H2'        G  11  20.836 -12.162  -1.651
  116   2HO*    G  11          2HO'        G  11  19.031 -13.378  -0.876
  117    H1*    G  11           H1'        G  11  20.886 -14.151  -3.613
  118    H8     G  11           H8         G  11  21.443 -11.021  -5.466
  119    H1     G  11           H1         G  11  26.705 -13.398  -2.722
  120   1H2     G  11          H21         G  11  26.143 -14.817  -1.117
  121   2H2     G  11          H22         G  11  24.457 -15.134  -0.753
  122   1H5*    A  12          H5'         A  12  18.460 -12.044   0.842
  123   2H5*    A  12          H5''        A  12  18.404 -10.714   2.010
  124    H4*    A  12           H4'        A  12  20.109 -12.443   2.550
  125    H3*    A  12           H3'        A  12  21.519  -9.892   1.772
  126    H2*    A  12           H2'        A  12  23.385 -10.566   2.620
  127   2HO*    A  12          2HO'        A  12  22.558 -12.157   4.243
  128    H1*    A  12           H1'        A  12  23.006 -12.553   1.043
  129    H8     A  12           H8         A  12  21.347  -9.559  -0.616
  130   1H6     A  12          H61         A  12  26.677  -8.903  -3.679
  131   2H6     A  12          H62         A  12  24.971  -8.495  -3.750
  132    H2     A  12           H2         A  12  27.381 -11.224  -0.078
  133   1H5*    C  13          H5'         C  13  24.160  -8.224   6.240
  134   2H5*    C  13          H5''        C  13  23.842  -7.299   4.764
  135    H4*    C  13           H4'        C  13  25.383  -9.912   4.846
  136    H3*    C  13           H3'        C  13  26.464  -7.087   4.332
  137    H2*    C  13           H2'        C  13  28.148  -8.167   3.162
  138   2HO*    C  13          2HO'        C  13  28.576 -10.001   4.495
  139    H1*    C  13           H1'        C  13  26.123 -10.100   2.112
  140   1H4     C  13          H41         C  13  25.704  -5.360  -2.291
  141   2H4     C  13          H42         C  13  27.435  -5.544  -2.429
  142    H5     C  13           H5         C  13  24.351  -6.654  -0.874
  143    H6     C  13           H6         C  13  24.237  -7.956   1.068
  144   1H5*    U  14          H5'         U  14  30.015  -9.291   5.570
  145   2H5*    U  14          H5''        U  14  31.211  -8.175   6.222
  146    H4*    U  14           H4'        U  14  31.890  -9.526   4.257
  147    H3*    U  14           H3'        U  14  32.190  -6.523   3.799
  148    H2*    U  14           H2'        U  14  33.357  -7.250   1.870
  149   2HO*    U  14          2HO'        U  14  33.947  -9.444   3.147
  150    H1*    U  14           H1'        U  14  31.436  -9.002   1.136
  151    H3     U  14           H3         U  14  31.030  -5.579  -1.849
  152    H5     U  14           H5         U  14  28.773  -4.408   1.518
  153    H6     U  14           H6         U  14  29.775  -6.195   2.739
  154   1H5*    C  15          H5'         C  15  35.769  -8.254   2.749
  155   2H5*    C  15          H5''        C  15  37.154  -7.231   3.073
  156    H4*    C  15           H4'        C  15  36.976  -7.826   0.744
  157    H3*    C  15           H3'        C  15  36.656  -4.845   1.212
  158    H2*    C  15           H2'        C  15  36.897  -4.671  -1.129
  159   2HO*    C  15          2HO'        C  15  38.355  -6.509  -1.505
  160    H1*    C  15           H1'        C  15  35.000  -6.637  -1.624
  161   1H4     C  15          H41         C  15  31.532  -1.204   0.043
  162   2H4     C  15          H42         C  15  32.044  -0.947  -1.621
  163    H5     C  15           H5         C  15  32.114  -3.251   1.264
  164    H6     C  15           H6         C  15  33.435  -5.278   1.207
  165   1H5*    A  16          H5'         A  16  39.634  -4.950  -1.247
  166   2H5*    A  16          H5''        A  16  41.024  -3.931  -0.846
  167    H4*    A  16           H4'        A  16  39.889  -3.346  -3.011
  168    H3*    A  16           H3'        A  16  39.868  -1.208  -0.851
  169    H2*    A  16           H2'        A  16  38.835   0.120  -2.268
  170   2HO*    A  16          2HO'        A  16  39.425   0.346  -4.327
  171    H1*    A  16           H1'        A  16  37.532  -2.159  -3.591
  172    H8     A  16           H8         A  16  36.906  -1.571  -0.599
  173   1H6     A  16          H61         A  16  33.149   1.780  -0.653
  174   2H6     A  16          H62         A  16  32.649   2.859  -1.945
  175    H2     A  16           H2         A  16  35.630   2.351  -5.265
  176   1H5*    G  17          H5'         G  17  41.690   0.533  -4.257
  177   2H5*    G  17          H5''        G  17  42.848   1.757  -3.778
  178    H4*    G  17           H4'        G  17  40.941   2.582  -5.198
  179    H3*    G  17           H3'        G  17  41.599   3.835  -2.542
  180    H2*    G  17           H2'        G  17  39.755   5.065  -2.604
  181   2HO*    G  17          2HO'        G  17  40.578   5.705  -5.054
  182    H1*    G  17           H1'        G  17  38.361   3.492  -4.727
  183    H8     G  17           H8         G  17  38.765   2.617  -1.133
  184    H1     G  17           H1         G  17  33.662   6.312  -2.214
  185   1H2     G  17          H21         G  17  35.116   6.895  -5.241
  186   2H2     G  17          H22         G  17  33.867   7.332  -4.080
  187   1H5*    A  18          H5'         A  18  44.148   7.691  -2.743
  188   2H5*    A  18          H5''        A  18  42.452   7.233  -2.910
  189    H4*    A  18           H4'        A  18  43.874   8.772  -5.051
  190    H3*    A  18           H3'        A  18  43.904  10.121  -2.830
  191    H2*    A  18           H2'        A  18  41.812   9.370  -2.170
  192   2HO*    A  18          2HO'        A  18  42.004  12.021  -2.642
  193    H1*    A  18           H1'        A  18  40.712  10.452  -4.770
  194    H8     A  18           H8         A  18  40.456   7.762  -2.114
  195   1H6     A  18          H61         A  18  34.414   9.175  -2.153
  196   2H6     A  18          H62         A  18  35.684   8.305  -1.305
  197    H2     A  18           H2         A  18  36.333  11.176  -5.641
  198   1H5*    A  19          H5'         A  19  41.487  13.615  -5.406
  199   2H5*    A  19          H5''        A  19  42.784  14.811  -5.345
  200    H4*    A  19           H4'        A  19  41.253  16.198  -4.853
  201    H3*    A  19           H3'        A  19  42.413  15.933  -2.496
  202    H2*    A  19           H2'        A  19  40.831  13.916  -2.137
  203   2HO*    A  19          2HO'        A  19  40.497  16.268  -0.594
  204    H1*    A  19           H1'        A  19  38.838  16.078  -2.784
  205    H8     A  19           H8         A  19  39.089  12.284  -1.921
  206   1H6     A  19          H61         A  19  34.355  11.290  -2.330
  207   2H6     A  19          H62         A  19  32.930  12.288  -2.591
  208    H2     A  19           H2         A  19  34.455  16.469  -3.198
  209   1H5*    G  20          H5'         G  20  40.671  19.610   0.795
  210   2H5*    G  20          H5''        G  20  40.340  18.061   1.540
  211    H4*    G  20           H4'        G  20  38.658  19.508  -0.443
  212    H3*    G  20           H3'        G  20  38.043  18.021   2.151
  213    H2*    G  20           H2'        G  20  35.797  18.051   1.476
  214   2HO*    G  20          2HO'        G  20  36.103  20.233   0.266
  215    H1*    G  20           H1'        G  20  36.513  17.181  -1.105
  216    H8     G  20           H8         G  20  38.739  15.371   1.256
  217    H1     G  20           H1         G  20  32.915  12.825   0.539
  218   1H2     G  20          H21         G  20  31.926  16.043  -0.089
  219   2H2     G  20          H22         G  20  31.472  14.353   0.081
  220   1H5*    C  21          H5'         C  21  35.144  20.632   2.621
  221   2H5*    C  21          H5''        C  21  35.116  21.295   4.261
  222    H4*    C  21           H4'        C  21  33.056  20.185   3.833
  223    H3*    C  21           H3'        C  21  34.730  18.485   5.737
  224    H2*    C  21           H2'        C  21  32.775  17.204   6.015
  225   2HO*    C  21          2HO'        C  21  31.405  19.355   5.550
  226    H1*    C  21           H1'        C  21  32.276  17.202   3.233
  227   1H4     C  21          H41         C  21  36.740  12.415   3.897
  228   2H4     C  21          H42         C  21  35.146  11.682   4.010
  229    H5     C  21           H5         C  21  37.024  14.880   3.874
  230    H6     C  21           H6         C  21  35.847  16.969   3.863
  231   1H5*    C  22          H5'         C  22  31.238  18.856   7.911
  232   2H5*    C  22          H5''        C  22  31.671  19.515   9.501
  233    H4*    C  22           H4'        C  22  30.463  17.552   9.942
  234    H3*    C  22           H3'        C  22  33.415  16.854  10.191
  235    H2*    C  22           H2'        C  22  32.773  14.850  10.976
  236   2HO*    C  22          2HO'        C  22  30.803  16.069  12.155
  237    H1*    C  22           H1'        C  22  30.512  14.639   9.187
  238   1H4     C  22          H41         C  22  36.133  12.139   6.625
  239   2H4     C  22          H42         C  22  35.095  10.751   6.827
  240    H5     C  22           H5         C  22  35.567  14.337   7.264
  241    H6     C  22           H6         C  22  33.866  15.735   8.298
  242    H3T    C  22           H3T        C  22  32.698  18.534  11.508
  Start of MODEL    5
    1   1H5*    G   1          H5'         G   1  42.122  -0.221  11.095
    2   2H5*    G   1          H5''        G   1  40.552  -1.006  10.935
    3    H4*    G   1           H4'        G   1  40.533   0.699  12.667
    4    H3*    G   1           H3'        G   1  38.775   1.456  10.295
    5    H2*    G   1           H2'        G   1  37.999   3.130  11.653
    6   2HO*    G   1          2HO'        G   1  38.004   1.797  13.692
    7    H1*    G   1           H1'        G   1  40.518   3.684  12.747
    8    H8     G   1           H8         G   1  39.518   3.341   9.051
    9    H1     G   1           H1         G   1  39.603   9.282  11.356
   10   1H2     G   1          H21         G   1  39.901   7.678  14.395
   11   2H2     G   1          H22         G   1  39.573   9.182  13.558
   12    H5T    G   1           H5T        G   1  40.180   0.352   9.094
   13   1H5*    G   2          H5'         G   2  36.221   1.298  13.829
   14   2H5*    G   2          H5''        G   2  34.558   0.986  13.339
   15    H4*    G   2           H4'        G   2  34.833   3.033  14.625
   16    H3*    G   2           H3'        G   2  33.847   3.592  11.791
   17    H2*    G   2           H2'        G   2  33.433   5.769  12.635
   18   2HO*    G   2          2HO'        G   2  32.867   4.686  14.882
   19    H1*    G   2           H1'        G   2  35.870   5.784  14.096
   20    H8     G   2           H8         G   2  36.894   4.599  10.784
   21    H1     G   2           H1         G   2  35.528  10.835  10.757
   22   1H2     G   2          H21         G   2  33.852  10.196  13.679
   23   2H2     G   2          H22         G   2  34.257  11.371  12.439
   24   1H5*    C   3          H5'         C   3  30.784   5.116  14.064
   25   2H5*    C   3          H5''        C   3  29.201   4.700  13.393
   26    H4*    C   3           H4'        C   3  29.444   7.107  13.529
   27    H3*    C   3           H3'        C   3  29.466   6.101  10.659
   28    H2*    C   3           H2'        C   3  29.452   8.282   9.970
   29   2HO*    C   3          2HO'        C   3  29.188  10.071  11.441
   30    H1*    C   3           H1'        C   3  31.241   9.129  12.092
   31   1H4     C   3          H41         C   3  35.192   7.353   7.146
   32   2H4     C   3          H42         C   3  34.875   9.060   6.883
   33    H5     C   3           H5         C   3  34.099   6.073   8.883
   34    H6     C   3           H6         C   3  32.431   6.109  10.576
   35   1H5*    C   4          H5'         C   4  25.736   5.489   7.943
   36   2H5*    C   4          H5''        C   4  27.496   5.318   7.910
   37    H4*    C   4           H4'        C   4  25.936   7.771   7.115
   38    H3*    C   4           H3'        C   4  27.355   5.647   5.466
   39    H2*    C   4           H2'        C   4  27.834   7.350   3.893
   40   2HO*    C   4          2HO'        C   4  25.803   8.653   4.696
   41    H1*    C   4           H1'        C   4  29.014   8.951   5.807
   42   1H4     C   4          H41         C   4  33.459   4.095   6.013
   43   2H4     C   4          H42         C   4  33.678   4.761   4.411
   44    H5     C   4           H5         C   4  31.716   4.862   7.524
   45    H6     C   4           H6         C   4  29.818   6.286   7.751
   46   1H5*    U   5          H5'         U   5  24.979   7.282   2.705
   47   2H5*    U   5          H5''        U   5  24.043   6.170   1.689
   48    H4*    U   5           H4'        U   5  25.541   7.460   0.339
   49    H3*    U   5           H3'        U   5  26.407   4.548   0.513
   50    H2*    U   5           H2'        U   5  27.954   5.097  -1.171
   51   2HO*    U   5          2HO'        U   5  26.407   7.024  -1.903
   52    H1*    U   5           H1'        U   5  28.985   7.181   0.319
   53    H3     U   5           H3         U   5  31.605   3.353   0.840
   54    H5     U   5           H5         U   5  29.114   3.618   4.172
   55    H6     U   5           H6         U   5  27.882   5.265   3.032
   56   1H5*    G   6          H5'         G   6  26.263   5.179  -3.379
   57   2H5*    G   6          H5''        G   6  25.456   3.904  -4.302
   58    H4*    G   6           H4'        G   6  27.732   4.188  -5.037
   59    H3*    G   6           H3'        G   6  27.279   1.531  -3.626
   60    H2*    G   6           H2'        G   6  29.459   0.977  -4.345
   61   2HO*    G   6          2HO'        G   6  30.169   1.981  -6.151
   62    H1*    G   6           H1'        G   6  30.538   3.206  -3.345
   63    H8     G   6           H8         G   6  27.751   2.621  -0.873
   64    H1     G   6           H1         G   6  33.048  -0.897  -0.014
   65   1H2     G   6          H21         G   6  33.548  -0.144  -3.366
   66   2H2     G   6          H22         G   6  34.151  -0.992  -1.953
   67   1H5*    A   7          H5'         A   7  28.903   0.606  -7.208
   68   2H5*    A   7          H5''        A   7  28.135  -0.769  -7.993
   69    H4*    A   7           H4'        A   7  30.470  -1.170  -7.791
   70    H3*    A   7           H3'        A   7  28.910  -2.943  -5.901
   71    H2*    A   7           H2'        A   7  30.973  -4.092  -5.592
   72   2HO*    A   7          2HO'        A   7  32.308  -4.072  -7.321
   73    H1*    A   7           H1'        A   7  32.379  -1.699  -5.195
   74    H8     A   7           H8         A   7  29.339  -0.851  -3.462
   75   1H6     A   7          H61         A   7  30.169  -2.765   0.771
   76   2H6     A   7          H62         A   7  31.224  -4.001   1.416
   77    H2     A   7           H2         A   7  33.543  -5.535  -2.151
   78   1H5*    G   8          H5'         G   8  30.801  -5.795  -8.208
   79   2H5*    G   8          H5''        G   8  29.701  -7.124  -8.589
   80    H4*    G   8           H4'        G   8  31.617  -7.936  -7.428
   81    H3*    G   8           H3'        G   8  29.132  -8.119  -5.684
   82    H2*    G   8           H2'        G   8  30.481  -9.406  -4.220
   83   2HO*    G   8          2HO'        G   8  32.627  -9.046  -6.124
   84    H1*    G   8           H1'        G   8  32.511  -7.454  -4.237
   85    H8     G   8           H8         G   8  29.284  -5.590  -4.554
   86    H1     G   8           H1         G   8  30.535  -7.702   1.361
   87   1H2     G   8          H21         G   8  32.832  -9.696  -0.166
   88   2H2     G   8          H22         G   8  32.056  -9.214   1.325
   89   1H5*    G   9          H5'         G   9  29.219 -11.800  -5.142
   90   2H5*    G   9          H5''        G   9  27.866 -12.560  -5.988
   91    H4*    G   9           H4'        G   9  27.612 -13.212  -3.912
   92    H3*    G   9           H3'        G   9  25.738 -10.873  -4.236
   93    H2*    G   9           H2'        G   9  24.931 -11.094  -2.145
   94   2HO*    G   9          2HO'        G   9  26.095 -13.059  -0.847
   95    H1*    G   9           H1'        G   9  27.452 -11.629  -0.915
   96    H8     G   9           H8         G   9  27.331  -9.213  -3.620
   97    H1     G   9           H1         G   9  24.927  -6.967   1.909
   98   1H2     G   9          H21         G   9  25.487 -10.261   2.919
   99   2H2     G   9          H22         G   9  24.907  -8.671   3.380
  100   1H5*    A  10          H5'         A  10  21.442 -13.451  -3.094
  101   2H5*    A  10          H5''        A  10  23.054 -12.873  -2.681
  102    H4*    A  10           H4'        A  10  22.208 -15.720  -3.203
  103    H3*    A  10           H3'        A  10  23.327 -14.376  -0.706
  104    H2*    A  10           H2'        A  10  24.026 -16.521  -0.087
  105   2HO*    A  10          2HO'        A  10  21.964 -17.565  -0.702
  106    H1*    A  10           H1'        A  10  24.433 -17.262  -2.867
  107    H8     A  10           H8         A  10  26.882 -14.699  -2.867
  108   1H6     A  10          H61         A  10  30.675 -17.215  -1.041
  109   2H6     A  10          H62         A  10  30.758 -18.598   0.043
  110    H2     A  10           H2         A  10  26.620 -19.904   0.910
  111   1H5*    G  11          H5'         G  11  21.765 -14.301   3.613
  112   2H5*    G  11          H5''        G  11  23.052 -14.005   2.437
  113    H4*    G  11           H4'        G  11  22.610 -16.605   3.919
  114    H3*    G  11           H3'        G  11  24.656 -14.379   4.294
  115    H2*    G  11           H2'        G  11  26.307 -15.951   4.615
  116   2HO*    G  11          2HO'        G  11  24.817 -17.486   5.821
  117    H1*    G  11           H1'        G  11  25.613 -17.617   2.501
  118    H8     G  11           H8         G  11  24.899 -14.456   0.947
  119    H1     G  11           H1         G  11  31.209 -15.417   1.651
  120   1H2     G  11          H21         G  11  30.237 -17.776   3.982
  121   2H2     G  11          H22         G  11  31.569 -16.960   3.174
  122   1H5*    A  12          H5'         A  12  25.807 -16.279   7.674
  123   2H5*    A  12          H5''        A  12  26.082 -15.181   9.039
  124    H4*    A  12           H4'        A  12  28.179 -16.190   8.188
  125    H3*    A  12           H3'        A  12  28.169 -13.279   7.423
  126    H2*    A  12           H2'        A  12  30.290 -13.287   7.018
  127   2HO*    A  12          2HO'        A  12  31.126 -15.084   8.296
  128    H1*    A  12           H1'        A  12  29.612 -15.257   5.462
  129    H8     A  12           H8         A  12  26.595 -13.075   5.443
  130   1H6     A  12          H61         A  12  29.189 -10.118   0.628
  131   2H6     A  12          H62         A  12  27.629 -10.470   1.357
  132    H2     A  12           H2         A  12  32.263 -12.165   2.897
  133   1H5*    C  13          H5'         C  13  31.784 -10.495  10.318
  134   2H5*    C  13          H5''        C  13  30.478  -9.937   9.246
  135    H4*    C  13           H4'        C  13  32.759 -11.730   8.381
  136    H3*    C  13           H3'        C  13  32.360  -8.767   7.667
  137    H2*    C  13           H2'        C  13  33.621  -9.318   5.765
  138   2HO*    C  13          2HO'        C  13  34.645 -11.282   7.235
  139    H1*    C  13           H1'        C  13  31.966 -11.778   5.465
  140   1H4     C  13          H41         C  13  27.783  -7.305   3.234
  141   2H4     C  13          H42         C  13  29.119  -6.796   2.230
  142    H5     C  13           H5         C  13  27.885  -9.250   4.651
  143    H6     C  13           H6         C  13  29.265 -10.576   5.977
  144   1H5*    U  14          H5'         U  14  36.555  -9.636   6.831
  145   2H5*    U  14          H5''        U  14  37.557  -8.188   6.951
  146    H4*    U  14           H4'        U  14  37.590  -9.324   4.773
  147    H3*    U  14           H3'        U  14  36.585  -6.458   4.558
  148    H2*    U  14           H2'        U  14  36.832  -6.864   2.173
  149   2HO*    U  14          2HO'        U  14  38.613  -8.621   2.616
  150    H1*    U  14           H1'        U  14  35.249  -8.988   2.316
  151    H3     U  14           H3         U  14  32.509  -5.535   1.041
  152    H5     U  14           H5         U  14  32.175  -5.846   5.216
  153    H6     U  14           H6         U  14  34.135  -7.140   5.203
  154   1H5*    C  15          H5'         C  15  39.485  -6.747   1.833
  155   2H5*    C  15          H5''        C  15  40.599  -5.375   1.802
  156    H4*    C  15           H4'        C  15  39.590  -5.754  -0.364
  157    H3*    C  15           H3'        C  15  38.805  -3.128   0.936
  158    H2*    C  15           H2'        C  15  37.780  -2.574  -1.098
  159   2HO*    C  15          2HO'        C  15  39.117  -3.840  -2.608
  160    H1*    C  15           H1'        C  15  36.285  -4.885  -1.114
  161   1H4     C  15          H41         C  15  33.106  -2.118   3.874
  162   2H4     C  15          H42         C  15  32.709  -1.133   2.473
  163    H5     C  15           H5         C  15  34.849  -3.837   3.780
  164    H6     C  15           H6         C  15  36.387  -4.929   2.351
  165   1H5*    A  16          H5'         A  16  40.490  -1.882  -2.581
  166   2H5*    A  16          H5''        A  16  41.595  -0.509  -2.398
  167    H4*    A  16           H4'        A  16  39.655   0.016  -3.853
  168    H3*    A  16           H3'        A  16  39.704   1.551  -1.232
  169    H2*    A  16           H2'        A  16  37.900   2.694  -1.966
  170   2HO*    A  16          2HO'        A  16  37.874   3.221  -4.098
  171    H1*    A  16           H1'        A  16  36.742   0.268  -3.006
  172    H8     A  16           H8         A  16  38.120   0.219  -0.194
  173   1H6     A  16          H61         A  16  34.664   1.714   3.056
  174   2H6     A  16          H62         A  16  33.159   2.580   2.769
  175    H2     A  16           H2         A  16  32.995   3.436  -1.625
  176   1H5*    G  17          H5'         G  17  39.749   6.451  -3.879
  177   2H5*    G  17          H5''        G  17  39.157   6.110  -2.266
  178    H4*    G  17           H4'        G  17  37.851   5.462  -4.886
  179    H3*    G  17           H3'        G  17  37.730   7.923  -4.066
  180    H2*    G  17           H2'        G  17  36.744   7.682  -1.941
  181   2HO*    G  17          2HO'        G  17  34.853   8.089  -3.902
  182    H1*    G  17           H1'        G  17  34.856   5.486  -2.757
  183    H8     G  17           H8         G  17  37.989   5.182  -0.852
  184    H1     G  17           H1         G  17  33.002   6.290   2.956
  185   1H2     G  17          H21         G  17  31.424   7.228   0.110
  186   2H2     G  17          H22         G  17  31.412   7.094   1.869
  187   1H5*    A  18          H5'         A  18  36.430  11.205  -5.327
  188   2H5*    A  18          H5''        A  18  36.085  10.291  -3.843
  189    H4*    A  18           H4'        A  18  34.066  11.642  -5.618
  190    H3*    A  18           H3'        A  18  35.491  13.276  -4.083
  191    H2*    A  18           H2'        A  18  35.237  12.137  -2.093
  192   2HO*    A  18          2HO'        A  18  33.371  14.175  -2.360
  193    H1*    A  18           H1'        A  18  32.291  11.811  -2.664
  194    H8     A  18           H8         A  18  35.429  10.047  -1.343
  195   1H6     A  18          H61         A  18  31.825   9.342   3.727
  196   2H6     A  18          H62         A  18  33.489   9.228   3.180
  197    H2     A  18           H2         A  18  29.293  10.764   0.416
  198   1H5*    A  19          H5'         A  19  35.838  16.719  -3.088
  199   2H5*    A  19          H5''        A  19  35.467  15.182  -2.343
  200    H4*    A  19           H4'        A  19  34.615  17.932  -1.558
  201    H3*    A  19           H3'        A  19  36.808  16.844  -0.554
  202    H2*    A  19           H2'        A  19  35.421  14.753  -0.034
  203   2HO*    A  19          2HO'        A  19  36.545  16.225   1.999
  204    H1*    A  19           H1'        A  19  33.778  16.934   1.245
  205    H8     A  19           H8         A  19  33.907  13.069   0.968
  206   1H6     A  19          H61         A  19  29.543  13.465   5.381
  207   2H6     A  19          H62         A  19  30.558  12.334   4.482
  208    H2     A  19           H2         A  19  30.234  17.493   3.755
  209   1H5*    G  20          H5'         G  20  36.675  19.716   4.595
  210   2H5*    G  20          H5''        G  20  36.970  18.077   4.070
  211    H4*    G  20           H4'        G  20  34.194  19.254   4.286
  212    H3*    G  20           H3'        G  20  35.818  17.767   6.386
  213    H2*    G  20           H2'        G  20  33.784  16.842   7.161
  214   2HO*    G  20          2HO'        G  20  32.523  18.878   6.676
  215    H1*    G  20           H1'        G  20  32.866  16.270   4.595
  216    H8     G  20           H8         G  20  36.491  15.486   4.542
  217    H1     G  20           H1         G  20  33.069  10.905   7.403
  218   1H2     G  20          H21         G  20  30.856  13.455   8.082
  219   2H2     G  20          H22         G  20  31.344  11.799   8.400
  220   1H5*    C  21          H5'         C  21  33.085  19.301   9.051
  221   2H5*    C  21          H5''        C  21  33.951  20.001  10.426
  222    H4*    C  21           H4'        C  21  32.585  18.199  11.199
  223    H3*    C  21           H3'        C  21  35.505  17.337  11.204
  224    H2*    C  21           H2'        C  21  34.778  15.481  12.448
  225   2HO*    C  21          2HO'        C  21  33.025  16.517  13.691
  226    H1*    C  21           H1'        C  21  32.631  15.071  10.679
  227   1H4     C  21          H41         C  21  37.583  12.426   7.343
  228   2H4     C  21          H42         C  21  36.948  11.142   8.360
  229    H5     C  21           H5         C  21  37.031  14.742   7.694
  230    H6     C  21           H6         C  21  35.535  16.248   8.839
  231   1H5*    C  22          H5'         C  22  35.123  16.549  14.921
  232   2H5*    C  22          H5''        C  22  36.399  17.351  15.851
  233    H4*    C  22           H4'        C  22  36.653  15.046  16.211
  234    H3*    C  22           H3'        C  22  38.712  15.800  14.092
  235    H2*    C  22           H2'        C  22  39.572  13.719  14.446
  236   2HO*    C  22          2HO'        C  22  39.183  13.938  16.927
  237    H1*    C  22           H1'        C  22  36.918  12.578  14.868
  238   1H4     C  22          H41         C  22  39.780  11.961   8.852
  239   2H4     C  22          H42         C  22  39.612  10.343   9.502
  240    H5     C  22           H5         C  22  39.038  13.939  10.050
  241    H6     C  22           H6         C  22  37.946  14.711  12.103
  242    H3T    C  22           H3T        C  22  38.818  17.038  15.980
  Start of MODEL    6
    1   1H5*    G   1          H5'         G   1  37.377  12.127  15.669
    2   2H5*    G   1          H5''        G   1  36.625  10.693  14.975
    3    H4*    G   1           H4'        G   1  35.282  12.678  14.665
    4    H3*    G   1           H3'        G   1  36.283  11.578  12.004
    5    H2*    G   1           H2'        G   1  34.759  13.030  11.139
    6   2HO*    G   1          2HO'        G   1  32.875  13.176  12.239
    7    H1*    G   1           H1'        G   1  35.282  15.089  12.894
    8    H8     G   1           H8         G   1  37.771  12.981  10.896
    9    H1     G   1           H1         G   1  35.612  18.162   7.835
   10   1H2     G   1          H21         G   1  33.468  18.401  10.539
   11   2H2     G   1          H22         G   1  33.921  19.014   8.961
   12    H5T    G   1           H5T        G   1  38.811  12.191  13.986
   13   1H5*    G   2          H5'         G   2  31.654  11.553  12.360
   14   2H5*    G   2          H5''        G   2  31.011  10.561  11.057
   15    H4*    G   2           H4'        G   2  30.107  12.816  11.190
   16    H3*    G   2           H3'        G   2  31.453  12.277   8.521
   17    H2*    G   2           H2'        G   2  30.283  14.298   7.860
   18   2HO*    G   2          2HO'        G   2  28.945  15.419   9.335
   19    H1*    G   2           H1'        G   2  31.427  15.655   9.965
   20    H8     G   2           H8         G   2  34.004  13.153   9.364
   21    H1     G   2           H1         G   2  33.700  17.044   4.352
   22   1H2     G   2          H21         G   2  30.662  17.952   5.602
   23   2H2     G   2          H22         G   2  31.813  18.069   4.280
   24   1H5*    C   3          H5'         C   3  27.776  13.332   7.431
   25   2H5*    C   3          H5''        C   3  26.975  12.085   6.461
   26    H4*    C   3           H4'        C   3  26.773  14.110   5.297
   27    H3*    C   3           H3'        C   3  28.979  12.509   3.999
   28    H2*    C   3           H2'        C   3  28.839  14.072   2.198
   29   2HO*    C   3          2HO'        C   3  26.487  14.822   2.765
   30    H1*    C   3           H1'        C   3  29.400  16.056   4.011
   31   1H4     C   3          H41         C   3  34.725  12.072   4.274
   32   2H4     C   3          H42         C   3  34.943  12.938   2.762
   33    H5     C   3           H5         C   3  32.857  12.441   5.731
   34    H6     C   3           H6         C   3  30.790  13.530   5.956
   35   1H5*    C   4          H5'         C   4  27.028  14.400   0.488
   36   2H5*    C   4          H5''        C   4  25.944  13.322  -0.402
   37    H4*    C   4           H4'        C   4  27.753  13.951  -1.782
   38    H3*    C   4           H3'        C   4  27.963  11.016  -0.984
   39    H2*    C   4           H2'        C   4  29.679  10.919  -2.597
   40   2HO*    C   4          2HO'        C   4  28.529  12.944  -3.779
   41    H1*    C   4           H1'        C   4  30.999  13.093  -1.501
   42   1H4     C   4          H41         C   4  32.059   8.406   3.046
   43   2H4     C   4          H42         C   4  33.076   7.922   1.697
   44    H5     C   4           H5         C   4  30.499  10.256   2.911
   45    H6     C   4           H6         C   4  29.595  11.955   1.496
   46   1H5*    U   5          H5'         U   5  27.396  10.964  -5.026
   47   2H5*    U   5          H5''        U   5  26.400   9.661  -5.679
   48    H4*    U   5           H4'        U   5  28.668   9.549  -6.481
   49    H3*    U   5           H3'        U   5  28.083   7.157  -4.651
   50    H2*    U   5           H2'        U   5  30.113   6.338  -5.451
   51   2HO*    U   5          2HO'        U   5  30.569   7.153  -7.501
   52    H1*    U   5           H1'        U   5  31.420   8.664  -4.691
   53    H3     U   5           H3         U   5  31.854   5.366  -1.438
   54    H5     U   5           H5         U   5  28.931   8.048  -0.120
   55    H6     U   5           H6         U   5  28.826   8.886  -2.319
   56   1H5*    G   6          H5'         G   6  29.273   5.502  -7.931
   57   2H5*    G   6          H5''        G   6  28.251   4.172  -8.483
   58    H4*    G   6           H4'        G   6  30.490   3.451  -8.210
   59    H3*    G   6           H3'        G   6  28.700   2.215  -6.086
   60    H2*    G   6           H2'        G   6  30.575   0.788  -5.700
   61   2HO*    G   6          2HO'        G   6  31.342   1.231  -8.131
   62    H1*    G   6           H1'        G   6  32.201   2.798  -5.372
   63    H8     G   6           H8         G   6  29.031   4.353  -4.090
   64    H1     G   6           H1         G   6  31.687   0.055  -0.110
   65   1H2     G   6          H21         G   6  33.504  -0.822  -2.959
   66   2H2     G   6          H22         G   6  33.145  -1.191  -1.278
   67   1H5*    A   7          H5'         A   7  30.671  -0.718  -8.257
   68   2H5*    A   7          H5''        A   7  29.595  -2.045  -8.693
   69    H4*    A   7           H4'        A   7  31.624  -2.881  -7.697
   70    H3*    A   7           H3'        A   7  29.104  -3.331  -6.098
   71    H2*    A   7           H2'        A   7  30.403  -4.676  -4.659
   72   2HO*    A   7          2HO'        A   7  31.906  -5.153  -6.741
   73    H1*    A   7           H1'        A   7  32.448  -2.813  -4.418
   74    H8     A   7           H8         A   7  29.713  -0.522  -4.497
   75   1H6     A   7          H61         A   7  28.284  -0.587  -0.029
   76   2H6     A   7          H62         A   7  28.380  -1.680   1.336
   77    H2     A   7           H2         A   7  30.914  -5.130  -0.184
   78   1H5*    G   8          H5'         G   8  30.457  -7.044  -6.371
   79   2H5*    G   8          H5''        G   8  29.215  -8.185  -6.905
   80    H4*    G   8           H4'        G   8  30.040  -8.885  -4.813
   81    H3*    G   8           H3'        G   8  27.296  -7.655  -4.396
   82    H2*    G   8           H2'        G   8  27.412  -8.668  -2.225
   83   2HO*    G   8          2HO'        G   8  28.764 -10.551  -2.668
   84    H1*    G   8           H1'        G   8  29.887  -7.446  -1.822
   85    H8     G   8           H8         G   8  27.915  -5.153  -4.044
   86    H1     G   8           H1         G   8  26.506  -4.803   2.202
   87   1H2     G   8          H21         G   8  28.153  -7.776   2.392
   88   2H2     G   8          H22         G   8  27.263  -6.530   3.255
   89   1H5*    G   9          H5'         G   9  25.163 -11.179  -2.084
   90   2H5*    G   9          H5''        G   9  24.109 -11.608  -3.435
   91    H4*    G   9           H4'        G   9  22.916 -10.559  -1.735
   92    H3*    G   9           H3'        G   9  23.154  -8.558  -4.016
   93    H2*    G   9           H2'        G   9  21.625  -7.263  -2.899
   94   2HO*    G   9          2HO'        G   9  20.959  -8.712  -0.675
   95    H1*    G   9           H1'        G   9  22.743  -7.935  -0.308
   96    H8     G   9           H8         G   9  24.598  -7.076  -3.345
   97    H1     G   9           H1         G   9  22.144  -2.016  -0.208
   98   1H2     G   9          H21         G   9  21.120  -4.546   1.987
   99   2H2     G   9          H22         G   9  21.051  -2.824   1.628
  100   1H5*    A  10          H5'         A  10  17.923  -8.095  -4.786
  101   2H5*    A  10          H5''        A  10  19.273  -8.138  -3.660
  102    H4*    A  10           H4'        A  10  16.979 -10.086  -3.892
  103    H3*    A  10           H3'        A  10  18.135  -8.551  -1.503
  104    H2*    A  10           H2'        A  10  17.257 -10.252  -0.165
  105   2HO*    A  10          2HO'        A  10  15.172 -10.340  -1.297
  106    H1*    A  10           H1'        A  10  17.724 -12.274  -2.185
  107    H8     A  10           H8         A  10  21.071 -11.184  -2.064
  108   1H6     A  10          H61         A  10  21.831 -14.656   3.046
  109   2H6     A  10          H62         A  10  22.657 -13.908   1.682
  110    H2     A  10           H2         A  10  17.516 -13.688   2.690
  111   1H5*    G  11          H5'         G  11  15.665  -6.094   1.795
  112   2H5*    G  11          H5''        G  11  17.281  -6.599   1.292
  113    H4*    G  11           H4'        G  11  15.360  -8.161   3.016
  114    H3*    G  11           H3'        G  11  18.124  -6.978   3.538
  115    H2*    G  11           H2'        G  11  18.627  -8.854   4.836
  116   2HO*    G  11          2HO'        G  11  16.508  -9.058   5.875
  117    H1*    G  11           H1'        G  11  17.564 -10.750   3.100
  118    H8     G  11           H8         G  11  18.995  -8.564   0.652
  119    H1     G  11           H1         G  11  23.604 -11.622   3.875
  120   1H2     G  11          H21         G  11  22.829 -12.386   5.764
  121   2H2     G  11          H22         G  11  21.147 -12.166   6.216
  122   1H5*    A  12          H5'         A  12  17.208  -7.306   7.733
  123   2H5*    A  12          H5''        A  12  17.897  -5.936   8.619
  124    H4*    A  12           H4'        A  12  19.064  -8.102   9.052
  125    H3*    A  12           H3'        A  12  20.895  -6.262   7.507
  126    H2*    A  12           H2'        A  12  22.630  -7.488   7.995
  127   2HO*    A  12          2HO'        A  12  21.107  -8.548   9.944
  128    H1*    A  12           H1'        A  12  21.220  -9.329   6.932
  129    H8     A  12           H8         A  12  19.962  -6.363   5.024
  130   1H6     A  12          H61         A  12  24.865  -7.090   1.327
  131   2H6     A  12          H62         A  12  23.192  -6.547   1.324
  132    H2     A  12           H2         A  12  25.701  -8.747   5.270
  133   1H5*    C  13          H5'         C  13  24.014  -3.114  10.818
  134   2H5*    C  13          H5''        C  13  23.472  -2.970   9.162
  135    H4*    C  13           H4'        C  13  24.698  -5.426  10.430
  136    H3*    C  13           H3'        C  13  25.788  -3.511   8.323
  137    H2*    C  13           H2'        C  13  27.171  -5.226   7.691
  138   2HO*    C  13          2HO'        C  13  27.623  -6.886   9.034
  139    H1*    C  13           H1'        C  13  24.821  -7.038   7.538
  140   1H4     C  13          H41         C  13  23.515  -3.357   2.343
  141   2H4     C  13          H42         C  13  25.212  -3.556   1.984
  142    H5     C  13           H5         C  13  22.455  -4.363   4.261
  143    H6     C  13           H6         C  13  22.775  -5.180   6.418
  144   1H5*    U  14          H5'         U  14  29.118  -5.237   9.877
  145   2H5*    U  14          H5''        U  14  30.547  -4.215  10.067
  146    H4*    U  14           H4'        U  14  30.954  -6.093   8.604
  147    H3*    U  14           H3'        U  14  31.046  -3.472   7.046
  148    H2*    U  14           H2'        U  14  31.891  -4.880   5.273
  149   2HO*    U  14          2HO'        U  14  32.792  -6.551   6.966
  150    H1*    U  14           H1'        U  14  29.793  -6.465   5.389
  151    H3     U  14           H3         U  14  29.011  -3.339   2.061
  152    H5     U  14           H5         U  14  27.128  -1.881   5.534
  153    H6     U  14           H6         U  14  28.252  -3.525   6.748
  154   1H5*    C  15          H5'         C  15  34.427  -5.320   6.195
  155   2H5*    C  15          H5''        C  15  35.860  -4.291   6.186
  156    H4*    C  15           H4'        C  15  35.536  -5.384   4.052
  157    H3*    C  15           H3'        C  15  35.274  -2.362   4.011
  158    H2*    C  15           H2'        C  15  35.131  -2.521   1.681
  159   2HO*    C  15          2HO'        C  15  36.392  -4.784   1.820
  160    H1*    C  15           H1'        C  15  33.092  -4.389   1.752
  161   1H4     C  15          H41         C  15  29.775   0.943   3.754
  162   2H4     C  15          H42         C  15  30.253   1.261   2.084
  163    H5     C  15           H5         C  15  30.704  -0.996   4.980
  164    H6     C  15           H6         C  15  32.040  -2.950   4.746
  165   1H5*    A  16          H5'         A  16  37.988  -3.322   1.248
  166   2H5*    A  16          H5''        A  16  39.493  -2.391   1.278
  167    H4*    A  16           H4'        A  16  38.302  -2.209  -0.893
  168    H3*    A  16           H3'        A  16  38.552   0.354   0.728
  169    H2*    A  16           H2'        A  16  37.520   1.438  -0.898
  170   2HO*    A  16          2HO'        A  16  38.021   1.026  -2.956
  171    H1*    A  16           H1'        A  16  35.706  -0.739  -1.433
  172    H8     A  16           H8         A  16  36.130   0.197   1.520
  173   1H6     A  16          H61         A  16  33.093   4.112   2.273
  174   2H6     A  16          H62         A  16  32.264   5.120   1.093
  175    H2     A  16           H2         A  16  33.592   3.738  -2.930
  176   1H5*    G  17          H5'         G  17  41.267   2.920  -2.616
  177   2H5*    G  17          H5''        G  17  40.273   4.118  -1.826
  178    H4*    G  17           H4'        G  17  39.578   2.200  -3.982
  179    H3*    G  17           H3'        G  17  40.312   4.599  -4.389
  180    H2*    G  17           H2'        G  17  38.846   5.795  -2.976
  181   2HO*    G  17          2HO'        G  17  36.809   6.318  -4.314
  182    H1*    G  17           H1'        G  17  36.422   4.206  -3.789
  183    H8     G  17           H8         G  17  38.363   4.025  -0.666
  184    H1     G  17           H1         G  17  33.616   8.271  -0.371
  185   1H2     G  17          H21         G  17  33.831   8.172  -3.760
  186   2H2     G  17          H22         G  17  33.145   8.936  -2.321
  187   1H5*    A  18          H5'         A  18  41.624   6.200  -5.938
  188   2H5*    A  18          H5''        A  18  40.112   6.822  -5.296
  189    H4*    A  18           H4'        A  18  41.517   7.784  -7.758
  190    H3*    A  18           H3'        A  18  42.558   8.528  -5.453
  191    H2*    A  18           H2'        A  18  40.511   8.845  -4.469
  192   2HO*    A  18          2HO'        A  18  41.470  11.420  -5.272
  193    H1*    A  18           H1'        A  18  39.803  10.740  -6.712
  194    H8     A  18           H8         A  18  38.568   8.399  -4.010
  195   1H6     A  18          H61         A  18  33.871  10.108  -3.810
  196   2H6     A  18          H62         A  18  33.070  11.331  -4.782
  197    H2     A  18           H2         A  18  35.932  12.966  -7.681
  198   1H5*    A  19          H5'         A  19  43.844  13.817  -5.625
  199   2H5*    A  19          H5''        A  19  42.899  12.855  -4.486
  200    H4*    A  19           H4'        A  19  41.755  14.643  -6.624
  201    H3*    A  19           H3'        A  19  42.849  15.963  -4.669
  202    H2*    A  19           H2'        A  19  41.997  14.244  -3.039
  203   2HO*    A  19          2HO'        A  19  40.555  16.720  -2.989
  204    H1*    A  19           H1'        A  19  39.332  15.017  -4.210
  205    H8     A  19           H8         A  19  41.138  12.222  -2.155
  206   1H6     A  19          H61         A  19  35.328  10.543  -0.578
  207   2H6     A  19          H62         A  19  37.017  10.120  -0.339
  208    H2     A  19           H2         A  19  35.097  13.975  -3.350
  209   1H5*    G  20          H5'         G  20  40.174  20.439  -3.752
  210   2H5*    G  20          H5''        G  20  40.128  19.534  -2.256
  211    H4*    G  20           H4'        G  20  38.464  19.092  -4.699
  212    H3*    G  20           H3'        G  20  37.791  19.438  -1.755
  213    H2*    G  20           H2'        G  20  35.684  18.507  -2.305
  214   2HO*    G  20          2HO'        G  20  36.628  18.173  -5.016
  215    H1*    G  20           H1'        G  20  36.935  16.351  -3.575
  216    H8     G  20           H8         G  20  39.335  17.005  -0.899
  217    H1     G  20           H1         G  20  34.004  14.191   1.222
  218   1H2     G  20          H21         G  20  32.473  16.027  -1.220
  219   2H2     G  20          H22         G  20  32.295  15.040   0.215
  220   1H5*    C  21          H5'         C  21  34.519  21.058  -3.342
  221   2H5*    C  21          H5''        C  21  34.169  22.729  -2.854
  222    H4*    C  21           H4'        C  21  32.233  21.472  -2.339
  223    H3*    C  21           H3'        C  21  33.822  22.021   0.205
  224    H2*    C  21           H2'        C  21  32.119  21.004   1.408
  225   2HO*    C  21          2HO'        C  21  30.345  21.765  -0.088
  226    H1*    C  21           H1'        C  21  31.976  18.798  -0.269
  227   1H4     C  21          H41         C  21  37.473  17.131   2.728
  228   2H4     C  21          H42         C  21  36.184  16.626   3.803
  229    H5     C  21           H5         C  21  37.110  18.702   0.947
  230    H6     C  21           H6         C  21  35.446  19.733  -0.391
  231   1H5*    C  22          H5'         C  22  30.753  23.288   1.923
  232   2H5*    C  22          H5''        C  22  31.020  24.930   2.540
  233    H4*    C  22           H4'        C  22  30.692  23.466   4.405
  234    H3*    C  22           H3'        C  22  33.668  24.090   4.151
  235    H2*    C  22           H2'        C  22  33.911  23.068   6.147
  236   2HO*    C  22          2HO'        C  22  32.158  22.613   7.597
  237    H1*    C  22           H1'        C  22  31.753  21.156   5.579
  238   1H4     C  22          H41         C  22  38.067  19.070   4.844
  239   2H4     C  22          H42         C  22  37.405  18.226   6.229
  240    H5     C  22           H5         C  22  36.781  20.729   3.590
  241    H6     C  22           H6         C  22  34.617  21.864   3.469
  242    H3T    C  22           H3T        C  22  31.821  25.320   5.856
  Start of MODEL    7
    1   1H5*    G   1          H5'         G   1  45.123   3.605   3.337
    2   2H5*    G   1          H5''        G   1  43.588   2.840   3.741
    3    H4*    G   1           H4'        G   1  43.728   5.005   4.735
    4    H3*    G   1           H3'        G   1  41.662   5.023   2.493
    5    H2*    G   1           H2'        G   1  41.076   7.068   3.369
    6   2HO*    G   1          2HO'        G   1  41.048   7.023   5.559
    7    H1*    G   1           H1'        G   1  43.720   7.752   4.052
    8    H8     G   1           H8         G   1  42.251   6.753   0.616
    9    H1     G   1           H1         G   1  43.182  13.040   1.590
   10   1H2     G   1          H21         G   1  43.990  12.056   4.779
   11   2H2     G   1          H22         G   1  43.775  13.380   3.650
   12    H5T    G   1           H5T        G   1  44.154   2.561   1.533
   13   1H5*    G   2          H5'         G   2  39.824   6.007   6.584
   14   2H5*    G   2          H5''        G   2  38.079   5.835   6.420
   15    H4*    G   2           H4'        G   2  38.657   7.977   7.251
   16    H3*    G   2           H3'        G   2  37.505   8.250   4.446
   17    H2*    G   2           H2'        G   2  37.306  10.562   5.041
   18   2HO*    G   2          2HO'        G   2  36.905  10.037   7.440
   19    H1*    G   2           H1'        G   2  39.941  10.587   6.026
   20    H8     G   2           H8         G   2  39.697   8.439   2.955
   21    H1     G   2           H1         G   2  39.715  14.677   1.610
   22   1H2     G   2          H21         G   2  39.455  15.087   5.017
   23   2H2     G   2          H22         G   2  39.499  15.839   3.433
   24   1H5*    C   3          H5'         C   3  34.497   9.932   6.843
   25   2H5*    C   3          H5''        C   3  32.924   9.256   6.403
   26    H4*    C   3           H4'        C   3  32.773  11.622   6.264
   27    H3*    C   3           H3'        C   3  32.904  10.377   3.511
   28    H2*    C   3           H2'        C   3  32.432  12.531   2.645
   29   2HO*    C   3          2HO'        C   3  31.014  13.204   4.484
   30    H1*    C   3           H1'        C   3  34.406  13.710   4.263
   31   1H4     C   3          H41         C   3  37.758  10.671  -0.563
   32   2H4     C   3          H42         C   3  37.259  12.204  -1.255
   33    H5     C   3           H5         C   3  36.953   9.884   1.556
   34    H6     C   3           H6         C   3  35.620  10.418   3.457
   35   1H5*    C   4          H5'         C   4  29.727  11.875   2.537
   36   2H5*    C   4          H5''        C   4  28.461  10.785   1.944
   37    H4*    C   4           H4'        C   4  29.232  12.208   0.165
   38    H3*    C   4           H3'        C   4  30.072   9.301  -0.217
   39    H2*    C   4           H2'        C   4  30.887  10.011  -2.350
   40   2HO*    C   4          2HO'        C   4  29.669  11.693  -3.134
   41    H1*    C   4           H1'        C   4  32.328  12.103  -1.266
   42   1H4     C   4          H41         C   4  35.615   6.754   0.879
   43   2H4     C   4          H42         C   4  36.121   6.844  -0.791
   44    H5     C   4           H5         C   4  34.039   8.204   1.887
   45    H6     C   4           H6         C   4  32.487   9.958   1.496
   46   1H5*    U   5          H5'         U   5  27.326  10.005  -3.402
   47   2H5*    U   5          H5''        U   5  26.323   8.614  -3.830
   48    H4*    U   5           H4'        U   5  27.851   9.213  -5.601
   49    H3*    U   5           H3'        U   5  28.577   6.464  -4.438
   50    H2*    U   5           H2'        U   5  30.034   6.321  -6.260
   51   2HO*    U   5          2HO'        U   5  28.669   7.834  -7.674
   52    H1*    U   5           H1'        U   5  31.243   8.725  -5.575
   53    H3     U   5           H3         U   5  33.502   4.972  -3.811
   54    H5     U   5           H5         U   5  31.305   6.729  -0.718
   55    H6     U   5           H6         U   5  30.141   7.943  -2.345
   56   1H5*    G   6          H5'         G   6  28.269   5.647  -8.194
   57   2H5*    G   6          H5''        G   6  27.114   4.353  -8.526
   58    H4*    G   6           H4'        G   6  29.182   3.837  -9.546
   59    H3*    G   6           H3'        G   6  28.579   1.995  -7.204
   60    H2*    G   6           H2'        G   6  30.425   0.742  -7.929
   61   2HO*    G   6          2HO'        G   6  30.059   1.353 -10.307
   62    H1*    G   6           H1'        G   6  32.058   2.840  -8.082
   63    H8     G   6           H8         G   6  30.000   3.921  -5.199
   64    H1     G   6           H1         G   6  34.267  -0.691  -3.882
   65   1H2     G   6          H21         G   6  34.292  -1.119  -7.312
   66   2H2     G   6          H22         G   6  34.827  -1.722  -5.755
   67   1H5*    A   7          H5'         A   7  29.084  -0.706 -10.234
   68   2H5*    A   7          H5''        A   7  27.751  -1.857 -10.264
   69    H4*    A   7           H4'        A   7  29.721  -3.084 -10.190
   70    H3*    A   7           H3'        A   7  28.448  -3.211  -7.434
   71    H2*    A   7           H2'        A   7  30.076  -4.856  -6.992
   72   2HO*    A   7          2HO'        A   7  30.012  -5.730  -9.296
   73    H1*    A   7           H1'        A   7  32.172  -3.343  -8.107
   74    H8     A   7           H8         A   7  30.377  -0.695  -6.445
   75   1H6     A   7          H61         A   7  31.481  -1.365  -1.884
   76   2H6     A   7          H62         A   7  32.211  -2.637  -0.932
   77    H2     A   7           H2         A   7  33.204  -5.906  -3.901
   78   1H5*    G   8          H5'         G   8  28.612  -7.172  -8.449
   79   2H5*    G   8          H5''        G   8  27.125  -8.013  -8.003
   80    H4*    G   8           H4'        G   8  28.982  -9.031  -6.948
   81    H3*    G   8           H3'        G   8  27.403  -7.505  -4.867
   82    H2*    G   8           H2'        G   8  28.691  -8.782  -3.289
   83   2HO*    G   8          2HO'        G   8  29.152 -10.747  -4.550
   84    H1*    G   8           H1'        G   8  31.008  -7.874  -4.564
   85    H8     G   8           H8         G   8  28.643  -5.074  -5.095
   86    H1     G   8           H1         G   8  30.892  -5.490   0.887
   87   1H2     G   8          H21         G   8  31.979  -8.568  -0.082
   88   2H2     G   8          H22         G   8  31.912  -7.357   1.187
   89   1H5*    G   9          H5'         G   9  23.889  -9.816  -3.562
   90   2H5*    G   9          H5''        G   9  24.873  -8.361  -3.714
   91    H4*    G   9           H4'        G   9  24.154  -9.888  -1.268
   92    H3*    G   9           H3'        G   9  23.539  -7.091  -2.220
   93    H2*    G   9           H2'        G   9  23.678  -6.170  -0.149
   94   2HO*    G   9          2HO'        G   9  22.619  -8.265   0.853
   95    H1*    G   9           H1'        G   9  25.896  -7.687   0.775
   96    H8     G   9           H8         G   9  25.973  -6.589  -2.707
   97    H1     G   9           H1         G   9  26.568  -1.748   1.493
   98   1H2     G   9          H21         G   9  26.609  -4.364   3.771
   99   2H2     G   9          H22         G   9  26.663  -2.623   3.565
  100   1H5*    A  10          H5'         A  10  19.492  -6.197   0.844
  101   2H5*    A  10          H5''        A  10  21.197  -6.557   0.603
  102    H4*    A  10           H4'        A  10  19.087  -8.331   1.825
  103    H3*    A  10           H3'        A  10  21.770  -7.359   2.885
  104    H2*    A  10           H2'        A  10  21.571  -9.170   4.408
  105   2HO*    A  10          2HO'        A  10  19.211  -8.773   4.766
  106    H1*    A  10           H1'        A  10  20.306 -10.758   2.398
  107    H8     A  10           H8         A  10  23.331 -10.243   0.527
  108   1H6     A  10          H61         A  10  26.095 -14.492   4.101
  109   2H6     A  10          H62         A  10  26.149 -13.678   2.541
  110    H2     A  10           H2         A  10  22.592 -12.964   6.320
  111   1H5*    G  11          H5'         G  11  20.460  -6.801   6.912
  112   2H5*    G  11          H5''        G  11  21.531  -5.528   7.517
  113    H4*    G  11           H4'        G  11  21.974  -7.805   8.417
  114    H3*    G  11           H3'        G  11  24.335  -6.617   6.892
  115    H2*    G  11           H2'        G  11  25.513  -8.508   7.674
  116   2HO*    G  11          2HO'        G  11  24.261  -8.626   9.802
  117    H1*    G  11           H1'        G  11  23.445 -10.256   6.906
  118    H8     G  11           H8         G  11  23.430  -7.876   4.124
  119    H1     G  11           H1         G  11  28.485 -11.797   3.963
  120   1H2     G  11          H21         G  11  27.861 -12.165   7.330
  121   2H2     G  11          H22         G  11  28.925 -12.544   5.983
  122   1H5*    A  12          H5'         A  12  26.249  -7.043  10.665
  123   2H5*    A  12          H5''        A  12  27.461  -5.781  10.924
  124    H4*    A  12           H4'        A  12  28.418  -8.071  10.691
  125    H3*    A  12           H3'        A  12  29.190  -6.471   8.301
  126    H2*    A  12           H2'        A  12  30.805  -7.917   7.778
  127   2HO*    A  12          2HO'        A  12  31.185  -9.047   9.840
  128    H1*    A  12           H1'        A  12  28.781  -9.527   7.762
  129    H8     A  12           H8         A  12  27.227  -6.256   6.921
  130   1H6     A  12          H61         A  12  28.708  -7.407   1.023
  131   2H6     A  12          H62         A  12  27.523  -6.571   2.016
  132    H2     A  12           H2         A  12  31.421  -9.545   3.717
  133   1H5*    C  13          H5'         C  13  34.632  -5.815   9.855
  134   2H5*    C  13          H5''        C  13  34.320  -4.600   8.627
  135    H4*    C  13           H4'        C  13  34.229  -7.547   8.345
  136    H3*    C  13           H3'        C  13  34.903  -5.282   6.400
  137    H2*    C  13           H2'        C  13  34.774  -6.850   4.737
  138   2HO*    C  13          2HO'        C  13  35.500  -8.650   6.497
  139    H1*    C  13           H1'        C  13  32.369  -8.052   6.033
  140   1H4     C  13          H41         C  13  29.176  -3.471   2.867
  141   2H4     C  13          H42         C  13  30.189  -3.900   1.512
  142    H5     C  13           H5         C  13  29.265  -4.601   4.987
  143    H6     C  13           H6         C  13  30.664  -5.756   6.463
  144   1H5*    U  14          H5'         U  14  37.436  -8.185   4.937
  145   2H5*    U  14          H5''        U  14  38.973  -7.485   4.421
  146    H4*    U  14           H4'        U  14  37.816  -8.636   2.633
  147    H3*    U  14           H3'        U  14  37.990  -5.643   2.068
  148    H2*    U  14           H2'        U  14  37.286  -6.300  -0.097
  149   2HO*    U  14          2HO'        U  14  37.209  -8.397  -0.792
  150    H1*    U  14           H1'        U  14  35.276  -7.825   0.860
  151    H3     U  14           H3         U  14  33.137  -4.257  -0.866
  152    H5     U  14           H5         U  14  34.194  -3.106   3.052
  153    H6     U  14           H6         U  14  35.629  -5.015   3.145
  154   1H5*    C  15          H5'         C  15  39.576  -7.435  -1.218
  155   2H5*    C  15          H5''        C  15  40.906  -6.511  -1.905
  156    H4*    C  15           H4'        C  15  39.197  -6.817  -3.517
  157    H3*    C  15           H3'        C  15  39.408  -3.904  -2.694
  158    H2*    C  15           H2'        C  15  37.990  -3.489  -4.537
  159   2HO*    C  15          2HO'        C  15  38.889  -5.595  -5.698
  160    H1*    C  15           H1'        C  15  36.178  -5.426  -3.795
  161   1H4     C  15          H41         C  15  35.116  -0.344   0.316
  162   2H4     C  15          H42         C  15  34.278   0.044  -1.188
  163    H5     C  15           H5         C  15  36.396  -2.396   0.574
  164    H6     C  15           H6         C  15  37.219  -4.343  -0.556
  165   1H5*    A  16          H5'         A  16  39.879  -3.755  -6.589
  166   2H5*    A  16          H5''        A  16  41.233  -2.758  -7.143
  167    H4*    A  16           H4'        A  16  39.017  -2.011  -8.001
  168    H3*    A  16           H3'        A  16  40.410  -0.027  -6.159
  169    H2*    A  16           H2'        A  16  38.739   1.384  -6.612
  170   2HO*    A  16          2HO'        A  16  38.662   0.286  -9.102
  171    H1*    A  16           H1'        A  16  36.845  -0.845  -6.784
  172    H8     A  16           H8         A  16  38.496  -0.440  -4.170
  173   1H6     A  16          H61         A  16  36.085   2.965  -1.450
  174   2H6     A  16          H62         A  16  34.873   4.143  -1.926
  175    H2     A  16           H2         A  16  34.374   3.688  -6.365
  176   1H5*    G  17          H5'         G  17  39.778   2.028  -9.902
  177   2H5*    G  17          H5''        G  17  41.040   3.237 -10.122
  178    H4*    G  17           H4'        G  17  38.818   4.237 -10.129
  179    H3*    G  17           H3'        G  17  40.467   5.098  -7.723
  180    H2*    G  17           H2'        G  17  38.896   6.502  -7.235
  181   2HO*    G  17          2HO'        G  17  37.583   7.513  -8.640
  182    H1*    G  17           H1'        G  17  36.683   4.796  -7.940
  183    H8     G  17           H8         G  17  39.625   3.838  -5.939
  184    H1     G  17           H1         G  17  35.644   7.523  -2.615
  185   1H2     G  17          H21         G  17  34.370   8.324  -5.649
  186   2H2     G  17          H22         G  17  34.426   8.625  -3.926
  187   1H5*    A  18          H5'         A  18  42.688   9.517  -8.218
  188   2H5*    A  18          H5''        A  18  41.076   9.149  -7.677
  189    H4*    A  18           H4'        A  18  41.840  11.006  -9.915
  190    H3*    A  18           H3'        A  18  42.073  11.929  -7.513
  191    H2*    A  18           H2'        A  18  40.107  10.815  -6.764
  192   2HO*    A  18          2HO'        A  18  40.246  13.519  -6.612
  193    H1*    A  18           H1'        A  18  38.646  12.366  -8.908
  194    H8     A  18           H8         A  18  38.993   9.016  -7.205
  195   1H6     A  18          H61         A  18  34.133   7.737  -7.360
  196   2H6     A  18          H62         A  18  32.738   8.725  -7.768
  197    H2     A  18           H2         A  18  34.090  12.609  -9.297
  198   1H5*    A  19          H5'         A  19  40.952  17.139  -7.685
  199   2H5*    A  19          H5''        A  19  40.063  16.628  -6.267
  200    H4*    A  19           H4'        A  19  39.331  15.904  -9.094
  201    H3*    A  19           H3'        A  19  38.369  18.029  -7.358
  202    H2*    A  19           H2'        A  19  36.418  17.233  -6.915
  203   2HO*    A  19          2HO'        A  19  35.914  18.083  -9.135
  204    H1*    A  19           H1'        A  19  36.716  14.863  -8.738
  205    H8     A  19           H8         A  19  37.152  12.832  -6.355
  206   1H6     A  19          H61         A  19  31.803  13.420  -3.399
  207   2H6     A  19          H62         A  19  33.208  12.394  -3.680
  208    H2     A  19           H2         A  19  32.369  17.070  -5.885
  209   1H5*    G  20          H5'         G  20  37.817  21.880  -6.996
  210   2H5*    G  20          H5''        G  20  38.448  20.318  -6.472
  211    H4*    G  20           H4'        G  20  35.626  21.327  -6.055
  212    H3*    G  20           H3'        G  20  37.862  20.502  -4.132
  213    H2*    G  20           H2'        G  20  36.220  19.805  -2.622
  214   2HO*    G  20          2HO'        G  20  34.680  21.562  -2.997
  215    H1*    G  20           H1'        G  20  34.608  18.645  -4.655
  216    H8     G  20           H8         G  20  38.225  17.771  -5.220
  217    H1     G  20           H1         G  20  35.313  13.991  -1.009
  218   1H2     G  20          H21         G  20  33.153  16.682  -0.654
  219   2H2     G  20          H22         G  20  33.570  15.068  -0.115
  220   1H5*    C  21          H5'         C  21  35.864  22.364  -0.957
  221   2H5*    C  21          H5''        C  21  37.112  23.390  -0.212
  222    H4*    C  21           H4'        C  21  36.377  21.759   1.390
  223    H3*    C  21           H3'        C  21  39.151  21.058   0.331
  224    H2*    C  21           H2'        C  21  39.259  19.486   2.005
  225   2HO*    C  21          2HO'        C  21  38.078  19.573   3.833
  226    H1*    C  21           H1'        C  21  36.521  18.704   1.567
  227   1H4     C  21          H41         C  21  39.986  15.056  -2.624
  228   2H4     C  21          H42         C  21  39.802  14.118  -1.140
  229    H5     C  21           H5         C  21  39.568  17.467  -2.649
  230    H6     C  21           H6         C  21  38.495  19.278  -1.452
  231   1H5*    C  22          H5'         C  22  40.675  21.501   4.199
  232   2H5*    C  22          H5''        C  22  42.052  22.600   3.992
  233    H4*    C  22           H4'        C  22  42.966  20.676   4.896
  234    H3*    C  22           H3'        C  22  43.409  20.409   1.891
  235    H2*    C  22           H2'        C  22  44.765  18.631   2.438
  236   2HO*    C  22          2HO'        C  22  45.779  18.409   4.379
  237    H1*    C  22           H1'        C  22  43.014  17.832   4.631
  238   1H4     C  22          H41         C  22  42.250  14.929  -1.319
  239   2H4     C  22          H42         C  22  42.686  13.619  -0.254
  240    H5     C  22           H5         C  22  41.906  17.149  -0.642
  241    H6     C  22           H6         C  22  42.014  18.700   1.214
  242    H3T    C  22           H3T        C  22  45.167  21.379   3.862
  Start of MODEL    8
    1   1H5*    G   1          H5'         G   1  43.833   6.487  16.671
    2   2H5*    G   1          H5''        G   1  42.257   6.120  15.972
    3    H4*    G   1           H4'        G   1  42.783   8.423  15.608
    4    H3*    G   1           H3'        G   1  42.954   6.879  12.994
    5    H2*    G   1           H2'        G   1  43.202   8.898  11.999
    6   2HO*    G   1          2HO'        G   1  42.522  10.868  12.823
    7    H1*    G   1           H1'        G   1  44.425  10.102  14.322
    8    H8     G   1           H8         G   1  45.746   7.285  12.086
    9    H1     G   1           H1         G   1  46.831  13.212   9.929
   10   1H2     G   1          H21         G   1  45.091  14.156  12.762
   11   2H2     G   1          H22         G   1  45.847  14.662  11.262
   12    H5T    G   1           H5T        G   1  43.460   5.276  14.128
   13   1H5*    G   2          H5'         G   2  39.449   9.842  13.618
   14   2H5*    G   2          H5''        G   2  38.142   9.502  12.481
   15    H4*    G   2           H4'        G   2  38.588  11.851  12.634
   16    H3*    G   2           H3'        G   2  39.281  10.751   9.879
   17    H2*    G   2           H2'        G   2  39.564  13.036   9.273
   18   2HO*    G   2          2HO'        G   2  37.842  13.587  11.186
   19    H1*    G   2           H1'        G   2  41.180  13.557  11.510
   20    H8     G   2           H8         G   2  42.181  10.171  10.758
   21    H1     G   2           H1         G   2  44.398  14.268   6.394
   22   1H2     G   2          H21         G   2  41.824  16.280   7.438
   23   2H2     G   2          H22         G   2  43.117  16.013   6.283
   24   1H5*    C   3          H5'         C   3  36.603  13.615   9.380
   25   2H5*    C   3          H5''        C   3  35.215  13.279   8.341
   26    H4*    C   3           H4'        C   3  36.388  15.209   7.510
   27    H3*    C   3           H3'        C   3  36.681  12.760   5.752
   28    H2*    C   3           H2'        C   3  37.726  14.120   4.171
   29   2HO*    C   3          2HO'        C   3  36.645  16.149   4.458
   30    H1*    C   3           H1'        C   3  39.457  15.219   6.071
   31   1H4     C   3          H41         C   3  42.683   9.646   5.757
   32   2H4     C   3          H42         C   3  43.157  10.557   4.333
   33    H5     C   3           H5         C   3  40.740  10.288   7.107
   34    H6     C   3           H6         C   3  39.067  11.964   7.398
   35   1H5*    C   4          H5'         C   4  34.063  12.926   1.487
   36   2H5*    C   4          H5''        C   4  34.723  11.582   2.417
   37    H4*    C   4           H4'        C   4  36.078  13.403   0.489
   38    H3*    C   4           H3'        C   4  36.133  10.422   1.090
   39    H2*    C   4           H2'        C   4  38.316  10.337   0.123
   40   2HO*    C   4          2HO'        C   4  38.367  11.987  -1.452
   41    H1*    C   4           H1'        C   4  39.259  12.297   1.765
   42   1H4     C   4          H41         C   4  38.288   8.312   6.776
   43   2H4     C   4          H42         C   4  39.701   7.632   5.985
   44    H5     C   4           H5         C   4  36.824   9.883   5.723
   45    H6     C   4           H6         C   4  36.591  11.359   3.864
   46   1H5*    U   5          H5'         U   5  36.945  10.183  -2.937
   47   2H5*    U   5          H5''        U   5  35.830   9.127  -3.827
   48    H4*    U   5           H4'        U   5  38.034   8.249  -4.054
   49    H3*    U   5           H3'        U   5  36.430   6.497  -2.128
   50    H2*    U   5           H2'        U   5  38.242   5.041  -2.150
   51   2HO*    U   5          2HO'        U   5  39.206   5.241  -4.218
   52    H1*    U   5           H1'        U   5  40.021   7.065  -1.481
   53    H3     U   5           H3         U   5  38.627   4.679   2.311
   54    H5     U   5           H5         U   5  36.402   8.211   2.182
   55    H6     U   5           H6         U   5  37.180   8.504  -0.023
   56   1H5*    G   6          H5'         G   6  37.505   3.664  -4.604
   57   2H5*    G   6          H5''        G   6  36.097   2.862  -5.322
   58    H4*    G   6           H4'        G   6  37.482   1.232  -4.291
   59    H3*    G   6           H3'        G   6  34.953   1.680  -2.662
   60    H2*    G   6           H2'        G   6  35.583  -0.240  -1.508
   61   2HO*    G   6          2HO'        G   6  37.250  -1.578  -2.102
   62    H1*    G   6           H1'        G   6  38.081   0.621  -1.121
   63    H8     G   6           H8         G   6  36.225   3.841  -0.729
   64    H1     G   6           H1         G   6  35.778  -0.263   4.201
   65   1H2     G   6          H21         G   6  37.164  -2.475   1.907
   66   2H2     G   6          H22         G   6  36.518  -2.262   3.521
   67   1H5*    A   7          H5'         A   7  35.262  -2.346  -3.639
   68   2H5*    A   7          H5''        A   7  33.717  -3.011  -4.156
   69    H4*    A   7           H4'        A   7  34.676  -4.414  -2.494
   70    H3*    A   7           H3'        A   7  32.226  -2.964  -1.439
   71    H2*    A   7           H2'        A   7  32.388  -4.399   0.402
   72   2HO*    A   7          2HO'        A   7  33.763  -6.160   0.505
   73    H1*    A   7           H1'        A   7  35.132  -3.949   0.733
   74    H8     A   7           H8         A   7  34.129  -0.617  -0.197
   75   1H6     A   7          H61         A   7  32.467   1.045   3.892
   76   2H6     A   7          H62         A   7  31.983   0.373   5.434
   77    H2     A   7           H2         A   7  32.467  -4.103   4.949
   78   1H5*    G   8          H5'         G   8  31.441  -6.817  -0.905
   79   2H5*    G   8          H5''        G   8  29.819  -7.282  -1.410
   80    H4*    G   8           H4'        G   8  30.103  -7.885   0.840
   81    H3*    G   8           H3'        G   8  28.355  -5.412   0.742
   82    H2*    G   8           H2'        G   8  27.853  -5.948   3.034
   83   2HO*    G   8          2HO'        G   8  28.186  -8.352   2.884
   84    H1*    G   8           H1'        G   8  30.582  -6.006   3.563
   85    H8     G   8           H8         G   8  30.106  -3.523   0.766
   86    H1     G   8           H1         G   8  28.851  -1.276   6.644
   87   1H2     G   8          H21         G   8  28.701  -4.576   7.502
   88   2H2     G   8          H22         G   8  28.569  -2.912   8.047
   89   1H5*    G   9          H5'         G   9  25.474  -6.949   3.661
   90   2H5*    G   9          H5''        G   9  24.082  -7.504   2.726
   91    H4*    G   9           H4'        G   9  23.298  -5.777   3.839
   92    H3*    G   9           H3'        G   9  24.111  -4.478   1.211
   93    H2*    G   9           H2'        G   9  23.074  -2.556   1.914
   94   2HO*    G   9          2HO'        G   9  22.043  -3.055   4.344
   95    H1*    G   9           H1'        G   9  23.984  -2.856   4.630
   96    H8     G   9           H8         G   9  26.014  -3.574   1.666
   97    H1     G   9           H1         G   9  26.104   2.597   3.525
   98   1H2     G   9          H21         G   9  23.891   1.382   5.940
   99   2H2     G   9          H22         G   9  24.742   2.791   5.338
  100   1H5*    A  10          H5'         A  10  19.307  -3.037  -0.372
  101   2H5*    A  10          H5''        A  10  20.587  -3.018   0.839
  102    H4*    A  10           H4'        A  10  17.859  -4.276   1.058
  103    H3*    A  10           H3'        A  10  19.395  -2.251   2.766
  104    H2*    A  10           H2'        A  10  18.226  -3.032   4.586
  105   2HO*    A  10          2HO'        A  10  16.118  -2.883   3.517
  106    H1*    A  10           H1'        A  10  17.860  -5.669   3.470
  107    H8     A  10           H8         A  10  21.349  -5.870   3.630
  108   1H6     A  10          H61         A  10  21.840  -7.432   8.242
  109   2H6     A  10          H62         A  10  20.785  -7.355   9.648
  110    H2     A  10           H2         A  10  17.172  -5.051   8.457
  111   1H5*    G  11          H5'         G  11  18.306   1.689   4.440
  112   2H5*    G  11          H5''        G  11  19.376   0.271   4.388
  113    H4*    G  11           H4'        G  11  16.987   0.598   6.215
  114    H3*    G  11           H3'        G  11  19.980   0.766   6.766
  115    H2*    G  11           H2'        G  11  19.583  -0.187   8.862
  116   2HO*    G  11          2HO'        G  11  16.845   0.313   8.236
  117    H1*    G  11           H1'        G  11  17.969  -2.234   7.787
  118    H8     G  11           H8         G  11  20.381  -1.955   5.132
  119    H1     G  11           H1         G  11  22.682  -4.867  10.364
  120   1H2     G  11          H21         G  11  21.310  -4.517  12.072
  121   2H2     G  11          H22         G  11  19.910  -3.471  11.899
  122   1H5*    A  12          H5'         A  12  21.099   4.108  10.611
  123   2H5*    A  12          H5''        A  12  22.033   3.130   9.487
  124    H4*    A  12           H4'        A  12  20.871   2.345  12.143
  125    H3*    A  12           H3'        A  12  23.443   1.702  10.742
  126    H2*    A  12           H2'        A  12  24.018   0.135  12.188
  127   2HO*    A  12          2HO'        A  12  21.800   1.187  13.564
  128    H1*    A  12           H1'        A  12  21.864  -0.918  11.442
  129    H8     A  12           H8         A  12  22.267   1.134   8.561
  130   1H6     A  12          H61         A  12  26.589  -2.684   6.236
  131   2H6     A  12          H62         A  12  25.466  -1.424   5.753
  132    H2     A  12           H2         A  12  26.115  -3.363  10.485
  133   1H5*    C  13          H5'         C  13  25.982   3.172  13.936
  134   2H5*    C  13          H5''        C  13  27.597   3.545  13.349
  135    H4*    C  13           H4'        C  13  26.948   1.182  14.402
  136    H3*    C  13           H3'        C  13  28.937   1.396  12.113
  137    H2*    C  13           H2'        C  13  29.048  -0.922  12.185
  138   2HO*    C  13          2HO'        C  13  28.629  -1.649  14.266
  139    H1*    C  13           H1'        C  13  26.089  -1.089  11.911
  140   1H4     C  13          H41         C  13  27.100   1.694   6.173
  141   2H4     C  13          H42         C  13  28.469   0.614   6.051
  142    H5     C  13           H5         C  13  25.538   1.602   8.068
  143    H6     C  13           H6         C  13  25.405   1.178  10.344
  144   1H5*    U  14          H5'         U  14  30.723  -1.365  14.506
  145   2H5*    U  14          H5''        U  14  32.472  -1.210  14.727
  146    H4*    U  14           H4'        U  14  31.856  -3.288  13.643
  147    H3*    U  14           H3'        U  14  33.396  -1.470  11.739
  148    H2*    U  14           H2'        U  14  33.376  -3.412  10.297
  149   2HO*    U  14          2HO'        U  14  33.057  -4.849  12.472
  150    H1*    U  14           H1'        U  14  30.775  -3.607  10.379
  151    H3     U  14           H3         U  14  31.773  -1.187   6.576
  152    H5     U  14           H5         U  14  30.842   1.627   9.538
  153    H6     U  14           H6         U  14  30.905  -0.113  11.101
  154   1H5*    C  15          H5'         C  15  35.217  -4.998  11.591
  155   2H5*    C  15          H5''        C  15  36.981  -4.935  11.599
  156    H4*    C  15           H4'        C  15  36.159  -6.081   9.639
  157    H3*    C  15           H3'        C  15  37.543  -3.443   9.061
  158    H2*    C  15           H2'        C  15  37.383  -4.000   6.779
  159   2HO*    C  15          2HO'        C  15  37.427  -6.399   7.001
  160    H1*    C  15           H1'        C  15  34.723  -4.428   6.906
  161   1H4     C  15          H41         C  15  34.627   2.104   7.562
  162   2H4     C  15          H42         C  15  35.203   1.784   5.931
  163    H5     C  15           H5         C  15  34.471   0.296   9.242
  164    H6     C  15           H6         C  15  34.611  -2.058   9.532
  165   1H5*    A  16          H5'         A  16  39.546  -5.499   6.745
  166   2H5*    A  16          H5''        A  16  41.304  -5.362   6.867
  167    H4*    A  16           H4'        A  16  40.421  -4.557   4.700
  168    H3*    A  16           H3'        A  16  41.591  -2.346   6.423
  169    H2*    A  16           H2'        A  16  41.366  -1.007   4.651
  170   2HO*    A  16          2HO'        A  16  40.923  -1.713   2.468
  171    H1*    A  16           H1'        A  16  38.933  -2.488   3.920
  172    H8     A  16           H8         A  16  39.102  -1.090   6.701
  173   1H6     A  16          H61         A  16  38.101   3.732   5.980
  174   2H6     A  16          H62         A  16  38.189   4.706   4.518
  175    H2     A  16           H2         A  16  39.427   1.891   1.242
  176   1H5*    G  17          H5'         G  17  43.817  -2.246   3.068
  177   2H5*    G  17          H5''        G  17  45.460  -1.751   3.423
  178    H4*    G  17           H4'        G  17  44.546  -0.227   1.914
  179    H3*    G  17           H3'        G  17  44.688   1.143   4.626
  180    H2*    G  17           H2'        G  17  44.416   2.988   3.482
  181   2HO*    G  17          2HO'        G  17  45.352   3.178   1.528
  182    H1*    G  17           H1'        G  17  42.385   1.877   1.756
  183    H8     G  17           H8         G  17  42.589   1.396   5.349
  184    H1     G  17           H1         G  17  40.781   7.395   4.081
  185   1H2     G  17          H21         G  17  41.626   6.680   0.883
  186   2H2     G  17          H22         G  17  41.131   7.855   2.086
  187   1H5*    A  18          H5'         A  18  49.990   2.008   3.800
  188   2H5*    A  18          H5''        A  18  49.681   3.282   4.960
  189    H4*    A  18           H4'        A  18  50.957   3.623   2.762
  190    H3*    A  18           H3'        A  18  50.322   5.561   4.416
  191    H2*    A  18           H2'        A  18  48.164   5.525   3.789
  192   2HO*    A  18          2HO'        A  18  49.045   7.651   2.074
  193    H1*    A  18           H1'        A  18  48.931   5.827   0.884
  194    H8     A  18           H8         A  18  46.258   4.870   3.424
  195   1H6     A  18          H61         A  18  42.325   5.458  -1.401
  196   2H6     A  18          H62         A  18  42.450   5.230   0.342
  197    H2     A  18           H2         A  18  46.463   5.484  -2.974
  198   1H5*    A  19          H5'         A  19  51.503   9.396   0.195
  199   2H5*    A  19          H5''        A  19  50.005   9.618   1.123
  200    H4*    A  19           H4'        A  19  50.232   8.010  -1.414
  201    H3*    A  19           H3'        A  19  49.789  10.855  -1.196
  202    H2*    A  19           H2'        A  19  47.712  10.911  -1.781
  203   2HO*    A  19          2HO'        A  19  48.769  10.358  -4.011
  204    H1*    A  19           H1'        A  19  47.457   7.965  -2.250
  205    H8     A  19           H8         A  19  46.128   8.012   0.856
  206   1H6     A  19          H61         A  19  41.546   9.649   0.240
  207   2H6     A  19          H62         A  19  40.781  10.551  -1.058
  208    H2     A  19           H2         A  19  43.972  11.699  -3.933
  209   1H5*    G  20          H5'         G  20  50.910  14.330  -2.323
  210   2H5*    G  20          H5''        G  20  50.212  13.130  -1.233
  211    H4*    G  20           H4'        G  20  48.718  14.770  -3.285
  212    H3*    G  20           H3'        G  20  48.550  14.747  -0.238
  213    H2*    G  20           H2'        G  20  46.293  15.507  -0.531
  214   2HO*    G  20          2HO'        G  20  46.388  16.717  -2.527
  215    H1*    G  20           H1'        G  20  45.758  13.413  -2.225
  216    H8     G  20           H8         G  20  48.450  12.184   0.110
  217    H1     G  20           H1         G  20  42.725  12.360   2.919
  218   1H2     G  20          H21         G  20  41.817  14.455   0.404
  219   2H2     G  20          H22         G  20  41.394  13.645   1.897
  220   1H5*    C  21          H5'         C  21  46.830  18.218  -1.065
  221   2H5*    C  21          H5''        C  21  47.421  19.624  -0.155
  222    H4*    C  21           H4'        C  21  45.050  19.368   0.245
  223    H3*    C  21           H3'        C  21  46.753  18.591   2.657
  224    H2*    C  21           H2'        C  21  44.776  18.345   3.863
  225   2HO*    C  21          2HO'        C  21  42.739  18.895   3.050
  226    H1*    C  21           H1'        C  21  43.576  16.809   1.865
  227   1H4     C  21          H41         C  21  47.684  12.464   4.514
  228   2H4     C  21          H42         C  21  46.298  12.491   5.589
  229    H5     C  21           H5         C  21  48.001  14.049   2.758
  230    H6     C  21           H6         C  21  47.012  15.863   1.580
  231   1H5*    C  22          H5'         C  22  44.840  20.789   5.018
  232   2H5*    C  22          H5''        C  22  45.948  22.011   5.674
  233    H4*    C  22           H4'        C  22  45.223  20.757   7.517
  234    H3*    C  22           H3'        C  22  47.954  19.639   6.742
  235    H2*    C  22           H2'        C  22  47.859  18.442   8.633
  236   2HO*    C  22          2HO'        C  22  47.180  19.484  10.417
  237    H1*    C  22           H1'        C  22  44.940  18.152   8.482
  238   1H4     C  22          H41         C  22  48.876  13.086   6.650
  239   2H4     C  22          H42         C  22  48.088  12.573   8.123
  240    H5     C  22           H5         C  22  48.572  15.261   5.674
  241    H6     C  22           H6         C  22  47.330  17.352   5.867
  242    H3T    C  22           H3T        C  22  47.315  21.563   8.688
  Start of MODEL    9
    1   1H5*    G   1          H5'         G   1  40.162  -1.707  16.972
    2   2H5*    G   1          H5''        G   1  39.060  -2.618  15.943
    3    H4*    G   1           H4'        G   1  38.071  -0.545  16.575
    4    H3*    G   1           H3'        G   1  38.802  -0.477  13.618
    5    H2*    G   1           H2'        G   1  37.571   1.437  13.598
    6   2HO*    G   1          2HO'        G   1  35.754   1.551  14.751
    7    H1*    G   1           H1'        G   1  38.306   2.228  16.212
    8    H8     G   1           H8         G   1  40.574   1.472  13.254
    9    H1     G   1           H1         G   1  38.492   7.510  13.572
   10   1H2     G   1          H21         G   1  36.271   6.220  15.868
   11   2H2     G   1          H22         G   1  36.784   7.617  14.945
   12    H5T    G   1           H5T        G   1  41.266  -2.625  15.206
   13   1H5*    G   2          H5'         G   2  34.289  -0.237  14.637
   14   2H5*    G   2          H5''        G   2  33.317  -0.515  13.197
   15    H4*    G   2           H4'        G   2  32.703   1.477  14.444
   16    H3*    G   2           H3'        G   2  33.590   2.108  11.606
   17    H2*    G   2           H2'        G   2  32.693   4.292  12.096
   18   2HO*    G   2          2HO'        G   2  30.935   3.950  13.488
   19    H1*    G   2           H1'        G   2  34.082   4.465  14.447
   20    H8     G   2           H8         G   2  36.454   2.577  12.432
   21    H1     G   2           H1         G   2  36.219   8.688  10.634
   22   1H2     G   2          H21         G   2  33.338   8.812  12.458
   23   2H2     G   2          H22         G   2  34.495   9.664  11.442
   24   1H5*    C   3          H5'         C   3  29.694   3.250  11.756
   25   2H5*    C   3          H5''        C   3  28.728   2.902  10.321
   26    H4*    C   3           H4'        C   3  28.832   5.276  10.688
   27    H3*    C   3           H3'        C   3  30.470   4.483   8.249
   28    H2*    C   3           H2'        C   3  30.696   6.804   7.838
   29   2HO*    C   3          2HO'        C   3  28.587   7.503   8.762
   30    H1*    C   3           H1'        C   3  31.561   7.273  10.433
   31   1H4     C   3          H41         C   3  36.751   4.118   7.789
   32   2H4     C   3          H42         C   3  36.868   5.794   7.257
   33    H5     C   3           H5         C   3  34.849   3.340   9.112
   34    H6     C   3           H6         C   3  32.733   3.940   9.968
   35   1H5*    C   4          H5'         C   4  28.474   7.176   6.528
   36   2H5*    C   4          H5''        C   4  27.331   6.552   5.332
   37    H4*    C   4           H4'        C   4  28.607   8.325   4.370
   38    H3*    C   4           H3'        C   4  29.124   5.580   3.192
   39    H2*    C   4           H2'        C   4  30.571   6.582   1.656
   40   2HO*    C   4          2HO'        C   4  29.875   8.648   1.204
   41    H1*    C   4           H1'        C   4  32.058   7.883   3.589
   42   1H4     C   4          H41         C   4  33.462   1.585   5.146
   43   2H4     C   4          H42         C   4  34.156   1.697   3.536
   44    H5     C   4           H5         C   4  32.325   3.388   6.209
   45    H6     C   4           H6         C   4  31.404   5.560   5.946
   46   1H5*    U   5          H5'         U   5  27.843   7.753  -0.031
   47   2H5*    U   5          H5''        U   5  26.614   6.979  -1.042
   48    H4*    U   5           H4'        U   5  28.621   7.380  -2.310
   49    H3*    U   5           H3'        U   5  28.242   4.391  -1.795
   50    H2*    U   5           H2'        U   5  29.998   4.103  -3.311
   51   2HO*    U   5          2HO'        U   5  31.136   5.919  -4.223
   52    H1*    U   5           H1'        U   5  31.630   5.811  -1.845
   53    H3     U   5           H3         U   5  32.377   1.307  -0.800
   54    H5     U   5           H5         U   5  30.041   2.944   2.247
   55    H6     U   5           H6         U   5  29.625   4.779   0.840
   56   1H5*    G   6          H5'         G   6  28.520   4.452  -5.637
   57   2H5*    G   6          H5''        G   6  27.266   3.544  -6.483
   58    H4*    G   6           H4'        G   6  29.418   2.750  -7.073
   59    H3*    G   6           H3'        G   6  27.947   0.687  -5.380
   60    H2*    G   6           H2'        G   6  29.673  -0.783  -6.084
   61   2HO*    G   6          2HO'        G   6  29.965   0.801  -8.159
   62    H1*    G   6           H1'        G   6  31.610   0.924  -5.333
   63    H8     G   6           H8         G   6  29.010   1.635  -2.718
   64    H1     G   6           H1         G   6  32.119  -3.946  -2.044
   65   1H2     G   6          H21         G   6  33.102  -3.341  -5.314
   66   2H2     G   6          H22         G   6  33.089  -4.472  -3.969
   67   1H5*    A   7          H5'         A   7  28.994  -1.041  -8.988
   68   2H5*    A   7          H5''        A   7  27.725  -2.080  -9.639
   69    H4*    A   7           H4'        A   7  29.848  -3.241  -9.500
   70    H3*    A   7           H3'        A   7  27.722  -4.364  -7.641
   71    H2*    A   7           H2'        A   7  29.199  -6.106  -7.260
   72   2HO*    A   7          2HO'        A   7  30.203  -5.600  -9.665
   73    H1*    A   7           H1'        A   7  31.408  -4.427  -6.893
   74    H8     A   7           H8         A   7  29.097  -2.481  -5.106
   75   1H6     A   7          H61         A   7  28.757  -4.882  -0.981
   76   2H6     A   7          H62         A   7  29.175  -6.492  -0.428
   77    H2     A   7           H2         A   7  30.728  -8.616  -4.140
   78   1H5*    G   8          H5'         G   8  28.868  -7.301 -10.178
   79   2H5*    G   8          H5''        G   8  27.555  -8.262 -10.849
   80    H4*    G   8           H4'        G   8  29.254  -9.609  -9.755
   81    H3*    G   8           H3'        G   8  26.540  -9.732  -8.380
   82    H2*    G   8           H2'        G   8  27.488 -11.555  -7.152
   83   2HO*    G   8          2HO'        G   8  28.946 -12.032  -9.209
   84    H1*    G   8           H1'        G   8  29.805 -10.083  -6.610
   85    H8     G   8           H8         G   8  27.230  -7.503  -6.334
   86    H1     G   8           H1         G   8  27.942 -11.239  -1.173
   87   1H2     G   8          H21         G   8  29.082 -13.603  -3.359
   88   2H2     G   8          H22         G   8  28.676 -13.194  -1.699
   89   1H5*    G   9          H5'         G   9  25.993 -13.223  -8.586
   90   2H5*    G   9          H5''        G   9  24.364 -13.606  -9.173
   91    H4*    G   9           H4'        G   9  24.446 -14.039  -6.837
   92    H3*    G   9           H3'        G   9  22.960 -11.429  -7.260
   93    H2*    G   9           H2'        G   9  22.374 -11.612  -4.934
   94   2HO*    G   9          2HO'        G   9  22.648 -13.499  -3.814
   95    H1*    G   9           H1'        G   9  25.016 -12.087  -4.279
   96    H8     G   9           H8         G   9  24.314  -9.952  -7.174
   97    H1     G   9           H1         G   9  22.658  -7.034  -1.766
   98   1H2     G   9          H21         G   9  23.404 -10.088  -0.322
   99   2H2     G   9          H22         G   9  22.729  -8.488  -0.113
  100   1H5*    A  10          H5'         A  10  18.608 -10.804  -8.065
  101   2H5*    A  10          H5''        A  10  19.233  -9.656  -6.884
  102    H4*    A  10           H4'        A  10  17.209 -10.728  -6.129
  103    H3*    A  10           H3'        A  10  19.589 -11.429  -4.364
  104    H2*    A  10           H2'        A  10  17.964 -12.417  -2.927
  105   2HO*    A  10          2HO'        A  10  16.104 -11.096  -3.111
  106    H1*    A  10           H1'        A  10  16.745 -13.761  -5.025
  107    H8     A  10           H8         A  10  20.489 -13.756  -5.765
  108   1H6     A  10          H61         A  10  20.363 -19.080  -2.470
  109   2H6     A  10          H62         A  10  21.285 -18.174  -3.663
  110    H2     A  10           H2         A  10  16.795 -16.695  -1.396
  111   1H5*    G  11          H5'         G  11  18.906  -9.191   0.373
  112   2H5*    G  11          H5''        G  11  20.060 -10.326  -0.313
  113    H4*    G  11           H4'        G  11  17.499 -10.927   1.107
  114    H3*    G  11           H3'        G  11  20.395 -11.698   1.498
  115    H2*    G  11           H2'        G  11  19.891 -13.887   1.992
  116   2HO*    G  11          2HO'        G  11  17.872 -13.287   3.240
  117    H1*    G  11           H1'        G  11  18.088 -14.405   0.054
  118    H8     G  11           H8         G  11  20.156 -12.094  -1.809
  119    H1     G  11           H1         G  11  22.947 -17.820  -1.006
  120   1H2     G  11          H21         G  11  21.865 -18.973   0.533
  121   2H2     G  11          H22         G  11  20.514 -18.270   1.398
  122   1H5*    A  12          H5'         A  12  19.601 -13.877   4.746
  123   2H5*    A  12          H5''        A  12  20.667 -13.361   6.068
  124    H4*    A  12           H4'        A  12  21.231 -15.622   5.368
  125    H3*    A  12           H3'        A  12  23.307 -13.846   4.186
  126    H2*    A  12           H2'        A  12  24.690 -15.512   3.828
  127   2HO*    A  12          2HO'        A  12  23.786 -17.079   5.509
  128    H1*    A  12           H1'        A  12  22.618 -16.389   2.495
  129    H8     A  12           H8         A  12  22.592 -12.687   2.522
  130   1H6     A  12          H61         A  12  25.951 -12.562  -2.544
  131   2H6     A  12          H62         A  12  24.585 -11.751  -1.787
  132    H2     A  12           H2         A  12  26.787 -16.161  -0.155
  133   1H5*    C  13          H5'         C  13  27.403 -15.878   7.097
  134   2H5*    C  13          H5''        C  13  27.631 -14.197   6.565
  135    H4*    C  13           H4'        C  13  28.151 -16.743   5.168
  136    H3*    C  13           H3'        C  13  29.094 -13.929   4.443
  137    H2*    C  13           H2'        C  13  29.908 -14.942   2.446
  138   2HO*    C  13          2HO'        C  13  30.310 -17.129   2.751
  139    H1*    C  13           H1'        C  13  27.105 -15.909   2.097
  140   1H4     C  13          H41         C  13  25.411  -9.897   1.213
  141   2H4     C  13          H42         C  13  26.604  -9.907  -0.072
  142    H5     C  13           H5         C  13  25.056 -11.683   2.647
  143    H6     C  13           H6         C  13  25.810 -13.590   3.594
  144   1H5*    U  14          H5'         U  14  32.172 -15.419   2.981
  145   2H5*    U  14          H5''        U  14  33.697 -14.635   3.396
  146    H4*    U  14           H4'        U  14  32.976 -14.594   1.006
  147    H3*    U  14           H3'        U  14  33.491 -11.826   2.190
  148    H2*    U  14           H2'        U  14  33.439 -11.183  -0.107
  149   2HO*    U  14          2HO'        U  14  34.037 -13.757  -0.614
  150    H1*    U  14           H1'        U  14  31.164 -12.613  -0.571
  151    H3     U  14           H3         U  14  29.994  -8.238  -0.850
  152    H5     U  14           H5         U  14  29.877  -9.107   3.266
  153    H6     U  14           H6         U  14  30.932 -11.190   2.778
  154   1H5*    C  15          H5'         C  15  35.903 -12.403  -1.216
  155   2H5*    C  15          H5''        C  15  37.418 -11.515  -1.123
  156    H4*    C  15           H4'        C  15  36.128 -10.993  -3.105
  157    H3*    C  15           H3'        C  15  36.529  -8.604  -1.269
  158    H2*    C  15           H2'        C  15  35.768  -7.352  -3.116
  159   2HO*    C  15          2HO'        C  15  36.666  -8.948  -4.775
  160    H1*    C  15           H1'        C  15  33.592  -9.044  -3.532
  161   1H4     C  15          H41         C  15  31.681  -5.322   1.550
  162   2H4     C  15          H42         C  15  31.569  -4.233   0.178
  163    H5     C  15           H5         C  15  32.631  -7.515   1.417
  164    H6     C  15           H6         C  15  33.556  -9.165  -0.050
  165   1H5*    A  16          H5'         A  16  37.990  -7.563  -4.705
  166   2H5*    A  16          H5''        A  16  39.536  -6.737  -4.771
  167    H4*    A  16           H4'        A  16  37.503  -5.527  -5.765
  168    H3*    A  16           H3'        A  16  39.416  -4.157  -3.861
  169    H2*    A  16           H2'        A  16  37.902  -2.634  -3.373
  170   2HO*    A  16          2HO'        A  16  38.047  -1.667  -5.552
  171    H1*    A  16           H1'        A  16  35.626  -4.034  -4.550
  172    H8     A  16           H8         A  16  36.519  -4.763  -1.664
  173   1H6     A  16          H61         A  16  33.749  -1.881   1.346
  174   2H6     A  16          H62         A  16  32.905  -0.382   1.000
  175    H2     A  16           H2         A  16  33.795   0.641  -3.277
  176   1H5*    G  17          H5'         G  17  41.102   0.104  -5.448
  177   2H5*    G  17          H5''        G  17  40.692  -0.874  -4.026
  178    H4*    G  17           H4'        G  17  38.667   0.838  -5.477
  179    H3*    G  17           H3'        G  17  40.607   1.577  -3.273
  180    H2*    G  17           H2'        G  17  38.996   2.117  -1.910
  181   2HO*    G  17          2HO'        G  17  38.522   3.850  -3.843
  182    H1*    G  17           H1'        G  17  36.738   1.156  -3.626
  183    H8     G  17           H8         G  17  38.628  -0.820  -1.216
  184    H1     G  17           H1         G  17  34.378   2.882   1.781
  185   1H2     G  17          H21         G  17  34.366   4.593  -1.180
  186   2H2     G  17          H22         G  17  33.860   4.519   0.506
  187   1H5*    A  18          H5'         A  18  42.407   6.146  -4.704
  188   2H5*    A  18          H5''        A  18  43.496   5.123  -3.774
  189    H4*    A  18           H4'        A  18  43.157   7.207  -2.720
  190    H3*    A  18           H3'        A  18  43.135   4.991  -1.092
  191    H2*    A  18           H2'        A  18  40.894   4.826  -1.373
  192   2HO*    A  18          2HO'        A  18  41.907   5.634   1.059
  193    H1*    A  18           H1'        A  18  40.803   7.755  -0.611
  194    H8     A  18           H8         A  18  38.896   4.672  -1.003
  195   1H6     A  18          H61         A  18  34.371   6.630  -0.390
  196   2H6     A  18          H62         A  18  33.821   8.293  -0.492
  197    H2     A  18           H2         A  18  37.353  10.881  -1.178
  198   1H5*    A  19          H5'         A  19  45.339   9.324   2.385
  199   2H5*    A  19          H5''        A  19  43.992   8.256   2.707
  200    H4*    A  19           H4'        A  19  44.135  10.062   0.299
  201    H3*    A  19           H3'        A  19  44.133  11.450   2.478
  202    H2*    A  19           H2'        A  19  42.513   9.719   3.522
  203   2HO*    A  19          2HO'        A  19  40.674  11.705   3.032
  204    H1*    A  19           H1'        A  19  40.717  10.459   1.221
  205    H8     A  19           H8         A  19  41.895   7.168   2.884
  206   1H6     A  19          H61         A  19  37.548   5.373   4.167
  207   2H6     A  19          H62         A  19  35.917   6.016   4.041
  208    H2     A  19           H2         A  19  36.192  10.023   2.169
  209   1H5*    G  20          H5'         G  20  40.992  15.649   2.942
  210   2H5*    G  20          H5''        G  20  41.441  14.191   3.839
  211    H4*    G  20           H4'        G  20  38.802  14.676   2.430
  212    H3*    G  20           H3'        G  20  39.375  14.297   5.416
  213    H2*    G  20           H2'        G  20  37.107  13.643   5.547
  214   2HO*    G  20          2HO'        G  20  36.338  15.202   3.825
  215    H1*    G  20           H1'        G  20  37.506  12.046   3.176
  216    H8     G  20           H8         G  20  40.384  11.598   5.540
  217    H1     G  20           H1         G  20  35.328   7.972   6.849
  218   1H2     G  20          H21         G  20  33.500  10.514   5.497
  219   2H2     G  20          H22         G  20  33.516   9.052   6.475
  220   1H5*    C  21          H5'         C  21  35.867  16.341   5.830
  221   2H5*    C  21          H5''        C  21  35.966  17.448   7.207
  222    H4*    C  21           H4'        C  21  34.221  15.875   7.571
  223    H3*    C  21           H3'        C  21  36.548  15.223   9.421
  224    H2*    C  21           H2'        C  21  35.011  13.795  10.510
  225   2HO*    C  21          2HO'        C  21  32.994  14.988  10.243
  226    H1*    C  21           H1'        C  21  34.176  12.719   8.068
  227   1H4     C  21          H41         C  21  39.855   9.628   8.877
  228   2H4     C  21          H42         C  21  38.641   8.593   9.613
  229    H5     C  21           H5         C  21  39.447  11.925   8.325
  230    H6     C  21           H6         C  21  37.722  13.563   7.958
  231   1H5*    C  22          H5'         C  22  33.938  15.515  12.234
  232   2H5*    C  22          H5''        C  22  34.522  16.520  13.567
  233    H4*    C  22           H4'        C  22  34.068  14.337  14.400
  234    H3*    C  22           H3'        C  22  37.076  14.684  14.148
  235    H2*    C  22           H2'        C  22  37.259  12.737  15.296
  236   2HO*    C  22          2HO'        C  22  35.361  11.710  16.333
  237    H1*    C  22           H1'        C  22  34.824  11.646  14.052
  238   1H4     C  22          H41         C  22  40.778   9.825  11.647
  239   2H4     C  22          H42         C  22  40.095   8.377  12.355
  240    H5     C  22           H5         C  22  39.675  11.935  11.652
  241    H6     C  22           H6         C  22  37.651  13.122  12.329
  242    H3T    C  22           H3T        C  22  36.812  15.237  16.381