*HEADER    RNA                                     01-MAR-10   2KUW              
*TITLE     SOLUTION STRUCTURE OF K10 TLS RNA (A-FORM MUTANT IN LOWER HELIX)      
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: K10 TLS RNA;                                               
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 ENGINEERED: YES;                                                     
*COMPND   5 MUTATION: YES;                                                       
*COMPND   6 OTHER_DETAILS: THE WILD-TYPE SEQUENCE OF K10 TLS RNA IS              
*COMPND   7  GGCUUGAUUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAAUUAAGCC  THE MUTATION IN   
*COMPND   8 THE A-FORM MUTANT IN LOWER HELIX RNA ARE: C3G, U4G, G6U, A7G, U8G,   
*COMPND   9 A41U, U42C, U43A, A44G, A45C, G46U                                   
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES;                                                      
*SOURCE   3 ORGANISM_SCIENTIFIC: DROSOPHILA MELANOGASTER;                        
*SOURCE   4 ORGANISM_COMMON: FRUIT FLY;                                          
*SOURCE   5 ORGANISM_TAXID: 7227;                                                
*SOURCE   6 OTHER_DETAILS: PREPARED BY IN VITRO TRANSCRIPTION USING T7 RNA       
*SOURCE   7 POLYMERASE                                                           
*KEYWDS    RNA TRANSPORT, RNA HAIRPIN, RNA                                       
*EXPDTA    SOLUTION NMR                                                          
*NUMMDL    11                                                                    
*AUTHOR    S.L.BULLOCK, I.RINGEL, D.ISH-HOROWICZ, P.J.LUKAVSKY                   
*REVDAT   1   19-MAY-10 2KUW    0                                                


{NOE-D2O}
assign (residue 10 and name h2'') (residue 11 and name h6) 1.8 0.4 1.2
assign (residue 11 and name h2'') (residue 12 and name h8) 1.8 0.4 1.2
assign (residue 12 and name h2'') (residue 13 and name h6) 1.8 0.4 1.2
assign (residue 13 and name h1') (residue 12 and name h2) 1.8 0.4 1.2
assign (residue 13 and name h2'') (residue 14 and name h6) 1.8 0.4 1.2
assign (residue 14 and name h2'') (residue 15 and name h6) 1.8 0.4 1.2
assign (residue 15 and name h2'') (residue 16 and name h6) 1.8 0.4 1.2
assign (residue 16 and name h2'') (residue 17 and name h6) 1.8 0.4 1.2
assign (residue 17 and name h2'') (residue 18 and name h8) 1.8 0.4 1.2
assign (residue 18 and name h2'') (residue 19 and name h8) 1.8 0.4 1.2
assign (residue 19 and name h2'') (residue 20 and name h8) 1.8 0.4 1.2
assign (residue 1 and name h2'') (residue 2 and name h8) 1.8 0.4 1.2
assign (residue 20 and name h2'') (residue 21 and name h6) 1.8 0.4 1.2
assign (residue 21 and name h2'') (residue 22 and name h6) 1.8 0.4 1.2
assign (residue 26 and name h2'') (residue 27 and name h6) 1.8 0.4 1.2
assign (residue 27 and name h2'') (residue 28 and name h6) 1.8 0.4 1.2
assign (residue 29 and name h2'') (residue 30 and name h8) 1.8 0.4 1.2
assign (residue 2 and name h2'') (residue 3 and name h8) 1.8 0.4 1.2
assign (residue 30 and name h1') (residue 18 and name h2) 1.8 0.4 1.2
assign (residue 30 and name h2'') (residue 31 and name h8) 1.8 0.4 1.2
assign (residue 31 and name h2'') (residue 32 and name h8) 1.8 0.4 1.2
assign (residue 32 and name h2'') (residue 33 and name h8) 1.8 0.4 1.2
assign (residue 33 and name h2'') (residue 34 and name h8) 1.8 0.4 1.2
assign (residue 36 and name h2'') (residue 37 and name h8) 1.8 0.4 1.2
assign (residue 37 and name h2'') (residue 38 and name h6) 1.8 0.4 1.2
assign (residue 38 and name h2'') (residue 39 and name h8) 1.8 0.4 1.2
assign (residue 39 and name h2'') (residue 40 and name h8) 1.8 0.4 1.2
assign (residue 3 and name h2'') (residue 4 and name h8) 1.8 0.4 1.2
assign (residue 40 and name h2'') (residue 41 and name h6) 1.8 0.4 1.2
assign (residue 41 and name h2'') (residue 42 and name h6) 1.8 0.4 1.2
assign (residue 42 and name h2'') (residue 43 and name h8) 1.8 0.4 1.2
assign (residue 43 and name h2'') (residue 44 and name h8) 1.8 0.4 1.2
assign (residue 44 and name h2'') (residue 45 and name h6) 1.8 0.4 1.2
assign (residue 45 and name h2'') (residue 46 and name h6) 1.8 0.4 1.2
assign (residue 46 and name h2'') (residue 47 and name h6) 1.8 0.4 1.2
assign (residue 47 and name h2'') (residue 48 and name h6) 1.8 0.4 1.2
assign (residue 4 and name h2'') (residue 5 and name h6) 1.8 0.4 1.2
assign (residue 5 and name h2'') (residue 6 and name h6) 1.8 0.4 1.2
assign (residue 6 and name h2'') (residue 7 and name h8) 1.8 0.4 1.2
assign (residue 7 and name h2'') (residue 8 and name h8) 1.8 0.4 1.2
assign (residue 8 and name h2'') (residue 9 and name h6) 1.8 0.4 1.2
assign (residue 9 and name h2'') (residue 10 and name h8) 1.8 0.4 1.2
assign (residue 10 and name h3') (residue 10 and name h8) 1.8 0 2.2
assign (residue 11 and name h3') (residue 11 and name h6) 1.8 0 2.2
assign (residue 12 and name h1') (residue 37 and name h2) 1.8 0 2.2
assign (residue 12 and name h3') (residue 12 and name h8) 1.8 0 2.2
assign (residue 12 and name h3') (residue 13 and name h6) 1.8 0 2.2
assign (residue 13 and name h3') (residue 13 and name h6) 1.8 0 2.2
assign (residue 13 and name h3') (residue 14 and name h6) 1.8 0 2.2
assign (residue 14 and name h3') (residue 14 and name h6) 1.8 0 2.2
assign (residue 15 and name h1') (residue 33 and name h2) 1.8 0 2.2
assign (residue 15 and name h3') (residue 15 and name h6) 1.8 0 2.2
assign (residue 16 and name h1') (residue 32 and name h2) 1.8 0 2.2
assign (residue 16 and name h3') (residue 16 and name h6) 1.8 0 2.2
assign (residue 17 and name h1') (residue 31 and name h2) 1.8 0 2.2
assign (residue 17 and name h3') (residue 17 and name h6) 1.8 0 2.2
assign (residue 17 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 18 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 18 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 18 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 19 and name h1') (residue 18 and name h2) 1.8 0 2.2
assign (residue 19 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 1 and name h3') (residue 1 and name h8) 1.8 0 2.2
assign (residue 20 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 20 and name h2'') (residue 20 and name h8) 1.8 0 2.2
assign (residue 20 and name h3') (residue 20 and name h8) 1.8 0 2.2
assign (residue 20 and name h3') (residue 21 and name h6) 1.8 0 2.2
assign (residue 21 and name h1') (residue 20 and name h2) 1.8 0 2.2
assign (residue 21 and name h2'') (residue 21 and name h6) 1.8 0 2.2
assign (residue 21 and name h3') (residue 21 and name h6) 1.8 0 2.2
assign (residue 22 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 22 and name h3') (residue 22 and name h6) 1.8 0 2.2
assign (residue 23 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 23 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 25 and name h2'') (residue 25 and name h6) 1.8 0 2.2
assign (residue 25 and name h3') (residue 25 and name h6) 1.8 0 2.2
assign (residue 25 and name h4') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h2'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h3') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h5'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 27 and name h2'') (residue 27 and name h6) 1.8 0 2.2
assign (residue 27 and name h3') (residue 27 and name h6) 1.8 0 2.2
assign (residue 28 and name h2'') (residue 29 and name h6) 1.8 0 2.2
assign (residue 28 and name h3') (residue 28 and name h6) 1.8 0 2.2
assign (residue 28 and name h3') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 29 and name h3') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 2 and name h3') (residue 2 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 31 and name h8) 1.8 0 2.2
assign (residue 31 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 31 and name h3') (residue 31 and name h8) 1.8 0 2.2
assign (residue 31 and name h3') (residue 32 and name h8) 1.8 0 2.2
assign (residue 32 and name h3') (residue 32 and name h8) 1.8 0 2.2
assign (residue 33 and name h1') (residue 32 and name h2) 1.8 0 2.2
assign (residue 33 and name h3') (residue 33 and name h8) 1.8 0 2.2
assign (residue 34 and name h1') (residue 33 and name h2) 1.8 0 2.2
assign (residue 34 and name h3') (residue 34 and name h8) 1.8 0 2.2
assign (residue 35 and name h2'') (residue 35 and name h6) 1.8 0 2.2
assign (residue 35 and name h3') (residue 35 and name h6) 1.8 0 2.2
assign (residue 36 and name h3') (residue 36 and name h6) 1.8 0 2.2
assign (residue 36 and name h5) (residue 35 and name h1') 1.8 0 2.2
assign (residue 37 and name h3') (residue 37 and name h8) 1.8 0 2.2
assign (residue 37 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 38 and name h1') (residue 37 and name h2) 1.8 0 2.2
assign (residue 38 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 38 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 39 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 39 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 3 and name h3') (residue 3 and name h8) 1.8 0 2.2
assign (residue 3 and name h3') (residue 4 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 41 and name h6) 1.8 0 2.2
assign (residue 41 and name h3') (residue 41 and name h6) 1.8 0 2.2
assign (residue 41 and name h3') (residue 42 and name h6) 1.8 0 2.2
assign (residue 42 and name h3') (residue 42 and name h6) 1.8 0 2.2
assign (residue 42 and name h3') (residue 43 and name h8) 1.8 0 2.2
assign (residue 43 and name h3') (residue 43 and name h8) 1.8 0 2.2
assign (residue 44 and name h3') (residue 44 and name h8) 1.8 0 2.2
assign (residue 44 and name h3') (residue 45 and name h6) 1.8 0 2.2
assign (residue 45 and name h3') (residue 45 and name h6) 1.8 0 2.2
assign (residue 45 and name h3') (residue 46 and name h6) 1.8 0 2.2
assign (residue 46 and name h3') (residue 46 and name h6) 1.8 0 2.2
assign (residue 47 and name h3') (residue 47 and name h6) 1.8 0 2.2
assign (residue 48 and name h3') (residue 48 and name h6) 1.8 0 2.2
assign (residue 4 and name h3') (residue 4 and name h8) 1.8 0 2.2
assign (residue 4 and name h3') (residue 5 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 5 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 6 and name h6) 1.8 0 2.2
assign (residue 6 and name h3') (residue 6 and name h6) 1.8 0 2.2
assign (residue 6 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 7 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 8 and name h3') (residue 8 and name h8) 1.8 0 2.2
assign (residue 8 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 9 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 10 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 10 and name h1') (residue 39 and name h2) 1.8 0 3.2
assign (residue 10 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h1') 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h5) 1.8 0 3.2
assign (residue 10 and name h3') (residue 11 and name h5) 1.8 0 3.2
assign (residue 10 and name h5'') (residue 10 and name h8) 1.8 0 3.2
assign (residue 11 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 11 and name h2'') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h5) (residue 10 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 13 and name h5) 1.8 0 3.2
assign (residue 12 and name h2) (residue 37 and name h2) 1.8 0 3.2
assign (residue 12 and name h3') (residue 13 and name h5) 1.8 0 3.2
assign (residue 12 and name h5'') (residue 12 and name h8) 1.8 0 3.2
assign (residue 13 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h1') (residue 14 and name h6) 1.8 0 3.2
assign (residue 13 and name h2'') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h2'') (residue 14 and name h5) 1.8 0 3.2
assign (residue 13 and name h3') (residue 13 and name h5) 1.8 0 3.2
assign (residue 13 and name h3') (residue 14 and name h5) 1.8 0 3.2
assign (residue 13 and name h5) (residue 12 and name h8) 1.8 0 3.2
assign (residue 13 and name h5) (residue 14 and name h5) 1.8 0 3.2
assign (residue 14 and name h1') (residue 14 and name h6) 1.8 0 3.2
assign (residue 14 and name h1') (residue 15 and name h6) 1.8 0 3.2
assign (residue 14 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 14 and name h5) (residue 13 and name h6) 1.8 0 3.2
assign (residue 15 and name h1') (residue 14 and name h1') 1.8 0 3.2
assign (residue 15 and name h1') (residue 15 and name h6) 1.8 0 3.2
assign (residue 15 and name h1') (residue 16 and name h6) 1.8 0 3.2
assign (residue 15 and name h5) (residue 14 and name h1') 1.8 0 3.2
assign (residue 15 and name h6) (residue 14 and name h6) 1.8 0 3.2
assign (residue 16 and name h1') (residue 16 and name h6) 1.8 0 3.2
assign (residue 16 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 16 and name h5) (residue 15 and name h1') 1.8 0 3.2
assign (residue 16 and name h5) (residue 15 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 17 and name h6) (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 18 and name h2) (residue 19 and name h2) 1.8 0 3.2
assign (residue 18 and name h4') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h5'') (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 20 and name h8) 1.8 0 3.2
assign (residue 1 and name h1') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 1 and name h2'') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h3') (residue 2 and name h8) 1.8 0 3.2
assign (residue 1 and name h4') (residue 1 and name h1') 1.8 0 3.2
assign (residue 1 and name h5'') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h5') (residue 1 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h1') 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h5) 1.8 0 3.2
assign (residue 20 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h1') 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h5) (residue 20 and name h8) 1.8 0 3.2
assign (residue 21 and name h5'') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h5') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h6) (residue 20 and name h8) 1.8 0 3.2
assign (residue 22 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 22 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h4') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h5'') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h5') (residue 22 and name h6) 1.8 0 3.2
assign (residue 23 and name h1') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h2) (residue 24 and name h2) 1.8 0 3.2
assign (residue 23 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h5'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 24 and name h1') (residue 23 and name h2) 1.8 0 3.2
assign (residue 24 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h5'') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h8) (residue 23 and name h8) 1.8 0 3.2
assign (residue 25 and name h1') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h3') (residue 26 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 26 and name h5) 1.8 0 3.2
assign (residue 25 and name h5') (residue 24 and name h3') 1.8 0 3.2
assign (residue 25 and name h5'') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5'') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h1') (residue 22 and name h1') 1.8 0 3.2
assign (residue 26 and name h1') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 26 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 26 and name h4') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5'') (residue 25 and name h1') 1.8 0 3.2
assign (residue 26 and name h5') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 27 and name h1') (residue 27 and name h6) 1.8 0 3.2
assign (residue 27 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 27 and name h3') (residue 28 and name h5) 1.8 0 3.2
assign (residue 27 and name h4') (residue 27 and name h6) 1.8 0 3.2
assign (residue 28 and name h1') (residue 20 and name h2) 1.8 0 3.2
assign (residue 28 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 28 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 28 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 28 and name h4') (residue 28 and name h6) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h6) 1.8 0 3.2
assign (residue 28 and name h6) (residue 20 and name h2) 1.8 0 3.2
assign (residue 29 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 29 and name h5) (residue 28 and name h6) 1.8 0 3.2
assign (residue 29 and name h5'') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h6) (residue 30 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 3 and name h8) 1.8 0 3.2
assign (residue 2 and name h3') (residue 3 and name h8) 1.8 0 3.2
assign (residue 2 and name h5') (residue 1 and name h2'') 1.8 0 3.2
assign (residue 2 and name h5'') (residue 2 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 31 and name h8) 1.8 0 3.2
assign (residue 30 and name h2) (residue 18 and name h2) 1.8 0 3.2
assign (residue 30 and name h5'') (residue 30 and name h8) 1.8 0 3.2
assign (residue 31 and name h1') (residue 31 and name h8) 1.8 0 3.2
assign (residue 31 and name h1') (residue 32 and name h8) 1.8 0 3.2
assign (residue 31 and name h2) (residue 32 and name h2) 1.8 0 3.2
assign (residue 32 and name h1') (residue 32 and name h8) 1.8 0 3.2
assign (residue 32 and name h1') (residue 33 and name h8) 1.8 0 3.2
assign (residue 32 and name h2) (residue 31 and name h2) 1.8 0 3.2
assign (residue 32 and name h2) (residue 33 and name h2) 1.8 0 3.2
assign (residue 32 and name h5'') (residue 32 and name h8) 1.8 0 3.2
assign (residue 32 and name h8) (residue 31 and name h8) 1.8 0 3.2
assign (residue 33 and name h1') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 33 and name h2'') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h2) (residue 34 and name h2) 1.8 0 3.2
assign (residue 33 and name h5'') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h5') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h8) (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 35 and name h6) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 36 and name h5) 1.8 0 3.2
assign (residue 34 and name h3') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 35 and name h1') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h1') (residue 36 and name h6) 1.8 0 3.2
assign (residue 35 and name h2'') (residue 36 and name h6) 1.8 0 3.2
assign (residue 35 and name h4') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h4') (residue 36 and name h5) 1.8 0 3.2
assign (residue 36 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 36 and name h2'') (residue 36 and name h6) 1.8 0 3.2
assign (residue 36 and name h4') (residue 36 and name h6) 1.8 0 3.2
assign (residue 36 and name h5) (residue 34 and name h1') 1.8 0 3.2
assign (residue 37 and name h1') (residue 12 and name h2) 1.8 0 3.2
assign (residue 37 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 38 and name h1') 1.8 0 3.2
assign (residue 37 and name h2'') (residue 38 and name h5) 1.8 0 3.2
assign (residue 37 and name h3') (residue 38 and name h5) 1.8 0 3.2
assign (residue 38 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 38 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 38 and name h2'') (residue 38 and name h6) 1.8 0 3.2
assign (residue 38 and name h4') (residue 38 and name h6) 1.8 0 3.2
assign (residue 39 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 39 and name h4') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h4') (residue 40 and name h8) 1.8 0 3.2
assign (residue 39 and name h5'') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h5') (residue 39 and name h8) 1.8 0 3.2
assign (residue 3 and name h1') (residue 3 and name h8) 1.8 0 3.2
assign (residue 3 and name h1') (residue 4 and name h8) 1.8 0 3.2
assign (residue 3 and name h2'') (residue 3 and name h8) 1.8 0 3.2
assign (residue 3 and name h5'') (residue 3 and name h8) 1.8 0 3.2
assign (residue 3 and name h5') (residue 3 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 39 and name h2) 1.8 0 3.2
assign (residue 40 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 41 and name h6) 1.8 0 3.2
assign (residue 40 and name h2'') (residue 41 and name h1') 1.8 0 3.2
assign (residue 40 and name h4') (residue 40 and name h8) 1.8 0 3.2
assign (residue 40 and name h8) (residue 41 and name h6) 1.8 0 3.2
assign (residue 41 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 41 and name h1') (residue 41 and name h6) 1.8 0 3.2
assign (residue 41 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 41 and name h2'') (residue 41 and name h6) 1.8 0 3.2
assign (residue 41 and name h3') (residue 42 and name h5) 1.8 0 3.2
assign (residue 41 and name h5'') (residue 41 and name h6) 1.8 0 3.2
assign (residue 42 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 42 and name h1') (residue 43 and name h8) 1.8 0 3.2
assign (residue 42 and name h3') (residue 42 and name h5) 1.8 0 3.2
assign (residue 43 and name h1') (residue 43 and name h8) 1.8 0 3.2
assign (residue 43 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 43 and name h2'') (residue 43 and name h8) 1.8 0 3.2
assign (residue 43 and name h3') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h1') (residue 43 and name h2) 1.8 0 3.2
assign (residue 44 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h1') (residue 45 and name h6) 1.8 0 3.2
assign (residue 44 and name h3') (residue 45 and name h5) 1.8 0 3.2
assign (residue 44 and name h5'') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h5') (residue 44 and name h8) 1.8 0 3.2
assign (residue 45 and name h1') (residue 45 and name h6) 1.8 0 3.2
assign (residue 45 and name h1') (residue 46 and name h6) 1.8 0 3.2
assign (residue 45 and name h2'') (residue 45 and name h6) 1.8 0 3.2
assign (residue 45 and name h3') (residue 45 and name h5) 1.8 0 3.2
assign (residue 45 and name h3') (residue 46 and name h5) 1.8 0 3.2
assign (residue 46 and name h1') (residue 46 and name h6) 1.8 0 3.2
assign (residue 46 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 46 and name h2'') (residue 46 and name h6) 1.8 0 3.2
assign (residue 46 and name h3') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 47 and name h2'') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h3') (residue 48 and name h6) 1.8 0 3.2
assign (residue 48 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 48 and name h2'') (residue 48 and name h6) 1.8 0 3.2
assign (residue 48 and name h5') (residue 48 and name h6) 1.8 0 3.2
assign (residue 4 and name h1') (residue 4 and name h8) 1.8 0 3.2
assign (residue 4 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 4 and name h2'') (residue 4 and name h8) 1.8 0 3.2
assign (residue 4 and name h3') (residue 5 and name h5) 1.8 0 3.2
assign (residue 5 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h1') (residue 6 and name h6) 1.8 0 3.2
assign (residue 5 and name h2'') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h2'') (residue 6 and name h1') 1.8 0 3.2
assign (residue 5 and name h5'') (residue 5 and name h6) 1.8 0 3.2
assign (residue 6 and name h1') (residue 6 and name h6) 1.8 0 3.2
assign (residue 6 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 6 and name h2'') (residue 6 and name h6) 1.8 0 3.2
assign (residue 7 and name h1') (residue 43 and name h2) 1.8 0 3.2
assign (residue 7 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h1') (residue 8 and name h8) 1.8 0 3.2
assign (residue 7 and name h2'') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h3') (residue 8 and name h8) 1.8 0 3.2
assign (residue 7 and name h5'') (residue 7 and name h8) 1.8 0 3.2
assign (residue 8 and name h1') (residue 8 and name h8) 1.8 0 3.2
assign (residue 8 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 8 and name h8) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 9 and name h5) 1.8 0 3.2
assign (residue 8 and name h5'') (residue 8 and name h8) 1.8 0 3.2
assign (residue 8 and name h5') (residue 8 and name h8) 1.8 0 3.2
assign (residue 9 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 9 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 10 and name h4') (residue 10 and name h8) 1.8 0 4.7
assign (residue 10 and name h5') (residue 10 and name h8) 1.8 0 4.7
assign (residue 10 and name h8) (residue 9 and name h6) 1.8 0 4.7
assign (residue 11 and name h1') (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 11 and name h2'') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h3') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h4') (residue 12 and name h8) 1.8 0 4.7
assign (residue 11 and name h5) (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 11 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h1') (residue 12 and name h2) 1.8 0 4.7
assign (residue 12 and name h2'') (residue 13 and name h1') 1.8 0 4.7
assign (residue 12 and name h2) (residue 13 and name h6) 1.8 0 4.7
assign (residue 12 and name h4') (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h4') (residue 13 and name h6) 1.8 0 4.7
assign (residue 12 and name h5') (residue 12 and name h8) 1.8 0 4.7
assign (residue 13 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 14 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 14 and name h5) 1.8 0 4.7
assign (residue 13 and name h2'') (residue 13 and name h5) 1.8 0 4.7
assign (residue 13 and name h4') (residue 13 and name h6) 1.8 0 4.7
assign (residue 13 and name h4') (residue 14 and name h6) 1.8 0 4.7
assign (residue 13 and name h5) (residue 12 and name h1') 1.8 0 4.7
assign (residue 13 and name h5) (residue 13 and name h1') 1.8 0 4.7
assign (residue 13 and name h6) (residue 12 and name h8) 1.8 0 4.7
assign (residue 13 and name h6) (residue 14 and name h6) 1.8 0 4.7
assign (residue 14 and name h1') (residue 33 and name h2) 1.8 0 4.7
assign (residue 14 and name h4') (residue 14 and name h6) 1.8 0 4.7
assign (residue 14 and name h5) (residue 34 and name h2) 1.8 0 4.7
assign (residue 15 and name h1') (residue 32 and name h2) 1.8 0 4.7
assign (residue 15 and name h2'') (residue 16 and name h1') 1.8 0 4.7
assign (residue 15 and name h4') (residue 15 and name h6) 1.8 0 4.7
assign (residue 15 and name h5'') (residue 15 and name h6) 1.8 0 4.7
assign (residue 15 and name h5') (residue 15 and name h6) 1.8 0 4.7
assign (residue 16 and name h1') (residue 31 and name h2) 1.8 0 4.7
assign (residue 16 and name h4') (residue 16 and name h6) 1.8 0 4.7
assign (residue 17 and name h1') (residue 18 and name h1') 1.8 0 4.7
assign (residue 17 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 17 and name h4') (residue 17 and name h6) 1.8 0 4.7
assign (residue 17 and name h4') (residue 18 and name h8) 1.8 0 4.7
assign (residue 17 and name h5) (residue 18 and name h8) 1.8 0 4.7
assign (residue 18 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 18 and name h2) (residue 19 and name h8) 1.8 0 4.7
assign (residue 18 and name h4') (residue 18 and name h8) 1.8 0 4.7
assign (residue 18 and name h5') (residue 18 and name h8) 1.8 0 4.7
assign (residue 19 and name h1') (residue 19 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h8) 1.8 0 4.7
assign (residue 19 and name h2) (residue 29 and name h6) 1.8 0 4.7
assign (residue 19 and name h4') (residue 19 and name h8) 1.8 0 4.7
assign (residue 1 and name h4') (residue 1 and name h8) 1.8 0 4.7
assign (residue 20 and name h4') (residue 21 and name h6) 1.8 0 4.7
assign (residue 21 and name h1') (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h2'') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h3') (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h4') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h4') (residue 21 and name h6) 1.8 0 4.7
assign (residue 21 and name h4') (residue 22 and name h6) 1.8 0 4.7
assign (residue 21 and name h5) (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 21 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h6) (residue 22 and name h6) 1.8 0 4.7
assign (residue 22 and name h1') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h3') (residue 22 and name h5) 1.8 0 4.7
assign (residue 22 and name h4') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h5) (residue 21 and name h6) 1.8 0 4.7
assign (residue 23 and name h1') (residue 23 and name h2) 1.8 0 4.7
assign (residue 23 and name h1') (residue 24 and name h1') 1.8 0 4.7
assign (residue 23 and name h3') (residue 24 and name h1') 1.8 0 4.7
assign (residue 23 and name h5') (residue 23 and name h8) 1.8 0 4.7
assign (residue 24 and name h1') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h2'') (residue 25 and name h1') 1.8 0 4.7
assign (residue 24 and name h2'') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h2'') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h3') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h5) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h4') (residue 24 and name h8) 1.8 0 4.7
assign (residue 24 and name h4') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h4') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h5') (residue 24 and name h8) 1.8 0 4.7
assign (residue 25 and name h1') (residue 24 and name h2) 1.8 0 4.7
assign (residue 25 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h2'') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h3') (residue 26 and name h4') 1.8 0 4.7
assign (residue 25 and name h3') (residue 26 and name h5) 1.8 0 4.7
assign (residue 25 and name h4') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h5'') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 25 and name h5'') (residue 26 and name h5) 1.8 0 4.7
assign (residue 25 and name h5') (residue 26 and name h5) 1.8 0 4.7
assign (residue 25 and name h5') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h5) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h6) 1.8 0 4.7
assign (residue 26 and name h2'') (residue 26 and name h5) 1.8 0 4.7
assign (residue 26 and name h4') (residue 25 and name h3') 1.8 0 4.7
assign (residue 26 and name h4') (residue 27 and name h6) 1.8 0 4.7
assign (residue 26 and name h5) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h5') (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 27 and name h1') (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h3') (residue 27 and name h5) 1.8 0 4.7
assign (residue 27 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h5'') (residue 27 and name h6) 1.8 0 4.7
assign (residue 27 and name h5') (residue 27 and name h6) 1.8 0 4.7
assign (residue 27 and name h5) (residue 28 and name h6) 1.8 0 4.7
assign (residue 27 and name h6) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h1') (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h1') (residue 28 and name h5) 1.8 0 4.7
assign (residue 28 and name h3') (residue 28 and name h5) 1.8 0 4.7
assign (residue 28 and name h4') (residue 29 and name h6) 1.8 0 4.7
assign (residue 28 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h5) (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h5) (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 29 and name h1') (residue 28 and name h1') 1.8 0 4.7
assign (residue 29 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 29 and name h4') (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h5) (residue 28 and name h5) 1.8 0 4.7
assign (residue 29 and name h5') (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h5) (residue 30 and name h8) 1.8 0 4.7
assign (residue 2 and name h2'') (residue 2 and name h8) 1.8 0 4.7
assign (residue 2 and name h4') (residue 2 and name h8) 1.8 0 4.7
assign (residue 2 and name h5'') (residue 1 and name h2'') 1.8 0 4.7
assign (residue 2 and name h5') (residue 2 and name h8) 1.8 0 4.7
assign (residue 30 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 30 and name h2) (residue 31 and name h8) 1.8 0 4.7
assign (residue 30 and name h4') (residue 30 and name h8) 1.8 0 4.7
assign (residue 30 and name h5') (residue 30 and name h8) 1.8 0 4.7
assign (residue 31 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 31 and name h2) (residue 32 and name h8) 1.8 0 4.7
assign (residue 31 and name h4') (residue 31 and name h8) 1.8 0 4.7
assign (residue 31 and name h8) (residue 30 and name h8) 1.8 0 4.7
assign (residue 32 and name h1') (residue 32 and name h2) 1.8 0 4.7
assign (residue 32 and name h2) (residue 33 and name h8) 1.8 0 4.7
assign (residue 32 and name h4') (residue 32 and name h8) 1.8 0 4.7
assign (residue 32 and name h5') (residue 32 and name h8) 1.8 0 4.7
assign (residue 33 and name h1') (residue 33 and name h2) 1.8 0 4.7
assign (residue 33 and name h2'') (residue 34 and name h1') 1.8 0 4.7
assign (residue 33 and name h4') (residue 33 and name h8) 1.8 0 4.7
assign (residue 34 and name h1') (residue 34 and name h2) 1.8 0 4.7
assign (residue 34 and name h1') (residue 35 and name h6) 1.8 0 4.7
assign (residue 34 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 34 and name h2'') (residue 36 and name h6) 1.8 0 4.7
assign (residue 34 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 34 and name h4') (residue 34 and name h8) 1.8 0 4.7
assign (residue 35 and name h2'') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h4') (residue 36 and name h6) 1.8 0 4.7
assign (residue 35 and name h6) (residue 36 and name h6) 1.8 0 4.7
assign (residue 36 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 36 and name h2'') (residue 36 and name h5) 1.8 0 4.7
assign (residue 36 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 36 and name h4') (residue 37 and name h8) 1.8 0 4.7
assign (residue 36 and name h5) (residue 34 and name h2) 1.8 0 4.7
assign (residue 36 and name h6) (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h1') (residue 37 and name h2) 1.8 0 4.7
assign (residue 37 and name h3') (residue 38 and name h1') 1.8 0 4.7
assign (residue 37 and name h4') (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h4') (residue 38 and name h6) 1.8 0 4.7
assign (residue 37 and name h5'') (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h5') (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h1') (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h1') (residue 39 and name h1') 1.8 0 4.7
assign (residue 38 and name h2'') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h3') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h4') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h4') (residue 39 and name h8) 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h5'') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h5') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h5) (residue 39 and name h8) 1.8 0 4.7
assign (residue 38 and name h6) (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h6) (residue 39 and name h8) 1.8 0 4.7
assign (residue 39 and name h2) (residue 40 and name h2) 1.8 0 4.7
assign (residue 3 and name h4') (residue 3 and name h8) 1.8 0 4.7
assign (residue 40 and name h1') (residue 40 and name h2) 1.8 0 4.7
assign (residue 40 and name h1') (residue 41 and name h1') 1.8 0 4.7
assign (residue 40 and name h5'') (residue 40 and name h8) 1.8 0 4.7
assign (residue 40 and name h5') (residue 40 and name h8) 1.8 0 4.7
assign (residue 40 and name h8) (residue 41 and name h5) 1.8 0 4.7
assign (residue 41 and name h4') (residue 41 and name h6) 1.8 0 4.7
assign (residue 41 and name h5') (residue 41 and name h6) 1.8 0 4.7
assign (residue 42 and name h4') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h5'') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h5') (residue 42 and name h6) 1.8 0 4.7
assign (residue 43 and name h2'') (residue 43 and name h2) 1.8 0 4.7
assign (residue 43 and name h2'') (residue 44 and name h1') 1.8 0 4.7
assign (residue 43 and name h4') (residue 43 and name h8) 1.8 0 4.7
assign (residue 43 and name h5'') (residue 43 and name h8) 1.8 0 4.7
assign (residue 43 and name h5') (residue 43 and name h8) 1.8 0 4.7
assign (residue 44 and name h2'') (residue 44 and name h8) 1.8 0 4.7
assign (residue 44 and name h4') (residue 44 and name h8) 1.8 0 4.7
assign (residue 45 and name h4') (residue 45 and name h6) 1.8 0 4.7
assign (residue 45 and name h5) (residue 44 and name h8) 1.8 0 4.7
assign (residue 45 and name h5'') (residue 45 and name h6) 1.8 0 4.7
assign (residue 45 and name h5') (residue 45 and name h6) 1.8 0 4.7
assign (residue 45 and name h6) (residue 46 and name h5) 1.8 0 4.7
assign (residue 46 and name h4') (residue 46 and name h6) 1.8 0 4.7
assign (residue 46 and name h5'') (residue 46 and name h6) 1.8 0 4.7
assign (residue 46 and name h5') (residue 46 and name h6) 1.8 0 4.7
assign (residue 47 and name h5') (residue 47 and name h6) 1.8 0 4.7
assign (residue 47 and name h5') (residue 47 and name h6) 1.8 0 4.7
assign (residue 48 and name h4') (residue 48 and name h6) 1.8 0 4.7
assign (residue 48 and name h5'') (residue 48 and name h6) 1.8 0 4.7
assign (residue 48 and name h6) (residue 47 and name h5) 1.8 0 4.7
assign (residue 4 and name h4') (residue 4 and name h8) 1.8 0 4.7
assign (residue 4 and name h5'') (residue 4 and name h8) 1.8 0 4.7
assign (residue 4 and name h5') (residue 4 and name h8) 1.8 0 4.7
assign (residue 5 and name h4') (residue 5 and name h6) 1.8 0 4.7
assign (residue 5 and name h5) (residue 4 and name h8) 1.8 0 4.7
assign (residue 5 and name h5') (residue 5 and name h6) 1.8 0 4.7
assign (residue 5 and name h6) (residue 6 and name h5) 1.8 0 4.7
assign (residue 6 and name h4') (residue 6 and name h6) 1.8 0 4.7
assign (residue 6 and name h5'') (residue 6 and name h6) 1.8 0 4.7
assign (residue 6 and name h5') (residue 6 and name h6) 1.8 0 4.7
assign (residue 6 and name h6) (residue 5 and name h5) 1.8 0 4.7
assign (residue 7 and name h4') (residue 7 and name h8) 1.8 0 4.7
assign (residue 7 and name h5') (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h5) 1.8 0 4.7
assign (residue 8 and name h4') (residue 8 and name h8) 1.8 0 4.7
assign (residue 8 and name h8) (residue 9 and name h6) 1.8 0 4.7
assign (residue 9 and name h4') (residue 9 and name h6) 1.8 0 4.7
assign (residue 9 and name h5) (residue 8 and name h8) 1.8 0 4.7
assign (residue 9 and name h5) (residue 9 and name h1') 1.8 0 4.7
{NOE-H2O}

assign (residue 18 and name h2) (residue 29 and name h3) 1.8 0 1.7
assign (residue 30 and name h2) (residue 17 and name h3) 1.8 0 1.7
assign (residue 31 and name h2) (residue 16 and name h3) 1.8 0 1.7
assign (residue 32 and name h2) (residue 15 and name h3) 1.8 0 1.7
assign (residue 33 and name h2) (residue 14 and name h3) 1.8 0 1.7
assign (residue 37 and name h2) (residue 11 and name h3) 1.8 0 1.7
assign (residue 38 and name h41) (residue 10 and name h1) 1.8 0 1.7
assign (residue 38 and name h42) (residue 10 and name h1) 1.8 0 1.7
assign (residue 40 and name h2) (residue 9 and name h3) 1.8 0 1.7
assign (residue 12 and name h2) (residue 36 and name h3) 1.8 0 2.7
assign (residue 19 and name h2) (residue 28 and name h3) 1.8 0 2.7
assign (residue 31 and name h2) (residue 17 and name h3) 1.8 0 2.7
assign (residue 32 and name h2) (residue 16 and name h3) 1.8 0 2.7
assign (residue 33 and name h2) (residue 15 and name h3) 1.8 0 2.7
assign (residue 34 and name h2) (residue 13 and name h3) 1.8 0 2.7
assign (residue 11 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 11 and name h3) (residue 10 and name h1) 1.8 0 4.2
assign (residue 16 and name h1') (residue 15 and name h3) 1.8 0 4.2
assign (residue 16 and name h3) (residue 15 and name h3) 1.8 0 4.2
assign (residue 17 and name h3) (residue 16 and name h3) 1.8 0 4.2
assign (residue 18 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 18 and name h8) (residue 17 and name h3) 1.8 0 4.2
assign (residue 19 and name h1') (residue 29 and name h3) 1.8 0 4.2
assign (residue 31 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 38 and name h5) (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h2) (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h8) (residue 10 and name h1) 1.8 0 4.2
assign (residue 10 and name h8) (residue 9 and name h3) 3.5 0 3.0
assign (residue 17 and name h1') (residue 17 and name h3) 3.5 0 3.0
assign (residue 32 and name h1') (residue 16 and name h3) 3.5 0 3.0
assign (residue 33 and name h1') (residue 15 and name h3) 3.5 0 3.0
assign (residue 37 and name h2) (residue 10 and name h1) 3.5 0 3.0
assign (residue 39 and name h2) (residue 9 and name h3) 3.5 0 3.0
assign (residue 3 and name h1) (residue 46 and name h3) 1.8 0 1.7
assign (residue 8 and name h1) (residue 41 and name h3) 1.8 0 1.7
assign (residue 42 and name h41) (residue 7 and name h1) 1.8 0 1.7
assign (residue 42 and name h42) (residue 7 and name h1) 1.8 0 1.7
assign (residue 43 and name h2) (residue 6 and name h3) 1.8 0 1.7
assign (residue 44 and name h1) (residue 5 and name h3) 1.8 0 1.7
assign (residue 45 and name h41) (residue 4 and name h1) 1.8 0 1.7
assign (residue 45 and name h42) (residue 4 and name h1) 1.8 0 1.7
assign (residue 47 and name h41) (residue 2 and name h1) 1.8 0 1.7
assign (residue 47 and name h42) (residue 2 and name h1) 1.8 0 1.7
assign (residue 48 and name h41) (residue 1 and name h1) 1.8 0 1.7
assign (residue 48 and name h42) (residue 1 and name h1) 1.8 0 1.7
assign (residue 2 and name h1') (residue 1 and name h1) 1.8 0 4.2
assign (residue 3 and name h1) (residue 4 and name h1) 1.8 0 4.2
assign (residue 3 and name h1') (residue 2 and name h1) 1.8 0 4.2
assign (residue 3 and name h22) (residue 46 and name h3) 1.8 0 4.2
assign (residue 4 and name h1') (residue 3 and name h1) 1.8 0 4.2
assign (residue 4 and name h1') (residue 46 and name h3) 1.8 0 4.2
assign (residue 5 and name h1') (residue 4 and name h1) 1.8 0 4.2
assign (residue 5 and name h3) (residue 4 and name h1) 1.8 0 4.2
assign (residue 5 and name h3) (residue 6 and name h3) 1.8 0 4.2
assign (residue 6 and name h1') (residue 5 and name h3) 1.8 0 4.2
assign (residue 6 and name h1') (residue 44 and name h1) 1.8 0 4.2
assign (residue 7 and name h1') (residue 6 and name h3) 1.8 0 4.2
assign (residue 8 and name h1') (residue 7 and name h1) 1.8 0 4.2
assign (residue 8 and name h22) (residue 41 and name h3) 1.8 0 4.2
assign (residue 9 and name h1') (residue 8 and name h1) 1.8 0 4.2
assign (residue 9 and name h3) (residue 8 and name h1) 1.8 0 4.2
assign (residue 42 and name h1') (residue 8 and name h1) 1.8 0 4.2
assign (residue 42 and name h1') (residue 41 and name h3) 1.8 0 4.2
assign (residue 42 and name h5) (residue 7 and name h1) 1.8 0 4.2
assign (residue 43 and name h1') (residue 7 and name h1) 1.8 0 4.2
assign (residue 44 and name h1) (residue 4 and name h1) 1.8 0 4.2
assign (residue 44 and name h1) (residue 6 and name h3) 1.8 0 4.2
assign (residue 44 and name h1') (residue 6 and name h3) 1.8 0 4.2
assign (residue 44 and name h22) (residue 5 and name h3) 1.8 0 4.2
assign (residue 45 and name h1') (residue 5 and name h3) 1.8 0 4.2
assign (residue 45 and name h1') (residue 44 and name h1) 1.8 0 4.2
assign (residue 45 and name h5) (residue 4 and name h1) 1.8 0 4.2
assign (residue 46 and name h1') (residue 4 and name h1) 1.8 0 4.2
assign (residue 47 and name h1') (residue 3 and name h1) 1.8 0 4.2
assign (residue 47 and name h1') (residue 46 and name h3) 1.8 0 4.2
assign (residue 47 and name h5) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h1') (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h5) (residue 1 and name h1) 1.8 0 4.2
assign (residue 48 and name h6) (residue 1 and name h1) 1.8 0 4.2
assign (residue 5 and name h5) (residue 4 and name h1) 3.5 0 3.0
assign (residue 6 and name h6) (residue 44 and name h1) 3.5 0 3.0
assign (residue 41 and name h1') (residue 8 and name h1) 3.5 0 3.0
assign (residue 42 and name h41) (residue 8 and name h1) 3.5 0 3.0
assign (residue 42 and name h42) (residue 8 and name h1) 3.5 0 3.0
assign (residue 42 and name h5) (residue 8 and name h1) 3.5 0 3.0
assign (residue 42 and name h6) (residue 7 and name h1) 3.5 0 3.0
assign (residue 42 and name h6) (residue 8 and name h1) 3.5 0 3.0
assign (residue 43 and name h2) (residue 44 and name h1) 3.5 0 3.0
assign (residue 46 and name h1') (residue 3 and name h1) 3.5 0 3.0
assign (residue 47 and name h41) (residue 3 and name h1) 3.5 0 3.0
assign (residue 47 and name h42) (residue 3 and name h1) 3.5 0 3.0
assign (residue 47 and name h6) (residue 3 and name h1) 3.5 0 3.0
{hydrogen bonds}
assign (residue 1 and name n1) (residue 48 and name n3) 2.8 0.2 0.2
assign (residue 2 and name n1) (residue 47 and name n3) 2.8 0.2 0.2
assign (residue 3 and name n1) (residue 46 and name o2) 2.8 0.2 0.2
assign (residue 3 and name o6) (residue 46 and name n3) 2.8 0.2 0.2
assign (residue 4 and name n1) (residue 45 and name n3) 2.8 0.2 0.2
assign (residue 44 and name n1) (residue 5 and name o2) 2.8 0.2 0.2
assign (residue 44 and name o6) (residue 5 and name n3) 2.8 0.2 0.2
assign (residue 6 and name n3) (residue 43 and name n1) 2.8 0.2 0.2
assign (residue 7 and name n1) (residue 42 and name n3) 2.8 0.2 0.2
assign (residue 8 and name n1) (residue 41 and name o2) 2.8 0.2 0.2
assign (residue 8 and name o6) (residue 41 and name n3) 2.8 0.2 0.2
assign (residue 9 and name n3) (residue 40 and name n1) 2.8 0.2 0.2
assign (residue 10 and name n1) (residue 38 and name n3) 2.8 0.2 0.2
assign (residue 11 and name n3) (residue 37 and name n1) 2.8 0.2 0.2
assign (residue 13 and name n3) (residue 34 and name n1) 2.8 0.2 0.2
assign (residue 14 and name n3) (residue 33 and name n1) 2.8 0.2 0.2
assign (residue 15 and name n3) (residue 32 and name n1) 2.8 0.2 0.2
assign (residue 16 and name n3) (residue 31 and name n1) 2.8 0.2 0.2
assign (residue 17 and name n3) (residue 30 and name n1) 2.8 0.2 0.2
assign (residue 29 and name n3) (residue 18 and name n1) 2.8 0.2 0.2
assign (residue 28 and name n3) (residue 19 and name n1) 2.8 0.2 0.2
{torsion angles}
assign (residue 1 and name c4') (residue 1 and name o4')
       (residue 1 and name c1') (residue 1 and name c2') 2 0 15 2
assign (residue 1 and name o4') (residue 1 and name c1')
       (residue 1 and name c2') (residue 1 and name c3') 2 -22 15 2
assign (residue 1 and name c1') (residue 1 and name c2')
       (residue 1 and name c3') (residue 1 and name c4') 2 36 15 2
assign (residue 1 and name c2') (residue 1 and name c3')
       (residue 1 and name c4') (residue 1 and name o4') 2 -36 15 2

assign (residue 2 and name c4') (residue 2 and name o4')
       (residue 2 and name c1') (residue 2 and name c2') 2 0 15 2
assign (residue 2 and name o4') (residue 2 and name c1') 
       (residue 2 and name c2') (residue 2 and name c3') 2 -22 15 2
assign (residue 2 and name c1') (residue 2 and name c2') 
       (residue 2 and name c3') (residue 2 and name c4') 2 36 15 2
assign (residue 2 and name c2') (residue 2 and name c3') 
       (residue 2 and name c4') (residue 2 and name o4') 2 -36 15 2

assign (residue 3 and name c4') (residue 3 and name o4') 
       (residue 3 and name c1') (residue 3 and name c2') 2 0 15 2
assign (residue 3 and name o4') (residue 3 and name c1') 
       (residue 3 and name c2') (residue 3 and name c3') 2 -22 15 2
assign (residue 3 and name c1') (residue 3 and name c2') 
       (residue 3 and name c3') (residue 3 and name c4') 2 36 15 2
assign (residue 3 and name c2') (residue 3 and name c3') 
       (residue 3 and name c4') (residue 3 and name o4') 2 -36 15 2

assign (residue 4 and name c4') (residue 4 and name o4') 
       (residue 4 and name c1') (residue 4 and name c2') 2 0 15 2
assign (residue 4 and name o4') (residue 4 and name c1') 
       (residue 4 and name c2') (residue 4 and name c3') 2 -22 15 2
assign (residue 4 and name c1') (residue 4 and name c2') 
       (residue 4 and name c3') (residue 4 and name c4') 2 36 15 2
assign (residue 4 and name c2') (residue 4 and name c3') 
       (residue 4 and name c4') (residue 4 and name o4') 2 -36 15 2

assign (residue 5 and name c4') (residue 5 and name o4') 
       (residue 5 and name c1') (residue 5 and name c2') 2 0 15 2
assign (residue 5 and name o4') (residue 5 and name c1') 
       (residue 5 and name c2') (residue 5 and name c3') 2 -22 15 2
assign (residue 5 and name c1') (residue 5 and name c2') 
       (residue 5 and name c3') (residue 5 and name c4') 2 36 15 2
assign (residue 5 and name c2') (residue 5 and name c3') 
       (residue 5 and name c4') (residue 5 and name o4') 2 -36 15 2

assign (residue 6 and name c4') (residue 6 and name o4')
       (residue 6 and name c1') (residue 6 and name c2') 2 0 15 2
assign (residue 6 and name o4') (residue 6 and name c1')
       (residue 6 and name c2') (residue 6 and name c3') 2 -22 15 2
assign (residue 6 and name c1') (residue 6 and name c2')
       (residue 6 and name c3') (residue 6 and name c4') 2 36 15 2
assign (residue 6 and name c2') (residue 6 and name c3')
       (residue 6 and name c4') (residue 6 and name o4') 2 -36 15 2

assign (residue 7 and name c4') (residue 7 and name o4')
       (residue 7 and name c1') (residue 7 and name c2') 2 0 15 2
assign (residue 7 and name o4') (residue 7 and name c1')
       (residue 7 and name c2') (residue 7 and name c3') 2 -22 15 2
assign (residue 7 and name c1') (residue 7 and name c2')
       (residue 7 and name c3') (residue 7 and name c4') 2 36 15 2
assign (residue 7 and name c2') (residue 7 and name c3')
       (residue 7 and name c4') (residue 7 and name o4') 2 -36 15 2

assign (residue 8 and name c4') (residue 8 and name o4')
       (residue 8 and name c1') (residue 8 and name c2') 2 0 15 2
assign (residue 8 and name o4') (residue 8 and name c1') 
       (residue 8 and name c2') (residue 8 and name c3') 2 -22 15 2
assign (residue 8 and name c1') (residue 8 and name c2') 
       (residue 8 and name c3') (residue 8 and name c4') 2 36 15 2
assign (residue 8 and name c2') (residue 8 and name c3') 
       (residue 8 and name c4') (residue 8 and name o4') 2 -36 15 2

assign (residue 9 and name c4') (residue 9 and name o4')
       (residue 9 and name c1') (residue 9 and name c2') 2 0 15 2
assign (residue 9 and name o4') (residue 9 and name c1') 
       (residue 9 and name c2') (residue 9 and name c3') 2 -22 15 2
assign (residue 9 and name c1') (residue 9 and name c2') 
       (residue 9 and name c3') (residue 9 and name c4') 2 36 15 2
assign (residue 9 and name c2') (residue 9 and name c3') 
       (residue 9 and name c4') (residue 9 and name o4') 2 -36 15 2

assign (residue 10 and name c4') (residue 10 and name o4') 
       (residue 10 and name c1') (residue 10 and name c2') 2 0 15 2 
assign (residue 10 and name o4') (residue 10 and name c1') 
       (residue 10 and name c2') (residue 10 and name c3')  2 -22 15 2
assign (residue 10 and name c1') (residue 10 and name c2') 
       (residue 10 and name c3') (residue 10 and name c4') 2 36 15 2
assign (residue 10 and name c2') (residue 10 and name c3') 
       (residue 10 and name c4') (residue 10 and name o4') 2 -36 15 2

assign (residue 11 and name c4') (residue 11 and name o4')
       (residue 11 and name c1') (residue 11 and name c2') 2 0 15 2
assign (residue 11 and name o4') (residue 11 and name c1')
       (residue 11 and name c2') (residue 11 and name c3')  2 -22 15 2
assign (residue 11 and name c1') (residue 11 and name c2')
       (residue 11 and name c3') (residue 11 and name c4') 2 36 15 2
assign (residue 11 and name c2') (residue 11 and name c3')
       (residue 11 and name c4') (residue 11 and name o4') 2 -36 15 2

assign (residue 12 and name c4') (residue 12 and name o4') 
       (residue 12 and name c1') (residue 12 and name c2') 2 0 15 2 
assign (residue 12 and name o4') (residue 12 and name c1') 
       (residue 12 and name c2') (residue 12 and name c3')  2 -22 15 2
assign (residue 12 and name c1') (residue 12 and name c2') 
       (residue 12 and name c3') (residue 12 and name c4') 2 36 15 2
assign (residue 12 and name c2') (residue 12 and name c3') 
       (residue 12 and name c4') (residue 12 and name o4') 2 -36 15 2

assign (residue 13 and name c4') (residue 13 and name o4')
       (residue 13 and name c1') (residue 13 and name c2') 2 0 15 2
assign (residue 13 and name o4') (residue 13 and name c1')
       (residue 13 and name c2') (residue 13 and name c3') 2 -22 15 2
assign (residue 13 and name c1') (residue 13 and name c2')
       (residue 13 and name c3') (residue 13 and name c4') 2 36 15 2
assign (residue 13 and name c2') (residue 13 and name c3')
       (residue 13 and name c4') (residue 13 and name o4') 2 -36 15 2

assign (residue 14 and name c4') (residue 14 and name o4')
       (residue 14 and name c1') (residue 14 and name c2') 2 0 15 2
assign (residue 14 and name o4') (residue 14 and name c1')
       (residue 14 and name c2') (residue 14 and name c3') 2 -22 15 2
assign (residue 14 and name c1') (residue 14 and name c2')
       (residue 14 and name c3') (residue 14 and name c4') 2 36 15 2
assign (residue 14 and name c2') (residue 14 and name c3')
       (residue 14 and name c4') (residue 14 and name o4') 2 -36 15 2

assign (residue 15 and name c4') (residue 15 and name o4')
       (residue 15 and name c1') (residue 15 and name c2') 2 0 15 2
assign (residue 15 and name o4') (residue 15 and name c1')
       (residue 15 and name c2') (residue 15 and name c3') 2 -22 15 2
assign (residue 15 and name c1') (residue 15 and name c2')
       (residue 15 and name c3') (residue 15 and name c4') 2 36 15 2
assign (residue 15 and name c2') (residue 15 and name c3')
       (residue 15 and name c4') (residue 15 and name o4') 2 -36 15 2

assign (residue 16 and name c4') (residue 16 and name o4')
       (residue 16 and name c1') (residue 16 and name c2') 2 0 15 2
assign (residue 16 and name o4') (residue 16 and name c1')
       (residue 16 and name c2') (residue 16 and name c3') 2 -22 15 2
assign (residue 16 and name c1') (residue 16 and name c2')
       (residue 16 and name c3') (residue 16 and name c4') 2 36 15 2
assign (residue 16 and name c2') (residue 16 and name c3')
       (residue 16 and name c4') (residue 16 and name o4') 2 -36 15 2

assign (residue 17 and name c4') (residue 17 and name o4')
       (residue 17 and name c1') (residue 17 and name c2') 2 0 15 2
assign (residue 17 and name o4') (residue 17 and name c1')
       (residue 17 and name c2') (residue 17 and name c3') 2 -22 15 2
assign (residue 17 and name c1') (residue 17 and name c2')
       (residue 17 and name c3') (residue 17 and name c4') 2 36 15 2
assign (residue 17 and name c2') (residue 17 and name c3')
       (residue 17 and name c4') (residue 17 and name o4') 2 -36 15 2

assign (residue 18 and name c4') (residue 18 and name o4')
       (residue 18 and name c1') (residue 18 and name c2') 2 0 15 2
assign (residue 18 and name o4') (residue 18 and name c1')
       (residue 18 and name c2') (residue 18 and name c3') 2 -22 15 2
assign (residue 18 and name c1') (residue 18 and name c2')
       (residue 18 and name c3') (residue 18 and name c4') 2 36 15 2
assign (residue 18 and name c2') (residue 18 and name c3')
       (residue 18 and name c4') (residue 18 and name o4') 2 -36 15 2

assign (residue 19 and name c4') (residue 19 and name o4')
       (residue 19 and name c1') (residue 19 and name c2') 2 0 15 2
assign (residue 19 and name o4') (residue 19 and name c1')
       (residue 19 and name c2') (residue 19 and name c3') 2 -22 15 2
assign (residue 19 and name c1') (residue 19 and name c2')
       (residue 19 and name c3') (residue 19 and name c4') 2 36 15 2
assign (residue 19 and name c2') (residue 19 and name c3')
       (residue 19 and name c4') (residue 19 and name o4') 2 -36 15 2

assign (residue 20 and name c4') (residue 20 and name o4')
       (residue 20 and name c1') (residue 20 and name c2') 2 0 15 2
assign (residue 20 and name o4') (residue 20 and name c1')
       (residue 20 and name c2') (residue 20 and name c3') 2 -22 15 2
assign (residue 20 and name c1') (residue 20 and name c2')
       (residue 20 and name c3') (residue 20 and name c4') 2 36 15 2
assign (residue 20 and name c2') (residue 20 and name c3')
       (residue 20 and name c4') (residue 20 and name o4') 2 -36 15 2

assign (residue 21 and name c4') (residue 21 and name o4')
       (residue 21 and name c1') (residue 21 and name c2') 2 0 15 2
assign (residue 21 and name o4') (residue 21 and name c1')
       (residue 21 and name c2') (residue 21 and name c3') 2 -22 15 2
assign (residue 21 and name c1') (residue 21 and name c2')
       (residue 21 and name c3') (residue 21 and name c4') 2 36 15 2
assign (residue 21 and name c2') (residue 21 and name c3')
       (residue 21 and name c4') (residue 21 and name o4') 2 -36 15 2

assign (residue 26 and name c4') (residue 26 and name o4') 
       (residue 26 and name c1') (residue 26 and name c2') 2 0 15 2
assign (residue 26 and name o4') (residue 26 and name c1') 
       (residue 26 and name c2') (residue 26 and name c3') 2 -22 15 2
assign (residue 26 and name c1') (residue 26 and name c2') 
       (residue 26 and name c3') (residue 26 and name c4') 2 36 15 2
assign (residue 26 and name c2') (residue 26 and name c3') 
       (residue 26 and name c4') (residue 26 and name o4') 2 -36 15 2

assign (residue 27 and name c4') (residue 27 and name o4')
       (residue 27 and name c1') (residue 27 and name c2') 2 0 15 2
assign (residue 27 and name o4') (residue 27 and name c1')
       (residue 27 and name c2') (residue 27 and name c3') 2 -22 15 2
assign (residue 27 and name c1') (residue 27 and name c2')
       (residue 27 and name c3') (residue 27 and name c4') 2 36 15 2
assign (residue 27 and name c2') (residue 27 and name c3')
       (residue 27 and name c4') (residue 27 and name o4') 2 -36 15 2

assign (residue 28 and name c4') (residue 28 and name o4') 
       (residue 28 and name c1') (residue 28 and name c2') 2 0 15 2
assign (residue 28 and name o4') (residue 28 and name c1') 
       (residue 28 and name c2') (residue 28 and name c3') 2 -22 15 2
assign (residue 28 and name c1') (residue 28 and name c2') 
       (residue 28 and name c3') (residue 28 and name c4') 2 36 15 2
assign (residue 28 and name c2') (residue 28 and name c3') 
       (residue 28 and name c4') (residue 28 and name o4') 2 -36 15 2

assign (residue 29 and name c4') (residue 29 and name o4')
       (residue 29 and name c1') (residue 29 and name c2') 2 0 15 2
assign (residue 29 and name o4') (residue 29 and name c1')
       (residue 29 and name c2') (residue 29 and name c3') 2 -22 15 2
assign (residue 29 and name c1') (residue 29 and name c2')
       (residue 29 and name c3') (residue 29 and name c4') 2 36 15 2
assign (residue 29 and name c2') (residue 29 and name c3')
       (residue 29 and name c4') (residue 29 and name o4') 2 -36 15 2

assign (residue 30 and name c4') (residue 30 and name o4')
       (residue 30 and name c1') (residue 30 and name c2') 2 0 15 2
assign (residue 30 and name o4') (residue 30 and name c1')
       (residue 30 and name c2') (residue 30 and name c3') 2 -22 15 2
assign (residue 30 and name c1') (residue 30 and name c2')
       (residue 30 and name c3') (residue 30 and name c4') 2 36 15 2
assign (residue 30 and name c2') (residue 30 and name c3')
       (residue 30 and name c4') (residue 30 and name o4') 2 -36 15 2

assign (residue 31 and name c4') (residue 31 and name o4')
       (residue 31 and name c1') (residue 31 and name c2') 2 0 15 2
assign (residue 31 and name o4') (residue 31 and name c1')
       (residue 31 and name c2') (residue 31 and name c3') 2 -22 15 2
assign (residue 31 and name c1') (residue 31 and name c2')
       (residue 31 and name c3') (residue 31 and name c4') 2 36 15 2
assign (residue 31 and name c2') (residue 31 and name c3')
       (residue 31 and name c4') (residue 31 and name o4') 2 -36 15 2

assign (residue 32 and name c4') (residue 32 and name o4')
       (residue 32 and name c1') (residue 32 and name c2') 2 0 15 2
assign (residue 32 and name o4') (residue 32 and name c1')
       (residue 32 and name c2') (residue 32 and name c3') 2 -22 15 2
assign (residue 32 and name c1') (residue 32 and name c2')
       (residue 32 and name c3') (residue 32 and name c4') 2 36 15 2
assign (residue 32 and name c2') (residue 32 and name c3')
       (residue 32 and name c4') (residue 32 and name o4') 2 -36 15 2

assign (residue 33 and name c4') (residue 33 and name o4')
       (residue 33 and name c1') (residue 33 and name c2') 2 0 15 2
assign (residue 33 and name o4') (residue 33 and name c1')
       (residue 33 and name c2') (residue 33 and name c3') 2 -22 15 2
assign (residue 33 and name c1') (residue 33 and name c2')
       (residue 33 and name c3') (residue 33 and name c4') 2 36 15 2
assign (residue 33 and name c2') (residue 33 and name c3')
       (residue 33 and name c4') (residue 33 and name o4') 2 -36 15 2

assign (residue 34 and name c4') (residue 34 and name o4')
       (residue 34 and name c1') (residue 34 and name c2') 2 0 15 2
assign (residue 34 and name o4') (residue 34 and name c1')
       (residue 34 and name c2') (residue 34 and name c3') 2 -22 15 2
assign (residue 34 and name c1') (residue 34 and name c2')
       (residue 34 and name c3') (residue 34 and name c4') 2 36 15 2
assign (residue 34 and name c2') (residue 34 and name c3')
       (residue 34 and name c4') (residue 34 and name o4') 2 -36 15 2

assign (residue 36 and name c4') (residue 36 and name o4')
       (residue 36 and name c1') (residue 36 and name c2') 2 0 15 2
assign (residue 36 and name o4') (residue 36 and name c1')
       (residue 36 and name c2') (residue 36 and name c3') 2 -22 15 2
assign (residue 36 and name c1') (residue 36 and name c2')
       (residue 36 and name c3') (residue 36 and name c4') 2 36 15 2
assign (residue 36 and name c2') (residue 36 and name c3')
       (residue 36 and name c4') (residue 36 and name o4') 2 -36 15 2

assign (residue 37 and name c4') (residue 37 and name o4')
       (residue 37 and name c1') (residue 37 and name c2') 2 0 15 2
assign (residue 37 and name o4') (residue 37 and name c1')
       (residue 37 and name c2') (residue 37 and name c3') 2 -22 15 2
assign (residue 37 and name c1') (residue 37 and name c2')
       (residue 37 and name c3') (residue 37 and name c4') 2 36 15 2
assign (residue 37 and name c2') (residue 37 and name c3')
       (residue 37 and name c4') (residue 37 and name o4') 2 -36 15 2

assign (residue 38 and name c4') (residue 38 and name o4')
       (residue 38 and name c1') (residue 38 and name c2') 2 0 15 2
assign (residue 38 and name o4') (residue 38 and name c1')
       (residue 38 and name c2') (residue 38 and name c3') 2 -22 15 2
assign (residue 38 and name c1') (residue 38 and name c2')
       (residue 38 and name c3') (residue 38 and name c4') 2 36 15 2
assign (residue 38 and name c2') (residue 38 and name c3')
       (residue 38 and name c4') (residue 38 and name o4') 2 -36 15 2

assign (residue 39 and name c4') (residue 39 and name o4')
       (residue 39 and name c1') (residue 39 and name c2') 2 0 15 2
assign (residue 39 and name o4') (residue 39 and name c1')
       (residue 39 and name c2') (residue 39 and name c3') 2 -22 15 2
assign (residue 39 and name c1') (residue 39 and name c2')
       (residue 39 and name c3') (residue 39 and name c4') 2 36 15 2
assign (residue 39 and name c2') (residue 39 and name c3')
       (residue 39 and name c4') (residue 39 and name o4') 2 -36 15 2

assign (residue 40 and name c4') (residue 40 and name o4')
       (residue 40 and name c1') (residue 40 and name c2') 2 0 15 2
assign (residue 40 and name o4') (residue 40 and name c1')
       (residue 40 and name c2') (residue 40 and name c3') 2 -22 15 2
assign (residue 40 and name c1') (residue 40 and name c2')
       (residue 40 and name c3') (residue 40 and name c4') 2 36 15 2
assign (residue 40 and name c2') (residue 40 and name c3')
       (residue 40 and name c4') (residue 40 and name o4') 2 -36 15 2

assign (residue 41 and name c4') (residue 41 and name o4')
       (residue 41 and name c1') (residue 41 and name c2') 2 0 15 2
assign (residue 41 and name o4') (residue 41 and name c1')
       (residue 41 and name c2') (residue 41 and name c3') 2 -22 15 2
assign (residue 41 and name c1') (residue 41 and name c2')
       (residue 41 and name c3') (residue 41 and name c4') 2 36 15 2
assign (residue 41 and name c2') (residue 41 and name c3')
       (residue 41 and name c4') (residue 41 and name o4') 2 -36 15 2

assign (residue 42 and name c4') (residue 42 and name o4')
       (residue 42 and name c1') (residue 42 and name c2') 2 0 15 2
assign (residue 42 and name o4') (residue 42 and name c1')
       (residue 42 and name c2') (residue 42 and name c3') 2 -22 15 2
assign (residue 42 and name c1') (residue 42 and name c2')
       (residue 42 and name c3') (residue 42 and name c4') 2 36 15 2
assign (residue 42 and name c2') (residue 42 and name c3')
       (residue 42 and name c4') (residue 42 and name o4') 2 -36 15 2

assign (residue 43 and name c4') (residue 43 and name o4')
       (residue 43 and name c1') (residue 43 and name c2') 2 0 15 2
assign (residue 43 and name o4') (residue 43 and name c1')
       (residue 43 and name c2') (residue 43 and name c3') 2 -22 15 2
assign (residue 43 and name c1') (residue 43 and name c2')
       (residue 43 and name c3') (residue 43 and name c4') 2 36 15 2
assign (residue 43 and name c2') (residue 43 and name c3')
       (residue 43 and name c4') (residue 43 and name o4') 2 -36 15 2

assign (residue 44 and name c4') (residue 44 and name o4')
       (residue 44 and name c1') (residue 44 and name c2') 2 0 15 2
assign (residue 44 and name o4') (residue 44 and name c1')
       (residue 44 and name c2') (residue 44 and name c3') 2 -22 15 2
assign (residue 44 and name c1') (residue 44 and name c2')
       (residue 44 and name c3') (residue 44 and name c4') 2 36 15 2
assign (residue 44 and name c2') (residue 44 and name c3')
       (residue 44 and name c4') (residue 44 and name o4') 2 -36 15 2

assign (residue 45 and name c4') (residue 45 and name o4')
       (residue 45 and name c1') (residue 45 and name c2') 2 0 15 2
assign (residue 45 and name o4') (residue 45 and name c1')
       (residue 45 and name c2') (residue 45 and name c3') 2 -22 15 2
assign (residue 45 and name c1') (residue 45 and name c2')
       (residue 45 and name c3') (residue 45 and name c4') 2 36 15 2
assign (residue 45 and name c2') (residue 45 and name c3')
       (residue 45 and name c4') (residue 45 and name o4') 2 -36 15 2

assign (residue 46 and name c4') (residue 46 and name o4')
       (residue 46 and name c1') (residue 46 and name c2') 2 0 15 2
assign (residue 46 and name o4') (residue 46 and name c1')
       (residue 46 and name c2') (residue 46 and name c3') 2 -22 15 2
assign (residue 46 and name c1') (residue 46 and name c2')
       (residue 46 and name c3') (residue 46 and name c4') 2 36 15 2
assign (residue 46 and name c2') (residue 46 and name c3')
       (residue 46 and name c4') (residue 46 and name o4') 2 -36 15 2

assign (residue 47 and name c4') (residue 47 and name o4')
       (residue 47 and name c1') (residue 47 and name c2') 2 0 15 2
assign (residue 47 and name o4') (residue 47 and name c1')
       (residue 47 and name c2') (residue 47 and name c3') 2 -22 15 2
assign (residue 47 and name c1') (residue 47 and name c2')
       (residue 47 and name c3') (residue 47 and name c4') 2 36 15 2
assign (residue 47 and name c2') (residue 47 and name c3')
       (residue 47 and name c4') (residue 47 and name o4') 2 -36 15 2

assign (residue 48 and name c4') (residue 48 and name o4')
       (residue 48 and name c1') (residue 48 and name c2') 2 0 15 2
assign (residue 48 and name o4') (residue 48 and name c1')
       (residue 48 and name c2') (residue 48 and name c3') 2 -22 15 2
assign (residue 48 and name c1') (residue 48 and name c2')
       (residue 48 and name c3') (residue 48 and name c4') 2 36 15 2
assign (residue 48 and name c2') (residue 48 and name c3')
       (residue 48 and name c4') (residue 48 and name o4') 2 -36 15 2

assign (residue 25 and name c4') (residue 25 and name o4')
       (residue 25 and name c1') (residue 25 and name c2') 2 -18 15 2
assign (residue 25 and name o4') (residue 25 and name c1')
       (residue 25 and name c2') (residue 25 and name c3') 2 34 15 2
assign (residue 25 and name c1') (residue 25 and name c2')
       (residue 25 and name c3') (residue 25 and name c4') 2 -37 15 2
assign (residue 25 and name c2') (residue 25 and name c3')
       (residue 25 and name c4') (residue 25 and name o4') 2 26 15 2

assign (residue 35 and name c4') (residue 35 and name o4')
       (residue 35 and name c1') (residue 35 and name c2') 2 -18 15 2
assign (residue 35 and name o4') (residue 35 and name c1')
       (residue 35 and name c2') (residue 35 and name c3') 2 34 15 2
assign (residue 35 and name c1') (residue 35 and name c2')
       (residue 35 and name c3') (residue 35 and name c4') 2 -37 15 2
assign (residue 35 and name c2') (residue 35 and name c3')
       (residue 35 and name c4') (residue 35 and name o4') 2 26 15 2

assign (residue 2 and name p) (residue 2 and name o5')
        (residue 2 and name c5') (residue 2 and name c4') 2 170 30 2
assign (residue 3 and name p) (residue 3 and name o5')
        (residue 3 and name c5') (residue 3 and name c4') 2 170 30 2
assign (residue 4 and name p) (residue 4 and name o5')
        (residue 4 and name c5') (residue 4 and name c4') 2 170 30 2
assign (residue 5 and name p) (residue 5 and name o5')
        (residue 5 and name c5') (residue 5 and name c4') 2 170 30 2
assign (residue 6 and name p) (residue 6 and name o5')
        (residue 6 and name c5') (residue 6 and name c4') 2 170 30 2
assign (residue 7 and name p) (residue 7 and name o5')
        (residue 7 and name c5') (residue 7 and name c4') 2 170 30 2
assign (residue 8 and name p) (residue 8 and name o5')
        (residue 8 and name c5') (residue 8 and name c4') 2 170 30 2
assign (residue 9 and name p) (residue 9 and name o5')
        (residue 9 and name c5') (residue 9 and name c4') 2 170 30 2
assign (residue 10 and name p) (residue 10 and name o5')
        (residue 10 and name c5') (residue 10 and name c4') 2 170 30 2
assign (residue 11 and name p) (residue 11 and name o5')
        (residue 11 and name c5') (residue 11 and name c4') 2 170 30 2
assign (residue 12 and name p) (residue 12 and name o5')
        (residue 12 and name c5') (residue 12 and name c4') 2 170 30 2
assign (residue 13 and name p) (residue 13 and name o5')
        (residue 13 and name c5') (residue 13 and name c4') 2 170 30 2
assign (residue 14 and name p) (residue 14 and name o5')
        (residue 14 and name c5') (residue 14 and name c4') 2 170 30 2
assign (residue 15 and name p) (residue 15 and name o5')
        (residue 15 and name c5') (residue 15 and name c4') 2 170 30 2
assign (residue 16 and name p) (residue 16 and name o5')
        (residue 16 and name c5') (residue 16 and name c4') 2 170 30 2
assign (residue 18 and name p) (residue 18 and name o5')
        (residue 18 and name c5') (residue 18 and name c4') 2 170 30 2
assign (residue 19 and name p) (residue 19 and name o5')
        (residue 19 and name c5') (residue 19 and name c4') 2 170 30 2
assign (residue 20 and name p) (residue 20 and name o5')
        (residue 20 and name c5') (residue 20 and name c4') 2 170 30 2
assign (residue 21 and name p) (residue 21 and name o5')
        (residue 21 and name c5') (residue 21 and name c4') 2 170 30 2
assign (residue 22 and name p) (residue 22 and name o5')
        (residue 22 and name c5') (residue 22 and name c4') 2 170 30 2
assign (residue 23 and name p) (residue 23 and name o5')
        (residue 23 and name c5') (residue 23 and name c4') 2 170 60 2
assign (residue 24 and name p) (residue 24 and name o5')
        (residue 24 and name c5') (residue 24 and name c4') 2 170 60 2
assign (residue 25 and name p) (residue 25 and name o5')
        (residue 25 and name c5') (residue 25 and name c4') 2 170 60 2
assign (residue 26 and name p) (residue 26 and name o5')
        (residue 26 and name c5') (residue 26 and name c4') 2 170 60 2
assign (residue 27 and name p) (residue 27 and name o5')
        (residue 27 and name c5') (residue 27 and name c4') 2 170 30 2
assign (residue 28 and name p) (residue 28 and name o5')
        (residue 28 and name c5') (residue 28 and name c4') 2 170 30 2
assign (residue 29 and name p) (residue 29 and name o5')
        (residue 29 and name c5') (residue 29 and name c4') 2 170 30 2
assign (residue 30 and name p) (residue 30 and name o5')
        (residue 30 and name c5') (residue 30 and name c4') 2 170 30 2
assign (residue 31 and name p) (residue 31 and name o5')
        (residue 31 and name c5') (residue 31 and name c4') 2 170 30 2
assign (residue 32 and name p) (residue 32 and name o5')
        (residue 32 and name c5') (residue 32 and name c4') 2 170 30 2
assign (residue 33 and name p) (residue 33 and name o5')
        (residue 33 and name c5') (residue 33 and name c4') 2 170 30 2
assign (residue 34 and name p) (residue 34 and name o5')
        (residue 34 and name c5') (residue 34 and name c4') 2 170 30 2
assign (residue 35 and name p) (residue 35 and name o5')
        (residue 35 and name c5') (residue 35 and name c4') 2 170 60 2
assign (residue 36 and name p) (residue 36 and name o5')
        (residue 36 and name c5') (residue 36 and name c4') 2 170 30 2
assign (residue 37 and name p) (residue 37 and name o5')
        (residue 37 and name c5') (residue 37 and name c4') 2 170 30 2
assign (residue 38 and name p) (residue 38 and name o5')
        (residue 38 and name c5') (residue 38 and name c4') 2 170 30 2
assign (residue 39 and name p) (residue 39 and name o5')
        (residue 39 and name c5') (residue 39 and name c4') 2 170 30 2
assign (residue 40 and name p) (residue 40 and name o5')
        (residue 40 and name c5') (residue 40 and name c4') 2 170 30 2
assign (residue 41 and name p) (residue 41 and name o5')
        (residue 41 and name c5') (residue 41 and name c4') 2 170 30 2
assign (residue 42 and name p) (residue 42 and name o5')
        (residue 42 and name c5') (residue 42 and name c4') 2 170 30 2
assign (residue 43 and name p) (residue 43 and name o5')
        (residue 43 and name c5') (residue 43 and name c4') 2 170 30 2
assign (residue 44 and name p) (residue 44 and name o5')
        (residue 44 and name c5') (residue 44 and name c4') 2 170 30 2
assign (residue 45 and name p) (residue 45 and name o5')
        (residue 45 and name c5') (residue 45 and name c4') 2 170 30 2
assign (residue 46 and name p) (residue 46 and name o5')
        (residue 46 and name c5') (residue 46 and name c4') 2 170 30 2
assign (residue 47 and name p) (residue 47 and name o5')
        (residue 47 and name c5') (residue 47 and name c4') 2 170 30 2
assign (residue 48 and name p) (residue 48 and name o5')
        (residue 48 and name c5') (residue 48 and name c4') 2 170 30 2

assign (residue 1 and name o5') (residue 1 and name c5')
        (residue 1 and name c4') (residue 1 and name c3') 2 55 30 2
assign (residue 2 and name o5') (residue 2 and name c5')
        (residue 2 and name c4') (residue 2 and name c3') 2 55 30 2
assign (residue 3 and name o5') (residue 3 and name c5')
        (residue 3 and name c4') (residue 3 and name c3') 2 55 30 2
assign (residue 4 and name o5') (residue 4 and name c5')
        (residue 4 and name c4') (residue 4 and name c3') 2 55 30 2
assign (residue 5 and name o5') (residue 5 and name c5')
        (residue 5 and name c4') (residue 5 and name c3') 2 55 30 2
assign (residue 6 and name o5') (residue 6 and name c5')
        (residue 6 and name c4') (residue 6 and name c3') 2 55 30 2
assign (residue 7 and name o5') (residue 7 and name c5')
        (residue 7 and name c4') (residue 7 and name c3') 2 55 30 2
assign (residue 8 and name o5') (residue 8 and name c5')
        (residue 8 and name c4') (residue 8 and name c3') 2 55 30 2
assign (residue 9 and name o5') (residue 9 and name c5')
        (residue 9 and name c4') (residue 9 and name c3') 2 55 30 2
assign (residue 10 and name o5') (residue 10 and name c5')
        (residue 10 and name c4') (residue 10 and name c3') 2 55 30 2
assign (residue 11 and name o5') (residue 11 and name c5')
        (residue 11 and name c4') (residue 11 and name c3') 2 55 30 2
assign (residue 12 and name o5') (residue 12 and name c5')
        (residue 12 and name c4') (residue 12 and name c3') 2 55 30 2
assign (residue 13 and name o5') (residue 13 and name c5')
        (residue 13 and name c4') (residue 13 and name c3') 2 55 30 2
assign (residue 14 and name o5') (residue 14 and name c5')
        (residue 14 and name c4') (residue 14 and name c3') 2 55 30 2
assign (residue 15 and name o5') (residue 15 and name c5')
        (residue 15 and name c4') (residue 15 and name c3') 2 55 30 2
assign (residue 16 and name o5') (residue 16 and name c5')
        (residue 16 and name c4') (residue 16 and name c3') 2 55 30 2
assign (residue 17 and name o5') (residue 17 and name c5')
        (residue 17 and name c4') (residue 17 and name c3') 2 55 30 2
assign (residue 18 and name o5') (residue 18 and name c5')
        (residue 18 and name c4') (residue 18 and name c3') 2 55 30 2
assign (residue 19 and name o5') (residue 19 and name c5')
        (residue 19 and name c4') (residue 19 and name c3') 2 55 30 2
assign (residue 20 and name o5') (residue 20 and name c5')
        (residue 20 and name c4') (residue 20 and name c3') 2 55 30 2
assign (residue 21 and name o5') (residue 21 and name c5')
        (residue 21 and name c4') (residue 21 and name c3') 2 55 30 2
assign (residue 22 and name o5') (residue 22 and name c5')
        (residue 22 and name c4') (residue 22 and name c3') 2 55 30 2
assign (residue 23 and name o5') (residue 23 and name c5')
        (residue 23 and name c4') (residue 23 and name c3') 2 55 60 2
assign (residue 24 and name o5') (residue 24 and name c5')
        (residue 24 and name c4') (residue 24 and name c3') 2 55 60 2

assign (residue 26 and name o5') (residue 26 and name c5')
        (residue 26 and name c4') (residue 26 and name c3') 2 55 60 2
assign (residue 27 and name o5') (residue 27 and name c5')
        (residue 27 and name c4') (residue 27 and name c3') 2 55 30 2
assign (residue 28 and name o5') (residue 28 and name c5')
        (residue 28 and name c4') (residue 28 and name c3') 2 55 30 2
assign (residue 29 and name o5') (residue 29 and name c5')
        (residue 29 and name c4') (residue 29 and name c3') 2 55 30 2
assign (residue 30 and name o5') (residue 30 and name c5')
        (residue 30 and name c4') (residue 30 and name c3') 2 55 30 2
assign (residue 31 and name o5') (residue 31 and name c5')
        (residue 31 and name c4') (residue 31 and name c3') 2 55 30 2
assign (residue 32 and name o5') (residue 32 and name c5')
        (residue 32 and name c4') (residue 32 and name c3') 2 55 30 2
assign (residue 33 and name o5') (residue 33 and name c5')
        (residue 33 and name c4') (residue 33 and name c3') 2 55 30 2
assign (residue 34 and name o5') (residue 34 and name c5')
        (residue 34 and name c4') (residue 34 and name c3') 2 55 30 2

assign (residue 36 and name o5') (residue 36 and name c5')
        (residue 36 and name c4') (residue 36 and name c3') 2 55 30 2
assign (residue 37 and name o5') (residue 37 and name c5')
        (residue 37 and name c4') (residue 37 and name c3') 2 55 30 2
assign (residue 38 and name o5') (residue 38 and name c5')
        (residue 38 and name c4') (residue 38 and name c3') 2 55 30 2
assign (residue 39 and name o5') (residue 39 and name c5')
        (residue 39 and name c4') (residue 39 and name c3') 2 55 30 2
assign (residue 40 and name o5') (residue 40 and name c5')
        (residue 40 and name c4') (residue 40 and name c3') 2 55 30 2
assign (residue 41 and name o5') (residue 41 and name c5')
        (residue 41 and name c4') (residue 41 and name c3') 2 55 30 2
assign (residue 42 and name o5') (residue 42 and name c5')
        (residue 42 and name c4') (residue 42 and name c3') 2 55 30 2
assign (residue 43 and name o5') (residue 43 and name c5')
        (residue 43 and name c4') (residue 43 and name c3') 2 55 30 2
assign (residue 44 and name o5') (residue 44 and name c5')
        (residue 44 and name c4') (residue 44 and name c3') 2 55 30 2
assign (residue 45 and name o5') (residue 45 and name c5')
        (residue 45 and name c4') (residue 45 and name c3') 2 55 30 2
assign (residue 46 and name o5') (residue 46 and name c5')
        (residue 46 and name c4') (residue 46 and name c3') 2 55 30 2
assign (residue 47 and name o5') (residue 47 and name c5')
        (residue 47 and name c4') (residue 47 and name c3') 2 55 30 2
assign (residue 48 and name o5') (residue 48 and name c5')
        (residue 48 and name c4') (residue 48 and name c3') 2 55 30 2

assign (residue 25 and name o5') (residue 25 and name c5')
        (residue 25 and name c4') (residue 25 and name c3') 2 155 60 2
assign (residue 35 and name o5') (residue 35 and name c5')
        (residue 35 and name c4') (residue 35 and name c3') 2 155 60 2

assign (residue 1 and name c4') (residue 1 and name c3')
        (residue 1 and name o3') (residue 2 and name p) 2 -155 30 2
assign (residue 2 and name c4') (residue 2 and name c3')
        (residue 2 and name o3') (residue 3 and name p) 2 -155 30 2
assign (residue 3 and name c4') (residue 3 and name c3')
        (residue 3 and name o3') (residue 4 and name p) 2 -155 30 2
assign (residue 4 and name c4') (residue 4 and name c3')
        (residue 4 and name o3') (residue 5 and name p) 2 -155 30 2
assign (residue 5 and name c4') (residue 5 and name c3')
        (residue 5 and name o3') (residue 6 and name p) 2 -155 30 2
assign (residue 6 and name c4') (residue 6 and name c3')
        (residue 6 and name o3') (residue 7 and name p) 2 -155 30 2
assign (residue 7 and name c4') (residue 7 and name c3')
        (residue 7 and name o3') (residue 8 and name p) 2 -155 30 2
assign (residue 8 and name c4') (residue 8 and name c3')
        (residue 8 and name o3') (residue 9 and name p) 2 -155 30 2
assign (residue 9 and name c4') (residue 9 and name c3')
        (residue 9 and name o3') (residue 10 and name p) 2 -155 30 2
assign (residue 10 and name c4') (residue 10 and name c3')
        (residue 10 and name o3') (residue 11 and name p) 2 -155 30 2
assign (residue 11 and name c4') (residue 11 and name c3')
        (residue 11 and name o3') (residue 12 and name p) 2 -155 30 2
assign (residue 12 and name c4') (residue 12 and name c3')
        (residue 12 and name o3') (residue 13 and name p) 2 -155 30 2
assign (residue 13 and name c4') (residue 13 and name c3')
        (residue 13 and name o3') (residue 14 and name p) 2 -155 30 2
assign (residue 14 and name c4') (residue 14 and name c3')
        (residue 14 and name o3') (residue 15 and name p) 2 -155 30 2
assign (residue 15 and name c4') (residue 15 and name c3')
        (residue 15 and name o3') (residue 16 and name p) 2 -155 30 2
assign (residue 17 and name c4') (residue 17 and name c3')
        (residue 17 and name o3') (residue 18 and name p) 2 -155 30 2
assign (residue 18 and name c4') (residue 18 and name c3')
        (residue 18 and name o3') (residue 19 and name p) 2 -155 30 2
assign (residue 19 and name c4') (residue 19 and name c3')
        (residue 19 and name o3') (residue 20 and name p) 2 -155 30 2
assign (residue 20 and name c4') (residue 20 and name c3')
        (residue 20 and name o3') (residue 21 and name p) 2 -155 30 2
assign (residue 21 and name c4') (residue 21 and name c3')
        (residue 21 and name o3') (residue 22 and name p) 2 -155 30 2
assign (residue 22 and name c4') (residue 22 and name c3')
        (residue 22 and name o3') (residue 23 and name p) 2 -155 30 2
assign (residue 23 and name c4') (residue 23 and name c3')
        (residue 23 and name o3') (residue 24 and name p) 2 -90 90 2
assign (residue 24 and name c4') (residue 24 and name c3')
        (residue 24 and name o3') (residue 25 and name p) 2 -90 90 2
assign (residue 25 and name c4') (residue 25 and name c3')
        (residue 25 and name o3') (residue 26 and name p) 2 -90 90 2
assign (residue 26 and name c4') (residue 26 and name c3')
        (residue 26 and name o3') (residue 27 and name p) 2 -90 90 2
assign (residue 27 and name c4') (residue 27 and name c3')
        (residue 27 and name o3') (residue 28 and name p) 2 -155 30 2
assign (residue 28 and name c4') (residue 28 and name c3')
        (residue 28 and name o3') (residue 29 and name p) 2 -155 30 2
assign (residue 29 and name c4') (residue 29 and name c3')
        (residue 29 and name o3') (residue 30 and name p) 2 -155 30 2
assign (residue 30 and name c4') (residue 30 and name c3')
        (residue 30 and name o3') (residue 31 and name p) 2 -155 30 2
assign (residue 31 and name c4') (residue 31 and name c3')
        (residue 31 and name o3') (residue 32 and name p) 2 -155 30 2
assign (residue 32 and name c4') (residue 32 and name c3')
        (residue 32 and name o3') (residue 33 and name p) 2 -155 30 2
assign (residue 33 and name c4') (residue 33 and name c3')
        (residue 33 and name o3') (residue 34 and name p) 2 -155 30 2
assign (residue 34 and name c4') (residue 34 and name c3')
        (residue 34 and name o3') (residue 35 and name p) 2 -155 30 2
assign (residue 35 and name c4') (residue 35 and name c3')
        (residue 35 and name o3') (residue 36 and name p) 2 -90 90 2
assign (residue 36 and name c4') (residue 36 and name c3')
        (residue 36 and name o3') (residue 37 and name p) 2 -155 30 2
assign (residue 37 and name c4') (residue 37 and name c3')
        (residue 37 and name o3') (residue 38 and name p) 2 -155 30 2
assign (residue 38 and name c4') (residue 38 and name c3')
        (residue 38 and name o3') (residue 39 and name p) 2 -155 30 2
assign (residue 39 and name c4') (residue 39 and name c3')
        (residue 39 and name o3') (residue 40 and name p) 2 -155 30 2
assign (residue 40 and name c4') (residue 40 and name c3')
        (residue 40 and name o3') (residue 41 and name p) 2 -155 30 2
assign (residue 41 and name c4') (residue 41 and name c3')
        (residue 41 and name o3') (residue 42 and name p) 2 -155 30 2
assign (residue 42 and name c4') (residue 42 and name c3')
        (residue 42 and name o3') (residue 43 and name p) 2 -155 30 2
assign (residue 43 and name c4') (residue 43 and name c3')
        (residue 43 and name o3') (residue 44 and name p) 2 -155 30 2
assign (residue 44 and name c4') (residue 44 and name c3')
        (residue 44 and name o3') (residue 45 and name p) 2 -155 30 2
assign (residue 45 and name c4') (residue 45 and name c3')
        (residue 45 and name o3') (residue 46 and name p) 2 -155 30 2
assign (residue 46 and name c4') (residue 46 and name c3')
        (residue 46 and name o3') (residue 47 and name p) 2 -155 30 2
assign (residue 47 and name c4') (residue 47 and name c3')
        (residue 47 and name o3') (residue 48 and name p) 2 -155 30 2

{global RDCs}
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c8 )(residue 1 and name h8 ) 23.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 2 and name c8 )(residue 2 and name h8 ) 21.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 3 and name c8 )(residue 3 and name h8 ) 24.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 4 and name c8 )(residue 4 and name h8 ) 26.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 5 and name c5 )(residue 5 and name h5 ) 23.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 5 and name c6 )(residue 5 and name h6 ) 23.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 6 and name c5 )(residue 6 and name h5 ) 21.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 7 and name c8 )(residue 7 and name h8 ) 27.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 8 and name c8 )(residue 8 and name h8 ) 22.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 9 and name c5 )(residue 9 and name h5 ) 20.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 10 and name c8 )(residue 10 and name h8 ) 25.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 11 and name c5 )(residue 11 and name h5 ) 24.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c8 )(residue 12 and name h8 ) 17.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 13 and name c5 )(residue 13 and name h5 ) 17.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c2 )(residue 19 and name h2 ) 25.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c8 )(residue 20 and name h8 ) 17.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c5 )(residue 21 and name h5 ) 12.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c6 )(residue 21 and name h6 ) 15.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c5 )(residue 22 and name h5 ) 11.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c2 )(residue 23 and name h2 ) 16.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c8 )(residue 23 and name h8 ) 10.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c8 )(residue 24 and name h8 ) 10.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c5 )(residue 26 and name h5 ) 12.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c5 )(residue 27 and name h5 ) 9.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 29 and name c5 )(residue 29 and name h5 ) 13.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c2 )(residue 31 and name h2 ) 24.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c8 )(residue 31 and name h8 ) 26.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 32 and name c2 )(residue 32 and name h2 ) 27.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 32 and name c8 )(residue 32 and name h8 ) 24.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 33 and name c2 )(residue 33 and name h2 ) 29.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 33 and name c8 )(residue 33 and name h8 ) 23.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c2 )(residue 34 and name h2 ) 24.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c8 )(residue 34 and name h8 ) 18.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c2 )(residue 37 and name h2 ) 20.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c8 )(residue 37 and name h8 ) 19.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c5 )(residue 38 and name h5 ) 12.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c6 )(residue 38 and name h6 ) 19.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c2 )(residue 39 and name h2 ) 23.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c8 )(residue 39 and name h8 ) 21.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c8 )(residue 40 and name h8 ) 17.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c5 )(residue 41 and name h5 ) 12.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c6 )(residue 41 and name h6 ) 23.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c5 )(residue 42 and name h5 ) 10.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c2 )(residue 43 and name h2 ) 24.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c8 )(residue 44 and name h8 ) 28.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c5 )(residue 45 and name h5 ) 21.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c6 )(residue 45 and name h6 ) 17.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c5 )(residue 46 and name h5 ) 19.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c6 )(residue 46 and name h6 ) 19.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c5 )(residue 47 and name h5 ) 27.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c6 )(residue 48 and name h6 ) 12.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c2' )(residue 1 and name h2'' ) 5.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c4' )(residue 1 and name h4' ) 21.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 3 and name c1' )(residue 3 and name h1' ) -41.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 3 and name c3' )(residue 3 and name h3' ) 13.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 5 and name c1' )(residue 5 and name h1' ) -14.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 8 and name c3' )(residue 8 and name h3' ) 21.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c1' )(residue 12 and name h1' ) -26.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 13 and name c1' )(residue 13 and name h1' ) -32.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 13 and name c2' )(residue 13 and name h2'' ) 20.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 18 and name c3' )(residue 18 and name h3' ) 13.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c3' )(residue 20 and name h3' ) 21.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c1' )(residue 21 and name h1' ) -14.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c2' )(residue 21 and name h2'' ) 15.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c3' )(residue 21 and name h3' ) 9.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c1' )(residue 22 and name h1' ) -4.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c4' )(residue 22 and name h4' ) 11.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c1' )(residue 23 and name h1' ) 2.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c4' )(residue 23 and name h4' ) -5.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c1' )(residue 24 and name h1' ) 11.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c2' )(residue 24 and name h2'' ) -3.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c4' )(residue 24 and name h4' ) 12.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c1' )(residue 26 and name h1' ) -16.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c4' )(residue 26 and name h4' ) 8.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c2' )(residue 27 and name h2'' ) 4.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c3' )(residue 27 and name h3' ) 7.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c1' )(residue 28 and name h1' ) -32.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c3' )(residue 28 and name h3' ) 10.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c4' )(residue 28 and name h4' ) 22.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 30 and name c3' )(residue 30 and name h3' ) 19.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c1' )(residue 34 and name h1' ) -5.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c2' )(residue 34 and name h2'' ) 3.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c1' )(residue 35 and name h1' ) -2.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c2' )(residue 35 and name h2'' ) 2.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c4' )(residue 35 and name h4' ) 11.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 36 and name c2' )(residue 36 and name h2'' ) 21.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c1' )(residue 37 and name h1' ) -31.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c2' )(residue 37 and name h2'' ) -0.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c3' )(residue 37 and name h3' ) 0.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c1' )(residue 38 and name h1' ) -26.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c1' )(residue 39 and name h1' ) -17.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c3' )(residue 40 and name h3' ) 6.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c4' )(residue 40 and name h4' ) 16.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c4' )(residue 41 and name h4' ) 15.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c3' )(residue 44 and name h3' ) 11.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c3' )(residue 45 and name h3' ) 13.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c1' )(residue 46 and name h1' ) -9.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c1' )(residue 47 and name h1' ) -6.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c2' )(residue 47 and name h2'' ) 11.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c3' )(residue 47 and name h3' ) 23.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c1' )(residue 48 and name h1' ) 1.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c2' )(residue 48 and name h2'' ) 18.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c3' )(residue 48 and name h3' ) 18.3 2.5
{local RDCs for lower helix}
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 2 and name c8 )(residue 2 and name h8 ) 6.9 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 3 and name c8 )(residue 3 and name h8 ) 6.1 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 4 and name c8 )(residue 4 and name h8 ) 5.7 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 5 and name c5 )(residue 5 and name h5 ) 5.5 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 5 and name c6 )(residue 5 and name h6 ) 13.3 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 6 and name c5 )(residue 6 and name h5 ) 8.8 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 6 and name c6 )(residue 6 and name h6 ) 14.0 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 7 and name c8 )(residue 7 and name h8 ) 13.6 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 8 and name c8 )(residue 8 and name h8 ) 13.7 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 41 and name c5 )(residue 41 and name h5 ) 15.8 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 41 and name c6 )(residue 41 and name h6 ) 10.3 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 42 and name c6 )(residue 42 and name h6 ) 10.1 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 43 and name c2 )(residue 43 and name h2 ) 12.9 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 43 and name c8 )(residue 43 and name h8 ) 13.9 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 44 and name c8 )(residue 44 and name h8 ) 15.1 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 45 and name c6 )(residue 45 and name h6 ) 6.2 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 46 and name c5 )(residue 46 and name h5 ) 12.2 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 46 and name c6 )(residue 46 and name h6 ) 6.8 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 47 and name c6 )(residue 47 and name h6 ) -1.1 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 2 and name c1' )(residue 2 and name h1' ) -9.6 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 3 and name c1' )(residue 3 and name h1' ) -15.1 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 3 and name c3' )(residue 3 and name h3' ) 12.5 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 4 and name c2' )(residue 4 and name h2'' ) 9.6 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 4 and name c3' )(residue 4 and name h3' ) 9.0 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 5 and name c1' )(residue 5 and name h1' ) -19.2 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 5 and name c2' )(residue 5 and name h2'' ) 9.0 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 5 and name c3' )(residue 5 and name h3' ) -2.8 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 6 and name c1' )(residue 6 and name h1' ) -12.5 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 6 and name c3' )(residue 6 and name h3' ) 0.5 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 7 and name c1' )(residue 7 and name h1' ) -10.9 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 7 and name c2' )(residue 7 and name h2'' ) 6.2 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 8 and name c1' )(residue 8 and name h1' ) -12.7 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 8 and name c2' )(residue 8 and name h2'' ) 6.9 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 41 and name c1' )(residue 41 and name h1' ) -8.8 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 41 and name c2' )(residue 41 and name h2'' ) 3.3 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 42 and name c1' )(residue 42 and name h1' ) -4.2 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 42 and name c2' )(residue 42 and name h2'' ) 4.5 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 43 and name c1' )(residue 43 and name h1' ) -2.7 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 43 and name c3' )(residue 43 and name h3' ) 12.8 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 44 and name c1' )(residue 44 and name h1' ) -8.0 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 44 and name c2' )(residue 44 and name h2'' ) 13.7 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 44 and name c3' )(residue 44 and name h3' ) 12.0 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 45 and name c3' )(residue 45 and name h3' ) 11.1 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 46 and name c1' )(residue 46 and name h1' ) -13.9 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 46 and name c2' )(residue 46 and name h2'' ) 10.3 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 47 and name c1' )(residue 47 and name h1' ) -14.4 2.5
assign (residue 499 and name OO)(residue 499 and name Z)(residue 499 and name X) (residue 499 and name Y)
(residue 47 and name c2' )(residue 47 and name h2'' ) 9.7 2.5

  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1    H5'    G   1           H5'        G   1  -0.421   3.602 -44.114
    2   H5''    G   1          H5''        G   1   0.754   4.845 -43.639
    3    H4'    G   1           H4'        G   1  -1.023   5.756 -45.155
    4    H3'    G   1           H3'        G   1  -0.520   6.648 -42.333
    5    H2'    G   1          H2''        G   1  -2.423   7.853 -42.121
    6   HO2'    G   1          H2'         G   1  -1.915   9.296 -43.780
    7    H1'    G   1           H1'        G   1  -3.989   6.691 -44.224
    8    H8     G   1           H8         G   1  -3.232   4.297 -41.384
    9    H1     G   1           H1         G   1  -8.078   8.326 -40.193
   10    H21    G   1           H21        G   1  -8.119   9.927 -41.712
   11    H22    G   1           H22        G   1  -7.078   9.904 -43.118
   12   HO5'    G   1          H5T         G   1  -1.384   3.768 -42.122
   13    H5'    G   2           H5'        G   2   0.189  11.216 -44.764
   14   H5''    G   2          H5''        G   2   0.671  11.899 -43.200
   15    H4'    G   2           H4'        G   2  -1.379  12.923 -44.601
   16    H3'    G   2           H3'        G   2  -0.957  12.521 -41.630
   17    H2'    G   2          H2''        G   2  -3.107  13.316 -41.137
   18   HO2'    G   2          H2'         G   2  -3.260  14.252 -43.822
   19    H1'    G   2           H1'        G   2  -4.463  12.113 -43.201
   20    H8     G   2           H8         G   2  -1.961   9.659 -41.830
   21    H1     G   2           H1         G   2  -7.061  10.493 -38.033
   22    H21    G   2           H21        G   2  -8.263  12.196 -38.764
   23    H22    G   2           H22        G   2  -7.711  13.242 -40.053
   24    H5'    G   3           H5'        G   3  -1.299  17.389 -41.615
   25   H5''    G   3          H5''        G   3  -0.785  17.614 -39.933
   26    H4'    G   3           H4'        G   3  -3.276  18.236 -40.745
   27    H3'    G   3           H3'        G   3  -2.324  16.932 -38.170
   28    H2'    G   3          H2''        G   3  -4.534  17.027 -37.345
   29   HO2'    G   3          H2'         G   3  -5.632  18.744 -37.875
   30    H1'    G   3           H1'        G   3  -5.689  16.098 -39.698
   31    H8     G   3           H8         G   3  -2.724  13.971 -39.517
   32    H1     G   3           H1         G   3  -6.861  12.598 -34.813
   33    H21    G   3           H21        G   3  -8.343  14.215 -34.608
   34    H22    G   3           H22        G   3  -8.245  15.699 -35.529
   35    H5'    G   4           H5'        G   4  -4.226  19.690 -36.630
   36   H5''    G   4          H5''        G   4  -3.448  20.899 -35.589
   37    H4'    G   4           H4'        G   4  -5.126  19.990 -34.188
   38    H3'    G   4           H3'        G   4  -2.416  18.695 -33.863
   39    H2'    G   4          H2''        G   4  -3.201  17.166 -32.325
   40   HO2'    G   4          H2'         G   4  -4.367  18.059 -30.814
   41    H1'    G   4           H1'        G   4  -5.745  16.772 -33.390
   42    H8     G   4           H8         G   4  -2.948  16.540 -35.997
   43    H1     G   4           H1         G   4  -3.578  11.305 -32.342
   44    H21    G   4           H21        G   4  -5.034  11.704 -30.722
   45    H22    G   4           H22        G   4  -5.691  13.297 -30.429
   46    H5'    U   5           H5'        U   5  -3.830  20.073 -29.322
   47   H5''    U   5          H5''        U   5  -2.216  20.005 -28.589
   48    H4'    U   5           H4'        U   5  -4.197  18.506 -27.627
   49    H3'    U   5           H3'        U   5  -1.266  17.945 -28.073
   50    H2'    U   5          H2''        U   5  -1.463  15.700 -27.530
   51   HO2'    U   5          H2'         U   5  -3.988  16.207 -26.326
   52    H1'    U   5           H1'        U   5  -4.049  15.218 -28.447
   53    H3     U   5           H3         U   5  -1.067  12.416 -30.506
   54    H5     U   5           H5         U   5  -0.563  16.133 -32.426
   55    H6     U   5           H6         U   5  -2.127  17.087 -30.832
   56    H5'    U   6           H5'        U   6  -2.478  16.406 -23.932
   57   H5''    U   6          H5''        U   6  -1.169  16.966 -22.873
   58    H4'    U   6           H4'        U   6  -1.631  14.585 -22.446
   59    H3'    U   6           H3'        U   6   0.945  15.434 -23.786
   60    H2'    U   6          H2''        U   6   1.681  13.220 -23.966
   61   HO2'    U   6          H2'         U   6  -0.384  12.439 -22.171
   62    H1'    U   6           H1'        U   6  -0.770  12.030 -24.523
   63    H3     U   6           H3         U   6   1.742  11.421 -28.263
   64    H5     U   6           H5         U   6   0.863  15.540 -28.278
   65    H6     U   6           H6         U   6  -0.197  15.253 -26.118
   66    H5'    G   7           H5'        G   7   3.085  14.128 -19.964
   67   H5''    G   7          H5''        G   7   4.667  14.875 -20.257
   68    H4'    G   7           H4'        G   7   4.266  12.241 -20.620
   69    H3'    G   7           H3'        G   7   5.926  14.266 -22.142
   70    H2'    G   7          H2''        G   7   6.465  12.731 -23.782
   71   HO2'    G   7          H2'         G   7   7.359  11.182 -22.409
   72    H1'    G   7           H1'        G   7   4.166  11.056 -23.547
   73    H8     G   7           H8         G   7   3.050  14.467 -24.551
   74    H1     G   7           H1         G   7   6.130  11.378 -29.256
   75    H21    G   7           H21        G   7   7.062   9.543 -28.467
   76    H22    G   7           H22        G   7   7.112   9.187 -26.756
   77    H5'    G   8           H5'        G   8   9.230  10.637 -20.437
   78   H5''    G   8          H5''        G   8  10.616  11.664 -20.847
   79    H4'    G   8           H4'        G   8  10.471   9.170 -21.765
   80    H3'    G   8           H3'        G   8  11.302  11.725 -23.167
   81    H2'    G   8          H2''        G   8  11.800  10.527 -25.120
   82   HO2'    G   8          H2'         G   8  12.624   8.607 -24.995
   83    H1'    G   8           H1'        G   8   9.624   8.806 -25.010
   84    H8     G   8           H8         G   8   8.162  12.107 -24.213
   85    H1     G   8           H1         G   8   9.989  11.723 -30.346
   86    H21    G   8           H21        G   8  11.267   9.953 -30.647
   87    H22    G   8           H22        G   8  11.810   8.954 -29.318
   88    H5'    U   9           H5'        U   9  14.730   9.543 -23.600
   89   H5''    U   9          H5''        U   9  16.236  10.482 -23.562
   90    H4'    U   9           H4'        U   9  15.735   9.547 -25.837
   91    H3'    U   9           H3'        U   9  16.015  12.451 -25.152
   92    H2'    U   9          H2''        U   9  15.173  13.248 -27.133
   93   HO2'    U   9          H2'         U   9  16.702  12.335 -28.464
   94    H1'    U   9           H1'        U   9  13.657  11.017 -27.993
   95    H3     U   9           H3         U   9  11.072  14.748 -28.432
   96    H5     U   9           H5         U   9  11.087  13.918 -24.301
   97    H6     U   9           H6         U   9  12.773  12.231 -24.712
   98    H5'    G  10           H5'        G  10  20.234  12.359 -27.812
   99   H5''    G  10          H5''        G  10  20.901  13.647 -26.789
  100    H4'    G  10           H4'        G  10  20.524  14.059 -29.392
  101    H3'    G  10           H3'        G  10  20.208  15.767 -26.955
  102    H2'    G  10          H2''        G  10  18.961  17.420 -27.952
  103   HO2'    G  10          H2'         G  10  20.303  18.019 -29.577
  104    H1'    G  10           H1'        G  10  17.669  16.003 -29.973
  105    H8     G  10           H8         G  10  16.942  14.138 -26.855
  106    H1     G  10           H1         G  10  13.907  19.782 -27.030
  107    H21    G  10           H21        G  10  14.714  21.027 -28.663
  108    H22    G  10           H22        G  10  16.124  20.556 -29.585
  109    H5'    U  11           H5'        U  11  22.960  19.065 -29.780
  110   H5''    U  11          H5''        U  11  23.532  19.731 -28.239
  111    H4'    U  11           H4'        U  11  22.297  21.295 -30.001
  112    H3'    U  11           H3'        U  11  22.109  21.117 -26.992
  113    H2'    U  11          H2''        U  11  20.408  22.711 -26.890
  114   HO2'    U  11          H2'         U  11  21.232  23.459 -29.503
  115    H1'    U  11           H1'        U  11  19.054  22.051 -29.214
  116    H3     U  11           H3         U  11  16.341  21.425 -25.567
  117    H5     U  11           H5         U  11  18.675  17.933 -25.840
  118    H6     U  11           H6         U  11  20.028  19.046 -27.520
  119    H5'    A  12           H5'        A  12  23.448  25.441 -26.912
  120   H5''    A  12          H5''        A  12  23.779  25.601 -25.177
  121    H4'    A  12           H4'        A  12  21.528  26.579 -26.262
  122    H3'    A  12           H3'        A  12  22.091  25.226 -23.616
  123    H2'    A  12          H2''        A  12  19.835  25.217 -23.024
  124   HO2'    A  12          H2'         A  12  19.323  27.347 -23.418
  125    H1'    A  12           H1'        A  12  18.738  24.782 -25.541
  126    H8     A  12           H8         A  12  21.354  22.171 -25.260
  127    H61    A  12           H61        A  12  17.658  19.181 -21.310
  128    H62    A  12           H62        A  12  18.994  19.021 -22.429
  129    H2     A  12           H2         A  12  16.065  23.342 -21.827
  130    H5'    U  13           H5'        U  13  20.090  29.074 -21.662
  131   H5''    U  13          H5''        U  13  20.965  28.886 -20.131
  132    H4'    U  13           H4'        U  13  18.316  28.646 -20.212
  133    H3'    U  13           H3'        U  13  20.434  27.116 -18.698
  134    H2'    U  13          H2''        U  13  18.895  25.548 -17.892
  135   HO2'    U  13          H2'         U  13  17.277  26.518 -16.958
  136    H1'    U  13           H1'        U  13  17.060  25.584 -19.992
  137    H3     U  13           H3         U  13  18.588  21.328 -19.090
  138    H5     U  13           H5         U  13  21.526  23.100 -21.531
  139    H6     U  13           H6         U  13  20.387  25.219 -21.257
  140    H5'    U  14           H5'        U  14  17.170  28.256 -15.982
  141   H5''    U  14          H5''        U  14  17.833  29.094 -14.564
  142    H4'    U  14           H4'        U  14  16.194  27.410 -13.830
  143    H3'    U  14           H3'        U  14  19.117  27.238 -13.248
  144    H2'    U  14          H2''        U  14  19.161  25.040 -12.623
  145   HO2'    U  14          H2'         U  14  16.474  25.459 -11.820
  146    H1'    U  14           H1'        U  14  16.901  24.018 -13.916
  147    H3     U  14           H3         U  14  20.203  21.244 -15.246
  148    H5     U  14           H5         U  14  21.209  24.920 -17.039
  149    H6     U  14           H6         U  14  19.390  25.944 -15.803
  150    H5'    U  15           H5'        U  15  16.774  26.165  -9.039
  151   H5''    U  15          H5''        U  15  18.129  26.364  -7.910
  152    H4'    U  15           H4'        U  15  16.876  24.019  -8.121
  153    H3'    U  15           H3'        U  15  19.751  24.786  -7.729
  154    H2'    U  15          H2''        U  15  20.600  22.715  -8.213
  155   HO2'    U  15          H2'         U  15  19.680  21.510  -6.655
  156    H1'    U  15           H1'        U  15  18.473  21.630  -9.745
  157    H3     U  15           H3         U  15  22.321  20.761 -12.013
  158    H5     U  15           H5         U  15  21.666  24.886 -12.556
  159    H6     U  15           H6         U  15  19.877  24.751 -10.928
  160    H5'    U  16           H5'        U  16  19.206  21.155  -4.383
  161   H5''    U  16          H5''        U  16  20.468  21.824  -3.330
  162    H4'    U  16           H4'        U  16  20.748  19.374  -4.249
  163    H3'    U  16           H3'        U  16  22.693  21.650  -4.005
  164    H2'    U  16          H2''        U  16  24.303  20.701  -5.319
  165   HO2'    U  16          H2'         U  16  24.937  18.861  -4.540
  166    H1'    U  16           H1'        U  16  22.729  18.846  -6.796
  167    H3     U  16           H3         U  16  25.358  20.852  -9.889
  168    H5     U  16           H5         U  16  22.785  23.926  -8.589
  169    H6     U  16           H6         U  16  21.949  22.416  -6.885
  170    H5'    U  17           H5'        U  17  25.097  17.725  -1.841
  171   H5''    U  17          H5''        U  17  26.303  18.775  -1.074
  172    H4'    U  17           H4'        U  17  27.065  16.844  -2.744
  173    H3'    U  17           H3'        U  17  28.031  19.659  -2.302
  174    H2'    U  17          H2''        U  17  29.337  19.715  -4.188
  175   HO2'    U  17          H2'         U  17  29.613  16.953  -3.704
  176    H1'    U  17           H1'        U  17  28.044  17.718  -5.741
  177    H3     U  17           H3         U  17  28.672  21.308  -8.450
  178    H5     U  17           H5         U  17  25.681  22.550  -5.756
  179    H6     U  17           H6         U  17  26.044  20.496  -4.514
  180    H5'    A  18           H5'        A  18  32.000  16.630  -2.224
  181   H5''    A  18          H5''        A  18  33.126  17.766  -1.460
  182    H4'    A  18           H4'        A  18  33.719  16.674  -3.809
  183    H3'    A  18           H3'        A  18  34.089  19.468  -2.734
  184    H2'    A  18          H2''        A  18  34.694  20.336  -4.767
  185   HO2'    A  18          H2'         A  18  35.694  17.741  -5.326
  186    H1'    A  18           H1'        A  18  33.537  18.351  -6.473
  187    H8     A  18           H8         A  18  31.055  20.407  -4.469
  188    H61    A  18           H61        A  18  31.493  24.651  -8.941
  189    H62    A  18           H62        A  18  30.549  24.091  -7.579
  190    H2     A  18           H2         A  18  34.675  21.564  -9.631
  191    H5'    A  19           H5'        A  19  38.668  18.147  -4.321
  192   H5''    A  19          H5''        A  19  39.473  19.430  -3.398
  193    H4'    A  19           H4'        A  19  39.759  19.297  -6.039
  194    H3'    A  19           H3'        A  19  39.366  21.641  -4.176
  195    H2'    A  19          H2''        A  19  39.114  23.140  -5.899
  196   HO2'    A  19          H2'         A  19  40.339  23.110  -7.656
  197    H1'    A  19           H1'        A  19  38.293  21.324  -7.944
  198    H8     A  19           H8         A  19  35.915  21.665  -4.994
  199    H61    A  19           H61        A  19  33.643  26.655  -7.835
  200    H62    A  19           H62        A  19  33.348  25.438  -6.614
  201    H2     A  19           H2         A  19  37.374  25.400  -9.991
  202    H5'    A  20           H5'        A  20  42.737  22.414  -7.151
  203   H5''    A  20          H5''        A  20  43.960  23.371  -6.292
  204    H4'    A  20           H4'        A  20  43.316  24.409  -8.473
  205    H3'    A  20           H3'        A  20  42.800  25.711  -5.800
  206    H2'    A  20          H2''        A  20  41.692  27.511  -6.745
  207   HO2'    A  20          H2'         A  20  42.260  28.393  -8.611
  208    H1'    A  20           H1'        A  20  40.669  26.237  -9.043
  209    H8     A  20           H8         A  20  39.873  24.790  -5.542
  210    H61    A  20           H61        A  20  34.980  28.562  -5.582
  211    H62    A  20           H62        A  20  35.718  27.174  -4.814
  212    H2     A  20           H2         A  20  37.460  29.468  -9.206
  213    H5'    U  21           H5'        U  21  44.198  28.851  -8.021
  214   H5''    U  21          H5''        U  21  45.191  29.946  -7.039
  215    H4'    U  21           H4'        U  21  43.106  31.054  -7.866
  216    H3'    U  21           H3'        U  21  43.732  30.579  -4.961
  217    H2'    U  21          H2''        U  21  41.685  31.365  -4.209
  218   HO2'    U  21          H2'         U  21  41.545  32.734  -6.696
  219    H1'    U  21           H1'        U  21  40.077  30.602  -6.363
  220    H3     U  21           H3         U  21  38.281  28.417  -2.834
  221    H5     U  21           H5         U  21  42.106  26.688  -3.212
  222    H6     U  21           H6         U  21  42.545  28.222  -5.038
  223    H5'    U  22           H5'        U  22  42.447  34.533  -6.105
  224   H5''    U  22          H5''        U  22  43.424  35.885  -5.497
  225    H4'    U  22           H4'        U  22  40.975  36.369  -5.350
  226    H3'    U  22           H3'        U  22  42.934  36.323  -3.137
  227    H2'    U  22          H2''        U  22  41.570  35.706  -1.436
  228   HO2'    U  22          H2'         U  22  40.048  37.767  -2.539
  229    H1'    U  22           H1'        U  22  39.084  35.278  -2.876
  230    H3     U  22           H3         U  22  38.489  31.978   0.097
  231    H5     U  22           H5         U  22  42.400  31.273  -1.304
  232    H6     U  22           H6         U  22  42.199  33.262  -2.676
  233    H5'    A  23           H5'        A  23  43.751  38.481  -0.304
  234   H5''    A  23          H5''        A  23  42.697  37.075  -0.542
  235    H4'    A  23           H4'        A  23  42.759  37.934   1.844
  236    H3'    A  23           H3'        A  23  40.455  37.338   0.130
  237    H2'    A  23          H2''        A  23  38.891  38.771   0.986
  238   HO2'    A  23          H2'         A  23  40.180  38.694   3.518
  239    H1'    A  23           H1'        A  23  40.420  40.672   2.369
  240    H8     A  23           H8         A  23  41.678  40.779  -1.104
  241    H61    A  23           H61        A  23  36.535  43.762  -2.771
  242    H62    A  23           H62        A  23  38.193  43.401  -3.197
  243    H2     A  23           H2         A  23  35.834  41.965   1.265
  244    H5'    A  24           H5'        A  24  37.988  34.679   2.861
  245   H5''    A  24          H5''        A  24  37.104  34.242   1.388
  246    H4'    A  24           H4'        A  24  36.553  36.399   3.186
  247    H3'    A  24           H3'        A  24  35.470  35.062   0.777
  248    H2'    A  24          H2''        A  24  34.917  36.908  -0.410
  249   HO2'    A  24          H2'         A  24  33.801  38.680   0.775
  250    H1'    A  24           H1'        A  24  35.929  38.989   1.367
  251    H8     A  24           H8         A  24  38.481  37.371  -0.788
  252    H61    A  24           H61        A  24  36.590  40.972  -5.450
  253    H62    A  24           H62        A  24  37.853  39.906  -4.878
  254    H2     A  24           H2         A  24  33.670  41.402  -2.071
  255    H5'    U  25           H5'        U  25  32.884  33.050   0.061
  256   H5''    U  25          H5''        U  25  33.498  34.712   0.121
  257    H4'    U  25           H4'        U  25  30.895  33.738  -0.789
  258    H3'    U  25           H3'        U  25  32.786  35.541  -1.591
  259    H2'    U  25          H2''        U  25  32.492  37.189   0.060
  260   HO2'    U  25          H2'         U  25  31.925  38.217  -1.886
  261    H1'    U  25           H1'        U  25  29.522  36.864   0.099
  262    H3     U  25           H3         U  25  29.043  39.253   3.847
  263    H5     U  25           H5         U  25  32.913  37.646   4.287
  264    H6     U  25           H6         U  25  32.636  36.548   2.143
  265    H5'    U  26           H5'        U  26  34.002  36.975  -2.323
  266   H5''    U  26          H5''        U  26  33.069  37.898  -3.517
  267    H4'    U  26           H4'        U  26  35.177  38.122  -4.497
  268    H3'    U  26           H3'        U  26  33.744  35.669  -5.373
  269    H2'    U  26          H2''        U  26  35.536  34.374  -5.950
  270   HO2'    U  26          H2'         U  26  36.444  35.516  -7.537
  271    H1'    U  26           H1'        U  26  37.613  35.494  -4.476
  272    H3     U  26           H3         U  26  37.753  31.195  -3.159
  273    H5     U  26           H5         U  26  34.102  32.574  -1.580
  274    H6     U  26           H6         U  26  34.448  34.666  -2.737
  275    H5'    C  27           H5'        C  27  34.197  37.212 -10.097
  276   H5''    C  27          H5''        C  27  32.937  36.051 -10.560
  277    H4'    C  27           H4'        C  27  35.439  35.755 -11.433
  278    H3'    C  27           H3'        C  27  33.306  33.841 -10.563
  279    H2'    C  27          H2''        C  27  34.695  32.022 -10.297
  280   HO2'    C  27          H2'         C  27  35.446  32.509 -12.602
  281    H1'    C  27           H1'        C  27  37.165  33.291  -9.857
  282    H41    C  27           H41        C  27  35.703  30.325  -4.433
  283    H42    C  27           H42        C  27  34.110  31.045  -4.398
  284    H5     C  27           H5         C  27  33.254  32.426  -6.173
  285    H6     C  27           H6         C  27  33.793  33.558  -8.274
  286    H5'    U  28           H5'        U  28  34.152  32.893 -15.443
  287   H5''    U  28          H5''        U  28  33.174  31.444 -15.753
  288    H4'    U  28           H4'        U  28  35.856  31.372 -15.955
  289    H3'    U  28           H3'        U  28  33.896  29.385 -14.753
  290    H2'    U  28          H2''        U  28  35.641  27.902 -14.260
  291   HO2'    U  28          H2'         U  28  37.389  27.786 -15.436
  292    H1'    U  28           H1'        U  28  37.392  29.814 -13.307
  293    H3     U  28           H3         U  28  35.765  27.031  -9.999
  294    H5     U  28           H5         U  28  32.835  30.002 -10.530
  295    H6     U  28           H6         U  28  34.079  30.811 -12.434
  296    H5'    U  29           H5'        U  29  36.227  26.964 -17.430
  297   H5''    U  29          H5''        U  29  35.324  25.491 -17.836
  298    H4'    U  29           H4'        U  29  37.478  25.358 -16.280
  299    H3'    U  29           H3'        U  29  34.821  23.954 -16.218
  300    H2'    U  29          H2''        U  29  35.121  23.053 -14.123
  301   HO2'    U  29          H2'         U  29  37.143  22.513 -13.301
  302    H1'    U  29           H1'        U  29  36.965  24.914 -13.048
  303    H3     U  29           H3         U  29  33.424  24.022 -10.209
  304    H5     U  29           H5         U  29  32.122  27.075 -12.800
  305    H6     U  29           H6         U  29  34.130  26.729 -14.116
  306    H5'    A  30           H5'        A  30  37.055  20.953 -14.629
  307   H5''    A  30          H5''        A  30  36.985  19.591 -15.764
  308    H4'    A  30           H4'        A  30  36.306  18.603 -13.727
  309    H3'    A  30           H3'        A  30  34.009  19.555 -15.435
  310    H2'    A  30          H2''        A  30  32.444  19.051 -13.807
  311   HO2'    A  30          H2'         A  30  34.325  17.102 -12.982
  312    H1'    A  30           H1'        A  30  34.171  19.231 -11.536
  313    H8     A  30           H8         A  30  33.473  22.317 -13.758
  314    H61    A  30           H61        A  30  28.672  23.329 -10.000
  315    H62    A  30           H62        A  30  29.700  24.023 -11.233
  316    H2     A  30           H2         A  30  30.505  19.385  -8.896
  317    H5'    A  31           H5'        A  31  33.523  15.042 -13.953
  318   H5''    A  31          H5''        A  31  32.419  14.317 -15.137
  319    H4'    A  31           H4'        A  31  31.751  14.047 -12.672
  320    H3'    A  31           H3'        A  31  30.088  15.167 -14.920
  321    H2'    A  31          H2''        A  31  28.398  15.877 -13.540
  322   HO2'    A  31          H2'         A  31  27.637  14.682 -11.927
  323    H1'    A  31           H1'        A  31  29.845  16.033 -11.076
  324    H8     A  31           H8         A  31  30.711  18.333 -14.052
  325    H61    A  31           H61        A  31  26.536  22.224 -11.676
  326    H62    A  31           H62        A  31  27.869  22.059 -12.797
  327    H2     A  31           H2         A  31  26.368  18.402  -9.336
  328    H5'    A  32           H5'        A  32  27.502  11.252 -13.076
  329   H5''    A  32          H5''        A  32  26.305  11.175 -14.384
  330    H4'    A  32           H4'        A  32  25.525  11.507 -11.857
  331    H3'    A  32           H3'        A  32  24.561  12.649 -14.466
  332    H2'    A  32          H2''        A  32  23.256  14.272 -13.509
  333   HO2'    A  32          H2'         A  32  22.510  12.262 -11.995
  334    H1'    A  32           H1'        A  32  24.511  14.488 -10.969
  335    H8     A  32           H8         A  32  26.662  15.359 -14.008
  336    H61    A  32           H61        A  32  24.134  20.992 -13.718
  337    H62    A  32           H62        A  32  25.434  20.033 -14.389
  338    H2     A  32           H2         A  32  22.059  18.380 -10.720
  339    H5'    A  33           H5'        A  33  20.558  10.869 -12.139
  340   H5''    A  33          H5''        A  33  19.443  10.874 -13.520
  341    H4'    A  33           H4'        A  33  18.883  12.271 -11.317
  342    H3'    A  33           H3'        A  33  18.481  12.816 -14.247
  343    H2'    A  33          H2''        A  33  17.931  15.037 -13.962
  344   HO2'    A  33          H2'         A  33  17.200  14.387 -11.287
  345    H1'    A  33           H1'        A  33  19.290  15.581 -11.553
  346    H8     A  33           H8         A  33  21.554  14.271 -14.315
  347    H61    A  33           H61        A  33  21.755  20.077 -16.424
  348    H62    A  33           H62        A  33  22.522  18.505 -16.469
  349    H2     A  33           H2         A  33  18.640  19.871 -13.202
  350    H5'    A  34           H5'        A  34  15.013  14.287 -12.019
  351   H5''    A  34          H5''        A  34  13.524  13.912 -12.910
  352    H4'    A  34           H4'        A  34  13.807  16.369 -12.287
  353    H3'    A  34           H3'        A  34  13.331  15.187 -14.997
  354    H2'    A  34          H2''        A  34  13.829  17.071 -16.185
  355   HO2'    A  34          H2'         A  34  12.862  18.486 -13.923
  356    H1'    A  34           H1'        A  34  15.339  18.512 -14.220
  357    H8     A  34           H8         A  34  16.792  15.213 -15.559
  358    H61    A  34           H61        A  34  19.751  18.772 -19.659
  359    H62    A  34           H62        A  34  19.714  17.206 -18.881
  360    H2     A  34           H2         A  34  16.709  21.304 -17.551
  361    H5'    C  35           H5'        C  35   9.567  16.439 -16.554
  362   H5''    C  35          H5''        C  35  10.039  15.191 -17.723
  363    H4'    C  35           H4'        C  35  11.136  17.924 -17.336
  364    H3'    C  35           H3'        C  35  10.196  16.214 -19.410
  365    H2'    C  35          H2''        C  35  12.182  15.054 -19.802
  366   HO2'    C  35          H2'         C  35  11.975  16.477 -21.621
  367    H1'    C  35           H1'        C  35  13.917  17.330 -18.950
  368    H41    C  35           H41        C  35  18.051  12.495 -18.830
  369    H42    C  35           H42        C  35  16.931  11.497 -17.930
  370    H5     C  35           H5         C  35  14.647  12.142 -17.505
  371    H6     C  35           H6         C  35  13.013  13.961 -17.655
  372    H5'    U  36           H5'        U  36   8.943  18.764 -18.524
  373   H5''    U  36          H5''        U  36   7.398  19.176 -19.293
  374    H4'    U  36           H4'        U  36   7.483  20.914 -17.769
  375    H3'    U  36           H3'        U  36   8.879  21.613 -20.317
  376    H2'    U  36          H2''        U  36  10.045  23.440 -19.495
  377   HO2'    U  36          H2'         U  36   8.067  23.525 -17.455
  378    H1'    U  36           H1'        U  36  10.469  22.674 -16.875
  379    H3     U  36           H3         U  36  14.005  23.191 -20.134
  380    H5     U  36           H5         U  36  13.646  19.182 -18.907
  381    H6     U  36           H6         U  36  11.517  19.737 -17.904
  382    H5'    A  37           H5'        A  37   8.549  25.469 -20.251
  383   H5''    A  37          H5''        A  37   7.268  25.796 -21.435
  384    H4'    A  37           H4'        A  37   9.154  26.991 -22.278
  385    H3'    A  37           H3'        A  37   8.740  24.252 -23.476
  386    H2'    A  37          H2''        A  37  10.563  24.451 -24.854
  387   HO2'    A  37          H2'         A  37  10.541  26.358 -25.816
  388    H1'    A  37           H1'        A  37  12.232  25.810 -23.020
  389    H8     A  37           H8         A  37  10.470  22.850 -21.412
  390    H61    A  37           H61        A  37  15.008  19.351 -23.719
  391    H62    A  37           H62        A  37  13.733  19.448 -22.525
  392    H2     A  37           H2         A  37  15.322  23.430 -25.563
  393    H5'    C  38           H5'        C  38   8.722  27.253 -27.350
  394   H5''    C  38          H5''        C  38   7.959  26.130 -28.492
  395    H4'    C  38           H4'        C  38  10.395  27.088 -28.972
  396    H3'    C  38           H3'        C  38   9.164  24.370 -29.367
  397    H2'    C  38          H2''        C  38  11.167  23.346 -29.908
  398   HO2'    C  38          H2'         C  38  12.779  24.338 -30.966
  399    H1'    C  38           H1'        C  38  12.933  24.933 -28.414
  400    H41    C  38           H41        C  38  12.669  19.259 -25.541
  401    H42    C  38           H42        C  38  11.079  19.621 -24.914
  402    H5     C  38           H5         C  38   9.910  21.672 -25.394
  403    H6     C  38           H6         C  38   9.976  23.773 -26.640
  404    H5'    A  39           H5'        A  39  10.111  24.833 -33.792
  405   H5''    A  39          H5''        A  39   9.027  23.590 -34.446
  406    H4'    A  39           H4'        A  39  11.652  23.143 -34.266
  407    H3'    A  39           H3'        A  39   9.252  21.391 -33.824
  408    H2'    A  39          H2''        A  39  10.450  19.706 -32.834
  409   HO2'    A  39          H2'         A  39  12.791  20.580 -34.195
  410    H1'    A  39           H1'        A  39  12.761  21.185 -32.019
  411    H8     A  39           H8         A  39   9.466  22.110 -30.321
  412    H61    A  39           H61        A  39  10.532  17.375 -26.491
  413    H62    A  39           H62        A  39   9.613  18.842 -26.740
  414    H2     A  39           H2         A  39  13.572  17.211 -29.787
  415    H5'    A  40           H5'        A  40  11.664  19.825 -37.713
  416   H5''    A  40          H5''        A  40  10.623  18.678 -38.581
  417    H4'    A  40           H4'        A  40  12.848  17.695 -37.786
  418    H3'    A  40           H3'        A  40  10.103  16.727 -36.894
  419    H2'    A  40          H2''        A  40  11.036  15.048 -35.580
  420   HO2'    A  40          H2'         A  40  12.449  14.213 -37.165
  421    H1'    A  40           H1'        A  40  13.302  16.449 -34.753
  422    H8     A  40           H8         A  40   9.955  18.337 -34.527
  423    H61    A  40           H61        A  40   9.496  15.945 -28.848
  424    H62    A  40           H62        A  40   8.880  17.150 -29.956
  425    H2     A  40           H2         A  40  13.068  14.104 -30.846
  426    H5'    U  41           H5'        U  41  11.263  12.836 -38.987
  427   H5''    U  41          H5''        U  41   9.735  11.938 -38.918
  428    H4'    U  41           H4'        U  41  11.782  11.375 -37.256
  429    H3'    U  41           H3'        U  41   8.776  11.400 -36.841
  430    H2'    U  41          H2''        U  41   9.006  10.993 -34.565
  431   HO2'    U  41          H2'         U  41  10.138   9.199 -34.352
  432    H1'    U  41           H1'        U  41  11.568  12.144 -34.190
  433    H3     U  41           H3         U  41   8.604  13.601 -31.009
  434    H5     U  41           H5         U  41   7.551  15.686 -34.520
  435    H6     U  41           H6         U  41   9.205  14.373 -35.716
  436    H5'    C  42           H5'        C  42  10.496   7.004 -35.748
  437   H5''    C  42          H5''        C  42   9.042   6.012 -35.968
  438    H4'    C  42           H4'        C  42  10.203   5.697 -33.730
  439    H3'    C  42           H3'        C  42   7.338   6.587 -34.107
  440    H2'    C  42          H2''        C  42   6.997   6.798 -31.812
  441   HO2'    C  42          H2'         C  42   7.693   5.251 -30.593
  442    H1'    C  42           H1'        C  42   9.561   7.625 -31.076
  443    H41    C  42           H41        C  42   5.759  12.713 -30.713
  444    H42    C  42           H42        C  42   5.615  12.778 -32.453
  445    H5     C  42           H5         C  42   6.707  11.209 -33.924
  446    H6     C  42           H6         C  42   8.055   9.169 -34.038
  447    H5'    A  43           H5'        A  43   5.942   2.432 -32.541
  448   H5''    A  43          H5''        A  43   4.263   2.575 -33.098
  449    H4'    A  43           H4'        A  43   4.897   2.866 -30.508
  450    H3'    A  43           H3'        A  43   2.920   4.334 -32.270
  451    H2'    A  43          H2''        A  43   2.336   5.773 -30.562
  452   HO2'    A  43          H2'         A  43   1.849   4.200 -29.011
  453    H1'    A  43           H1'        A  43   4.827   5.823 -29.216
  454    H8     A  43           H8         A  43   5.240   6.849 -32.821
  455    H61    A  43           H61        A  43   2.856  12.333 -31.219
  456    H62    A  43           H62        A  43   3.776  11.465 -32.428
  457    H2     A  43           H2         A  43   2.385   9.535 -27.744
  458    H5'    G  44           H5'        G  44   0.280   1.905 -28.448
  459   H5''    G  44          H5''        G  44  -1.268   2.206 -29.261
  460    H4'    G  44           H4'        G  44  -0.934   2.867 -26.700
  461    H3'    G  44           H3'        G  44  -2.325   4.284 -28.977
  462    H2'    G  44          H2''        G  44  -2.836   6.141 -27.663
  463   HO2'    G  44          H2'         G  44  -2.852   6.097 -25.424
  464    H1'    G  44           H1'        G  44  -0.489   6.231 -26.159
  465    H8     G  44           H8         G  44   0.823   5.817 -29.539
  466    H1     G  44           H1         G  44  -1.906  11.560 -28.754
  467    H21    G  44           H21        G  44  -3.071  11.597 -26.883
  468    H22    G  44           H22        G  44  -3.352  10.156 -25.931
  469    H5'    C  45           H5'        C  45  -4.817   5.034 -26.200
  470   H5''    C  45          H5''        C  45  -6.479   4.485 -26.491
  471    H4'    C  45           H4'        C  45  -6.633   6.843 -26.046
  472    H3'    C  45           H3'        C  45  -6.763   6.011 -28.953
  473    H2'    C  45          H2''        C  45  -6.915   8.201 -29.670
  474   HO2'    C  45          H2'         C  45  -8.337   9.384 -28.696
  475    H1'    C  45           H1'        C  45  -5.437   9.413 -27.593
  476    H41    C  45           H41        C  45  -2.187  10.003 -33.027
  477    H42    C  45           H42        C  45  -1.933   8.276 -33.119
  478    H5     C  45           H5         C  45  -2.726   6.736 -31.434
  479    H6     C  45           H6         C  45  -4.078   6.503 -29.410
  480    H5'    U  46           H5'        U  46 -10.894   8.660 -28.061
  481   H5''    U  46          H5''        U  46 -11.773   8.078 -29.487
  482    H4'    U  46           H4'        U  46 -11.335  10.681 -29.150
  483    H3'    U  46           H3'        U  46 -11.259   8.909 -31.585
  484    H2'    U  46          H2''        U  46 -10.363  10.546 -32.953
  485   HO2'    U  46          H2'         U  46 -11.532  12.297 -32.887
  486    H1'    U  46           H1'        U  46  -8.912  12.023 -31.065
  487    H3     U  46           H3         U  46  -6.003  10.814 -34.336
  488    H5     U  46           H5         U  46  -6.713   7.257 -32.201
  489    H6     U  46           H6         U  46  -8.431   8.429 -30.947
  490    H5'    C  47           H5'        C  47 -13.921  12.626 -32.718
  491   H5''    C  47          H5''        C  47 -15.106  11.898 -33.820
  492    H4'    C  47           H4'        C  47 -13.962  13.882 -34.835
  493    H3'    C  47           H3'        C  47 -13.562  11.085 -35.924
  494    H2'    C  47          H2''        C  47 -12.320  11.950 -37.721
  495   HO2'    C  47          H2'         C  47 -13.875  13.801 -37.929
  496    H1'    C  47           H1'        C  47 -10.912  13.834 -36.206
  497    H41    C  47           H41        C  47  -6.853   9.012 -36.738
  498    H42    C  47           H42        C  47  -7.800   8.039 -35.635
  499    H5     C  47           H5         C  47  -9.806   8.848 -34.572
  500    H6     C  47           H6         C  47 -11.560  10.558 -34.659
  501    H5'    C  48           H5'        C  48 -15.289  13.503 -39.269
  502   H5''    C  48          H5''        C  48 -16.303  12.439 -40.264
  503    H4'    C  48           H4'        C  48 -14.455  13.592 -41.554
  504    H3'    C  48           H3'        C  48 -14.847  10.626 -41.283
  505   HO3'    C  48          H3T         C  48 -15.465  10.885 -43.431
  506    H2'    C  48          H2''        C  48 -12.879  10.059 -42.321
  507   HO2'    C  48          H2'         C  48 -12.924  12.620 -43.568
  508    H1'    C  48           H1'        C  48 -11.358  12.365 -41.728
  509    H41    C  48           H41        C  48  -8.822   7.398 -38.636
  510    H42    C  48           H42        C  48 -10.094   7.472 -37.438
  511    H5     C  48           H5         C  48 -12.054   8.854 -37.688
  512    H6     C  48           H6         C  48 -13.114  10.611 -39.027
  Start of MODEL    2
    1    H5'    G   1           H5'        G   1  -0.961   4.017 -44.609
    2   H5''    G   1          H5''        G   1   0.238   5.257 -44.185
    3    H4'    G   1           H4'        G   1  -1.613   6.191 -45.589
    4    H3'    G   1           H3'        G   1  -0.983   7.033 -42.776
    5    H2'    G   1          H2''        G   1  -2.882   8.221 -42.453
    6   HO2'    G   1          H2'         G   1  -2.888   8.702 -45.255
    7    H1'    G   1           H1'        G   1  -4.537   7.089 -44.504
    8    H8     G   1           H8         G   1  -3.625   4.653 -41.744
    9    H1     G   1           H1         G   1  -8.463   8.598 -40.268
   10    H21    G   1           H21        G   1  -8.597  10.219 -41.759
   11    H22    G   1           H22        G   1  -7.622  10.232 -43.211
   12   HO5'    G   1          H5T         G   1  -0.868   3.694 -42.527
   13    H5'    G   2           H5'        G   2  -0.441  11.672 -45.153
   14   H5''    G   2          H5''        G   2   0.112  12.308 -43.592
   15    H4'    G   2           H4'        G   2  -1.999  13.373 -44.863
   16    H3'    G   2           H3'        G   2  -1.459  12.863 -41.926
   17    H2'    G   2          H2''        G   2  -3.583  13.670 -41.327
   18   HO2'    G   2          H2'         G   2  -3.813  14.663 -43.986
   19    H1'    G   2           H1'        G   2  -5.021  12.494 -43.344
   20    H8     G   2           H8         G   2  -2.413  10.042 -42.176
   21    H1     G   2           H1         G   2  -7.335  10.669 -38.113
   22    H21    G   2           H21        G   2  -8.605  12.366 -38.738
   23    H22    G   2           H22        G   2  -8.137  13.458 -40.021
   24    H5'    G   3           H5'        G   3  -1.880  17.652 -41.677
   25   H5''    G   3          H5''        G   3  -1.289  17.838 -40.016
   26    H4'    G   3           H4'        G   3  -3.845  18.369 -40.678
   27    H3'    G   3           H3'        G   3  -2.719  17.008 -38.202
   28    H2'    G   3          H2''        G   3  -4.889  17.020 -37.275
   29   HO2'    G   3          H2'         G   3  -6.215  18.580 -37.731
   30    H1'    G   3           H1'        G   3  -6.125  16.153 -39.615
   31    H8     G   3           H8         G   3  -3.163  14.025 -39.619
   32    H1     G   3           H1         G   3  -7.067  12.549 -34.749
   33    H21    G   3           H21        G   3  -8.540  14.161 -34.440
   34    H22    G   3           H22        G   3  -8.454  15.681 -35.302
   35    H5'    G   4           H5'        G   4  -4.679  19.632 -36.504
   36   H5''    G   4          H5''        G   4  -3.898  20.855 -35.481
   37    H4'    G   4           H4'        G   4  -5.489  19.904 -34.019
   38    H3'    G   4           H3'        G   4  -2.758  18.623 -33.824
   39    H2'    G   4          H2''        G   4  -3.476  17.078 -32.263
   40   HO2'    G   4          H2'         G   4  -4.857  19.028 -31.297
   41    H1'    G   4           H1'        G   4  -6.046  16.665 -33.247
   42    H8     G   4           H8         G   4  -3.339  16.514 -35.956
   43    H1     G   4           H1         G   4  -3.786  11.206 -32.381
   44    H21    G   4           H21        G   4  -5.193  11.557 -30.706
   45    H22    G   4           H22        G   4  -5.858  13.138 -30.362
   46    H5'    U   5           H5'        U   5  -3.939  19.844 -29.226
   47   H5''    U   5          H5''        U   5  -2.294  19.785 -28.566
   48    H4'    U   5           H4'        U   5  -4.199  18.200 -27.589
   49    H3'    U   5           H3'        U   5  -1.278  17.712 -28.185
   50    H2'    U   5          H2''        U   5  -1.422  15.451 -27.691
   51   HO2'    U   5          H2'         U   5  -3.755  16.115 -26.209
   52    H1'    U   5           H1'        U   5  -4.058  14.975 -28.485
   53    H3     U   5           H3         U   5  -1.166  12.180 -30.682
   54    H5     U   5           H5         U   5  -0.741  15.908 -32.605
   55    H6     U   5           H6         U   5  -2.241  16.854 -30.946
   56    H5'    U   6           H5'        U   6  -2.401  16.028 -24.079
   57   H5''    U   6          H5''        U   6  -1.097  16.592 -23.015
   58    H4'    U   6           H4'        U   6  -1.512  14.215 -22.585
   59    H3'    U   6           H3'        U   6   1.020  15.066 -24.003
   60    H2'    U   6          H2''        U   6   1.756  12.852 -24.200
   61   HO2'    U   6          H2'         U   6   1.515  11.936 -22.270
   62    H1'    U   6           H1'        U   6  -0.698  11.664 -24.715
   63    H3     U   6           H3         U   6   1.715  11.133 -28.531
   64    H5     U   6           H5         U   6   0.799  15.241 -28.461
   65    H6     U   6           H6         U   6  -0.192  14.916 -26.274
   66    H5'    G   7           H5'        G   7   3.252  13.751 -20.226
   67   H5''    G   7          H5''        G   7   4.833  14.486 -20.553
   68    H4'    G   7           H4'        G   7   4.413  11.854 -20.893
   69    H3'    G   7           H3'        G   7   6.052  13.863 -22.455
   70    H2'    G   7          H2''        G   7   6.540  12.329 -24.112
   71   HO2'    G   7          H2'         G   7   7.124  10.788 -22.199
   72    H1'    G   7           H1'        G   7   4.246  10.662 -23.825
   73    H8     G   7           H8         G   7   3.111  14.077 -24.792
   74    H1     G   7           H1         G   7   6.090  11.010 -29.575
   75    H21    G   7           H21        G   7   7.167   9.255 -28.790
   76    H22    G   7           H22        G   7   7.021   8.738 -27.126
   77    H5'    G   8           H5'        G   8   9.404  10.248 -20.818
   78   H5''    G   8          H5''        G   8  10.775  11.282 -21.262
   79    H4'    G   8           H4'        G   8  10.614   8.785 -22.176
   80    H3'    G   8           H3'        G   8  11.414  11.345 -23.585
   81    H2'    G   8          H2''        G   8  11.853  10.168 -25.562
   82   HO2'    G   8          H2'         G   8  12.146   7.970 -25.643
   83    H1'    G   8           H1'        G   8   9.686   8.443 -25.412
   84    H8     G   8           H8         G   8   8.264  11.750 -24.535
   85    H1     G   8           H1         G   8   9.905  11.404 -30.722
   86    H21    G   8           H21        G   8  11.153   9.621 -31.076
   87    H22    G   8           H22        G   8  11.747   8.623 -29.768
   88    H5'    U   9           H5'        U   9  14.135   8.912 -24.708
   89   H5''    U   9          H5''        U   9  15.819   9.280 -24.284
   90    H4'    U   9           H4'        U   9  15.841   8.868 -26.643
   91    H3'    U   9           H3'        U   9  15.994  11.687 -25.663
   92    H2'    U   9          H2''        U   9  15.552  12.707 -27.681
   93   HO2'    U   9          H2'         U   9  16.263  10.363 -29.111
   94    H1'    U   9           H1'        U   9  14.046  10.743 -28.975
   95    H3     U   9           H3         U   9  11.296  14.325 -28.998
   96    H5     U   9           H5         U   9  11.557  13.299 -24.920
   97    H6     U   9           H6         U   9  13.218  11.640 -25.511
   98    H5'    G  10           H5'        G  10  19.996  11.820 -27.929
   99   H5''    G  10          H5''        G  10  20.890  13.019 -26.974
  100    H4'    G  10           H4'        G  10  20.046  13.639 -29.408
  101    H3'    G  10           H3'        G  10  20.105  15.177 -26.827
  102    H2'    G  10          H2''        G  10  18.767  16.879 -27.574
  103   HO2'    G  10          H2'         G  10  19.669  16.257 -30.198
  104    H1'    G  10           H1'        G  10  17.402  15.549 -29.683
  105    H8     G  10           H8         G  10  16.528  13.864 -26.481
  106    H1     G  10           H1         G  10  13.752  19.617 -27.045
  107    H21    G  10           H21        G  10  14.647  20.729 -28.726
  108    H22    G  10           H22        G  10  16.057  20.148 -29.584
  109    H5'    U  11           H5'        U  11  22.777  18.423 -29.881
  110   H5''    U  11          H5''        U  11  23.400  19.152 -28.388
  111    H4'    U  11           H4'        U  11  22.140  20.647 -30.196
  112    H3'    U  11           H3'        U  11  22.014  20.629 -27.174
  113    H2'    U  11          H2''        U  11  20.378  22.298 -27.145
  114   HO2'    U  11          H2'         U  11  21.193  22.845 -29.810
  115    H1'    U  11           H1'        U  11  18.966  21.533 -29.407
  116    H3     U  11           H3         U  11  16.287  21.298 -25.690
  117    H5     U  11           H5         U  11  18.456  17.693 -25.736
  118    H6     U  11           H6         U  11  19.831  18.616 -27.512
  119    H5'    A  12           H5'        A  12  23.632  24.896 -27.218
  120   H5''    A  12          H5''        A  12  23.953  25.033 -25.478
  121    H4'    A  12           H4'        A  12  21.781  26.156 -26.596
  122    H3'    A  12           H3'        A  12  22.219  24.782 -23.935
  123    H2'    A  12          H2''        A  12  19.958  24.955 -23.367
  124   HO2'    A  12          H2'         A  12  19.831  26.931 -25.405
  125    H1'    A  12           H1'        A  12  18.873  24.472 -25.871
  126    H8     A  12           H8         A  12  21.406  21.789 -25.529
  127    H61    A  12           H61        A  12  17.730  19.129 -21.328
  128    H62    A  12           H62        A  12  19.025  18.863 -22.475
  129    H2     A  12           H2         A  12  16.246  23.304 -22.046
  130    H5'    U  13           H5'        U  13  20.164  28.778 -22.300
  131   H5''    U  13          H5''        U  13  20.997  28.732 -20.737
  132    H4'    U  13           H4'        U  13  18.341  28.591 -20.862
  133    H3'    U  13           H3'        U  13  20.338  27.119 -19.126
  134    H2'    U  13          H2''        U  13  18.655  25.813 -18.158
  135   HO2'    U  13          H2'         U  13  16.702  26.561 -17.744
  136    H1'    U  13           H1'        U  13  16.888  25.718 -20.323
  137    H3     U  13           H3         U  13  18.062  21.548 -18.673
  138    H5     U  13           H5         U  13  21.118  22.652 -21.356
  139    H6     U  13           H6         U  13  20.131  24.857 -21.478
  140    H5'    U  14           H5'        U  14  17.036  28.426 -16.414
  141   H5''    U  14          H5''        U  14  17.871  29.286 -15.105
  142    H4'    U  14           H4'        U  14  16.275  27.622 -14.187
  143    H3'    U  14           H3'        U  14  19.238  27.528 -13.820
  144    H2'    U  14          H2''        U  14  19.361  25.368 -13.083
  145   HO2'    U  14          H2'         U  14  18.064  24.653 -11.573
  146    H1'    U  14           H1'        U  14  17.003  24.268 -14.127
  147    H3     U  14           H3         U  14  20.155  21.366 -15.527
  148    H5     U  14           H5         U  14  21.097  24.919 -17.584
  149    H6     U  14           H6         U  14  19.387  26.046 -16.282
  150    H5'    U  15           H5'        U  15  17.184  26.713  -9.385
  151   H5''    U  15          H5''        U  15  18.615  26.968  -8.367
  152    H4'    U  15           H4'        U  15  17.333  24.628  -8.341
  153    H3'    U  15           H3'        U  15  20.226  25.398  -8.175
  154    H2'    U  15          H2''        U  15  21.051  23.304  -8.603
  155   HO2'    U  15          H2'         U  15  20.351  21.988  -7.110
  156    H1'    U  15           H1'        U  15  18.845  22.132  -9.940
  157    H3     U  15           H3         U  15  22.565  21.199 -12.394
  158    H5     U  15           H5         U  15  21.824  25.287 -13.086
  159    H6     U  15           H6         U  15  20.127  25.206 -11.360
  160    H5'    U  16           H5'        U  16  19.549  21.959  -4.685
  161   H5''    U  16          H5''        U  16  20.850  22.518  -3.616
  162    H4'    U  16           H4'        U  16  20.891  20.026  -4.430
  163    H3'    U  16           H3'        U  16  23.055  22.091  -4.237
  164    H2'    U  16          H2''        U  16  24.579  20.961  -5.512
  165   HO2'    U  16          H2'         U  16  25.009  19.089  -4.668
  166    H1'    U  16           H1'        U  16  22.875  19.261  -7.002
  167    H3     U  16           H3         U  16  25.691  21.137 -10.026
  168    H5     U  16           H5         U  16  23.212  24.316  -8.808
  169    H6     U  16           H6         U  16  22.276  22.852  -7.117
  170    H5'    U  17           H5'        U  17  25.177  18.066  -1.988
  171   H5''    U  17          H5''        U  17  26.402  19.084  -1.208
  172    H4'    U  17           H4'        U  17  27.130  17.109  -2.842
  173    H3'    U  17           H3'        U  17  28.184  19.894  -2.405
  174    H2'    U  17          H2''        U  17  29.531  19.888  -4.261
  175   HO2'    U  17          H2'         U  17  29.625  17.075  -3.899
  176    H1'    U  17           H1'        U  17  28.197  17.939  -5.833
  177    H3     U  17           H3         U  17  28.968  21.491  -8.546
  178    H5     U  17           H5         U  17  26.010  22.855  -5.874
  179    H6     U  17           H6         U  17  26.283  20.792  -4.626
  180    H5'    A  18           H5'        A  18  32.070  16.752  -2.218
  181   H5''    A  18          H5''        A  18  33.209  17.878  -1.456
  182    H4'    A  18           H4'        A  18  33.801  16.732  -3.784
  183    H3'    A  18           H3'        A  18  34.250  19.526  -2.734
  184    H2'    A  18          H2''        A  18  34.894  20.354  -4.770
  185   HO2'    A  18          H2'         A  18  35.845  17.732  -5.264
  186    H1'    A  18           H1'        A  18  33.701  18.386  -6.471
  187    H8     A  18           H8         A  18  31.262  20.532  -4.510
  188    H61    A  18           H61        A  18  31.764  24.643  -9.093
  189    H62    A  18           H62        A  18  30.957  24.255  -7.590
  190    H2     A  18           H2         A  18  34.954  21.535  -9.654
  191    H5'    A  19           H5'        A  19  38.836  18.128  -4.221
  192   H5''    A  19          H5''        A  19  39.623  19.407  -3.275
  193    H4'    A  19           H4'        A  19  39.961  19.280  -5.913
  194    H3'    A  19           H3'        A  19  39.552  21.613  -4.042
  195    H2'    A  19          H2''        A  19  39.333  23.131  -5.754
  196   HO2'    A  19          H2'         A  19  40.666  23.148  -7.395
  197    H1'    A  19           H1'        A  19  38.516  21.348  -7.828
  198    H8     A  19           H8         A  19  36.155  21.666  -4.849
  199    H61    A  19           H61        A  19  33.852  26.663  -7.649
  200    H62    A  19           H62        A  19  33.600  25.469  -6.396
  201    H2     A  19           H2         A  19  37.547  25.402  -9.866
  202    H5'    A  20           H5'        A  20  43.348  22.594  -6.804
  203   H5''    A  20          H5''        A  20  44.185  23.783  -5.788
  204    H4'    A  20           H4'        A  20  43.538  24.522  -8.190
  205    H3'    A  20           H3'        A  20  42.993  25.935  -5.579
  206    H2'    A  20          H2''        A  20  41.787  27.628  -6.605
  207   HO2'    A  20          H2'         A  20  43.027  26.902  -9.063
  208    H1'    A  20           H1'        A  20  40.769  26.170  -8.788
  209    H8     A  20           H8         A  20  40.103  24.773  -5.259
  210    H61    A  20           H61        A  20  35.141  28.456  -5.184
  211    H62    A  20           H62        A  20  35.938  27.101  -4.417
  212    H2     A  20           H2         A  20  37.508  29.390  -8.876
  213    H5'    U  21           H5'        U  21  43.931  29.007  -7.870
  214   H5''    U  21          H5''        U  21  45.001  30.169  -7.061
  215    H4'    U  21           H4'        U  21  42.853  31.249  -7.602
  216    H3'    U  21           H3'        U  21  43.673  30.667  -4.766
  217    H2'    U  21          H2''        U  21  41.660  31.361  -3.852
  218   HO2'    U  21          H2'         U  21  40.981  33.223  -4.528
  219    H1'    U  21           H1'        U  21  39.938  30.651  -5.935
  220    H3     U  21           H3         U  21  38.418  28.265  -2.408
  221    H5     U  21           H5         U  21  42.255  26.661  -3.097
  222    H6     U  21           H6         U  21  42.541  28.286  -4.873
  223    H5'    U  22           H5'        U  22  42.296  34.601  -5.747
  224   H5''    U  22          H5''        U  22  43.277  35.983  -5.217
  225    H4'    U  22           H4'        U  22  40.847  36.449  -4.941
  226    H3'    U  22           H3'        U  22  42.888  36.391  -2.800
  227    H2'    U  22          H2''        U  22  41.581  35.759  -1.060
  228   HO2'    U  22          H2'         U  22  39.900  37.757  -2.120
  229    H1'    U  22           H1'        U  22  39.044  35.372  -2.441
  230    H3     U  22           H3         U  22  38.440  32.083   0.540
  231    H5     U  22           H5         U  22  42.321  31.317  -0.915
  232    H6     U  22           H6         U  22  42.131  33.307  -2.287
  233    H5'    A  23           H5'        A  23  43.786  38.549   0.029
  234   H5''    A  23          H5''        A  23  42.715  37.152  -0.184
  235    H4'    A  23           H4'        A  23  42.843  38.025   2.201
  236    H3'    A  23           H3'        A  23  40.490  37.434   0.540
  237    H2'    A  23          H2''        A  23  38.948  38.839   1.480
  238   HO2'    A  23          H2'         A  23  40.383  38.634   3.930
  239    H1'    A  23           H1'        A  23  40.522  40.757   2.781
  240    H8     A  23           H8         A  23  41.645  40.833  -0.741
  241    H61    A  23           H61        A  23  36.465  43.860  -2.203
  242    H62    A  23           H62        A  23  38.044  43.350  -2.758
  243    H2     A  23           H2         A  23  35.893  42.032   1.842
  244    H5'    A  24           H5'        A  24  38.136  34.712   3.293
  245   H5''    A  24          H5''        A  24  37.203  34.298   1.843
  246    H4'    A  24           H4'        A  24  36.722  36.433   3.688
  247    H3'    A  24           H3'        A  24  35.549  35.124   1.305
  248    H2'    A  24          H2''        A  24  34.950  36.983   0.159
  249   HO2'    A  24          H2'         A  24  33.836  38.711   1.325
  250    H1'    A  24           H1'        A  24  36.039  39.047   1.903
  251    H8     A  24           H8         A  24  38.524  37.429  -0.326
  252    H61    A  24           H61        A  24  36.562  41.098  -4.900
  253    H62    A  24           H62        A  24  37.729  39.880  -4.435
  254    H2     A  24           H2         A  24  33.679  41.460  -1.483
  255    H5'    U  25           H5'        U  25  32.922  33.085   0.656
  256   H5''    U  25          H5''        U  25  33.579  34.732   0.667
  257    H4'    U  25           H4'        U  25  30.963  33.820  -0.216
  258    H3'    U  25           H3'        U  25  32.851  35.648  -0.970
  259    H2'    U  25          H2''        U  25  32.562  37.249   0.726
  260   HO2'    U  25          H2'         U  25  31.342  38.908  -0.093
  261    H1'    U  25           H1'        U  25  29.593  36.921   0.772
  262    H3     U  25           H3         U  25  29.106  39.104   4.648
  263    H5     U  25           H5         U  25  33.050  37.645   4.917
  264    H6     U  25           H6         U  25  32.753  36.617   2.741
  265    H5'    U  26           H5'        U  26  34.087  37.057  -1.761
  266   H5''    U  26          H5''        U  26  33.073  37.890  -2.958
  267    H4'    U  26           H4'        U  26  35.173  38.153  -3.982
  268    H3'    U  26           H3'        U  26  33.712  35.696  -4.801
  269    H2'    U  26          H2''        U  26  35.481  34.403  -5.452
  270   HO2'    U  26          H2'         U  26  36.414  35.457  -7.045
  271    H1'    U  26           H1'        U  26  37.608  35.506  -4.045
  272    H3     U  26           H3         U  26  37.731  31.204  -2.723
  273    H5     U  26           H5         U  26  34.148  32.635  -1.036
  274    H6     U  26           H6         U  26  34.492  34.722  -2.203
  275    H5'    C  27           H5'        C  27  34.226  37.270  -9.607
  276   H5''    C  27          H5''        C  27  32.963  36.100 -10.039
  277    H4'    C  27           H4'        C  27  35.418  35.886 -11.062
  278    H3'    C  27           H3'        C  27  33.370  33.899 -10.146
  279    H2'    C  27          H2''        C  27  34.804  32.103 -10.022
  280   HO2'    C  27          H2'         C  27  36.460  31.789 -11.445
  281    H1'    C  27           H1'        C  27  37.280  33.417  -9.712
  282    H41    C  27           H41        C  27  36.348  30.235  -4.295
  283    H42    C  27           H42        C  27  34.723  30.864  -4.134
  284    H5     C  27           H5         C  27  33.680  32.249  -5.802
  285    H6     C  27           H6         C  27  34.013  33.461  -7.902
  286    H5'    U  28           H5'        U  28  34.165  33.051 -15.065
  287   H5''    U  28          H5''        U  28  33.188  31.601 -15.372
  288    H4'    U  28           H4'        U  28  35.856  31.567 -15.709
  289    H3'    U  28           H3'        U  28  33.981  29.522 -14.475
  290    H2'    U  28          H2''        U  28  35.764  28.043 -14.122
  291   HO2'    U  28          H2'         U  28  37.468  29.776 -15.605
  292    H1'    U  28           H1'        U  28  37.528  29.937 -13.173
  293    H3     U  28           H3         U  28  36.038  27.037  -9.896
  294    H5     U  28           H5         U  28  33.069  29.997 -10.232
  295    H6     U  28           H6         U  28  34.241  30.878 -12.150
  296    H5'    U  29           H5'        U  29  36.114  27.210 -17.466
  297   H5''    U  29          H5''        U  29  35.197  25.735 -17.827
  298    H4'    U  29           H4'        U  29  37.481  25.603 -16.465
  299    H3'    U  29           H3'        U  29  34.863  24.146 -16.226
  300    H2'    U  29          H2''        U  29  35.354  23.180 -14.193
  301   HO2'    U  29          H2'         U  29  37.556  22.879 -13.505
  302    H1'    U  29           H1'        U  29  37.169  25.075 -13.167
  303    H3     U  29           H3         U  29  33.726  24.057 -10.243
  304    H5     U  29           H5         U  29  32.303  27.149 -12.719
  305    H6     U  29           H6         U  29  34.272  26.862 -14.105
  306    H5'    A  30           H5'        A  30  37.166  21.145 -14.915
  307   H5''    A  30          H5''        A  30  37.049  19.815 -16.082
  308    H4'    A  30           H4'        A  30  36.480  18.767 -14.041
  309    H3'    A  30           H3'        A  30  34.102  19.730 -15.625
  310    H2'    A  30          H2''        A  30  32.608  19.189 -13.945
  311   HO2'    A  30          H2'         A  30  32.720  17.295 -13.061
  312    H1'    A  30           H1'        A  30  34.402  19.361 -11.734
  313    H8     A  30           H8         A  30  33.674  22.461 -13.927
  314    H61    A  30           H61        A  30  28.984  23.511 -10.042
  315    H62    A  30           H62        A  30  29.985  24.196 -11.302
  316    H2     A  30           H2         A  30  30.796  19.539  -9.004
  317    H5'    A  31           H5'        A  31  33.498  14.950 -14.476
  318   H5''    A  31          H5''        A  31  32.166  14.574 -15.585
  319    H4'    A  31           H4'        A  31  31.866  14.186 -12.978
  320    H3'    A  31           H3'        A  31  30.015  15.288 -15.080
  321    H2'    A  31          H2''        A  31  28.459  16.042 -13.575
  322   HO2'    A  31          H2'         A  31  29.326  13.844 -12.029
  323    H1'    A  31           H1'        A  31  30.105  16.246 -11.249
  324    H8     A  31           H8         A  31  30.875  18.465 -14.290
  325    H61    A  31           H61        A  31  26.843  22.474 -11.866
  326    H62    A  31           H62        A  31  28.139  22.263 -13.021
  327    H2     A  31           H2         A  31  26.650  18.686  -9.473
  328    H5'    A  32           H5'        A  32  27.500  11.516 -13.078
  329   H5''    A  32          H5''        A  32  26.247  11.384 -14.327
  330    H4'    A  32           H4'        A  32  25.585  11.898 -11.795
  331    H3'    A  32           H3'        A  32  24.533  12.891 -14.433
  332    H2'    A  32          H2''        A  32  23.308  14.607 -13.529
  333   HO2'    A  32          H2'         A  32  21.911  13.964 -12.113
  334    H1'    A  32           H1'        A  32  24.673  14.934 -11.052
  335    H8     A  32           H8         A  32  26.730  15.615 -14.201
  336    H61    A  32           H61        A  32  24.277  21.289 -14.128
  337    H62    A  32           H62        A  32  25.522  20.268 -14.813
  338    H2     A  32           H2         A  32  22.261  18.861 -10.942
  339    H5'    A  33           H5'        A  33  20.701  11.280 -11.702
  340   H5''    A  33          H5''        A  33  19.464  11.204 -12.970
  341    H4'    A  33           H4'        A  33  19.076  12.691 -10.794
  342    H3'    A  33           H3'        A  33  18.404  13.081 -13.694
  343    H2'    A  33          H2''        A  33  17.869  15.312 -13.493
  344   HO2'    A  33          H2'         A  33  16.850  16.142 -11.774
  345    H1'    A  33           H1'        A  33  19.427  16.016 -11.260
  346    H8     A  33           H8         A  33  21.446  14.497 -14.103
  347    H61    A  33           H61        A  33  21.506  20.142 -16.618
  348    H62    A  33           H62        A  33  22.263  18.566 -16.609
  349    H2     A  33           H2         A  33  18.640  20.183 -13.165
  350    H5'    A  34           H5'        A  34  15.012  14.540 -11.172
  351   H5''    A  34          H5''        A  34  13.490  14.134 -11.988
  352    H4'    A  34           H4'        A  34  13.771  16.601 -11.377
  353    H3'    A  34           H3'        A  34  13.141  15.405 -14.054
  354    H2'    A  34          H2''        A  34  13.540  17.315 -15.260
  355   HO2'    A  34          H2'         A  34  12.806  18.789 -12.938
  356    H1'    A  34           H1'        A  34  15.131  18.770 -13.374
  357    H8     A  34           H8         A  34  16.571  15.528 -14.857
  358    H61    A  34           H61        A  34  19.169  19.203 -19.093
  359    H62    A  34           H62        A  34  19.229  17.633 -18.322
  360    H2     A  34           H2         A  34  16.193  21.632 -16.778
  361    H5'    C  35           H5'        C  35   9.130  16.835 -14.942
  362   H5''    C  35          H5''        C  35   9.227  15.666 -16.274
  363    H4'    C  35           H4'        C  35  10.487  18.291 -16.048
  364    H3'    C  35           H3'        C  35   9.440  16.490 -18.012
  365    H2'    C  35          H2''        C  35  11.412  15.402 -18.569
  366   HO2'    C  35          H2'         C  35  11.896  16.290 -20.399
  367    H1'    C  35           H1'        C  35  13.168  17.687 -17.785
  368    H41    C  35           H41        C  35  17.373  12.928 -17.770
  369    H42    C  35           H42        C  35  16.240  11.853 -16.982
  370    H5     C  35           H5         C  35  14.047  12.555 -16.266
  371    H6     C  35           H6         C  35  12.389  14.357 -16.347
  372    H5'    U  36           H5'        U  36   9.503  20.427 -16.526
  373   H5''    U  36          H5''        U  36   8.050  21.414 -16.781
  374    H4'    U  36           H4'        U  36   9.538  23.152 -16.506
  375    H3'    U  36           H3'        U  36   9.609  22.195 -19.352
  376    H2'    U  36          H2''        U  36  11.562  23.254 -19.882
  377   HO2'    U  36          H2'         U  36  10.697  25.323 -19.415
  378    H1'    U  36           H1'        U  36  12.634  23.611 -17.252
  379    H3     U  36           H3         U  36  15.555  22.162 -20.660
  380    H5     U  36           H5         U  36  14.370  18.863 -18.353
  381    H6     U  36           H6         U  36  12.591  20.223 -17.415
  382    H5'    A  37           H5'        A  37   8.264  26.754 -21.019
  383   H5''    A  37          H5''        A  37   7.471  25.817 -22.300
  384    H4'    A  37           H4'        A  37   9.431  27.513 -22.908
  385    H3'    A  37           H3'        A  37   8.872  24.704 -23.863
  386    H2'    A  37          H2''        A  37  10.714  24.692 -25.242
  387   HO2'    A  37          H2'         A  37  10.605  26.587 -26.325
  388    H1'    A  37           H1'        A  37  12.441  26.127 -23.519
  389    H8     A  37           H8         A  37  10.543  23.400 -21.679
  390    H61    A  37           H61        A  37  14.906  19.507 -23.680
  391    H62    A  37           H62        A  37  13.643  19.765 -22.496
  392    H2     A  37           H2         A  37  15.414  23.401 -25.848
  393    H5'    C  38           H5'        C  38   8.985  27.333 -27.987
  394   H5''    C  38          H5''        C  38   8.164  26.152 -29.025
  395    H4'    C  38           H4'        C  38  10.646  26.934 -29.580
  396    H3'    C  38           H3'        C  38   9.285  24.249 -29.724
  397    H2'    C  38          H2''        C  38  11.242  23.106 -30.205
  398   HO2'    C  38          H2'         C  38  12.389  25.590 -30.990
  399    H1'    C  38           H1'        C  38  13.073  24.713 -28.824
  400    H41    C  38           H41        C  38  12.472  19.269 -25.563
  401    H42    C  38           H42        C  38  10.899  19.760 -24.983
  402    H5     C  38           H5         C  38   9.861  21.844 -25.598
  403    H6     C  38           H6         C  38  10.048  23.844 -26.990
  404    H5'    A  39           H5'        A  39  10.261  24.439 -34.246
  405   H5''    A  39          H5''        A  39   9.155  23.182 -34.832
  406    H4'    A  39           H4'        A  39  11.787  22.743 -34.735
  407    H3'    A  39           H3'        A  39   9.405  20.995 -34.172
  408    H2'    A  39          H2''        A  39  10.652  19.327 -33.212
  409   HO2'    A  39          H2'         A  39  11.893  19.111 -35.193
  410    H1'    A  39           H1'        A  39  12.982  20.826 -32.512
  411    H8     A  39           H8         A  39   9.779  21.771 -30.668
  412    H61    A  39           H61        A  39  11.007  17.058 -26.858
  413    H62    A  39           H62        A  39  10.090  18.532 -27.070
  414    H2     A  39           H2         A  39  13.858  16.834 -30.316
  415    H5'    A  40           H5'        A  40  11.547  19.509 -38.196
  416   H5''    A  40          H5''        A  40  10.482  18.392 -39.074
  417    H4'    A  40           H4'        A  40  12.668  17.337 -38.301
  418    H3'    A  40           H3'        A  40   9.911  16.460 -37.352
  419    H2'    A  40          H2''        A  40  10.814  14.768 -36.034
  420   HO2'    A  40          H2'         A  40  13.213  15.075 -37.534
  421    H1'    A  40           H1'        A  40  13.128  16.107 -35.248
  422    H8     A  40           H8         A  40   9.811  18.064 -35.034
  423    H61    A  40           H61        A  40   9.467  15.905 -29.250
  424    H62    A  40           H62        A  40   8.746  16.971 -30.435
  425    H2     A  40           H2         A  40  12.920  13.893 -31.282
  426    H5'    U  41           H5'        U  41  11.013  12.501 -39.393
  427   H5''    U  41          H5''        U  41   9.479  11.617 -39.281
  428    H4'    U  41           H4'        U  41  11.566  11.040 -37.674
  429    H3'    U  41           H3'        U  41   8.574  11.089 -37.170
  430    H2'    U  41          H2''        U  41   8.877  10.653 -34.904
  431   HO2'    U  41          H2'         U  41  10.020   8.823 -34.849
  432    H1'    U  41           H1'        U  41  11.446  11.810 -34.606
  433    H3     U  41           H3         U  41   8.579  13.258 -31.335
  434    H5     U  41           H5         U  41   7.415  15.345 -34.808
  435    H6     U  41           H6         U  41   9.028  14.032 -36.058
  436    H5'    C  42           H5'        C  42  10.255   6.632 -36.200
  437   H5''    C  42          H5''        C  42   8.765   5.682 -36.365
  438    H4'    C  42           H4'        C  42  10.028   5.339 -34.174
  439    H3'    C  42           H3'        C  42   7.153   6.237 -34.452
  440    H2'    C  42          H2''        C  42   6.885   6.438 -32.146
  441   HO2'    C  42          H2'         C  42   7.755   4.333 -31.701
  442    H1'    C  42           H1'        C  42   9.469   7.269 -31.490
  443    H41    C  42           H41        C  42   5.675  12.351 -31.022
  444    H42    C  42           H42        C  42   5.477  12.414 -32.758
  445    H5     C  42           H5         C  42   6.527  10.844 -34.260
  446    H6     C  42           H6         C  42   7.878   8.809 -34.410
  447    H5'    A  43           H5'        A  43   5.775   2.105 -32.855
  448   H5''    A  43          H5''        A  43   4.085   2.260 -33.370
  449    H4'    A  43           H4'        A  43   4.790   2.561 -30.798
  450    H3'    A  43           H3'        A  43   2.777   4.036 -32.514
  451    H2'    A  43          H2''        A  43   2.248   5.481 -30.792
  452   HO2'    A  43          H2'         A  43   2.541   3.293 -29.302
  453    H1'    A  43           H1'        A  43   4.776   5.522 -29.521
  454    H8     A  43           H8         A  43   5.094   6.534 -33.139
  455    H61    A  43           H61        A  43   2.792  12.040 -31.483
  456    H62    A  43           H62        A  43   3.594  11.138 -32.749
  457    H2     A  43           H2         A  43   2.381   9.247 -27.999
  458    H5'    G  44           H5'        G  44   0.202   1.635 -28.668
  459   H5''    G  44          H5''        G  44  -1.369   1.946 -29.431
  460    H4'    G  44           H4'        G  44  -0.944   2.611 -26.884
  461    H3'    G  44           H3'        G  44  -2.406   4.030 -29.115
  462    H2'    G  44          H2''        G  44  -2.859   5.891 -27.787
  463   HO2'    G  44          H2'         G  44  -2.189   4.275 -25.538
  464    H1'    G  44           H1'        G  44  -0.463   5.962 -26.356
  465    H8     G  44           H8         G  44   0.735   5.566 -29.781
  466    H1     G  44           H1         G  44  -1.946  11.314 -28.870
  467    H21    G  44           H21        G  44  -3.059  11.341 -26.969
  468    H22    G  44           H22        G  44  -3.280   9.905 -25.994
  469    H5'    C  45           H5'        C  45  -4.774   4.828 -26.269
  470   H5''    C  45          H5''        C  45  -6.449   4.288 -26.491
  471    H4'    C  45           H4'        C  45  -6.574   6.647 -26.055
  472    H3'    C  45           H3'        C  45  -6.808   5.819 -28.958
  473    H2'    C  45          H2''        C  45  -6.983   8.014 -29.658
  474   HO2'    C  45          H2'         C  45  -8.091   9.463 -28.589
  475    H1'    C  45           H1'        C  45  -5.443   9.208 -27.608
  476    H41    C  45           H41        C  45  -2.407   9.928 -33.148
  477    H42    C  45           H42        C  45  -2.140   8.206 -33.281
  478    H5     C  45           H5         C  45  -2.852   6.627 -31.593
  479    H6     C  45           H6         C  45  -4.121   6.346 -29.522
  480    H5'    U  46           H5'        U  46 -10.896   8.498 -27.932
  481   H5''    U  46          H5''        U  46 -11.814   7.913 -29.333
  482    H4'    U  46           H4'        U  46 -11.357  10.516 -29.015
  483    H3'    U  46           H3'        U  46 -11.334   8.742 -31.453
  484    H2'    U  46          H2''        U  46 -10.500  10.398 -32.837
  485   HO2'    U  46          H2'         U  46 -12.030  11.990 -31.230
  486    H1'    U  46           H1'        U  46  -9.005  11.870 -30.973
  487    H3     U  46           H3         U  46  -6.202  10.738 -34.361
  488    H5     U  46           H5         U  46  -6.807   7.140 -32.259
  489    H6     U  46           H6         U  46  -8.483   8.281 -30.920
  490    H5'    C  47           H5'        C  47 -13.837  12.541 -32.372
  491   H5''    C  47          H5''        C  47 -15.165  11.935 -33.382
  492    H4'    C  47           H4'        C  47 -14.087  13.881 -34.461
  493    H3'    C  47           H3'        C  47 -13.704  11.116 -35.634
  494    H2'    C  47          H2''        C  47 -12.575  12.046 -37.474
  495   HO2'    C  47          H2'         C  47 -13.704  13.775 -38.103
  496    H1'    C  47           H1'        C  47 -11.114  13.909 -35.988
  497    H41    C  47           H41        C  47  -7.031   9.158 -36.863
  498    H42    C  47           H42        C  47  -7.910   8.142 -35.743
  499    H5     C  47           H5         C  47  -9.860   8.901 -34.545
  500    H6     C  47           H6         C  47 -11.639  10.588 -34.496
  501    H5'    C  48           H5'        C  48 -15.682  13.588 -38.798
  502   H5''    C  48          H5''        C  48 -16.733  12.538 -39.768
  503    H4'    C  48           H4'        C  48 -14.994  13.774 -41.127
  504    H3'    C  48           H3'        C  48 -15.306  10.795 -40.934
  505   HO3'    C  48          H3T         C  48 -15.633  12.778 -42.953
  506    H2'    C  48          H2''        C  48 -13.391  10.302 -42.100
  507   HO2'    C  48          H2'         C  48 -12.435  11.907 -43.540
  508    H1'    C  48           H1'        C  48 -11.877  12.611 -41.517
  509    H41    C  48           H41        C  48  -9.110   7.607 -38.696
  510    H42    C  48           H42        C  48 -10.320   7.627 -37.434
  511    H5     C  48           H5         C  48 -12.313   8.980 -37.548
  512    H6     C  48           H6         C  48 -13.465  10.754 -38.781
  Start of MODEL    3
    1    H5'    G   1           H5'        G   1  -0.693   3.911 -44.897
    2   H5''    G   1          H5''        G   1   0.485   5.166 -44.469
    3    H4'    G   1           H4'        G   1  -1.261   6.037 -46.032
    4    H3'    G   1           H3'        G   1  -0.845   7.008 -43.217
    5    H2'    G   1          H2''        G   1  -2.734   8.285 -43.133
    6   HO2'    G   1          H2'         G   1  -3.186   9.602 -44.696
    7    H1'    G   1           H1'        G   1  -4.345   6.933 -45.028
    8    H8     G   1           H8         G   1  -3.247   4.557 -42.315
    9    H1     G   1           H1         G   1  -8.151   8.315 -40.605
   10    H21    G   1           H21        G   1  -8.378   9.966 -42.054
   11    H22    G   1           H22        G   1  -7.452  10.040 -43.537
   12   HO5'    G   1          H5T         G   1  -1.414   3.879 -42.913
   13    H5'    G   2           H5'        G   2  -0.200  11.259 -45.093
   14   H5''    G   2          H5''        G   2   0.486  12.028 -43.651
   15    H4'    G   2           H4'        G   2  -2.006  12.592 -44.507
   16    H3'    G   2           H3'        G   2  -0.829  12.325 -41.727
   17    H2'    G   2          H2''        G   2  -2.887  12.547 -40.736
   18   HO2'    G   2          H2'         G   2  -3.657  13.978 -43.069
   19    H1'    G   2           H1'        G   2  -4.496  11.616 -42.922
   20    H8     G   2           H8         G   2  -2.199   8.977 -41.514
   21    H1     G   2           H1         G   2  -7.413  10.127 -37.954
   22    H21    G   2           H21        G   2  -8.465  11.903 -38.721
   23    H22    G   2           H22        G   2  -7.783  12.919 -39.972
   24    H5'    G   3           H5'        G   3  -2.291  17.350 -41.761
   25   H5''    G   3          H5''        G   3  -1.658  17.515 -40.113
   26    H4'    G   3           H4'        G   3  -4.215  18.108 -40.710
   27    H3'    G   3           H3'        G   3  -3.070  16.697 -38.273
   28    H2'    G   3          H2''        G   3  -5.224  16.754 -37.296
   29   HO2'    G   3          H2'         G   3  -5.649  18.960 -38.199
   30    H1'    G   3           H1'        G   3  -6.518  15.900 -39.610
   31    H8     G   3           H8         G   3  -3.506  13.843 -39.672
   32    H1     G   3           H1         G   3  -7.338  12.193 -34.806
   33    H21    G   3           H21        G   3  -8.851  13.760 -34.470
   34    H22    G   3           H22        G   3  -8.816  15.291 -35.317
   35    H5'    G   4           H5'        G   4  -4.827  19.457 -36.439
   36   H5''    G   4          H5''        G   4  -3.925  20.539 -35.359
   37    H4'    G   4           H4'        G   4  -5.582  19.538 -33.961
   38    H3'    G   4           H3'        G   4  -2.841  18.273 -33.839
   39    H2'    G   4          H2''        G   4  -3.533  16.651 -32.353
   40   HO2'    G   4          H2'         G   4  -4.673  17.337 -30.735
   41    H1'    G   4           H1'        G   4  -6.141  16.312 -33.294
   42    H8     G   4           H8         G   4  -3.465  16.163 -36.033
   43    H1     G   4           H1         G   4  -3.973  10.799 -32.549
   44    H21    G   4           H21        G   4  -5.350  11.144 -30.852
   45    H22    G   4           H22        G   4  -5.983  12.729 -30.472
   46    H5'    U   5           H5'        U   5  -4.105  19.421 -29.172
   47   H5''    U   5          H5''        U   5  -2.469  19.320 -28.496
   48    H4'    U   5           H4'        U   5  -4.422  17.781 -27.538
   49    H3'    U   5           H3'        U   5  -1.507  17.243 -28.096
   50    H2'    U   5          H2''        U   5  -1.686  14.974 -27.653
   51   HO2'    U   5          H2'         U   5  -4.057  15.612 -26.216
   52    H1'    U   5           H1'        U   5  -4.300  14.530 -28.505
   53    H3     U   5           H3         U   5  -1.379  11.828 -30.780
   54    H5     U   5           H5         U   5  -0.946  15.628 -32.550
   55    H6     U   5           H6         U   5  -2.459  16.507 -30.867
   56    H5'    U   6           H5'        U   6  -2.614  15.490 -24.020
   57   H5''    U   6          H5''        U   6  -1.285  16.002 -22.963
   58    H4'    U   6           H4'        U   6  -1.726  13.604 -22.639
   59    H3'    U   6           H3'        U   6   0.812  14.521 -24.004
   60    H2'    U   6          H2''        U   6   1.547  12.319 -24.302
   61   HO2'    U   6          H2'         U   6   1.279  11.414 -22.335
   62    H1'    U   6           H1'        U   6  -0.914  11.153 -24.858
   63    H3     U   6           H3         U   6   1.508  10.736 -28.684
   64    H5     U   6           H5         U   6   0.616  14.846 -28.479
   65    H6     U   6           H6         U   6  -0.384  14.452 -26.306
   66    H5'    G   7           H5'        G   7   3.030  13.031 -20.303
   67   H5''    G   7          H5''        G   7   4.612  13.784 -20.588
   68    H4'    G   7           H4'        G   7   4.193  11.173 -21.071
   69    H3'    G   7           H3'        G   7   5.831  13.265 -22.525
   70    H2'    G   7          H2''        G   7   6.327  11.814 -24.255
   71   HO2'    G   7          H2'         G   7   5.815   9.686 -22.431
   72    H1'    G   7           H1'        G   7   4.032  10.132 -24.051
   73    H8     G   7           H8         G   7   2.897  13.586 -24.859
   74    H1     G   7           H1         G   7   5.875  10.746 -29.780
   75    H21    G   7           H21        G   7   6.954   8.957 -29.076
   76    H22    G   7           H22        G   7   6.802   8.360 -27.439
   77    H5'    G   8           H5'        G   8   9.189   9.611 -21.073
   78   H5''    G   8          H5''        G   8  10.564  10.664 -21.456
   79    H4'    G   8           H4'        G   8  10.396   8.225 -22.512
   80    H3'    G   8           H3'        G   8  11.199  10.856 -23.784
   81    H2'    G   8          H2''        G   8  11.650   9.774 -25.811
   82   HO2'    G   8          H2'         G   8  11.849   7.497 -24.182
   83    H1'    G   8           H1'        G   8   9.484   8.031 -25.737
   84    H8     G   8           H8         G   8   8.052  11.305 -24.763
   85    H1     G   8           H1         G   8   9.718  11.155 -30.952
   86    H21    G   8           H21        G   8  10.971   9.387 -31.357
   87    H22    G   8           H22        G   8  11.555   8.345 -30.079
   88    H5'    U   9           H5'        U   9  13.883   8.522 -25.042
   89   H5''    U   9          H5''        U   9  15.551   8.775 -24.490
   90    H4'    U   9           H4'        U   9  15.780   8.559 -26.839
   91    H3'    U   9           H3'        U   9  15.758  11.334 -25.727
   92    H2'    U   9          H2''        U   9  15.458  12.430 -27.734
   93   HO2'    U   9          H2'         U   9  17.249  11.545 -28.771
   94    H1'    U   9           H1'        U   9  14.064  10.513 -29.198
   95    H3     U   9           H3         U   9  11.174  13.977 -29.161
   96    H5     U   9           H5         U   9  11.399  12.850 -25.108
   97    H6     U   9           H6         U   9  13.102  11.242 -25.717
   98    H5'    G  10           H5'        G  10  19.529  11.652 -27.917
   99   H5''    G  10          H5''        G  10  20.586  12.757 -27.016
  100    H4'    G  10           H4'        G  10  19.591  13.604 -29.268
  101    H3'    G  10           H3'        G  10  19.702  14.935 -26.573
  102    H2'    G  10          H2''        G  10  18.293  16.647 -27.148
  103   HO2'    G  10          H2'         G  10  19.513  17.533 -28.758
  104    H1'    G  10           H1'        G  10  16.969  15.444 -29.379
  105    H8     G  10           H8         G  10  16.063  13.590 -26.271
  106    H1     G  10           H1         G  10  13.144  19.287 -26.691
  107    H21    G  10           H21        G  10  14.060  20.485 -28.305
  108    H22    G  10           H22        G  10  15.509  19.972 -29.140
  109    H5'    U  11           H5'        U  11  22.130  18.567 -29.231
  110   H5''    U  11          H5''        U  11  22.888  19.051 -27.701
  111    H4'    U  11           H4'        U  11  21.417  20.791 -29.078
  112    H3'    U  11           H3'        U  11  21.718  20.230 -26.140
  113    H2'    U  11          H2''        U  11  19.880  21.434 -25.505
  114   HO2'    U  11          H2'         U  11  20.252  23.011 -27.845
  115    H1'    U  11           H1'        U  11  18.433  21.479 -27.955
  116    H3     U  11           H3         U  11  15.430  20.504 -24.689
  117    H5     U  11           H5         U  11  17.846  17.065 -24.932
  118    H6     U  11           H6         U  11  19.290  18.263 -26.469
  119    H5'    A  12           H5'        A  12  22.846  25.176 -26.746
  120   H5''    A  12          H5''        A  12  23.203  25.531 -25.045
  121    H4'    A  12           H4'        A  12  21.266  26.842 -26.360
  122    H3'    A  12           H3'        A  12  21.499  25.848 -23.518
  123    H2'    A  12          H2''        A  12  19.294  26.438 -22.990
  124   HO2'    A  12          H2'         A  12  19.275  27.960 -25.400
  125    H1'    A  12           H1'        A  12  18.083  25.665 -25.336
  126    H8     A  12           H8         A  12  20.594  22.989 -24.542
  127    H61    A  12           H61        A  12  16.685  20.950 -20.218
  128    H62    A  12           H62        A  12  18.070  20.551 -21.210
  129    H2     A  12           H2         A  12  15.232  24.953 -21.634
  130    H5'    U  13           H5'        U  13  20.455  29.921 -21.987
  131   H5''    U  13          H5''        U  13  21.281  29.775 -20.424
  132    H4'    U  13           H4'        U  13  18.620  29.733 -20.565
  133    H3'    U  13           H3'        U  13  20.576  28.158 -18.885
  134    H2'    U  13          H2''        U  13  18.889  26.807 -17.990
  135   HO2'    U  13          H2'         U  13  16.860  27.490 -17.666
  136    H1'    U  13           H1'        U  13  17.134  26.788 -20.150
  137    H3     U  13           H3         U  13  18.438  22.573 -18.713
  138    H5     U  13           H5         U  13  21.432  23.877 -21.376
  139    H6     U  13           H6         U  13  20.383  26.059 -21.392
  140    H5'    U  14           H5'        U  14  17.273  29.113 -16.273
  141   H5''    U  14          H5''        U  14  17.959  30.026 -14.914
  142    H4'    U  14           H4'        U  14  16.493  28.268 -14.034
  143    H3'    U  14           H3'        U  14  19.459  28.247 -13.671
  144    H2'    U  14          H2''        U  14  19.644  26.068 -13.008
  145   HO2'    U  14          H2'         U  14  17.814  24.990 -11.970
  146    H1'    U  14           H1'        U  14  17.301  24.944 -14.077
  147    H3     U  14           H3         U  14  20.485  22.133 -15.576
  148    H5     U  14           H5         U  14  21.391  25.766 -17.506
  149    H6     U  14           H6         U  14  19.665  26.828 -16.173
  150    H5'    U  15           H5'        U  15  17.454  27.258  -9.250
  151   H5''    U  15          H5''        U  15  18.888  27.514  -8.237
  152    H4'    U  15           H4'        U  15  17.664  25.145  -8.270
  153    H3'    U  15           H3'        U  15  20.547  25.968  -8.134
  154    H2'    U  15          H2''        U  15  21.391  23.894  -8.617
  155   HO2'    U  15          H2'         U  15  20.758  22.295  -7.432
  156    H1'    U  15           H1'        U  15  19.161  22.725  -9.931
  157    H3     U  15           H3         U  15  22.815  21.806 -12.479
  158    H5     U  15           H5         U  15  22.128  25.922 -13.057
  159    H6     U  15           H6         U  15  20.454  25.823 -11.305
  160    H5'    U  16           H5'        U  16  19.786  22.455  -5.017
  161   H5''    U  16          H5''        U  16  20.907  22.877  -3.708
  162    H4'    U  16           H4'        U  16  21.123  20.487  -4.589
  163    H3'    U  16           H3'        U  16  23.264  22.572  -4.341
  164    H2'    U  16          H2''        U  16  24.819  21.459  -5.594
  165   HO2'    U  16          H2'         U  16  23.785  19.316  -4.244
  166    H1'    U  16           H1'        U  16  23.142  19.730  -7.096
  167    H3     U  16           H3         U  16  25.979  21.518 -10.142
  168    H5     U  16           H5         U  16  23.619  24.782  -8.910
  169    H6     U  16           H6         U  16  22.633  23.348  -7.219
  170    H5'    U  17           H5'        U  17  25.221  18.471  -2.125
  171   H5''    U  17          H5''        U  17  26.503  19.382  -1.304
  172    H4'    U  17           H4'        U  17  27.119  17.406  -2.980
  173    H3'    U  17           H3'        U  17  28.347  20.099  -2.454
  174    H2'    U  17          H2''        U  17  29.685  20.080  -4.312
  175   HO2'    U  17          H2'         U  17  29.725  17.293  -3.884
  176    H1'    U  17           H1'        U  17  28.277  18.200  -5.921
  177    H3     U  17           H3         U  17  29.333  21.696  -8.614
  178    H5     U  17           H5         U  17  26.368  23.223  -6.040
  179    H6     U  17           H6         U  17  26.502  21.158  -4.773
  180    H5'    A  18           H5'        A  18  32.081  16.695  -2.272
  181   H5''    A  18          H5''        A  18  33.244  17.775  -1.479
  182    H4'    A  18           H4'        A  18  33.853  16.621  -3.796
  183    H3'    A  18           H3'        A  18  34.352  19.394  -2.728
  184    H2'    A  18          H2''        A  18  35.060  20.219  -4.740
  185   HO2'    A  18          H2'         A  18  36.597  19.212  -5.741
  186    H1'    A  18           H1'        A  18  33.851  18.305  -6.483
  187    H8     A  18           H8         A  18  31.453  20.499  -4.522
  188    H61    A  18           H61        A  18  32.133  24.649  -9.047
  189    H62    A  18           H62        A  18  31.293  24.265  -7.560
  190    H2     A  18           H2         A  18  35.231  21.450  -9.611
  191    H5'    A  19           H5'        A  19  38.426  17.702  -4.596
  192   H5''    A  19          H5''        A  19  39.609  18.496  -3.538
  193    H4'    A  19           H4'        A  19  40.053  18.821  -6.011
  194    H3'    A  19           H3'        A  19  39.577  21.043  -4.022
  195    H2'    A  19          H2''        A  19  39.620  22.681  -5.646
  196   HO2'    A  19          H2'         A  19  41.222  20.864  -7.129
  197    H1'    A  19           H1'        A  19  38.831  21.108  -7.879
  198    H8     A  19           H8         A  19  36.398  21.365  -4.928
  199    H61    A  19           H61        A  19  34.312  26.525  -7.594
  200    H62    A  19           H62        A  19  33.975  25.278  -6.414
  201    H2     A  19           H2         A  19  37.981  25.196  -9.815
  202    H5'    A  20           H5'        A  20  43.763  22.197  -6.226
  203   H5''    A  20          H5''        A  20  44.291  23.436  -5.072
  204    H4'    A  20           H4'        A  20  43.813  24.076  -7.612
  205    H3'    A  20           H3'        A  20  43.174  25.507  -5.029
  206    H2'    A  20          H2''        A  20  42.006  27.191  -6.116
  207   HO2'    A  20          H2'         A  20  42.405  27.815  -8.195
  208    H1'    A  20           H1'        A  20  41.028  25.706  -8.289
  209    H8     A  20           H8         A  20  40.328  24.298  -4.776
  210    H61    A  20           H61        A  20  35.380  27.999  -4.709
  211    H62    A  20           H62        A  20  36.165  26.633  -3.949
  212    H2     A  20           H2         A  20  37.744  28.915  -8.408
  213    H5'    U  21           H5'        U  21  44.244  28.520  -7.393
  214   H5''    U  21          H5''        U  21  45.327  29.680  -6.599
  215    H4'    U  21           H4'        U  21  43.256  30.818  -7.283
  216    H3'    U  21           H3'        U  21  43.912  30.333  -4.385
  217    H2'    U  21          H2''        U  21  41.889  31.164  -3.611
  218   HO2'    U  21          H2'         U  21  41.565  32.450  -6.132
  219    H1'    U  21           H1'        U  21  40.246  30.434  -5.745
  220    H3     U  21           H3         U  21  38.435  28.311  -2.184
  221    H5     U  21           H5         U  21  42.211  26.484  -2.600
  222    H6     U  21           H6         U  21  42.667  28.001  -4.436
  223    H5'    U  22           H5'        U  22  42.648  34.250  -5.506
  224   H5''    U  22          H5''        U  22  43.649  35.612  -4.962
  225    H4'    U  22           H4'        U  22  41.229  36.140  -4.740
  226    H3'    U  22           H3'        U  22  43.225  36.056  -2.568
  227    H2'    U  22          H2''        U  22  41.895  35.444  -0.837
  228   HO2'    U  22          H2'         U  22  40.153  37.378  -1.943
  229    H1'    U  22           H1'        U  22  39.373  35.026  -2.204
  230    H3     U  22           H3         U  22  38.874  31.657   0.701
  231    H5     U  22           H5         U  22  42.754  31.007  -0.811
  232    H6     U  22           H6         U  22  42.514  33.034  -2.120
  233    H5'    A  23           H5'        A  23  44.153  38.182   0.250
  234   H5''    A  23          H5''        A  23  43.097  36.776   0.014
  235    H4'    A  23           H4'        A  23  43.217  37.576   2.412
  236    H3'    A  23           H3'        A  23  40.865  37.036   0.750
  237    H2'    A  23          H2''        A  23  39.336  38.464   1.673
  238   HO2'    A  23          H2'         A  23  39.269  37.449   3.650
  239    H1'    A  23           H1'        A  23  40.911  40.323   3.059
  240    H8     A  23           H8         A  23  42.091  40.500  -0.438
  241    H61    A  23           H61        A  23  36.946  43.586  -1.903
  242    H62    A  23           H62        A  23  38.554  43.133  -2.421
  243    H2     A  23           H2         A  23  36.307  41.661   2.086
  244    H5'    A  24           H5'        A  24  38.653  34.080   3.444
  245   H5''    A  24          H5''        A  24  37.701  33.702   1.996
  246    H4'    A  24           H4'        A  24  37.185  35.731   3.944
  247    H3'    A  24           H3'        A  24  36.006  34.496   1.536
  248    H2'    A  24          H2''        A  24  35.366  36.386   0.468
  249   HO2'    A  24          H2'         A  24  34.356  38.086   2.019
  250    H1'    A  24           H1'        A  24  36.392  38.394   2.343
  251    H8     A  24           H8         A  24  38.853  37.012  -0.069
  252    H61    A  24           H61        A  24  36.719  41.019  -4.266
  253    H62    A  24           H62        A  24  37.896  39.765  -3.948
  254    H2     A  24           H2         A  24  33.929  41.051  -0.753
  255    H5'    U  25           H5'        U  25  32.913  33.035   0.653
  256   H5''    U  25          H5''        U  25  33.756  34.594   0.714
  257    H4'    U  25           H4'        U  25  31.029  34.030  -0.105
  258    H3'    U  25           H3'        U  25  33.098  35.720  -0.774
  259    H2'    U  25          H2''        U  25  32.914  37.261   0.988
  260   HO2'    U  25          H2'         U  25  32.020  39.035   0.152
  261    H1'    U  25           H1'        U  25  29.923  37.090   0.975
  262    H3     U  25           H3         U  25  29.429  39.292   4.837
  263    H5     U  25           H5         U  25  33.306  37.684   5.202
  264    H6     U  25           H6         U  25  33.024  36.662   3.020
  265    H5'    U  26           H5'        U  26  34.389  36.936  -1.544
  266   H5''    U  26          H5''        U  26  33.449  37.825  -2.760
  267    H4'    U  26           H4'        U  26  35.568  37.977  -3.748
  268    H3'    U  26           H3'        U  26  34.036  35.566  -4.577
  269    H2'    U  26          H2''        U  26  35.778  34.216  -5.197
  270   HO2'    U  26          H2'         U  26  36.637  35.470  -6.788
  271    H1'    U  26           H1'        U  26  37.896  35.232  -3.713
  272    H3     U  26           H3         U  26  37.763  30.920  -2.416
  273    H5     U  26           H5         U  26  34.196  32.516  -0.846
  274    H6     U  26           H6         U  26  34.686  34.593  -1.980
  275    H5'    C  27           H5'        C  27  34.690  37.165  -9.370
  276   H5''    C  27          H5''        C  27  33.420  36.023  -9.854
  277    H4'    C  27           H4'        C  27  35.897  35.786 -10.818
  278    H3'    C  27           H3'        C  27  33.802  33.812  -9.981
  279    H2'    C  27          H2''        C  27  35.214  31.996  -9.867
  280   HO2'    C  27          H2'         C  27  36.992  31.762 -11.224
  281    H1'    C  27           H1'        C  27  37.697  33.281  -9.485
  282    H41    C  27           H41        C  27  36.645  29.950  -4.182
  283    H42    C  27           H42        C  27  35.032  30.606  -4.015
  284    H5     C  27           H5         C  27  34.027  32.053  -5.657
  285    H6     C  27           H6         C  27  34.406  33.325  -7.714
  286    H5'    U  28           H5'        U  28  34.793  33.022 -14.888
  287   H5''    U  28          H5''        U  28  33.810  31.588 -15.243
  288    H4'    U  28           H4'        U  28  36.482  31.535 -15.533
  289    H3'    U  28           H3'        U  28  34.567  29.486 -14.370
  290    H2'    U  28          H2''        U  28  36.328  27.983 -14.015
  291   HO2'    U  28          H2'         U  28  37.910  27.906 -15.391
  292    H1'    U  28           H1'        U  28  38.098  29.840 -13.004
  293    H3     U  28           H3         U  28  36.519  26.880  -9.820
  294    H5     U  28           H5         U  28  33.605  29.897 -10.123
  295    H6     U  28           H6         U  28  34.817  30.804 -12.002
  296    H5'    U  29           H5'        U  29  36.728  27.194 -17.323
  297   H5''    U  29          H5''        U  29  35.795  25.743 -17.735
  298    H4'    U  29           H4'        U  29  38.031  25.538 -16.310
  299    H3'    U  29           H3'        U  29  35.371  24.147 -16.152
  300    H2'    U  29          H2''        U  29  35.793  23.144 -14.119
  301   HO2'    U  29          H2'         U  29  38.516  23.346 -14.868
  302    H1'    U  29           H1'        U  29  37.631  24.983 -13.034
  303    H3     U  29           H3         U  29  34.108  24.006 -10.191
  304    H5     U  29           H5         U  29  32.801  27.154 -12.661
  305    H6     U  29           H6         U  29  34.795  26.845 -14.007
  306    H5'    A  30           H5'        A  30  37.549  21.098 -14.852
  307   H5''    A  30          H5''        A  30  37.458  19.782 -16.038
  308    H4'    A  30           H4'        A  30  36.818  18.698 -14.046
  309    H3'    A  30           H3'        A  30  34.474  19.754 -15.627
  310    H2'    A  30          H2''        A  30  32.954  19.179 -13.978
  311   HO2'    A  30          H2'         A  30  34.855  17.195 -13.330
  312    H1'    A  30           H1'        A  30  34.703  19.322 -11.741
  313    H8     A  30           H8         A  30  34.101  22.424 -13.975
  314    H61    A  30           H61        A  30  29.410  23.667 -10.148
  315    H62    A  30           H62        A  30  30.427  24.293 -11.426
  316    H2     A  30           H2         A  30  31.077  19.650  -9.054
  317    H5'    A  31           H5'        A  31  33.668  15.067 -14.544
  318   H5''    A  31          H5''        A  31  32.355  14.723 -15.687
  319    H4'    A  31           H4'        A  31  31.957  14.397 -13.089
  320    H3'    A  31           H3'        A  31  30.215  15.579 -15.246
  321    H2'    A  31          H2''        A  31  28.651  16.375 -13.766
  322   HO2'    A  31          H2'         A  31  27.844  14.822 -12.609
  323    H1'    A  31           H1'        A  31  30.272  16.481 -11.410
  324    H8     A  31           H8         A  31  31.140  18.765 -14.374
  325    H61    A  31           H61        A  31  27.170  22.802 -11.896
  326    H62    A  31           H62        A  31  28.483  22.592 -13.034
  327    H2     A  31           H2         A  31  26.849  18.955  -9.610
  328    H5'    A  32           H5'        A  32  27.560  11.991 -13.126
  329   H5''    A  32          H5''        A  32  26.298  11.846 -14.366
  330    H4'    A  32           H4'        A  32  25.651  12.447 -11.855
  331    H3'    A  32           H3'        A  32  24.631  13.419 -14.513
  332    H2'    A  32          H2''        A  32  23.444  15.173 -13.635
  333   HO2'    A  32          H2'         A  32  22.139  14.874 -12.007
  334    H1'    A  32           H1'        A  32  24.811  15.480 -11.150
  335    H8     A  32           H8         A  32  26.862  16.134 -14.306
  336    H61    A  32           H61        A  32  24.544  21.864 -14.180
  337    H62    A  32           H62        A  32  25.735  20.808 -14.904
  338    H2     A  32           H2         A  32  22.458  19.449 -11.029
  339    H5'    A  33           H5'        A  33  20.725  11.949 -11.822
  340   H5''    A  33          H5''        A  33  19.517  11.879 -13.120
  341    H4'    A  33           H4'        A  33  19.114  13.424 -10.991
  342    H3'    A  33           H3'        A  33  18.557  13.801 -13.921
  343    H2'    A  33          H2''        A  33  18.059  16.044 -13.740
  344   HO2'    A  33          H2'         A  33  16.927  16.853 -12.115
  345    H1'    A  33           H1'        A  33  19.552  16.699 -11.438
  346    H8     A  33           H8         A  33  21.632  15.205 -14.252
  347    H61    A  33           H61        A  33  21.838  20.897 -16.652
  348    H62    A  33           H62        A  33  22.571  19.308 -16.656
  349    H2     A  33           H2         A  33  18.887  20.915 -13.272
  350    H5'    A  34           H5'        A  34  15.183  15.327 -11.515
  351   H5''    A  34          H5''        A  34  13.647  14.963 -12.328
  352    H4'    A  34           H4'        A  34  13.970  17.414 -11.725
  353    H3'    A  34           H3'        A  34  13.399  16.263 -14.438
  354    H2'    A  34          H2''        A  34  13.819  18.201 -15.587
  355   HO2'    A  34          H2'         A  34  13.185  20.176 -14.867
  356    H1'    A  34           H1'        A  34  15.378  19.587 -13.597
  357    H8     A  34           H8         A  34  16.852  16.420 -15.198
  358    H61    A  34           H61        A  34  19.546  20.287 -19.196
  359    H62    A  34           H62        A  34  19.584  18.682 -18.504
  360    H2     A  34           H2         A  34  16.539  22.617 -16.818
  361    H5'    C  35           H5'        C  35   9.332  17.012 -16.659
  362   H5''    C  35          H5''        C  35  11.013  16.504 -16.409
  363    H4'    C  35           H4'        C  35  10.550  19.450 -16.296
  364    H3'    C  35           H3'        C  35   9.351  17.923 -18.391
  365    H2'    C  35          H2''        C  35  11.217  17.428 -19.635
  366   HO2'    C  35          H2'         C  35  11.787  19.038 -21.054
  367    H1'    C  35           H1'        C  35  12.960  19.598 -18.678
  368    H41    C  35           H41        C  35  17.007  15.145 -20.709
  369    H42    C  35           H42        C  35  16.294  13.956 -19.642
  370    H5     C  35           H5         C  35  14.470  14.457 -18.150
  371    H6     C  35           H6         C  35  12.812  16.138 -17.498
  372    H5'    U  36           H5'        U  36   8.369  22.141 -16.226
  373   H5''    U  36          H5''        U  36   6.876  22.921 -16.787
  374    H4'    U  36           H4'        U  36   8.203  24.809 -16.761
  375    H3'    U  36           H3'        U  36   8.563  23.315 -19.338
  376    H2'    U  36          H2''        U  36  10.484  24.370 -19.948
  377   HO2'    U  36          H2'         U  36   9.532  26.418 -20.044
  378    H1'    U  36           H1'        U  36  11.310  25.369 -17.386
  379    H3     U  36           H3         U  36  14.706  23.594 -20.070
  380    H5     U  36           H5         U  36  13.465  20.664 -17.321
  381    H6     U  36           H6         U  36  11.465  21.954 -16.931
  382    H5'    A  37           H5'        A  37   7.939  27.314 -21.242
  383   H5''    A  37          H5''        A  37   6.921  26.914 -22.638
  384    H4'    A  37           H4'        A  37   9.153  27.898 -23.285
  385    H3'    A  37           H3'        A  37   8.326  25.077 -24.003
  386    H2'    A  37          H2''        A  37  10.260  24.775 -25.248
  387   HO2'    A  37          H2'         A  37  10.812  26.382 -26.482
  388    H1'    A  37           H1'        A  37  11.969  26.227 -23.519
  389    H8     A  37           H8         A  37   9.748  23.743 -21.678
  390    H61    A  37           H61        A  37  13.943  19.445 -23.141
  391    H62    A  37           H62        A  37  12.604  19.846 -22.088
  392    H2     A  37           H2         A  37  14.930  23.180 -25.417
  393    H5'    C  38           H5'        C  38   9.048  27.375 -28.046
  394   H5''    C  38          H5''        C  38   8.169  26.395 -29.237
  395    H4'    C  38           H4'        C  38  10.739  26.751 -29.572
  396    H3'    C  38           H3'        C  38   9.108  24.218 -29.720
  397    H2'    C  38          H2''        C  38  10.974  22.884 -30.036
  398   HO2'    C  38          H2'         C  38  12.736  23.518 -31.112
  399    H1'    C  38           H1'        C  38  12.861  24.413 -28.614
  400    H41    C  38           H41        C  38  11.772  19.078 -25.295
  401    H42    C  38           H42        C  38  10.197  19.666 -24.816
  402    H5     C  38           H5         C  38   9.328  21.808 -25.507
  403    H6     C  38           H6         C  38   9.695  23.753 -26.933
  404    H5'    A  39           H5'        A  39  10.241  24.342 -34.262
  405   H5''    A  39          H5''        A  39   9.104  23.133 -34.890
  406    H4'    A  39           H4'        A  39  11.713  22.589 -34.703
  407    H3'    A  39           H3'        A  39   9.250  20.928 -34.224
  408    H2'    A  39          H2''        A  39  10.417  19.205 -33.256
  409   HO2'    A  39          H2'         A  39  12.574  20.035 -34.906
  410    H1'    A  39           H1'        A  39  12.773  20.634 -32.476
  411    H8     A  39           H8         A  39   9.536  21.621 -30.709
  412    H61    A  39           H61        A  39  10.624  16.877 -26.891
  413    H62    A  39           H62        A  39   9.711  18.350 -27.129
  414    H2     A  39           H2         A  39  13.544  16.631 -30.287
  415    H5'    A  40           H5'        A  40  11.482  19.412 -38.188
  416   H5''    A  40          H5''        A  40  10.429  18.316 -39.106
  417    H4'    A  40           H4'        A  40  12.583  17.228 -38.297
  418    H3'    A  40           H3'        A  40   9.800  16.370 -37.411
  419    H2'    A  40          H2''        A  40  10.662  14.648 -36.103
  420   HO2'    A  40          H2'         A  40  12.476  13.606 -36.548
  421    H1'    A  40           H1'        A  40  12.970  15.958 -35.252
  422    H8     A  40           H8         A  40   9.664  17.940 -35.080
  423    H61    A  40           H61        A  40   9.175  15.698 -29.338
  424    H62    A  40           H62        A  40   8.491  16.788 -30.522
  425    H2     A  40           H2         A  40  12.664  13.698 -31.319
  426    H5'    U  41           H5'        U  41  10.861  12.468 -39.583
  427   H5''    U  41          H5''        U  41   9.323  11.588 -39.513
  428    H4'    U  41           H4'        U  41  11.386  10.960 -37.896
  429    H3'    U  41           H3'        U  41   8.387  11.012 -37.433
  430    H2'    U  41          H2''        U  41   8.652  10.530 -35.175
  431   HO2'    U  41          H2'         U  41  10.069   9.110 -34.471
  432    H1'    U  41           H1'        U  41  11.237  11.642 -34.817
  433    H3     U  41           H3         U  41   8.375  13.027 -31.518
  434    H5     U  41           H5         U  41   7.240  15.223 -34.935
  435    H6     U  41           H6         U  41   8.852  13.936 -36.214
  436    H5'    C  42           H5'        C  42  10.107   6.608 -36.505
  437   H5''    C  42          H5''        C  42   8.667   5.598 -36.742
  438    H4'    C  42           H4'        C  42   9.847   5.213 -34.533
  439    H3'    C  42           H3'        C  42   6.978   6.121 -34.830
  440    H2'    C  42          H2''        C  42   6.678   6.261 -32.524
  441   HO2'    C  42          H2'         C  42   7.476   4.164 -32.071
  442    H1'    C  42           H1'        C  42   9.261   7.046 -31.806
  443    H41    C  42           H41        C  42   5.487  12.129 -31.181
  444    H42    C  42           H42        C  42   5.305  12.257 -32.914
  445    H5     C  42           H5         C  42   6.358  10.737 -34.464
  446    H6     C  42           H6         C  42   7.700   8.701 -34.679
  447    H5'    A  43           H5'        A  43   5.602   1.917 -33.383
  448   H5''    A  43          H5''        A  43   3.914   2.079 -33.904
  449    H4'    A  43           H4'        A  43   4.597   2.283 -31.317
  450    H3'    A  43           H3'        A  43   2.589   3.813 -32.991
  451    H2'    A  43          H2''        A  43   2.040   5.191 -31.222
  452   HO2'    A  43          H2'         A  43   2.238   4.608 -29.089
  453    H1'    A  43           H1'        A  43   4.557   5.189 -29.923
  454    H8     A  43           H8         A  43   4.892   6.347 -33.497
  455    H61    A  43           H61        A  43   2.567  11.772 -31.633
  456    H62    A  43           H62        A  43   3.452  10.948 -32.897
  457    H2     A  43           H2         A  43   2.169   8.846 -28.256
  458    H5'    G  44           H5'        G  44   0.045   1.245 -29.202
  459   H5''    G  44          H5''        G  44  -1.528   1.579 -29.951
  460    H4'    G  44           H4'        G  44  -1.112   2.134 -27.378
  461    H3'    G  44           H3'        G  44  -2.570   3.648 -29.548
  462    H2'    G  44          H2''        G  44  -3.033   5.447 -28.140
  463   HO2'    G  44          H2'         G  44  -2.562   3.589 -26.058
  464    H1'    G  44           H1'        G  44  -0.642   5.466 -26.706
  465    H8     G  44           H8         G  44   0.570   5.205 -30.138
  466    H1     G  44           H1         G  44  -2.144  10.901 -29.027
  467    H21    G  44           H21        G  44  -3.252  10.855 -27.122
  468    H22    G  44           H22        G  44  -3.503   9.374 -26.224
  469    H5'    C  45           H5'        C  45  -4.951   4.279 -26.637
  470   H5''    C  45          H5''        C  45  -6.623   3.742 -26.886
  471    H4'    C  45           H4'        C  45  -6.763   6.071 -26.313
  472    H3'    C  45           H3'        C  45  -6.999   5.405 -29.255
  473    H2'    C  45          H2''        C  45  -7.196   7.633 -29.835
  474   HO2'    C  45          H2'         C  45  -8.030   8.036 -27.152
  475    H1'    C  45           H1'        C  45  -5.615   8.727 -27.777
  476    H41    C  45           H41        C  45  -2.604   9.532 -33.325
  477    H42    C  45           H42        C  45  -2.354   7.810 -33.490
  478    H5     C  45           H5         C  45  -3.073   6.208 -31.832
  479    H6     C  45           H6         C  45  -4.349   5.894 -29.769
  480    H5'    U  46           H5'        U  46 -11.127   7.962 -28.130
  481   H5''    U  46          H5''        U  46 -12.027   7.440 -29.566
  482    H4'    U  46           H4'        U  46 -11.585  10.028 -29.118
  483    H3'    U  46           H3'        U  46 -11.568   8.365 -31.628
  484    H2'    U  46          H2''        U  46 -10.688  10.050 -32.945
  485   HO2'    U  46          H2'         U  46 -11.787  11.831 -32.808
  486    H1'    U  46           H1'        U  46  -9.200  11.451 -31.027
  487    H3     U  46           H3         U  46  -6.364  10.383 -34.408
  488    H5     U  46           H5         U  46  -7.022   6.740 -32.406
  489    H6     U  46           H6         U  46  -8.708   7.857 -31.062
  490    H5'    C  47           H5'        C  47 -14.240  12.227 -32.621
  491   H5''    C  47          H5''        C  47 -15.403  11.475 -33.730
  492    H4'    C  47           H4'        C  47 -14.293  13.515 -34.706
  493    H3'    C  47           H3'        C  47 -13.914  10.742 -35.861
  494    H2'    C  47          H2''        C  47 -12.703  11.640 -37.662
  495   HO2'    C  47          H2'         C  47 -13.006  13.597 -38.401
  496    H1'    C  47           H1'        C  47 -11.247  13.474 -36.137
  497    H41    C  47           H41        C  47  -7.264   8.590 -36.738
  498    H42    C  47           H42        C  47  -8.237   7.612 -35.661
  499    H5     C  47           H5         C  47 -10.222   8.441 -34.581
  500    H6     C  47           H6         C  47 -11.945  10.184 -34.639
  501    H5'    C  48           H5'        C  48 -15.388  13.367 -39.069
  502   H5''    C  48          H5''        C  48 -16.483  12.454 -40.124
  503    H4'    C  48           H4'        C  48 -14.607  13.539 -41.388
  504    H3'    C  48           H3'        C  48 -15.042  10.567 -41.215
  505   HO3'    C  48          H3T         C  48 -16.389  12.007 -42.464
  506    H2'    C  48          H2''        C  48 -13.109  10.037 -42.337
  507   HO2'    C  48          H2'         C  48 -12.218  11.314 -43.913
  508    H1'    C  48           H1'        C  48 -11.584  12.345 -41.695
  509    H41    C  48           H41        C  48  -8.776   7.280 -39.049
  510    H42    C  48           H42        C  48  -9.979   7.253 -37.780
  511    H5     C  48           H5         C  48 -11.983   8.596 -37.841
  512    H6     C  48           H6         C  48 -13.161  10.390 -39.025
  Start of MODEL    4
    1    H5'    G   1           H5'        G   1   2.108   4.678 -40.271
    2   H5''    G   1          H5''        G   1   2.064   6.437 -40.035
    3    H4'    G   1           H4'        G   1   1.903   5.800 -42.471
    4    H3'    G   1           H3'        G   1  -0.369   7.179 -40.991
    5    H2'    G   1          H2''        G   1  -1.638   7.224 -43.060
    6   HO2'    G   1          H2'         G   1   0.165   7.882 -44.369
    7    H1'    G   1           H1'        G   1  -1.088   4.723 -43.843
    8    H8     G   1           H8         G   1  -1.739   3.281 -40.865
    9    H1     G   1           H1         G   1  -6.466   7.551 -41.564
   10    H21    G   1           H21        G   1  -6.038   8.886 -43.269
   11    H22    G   1           H22        G   1  -4.509   8.862 -44.118
   12   HO5'    G   1          H5T         G   1   0.083   6.304 -39.212
   13    H5'    G   2           H5'        G   2   1.374  10.708 -43.701
   14   H5''    G   2          H5''        G   2   1.700  11.968 -42.493
   15    H4'    G   2           H4'        G   2   0.346  12.874 -44.372
   16    H3'    G   2           H3'        G   2  -0.574  12.674 -41.532
   17    H2'    G   2          H2''        G   2  -2.814  13.138 -41.939
   18   HO2'    G   2          H2'         G   2  -1.931  14.222 -44.415
   19    H1'    G   2           H1'        G   2  -3.196  11.852 -44.303
   20    H8     G   2           H8         G   2  -1.224   9.263 -42.733
   21    H1     G   2           H1         G   2  -6.469  10.380 -39.226
   22    H21    G   2           H21        G   2  -7.450  12.235 -39.922
   23    H22    G   2           H22        G   2  -6.713  13.293 -41.102
   24    H5'    G   3           H5'        G   3  -0.686  17.562 -41.470
   25   H5''    G   3          H5''        G   3  -0.456  17.623 -39.712
   26    H4'    G   3           H4'        G   3  -2.736  18.465 -40.839
   27    H3'    G   3           H3'        G   3  -2.219  16.905 -38.292
   28    H2'    G   3          H2''        G   3  -4.511  16.811 -37.812
   29   HO2'    G   3          H2'         G   3  -6.012  18.118 -38.749
   30    H1'    G   3           H1'        G   3  -5.354  16.198 -40.363
   31    H8     G   3           H8         G   3  -2.478  14.027 -40.336
   32    H1     G   3           H1         G   3  -6.689  12.242 -35.842
   33    H21    G   3           H21        G   3  -8.160  13.845 -35.503
   34    H22    G   3           H22        G   3  -7.997  15.429 -36.230
   35    H5'    G   4           H5'        G   4  -4.711  19.189 -36.634
   36   H5''    G   4          H5''        G   4  -3.975  20.371 -35.532
   37    H4'    G   4           H4'        G   4  -5.655  19.395 -34.189
   38    H3'    G   4           H3'        G   4  -2.943  18.105 -33.883
   39    H2'    G   4          H2''        G   4  -3.732  16.479 -32.453
   40   HO2'    G   4          H2'         G   4  -4.844  17.576 -30.940
   41    H1'    G   4           H1'        G   4  -6.249  16.106 -33.568
   42    H8     G   4           H8         G   4  -3.410  16.110 -36.143
   43    H1     G   4           H1         G   4  -4.008  10.600 -32.912
   44    H21    G   4           H21        G   4  -5.494  10.844 -31.290
   45    H22    G   4           H22        G   4  -6.185  12.399 -30.883
   46    H5'    U   5           H5'        U   5  -4.593  19.294 -29.234
   47   H5''    U   5          H5''        U   5  -2.984  19.181 -28.497
   48    H4'    U   5           H4'        U   5  -4.996  17.697 -27.577
   49    H3'    U   5           H3'        U   5  -2.069  17.130 -27.996
   50    H2'    U   5          H2''        U   5  -2.264  14.860 -27.573
   51   HO2'    U   5          H2'         U   5  -4.645  15.547 -26.190
   52    H1'    U   5           H1'        U   5  -4.810  14.385 -28.558
   53    H3     U   5           H3         U   5  -1.744  11.833 -30.811
   54    H5     U   5           H5         U   5  -1.316  15.703 -32.421
   55    H6     U   5           H6         U   5  -2.907  16.490 -30.764
   56    H5'    U   6           H5'        U   6  -3.184  15.417 -23.722
   57   H5''    U   6          H5''        U   6  -1.728  15.887 -22.821
   58    H4'    U   6           H4'        U   6  -2.303  13.462 -22.531
   59    H3'    U   6           H3'        U   6   0.252  14.429 -23.824
   60    H2'    U   6          H2''        U   6   0.992  12.247 -24.225
   61   HO2'    U   6          H2'         U   6   0.516  10.600 -22.966
   62    H1'    U   6           H1'        U   6  -1.457  11.094 -24.849
   63    H3     U   6           H3         U   6   0.988  10.867 -28.672
   64    H5     U   6           H5         U   6   0.056  14.956 -28.294
   65    H6     U   6           H6         U   6  -0.959  14.456 -26.151
   66    H5'    G   7           H5'        G   7   2.453  12.744 -20.212
   67   H5''    G   7          H5''        G   7   4.027  13.533 -20.439
   68    H4'    G   7           H4'        G   7   3.644  10.956 -21.096
   69    H3'    G   7           H3'        G   7   5.267  13.165 -22.375
   70    H2'    G   7          H2''        G   7   5.756  11.892 -24.235
   71   HO2'    G   7          H2'         G   7   6.728  10.193 -23.105
   72    H1'    G   7           H1'        G   7   3.510  10.134 -24.157
   73    H8     G   7           H8         G   7   2.280  13.608 -24.695
   74    H1     G   7           H1         G   7   5.334  11.253 -29.820
   75    H21    G   7           H21        G   7   6.339   9.363 -29.298
   76    H22    G   7           H22        G   7   6.439   8.788 -27.649
   77    H5'    G   8           H5'        G   8   8.697   9.334 -21.231
   78   H5''    G   8          H5''        G   8  10.011  10.487 -21.528
   79    H4'    G   8           H4'        G   8   9.982   8.134 -22.770
   80    H3'    G   8           H3'        G   8  10.628  10.900 -23.819
   81    H2'    G   8          H2''        G   8  11.119  10.028 -25.942
   82   HO2'    G   8          H2'         G   8  12.112   8.036 -24.713
   83    H1'    G   8           H1'        G   8   9.020   8.230 -26.051
   84    H8     G   8           H8         G   8   7.485  11.276 -24.609
   85    H1     G   8           H1         G   8   9.001  12.049 -30.789
   86    H21    G   8           H21        G   8  10.312  10.409 -31.459
   87    H22    G   8           H22        G   8  10.972   9.229 -30.348
   88    H5'    U   9           H5'        U   9  13.907   8.953 -24.841
   89   H5''    U   9          H5''        U   9  15.479   9.732 -24.567
   90    H4'    U   9           H4'        U   9  15.127   9.412 -26.979
   91    H3'    U   9           H3'        U   9  15.216  12.106 -25.680
   92    H2'    U   9          H2''        U   9  14.384  13.287 -27.464
   93   HO2'    U   9          H2'         U   9  16.049  12.652 -28.870
   94    H1'    U   9           H1'        U   9  12.976  11.266 -28.841
   95    H3     U   9           H3         U   9  10.101  14.755 -28.397
   96    H5     U   9           H5         U   9  10.422  13.165 -24.508
   97    H6     U   9           H6         U   9  12.162  11.692 -25.323
   98    H5'    G  10           H5'        G  10  18.460  12.714 -28.812
   99   H5''    G  10          H5''        G  10  19.784  13.503 -27.932
  100    H4'    G  10           H4'        G  10  18.901  14.848 -29.894
  101    H3'    G  10           H3'        G  10  19.060  15.711 -27.026
  102    H2'    G  10          H2''        G  10  17.767  17.581 -27.270
  103   HO2'    G  10          H2'         G  10  18.075  18.947 -28.859
  104    H1'    G  10           H1'        G  10  16.289  16.902 -29.588
  105    H8     G  10           H8         G  10  15.690  14.488 -26.748
  106    H1     G  10           H1         G  10  12.544  20.035 -26.083
  107    H21    G  10           H21        G  10  13.251  21.493 -27.578
  108    H22    G  10           H22        G  10  14.623  21.174 -28.615
  109    H5'    U  11           H5'        U  11  21.471  19.474 -29.551
  110   H5''    U  11          H5''        U  11  22.208  20.056 -28.046
  111    H4'    U  11           H4'        U  11  20.735  21.690 -29.542
  112    H3'    U  11           H3'        U  11  20.907  21.321 -26.549
  113    H2'    U  11          H2''        U  11  19.198  22.853 -26.151
  114   HO2'    U  11          H2'         U  11  19.616  23.804 -28.801
  115    H1'    U  11           H1'        U  11  17.633  22.354 -28.400
  116    H3     U  11           H3         U  11  15.171  21.540 -24.628
  117    H5     U  11           H5         U  11  17.472  18.068 -25.231
  118    H6     U  11           H6         U  11  18.725  19.269 -26.927
  119    H5'    A  12           H5'        A  12  22.504  25.703 -26.452
  120   H5''    A  12          H5''        A  12  22.963  25.758 -24.739
  121    H4'    A  12           H4'        A  12  20.736  26.968 -25.625
  122    H3'    A  12           H3'        A  12  21.366  25.468 -23.077
  123    H2'    A  12          H2''        A  12  19.153  25.619 -22.317
  124   HO2'    A  12          H2'         A  12  17.814  27.198 -22.861
  125    H1'    A  12           H1'        A  12  17.870  25.199 -24.721
  126    H8     A  12           H8         A  12  20.652  22.691 -24.626
  127    H61    A  12           H61        A  12  17.173  19.399 -20.719
  128    H62    A  12           H62        A  12  18.500  19.342 -21.857
  129    H2     A  12           H2         A  12  15.359  23.483 -21.096
  130    H5'    U  13           H5'        U  13  19.799  29.173 -20.906
  131   H5''    U  13          H5''        U  13  20.658  28.930 -19.374
  132    H4'    U  13           H4'        U  13  18.014  28.670 -19.493
  133    H3'    U  13           H3'        U  13  20.128  27.079 -18.033
  134    H2'    U  13          H2''        U  13  18.573  25.486 -17.298
  135   HO2'    U  13          H2'         U  13  16.691  26.080 -16.591
  136    H1'    U  13           H1'        U  13  16.766  25.611 -19.414
  137    H3     U  13           H3         U  13  18.338  21.338 -18.573
  138    H5     U  13           H5         U  13  21.230  23.172 -21.024
  139    H6     U  13           H6         U  13  20.064  25.269 -20.727
  140    H5'    U  14           H5'        U  14  17.011  27.998 -15.440
  141   H5''    U  14          H5''        U  14  17.447  28.949 -14.005
  142    H4'    U  14           H4'        U  14  15.997  27.171 -13.240
  143    H3'    U  14           H3'        U  14  18.924  27.121 -12.668
  144    H2'    U  14          H2''        U  14  19.078  24.916 -12.088
  145   HO2'    U  14          H2'         U  14  17.743  24.113 -10.678
  146    H1'    U  14           H1'        U  14  16.872  23.806 -13.391
  147    H3     U  14           H3         U  14  20.274  21.232 -14.842
  148    H5     U  14           H5         U  14  21.098  25.004 -16.526
  149    H6     U  14           H6         U  14  19.251  25.907 -15.239
  150    H5'    U  15           H5'        U  15  16.704  25.858  -8.444
  151   H5''    U  15          H5''        U  15  18.074  26.118  -7.347
  152    H4'    U  15           H4'        U  15  16.958  23.708  -7.562
  153    H3'    U  15           H3'        U  15  19.797  24.636  -7.250
  154    H2'    U  15          H2''        U  15  20.746  22.621  -7.785
  155   HO2'    U  15          H2'         U  15  20.117  20.973  -6.670
  156    H1'    U  15           H1'        U  15  18.647  21.443  -9.283
  157    H3     U  15           H3         U  15  22.462  20.864 -11.690
  158    H5     U  15           H5         U  15  21.595  24.970 -12.048
  159    H6     U  15           H6         U  15  19.852  24.680 -10.391
  160    H5'    U  16           H5'        U  16  19.269  20.919  -4.365
  161   H5''    U  16          H5''        U  16  20.280  21.426  -2.998
  162    H4'    U  16           H4'        U  16  20.860  19.136  -3.937
  163    H3'    U  16           H3'        U  16  22.697  21.494  -3.642
  164    H2'    U  16          H2''        U  16  24.401  20.598  -4.876
  165   HO2'    U  16          H2'         U  16  25.100  18.724  -4.279
  166    H1'    U  16           H1'        U  16  22.964  18.694  -6.420
  167    H3     U  16           H3         U  16  25.550  20.822  -9.453
  168    H5     U  16           H5         U  16  22.913  23.820  -8.108
  169    H6     U  16           H6         U  16  22.081  22.252  -6.454
  170    H5'    U  17           H5'        U  17  25.124  17.678  -1.485
  171   H5''    U  17          H5''        U  17  26.308  18.698  -0.645
  172    H4'    U  17           H4'        U  17  27.120  16.849  -2.378
  173    H3'    U  17           H3'        U  17  28.052  19.657  -1.818
  174    H2'    U  17          H2''        U  17  29.401  19.771  -3.670
  175   HO2'    U  17          H2'         U  17  29.698  17.000  -3.244
  176    H1'    U  17           H1'        U  17  28.165  17.765  -5.279
  177    H3     U  17           H3         U  17  28.925  21.319  -7.993
  178    H5     U  17           H5         U  17  25.846  22.614  -5.424
  179    H6     U  17           H6         U  17  26.148  20.573  -4.146
  180    H5'    A  18           H5'        A  18  32.019  16.623  -1.574
  181   H5''    A  18          H5''        A  18  33.148  17.767  -0.823
  182    H4'    A  18           H4'        A  18  33.740  16.614  -3.150
  183    H3'    A  18           H3'        A  18  34.157  19.421  -2.122
  184    H2'    A  18          H2''        A  18  34.815  20.225  -4.163
  185   HO2'    A  18          H2'         A  18  36.286  19.226  -5.291
  186    H1'    A  18           H1'        A  18  33.632  18.220  -5.835
  187    H8     A  18           H8         A  18  31.152  20.401  -3.974
  188    H61    A  18           H61        A  18  31.872  24.502  -8.550
  189    H62    A  18           H62        A  18  30.917  24.055  -7.153
  190    H2     A  18           H2         A  18  35.003  21.320  -9.017
  191    H5'    A  19           H5'        A  19  37.886  17.812  -4.211
  192   H5''    A  19          H5''        A  19  39.246  18.301  -3.182
  193    H4'    A  19           H4'        A  19  39.753  18.829  -5.529
  194    H3'    A  19           H3'        A  19  39.243  21.022  -3.521
  195    H2'    A  19          H2''        A  19  39.300  22.685  -5.108
  196   HO2'    A  19          H2'         A  19  41.031  22.738  -6.275
  197    H1'    A  19           H1'        A  19  38.672  21.115  -7.413
  198    H8     A  19           H8         A  19  36.046  21.453  -4.630
  199    H61    A  19           H61        A  19  34.232  26.600  -7.525
  200    H62    A  19           H62        A  19  33.794  25.388  -6.342
  201    H2     A  19           H2         A  19  37.992  25.145  -9.492
  202    H5'    A  20           H5'        A  20  43.691  22.000  -5.485
  203   H5''    A  20          H5''        A  20  44.179  23.215  -4.288
  204    H4'    A  20           H4'        A  20  44.005  23.860  -6.864
  205    H3'    A  20           H3'        A  20  43.253  25.337  -4.349
  206    H2'    A  20          H2''        A  20  42.159  27.027  -5.468
  207   HO2'    A  20          H2'         A  20  42.921  27.905  -7.259
  208    H1'    A  20           H1'        A  20  41.485  25.646  -7.856
  209    H8     A  20           H8         A  20  40.148  24.335  -4.488
  210    H61    A  20           H61        A  20  35.352  28.128  -5.403
  211    H62    A  20           H62        A  20  36.032  26.884  -4.377
  212    H2     A  20           H2         A  20  38.420  28.982  -8.561
  213    H5'    U  21           H5'        U  21  45.043  28.283  -6.913
  214   H5''    U  21          H5''        U  21  46.043  29.379  -5.940
  215    H4'    U  21           H4'        U  21  44.236  30.579  -7.210
  216    H3'    U  21           H3'        U  21  44.491  30.517  -4.213
  217    H2'    U  21          H2''        U  21  42.501  31.653  -3.842
  218   HO2'    U  21          H2'         U  21  42.158  33.370  -4.981
  219    H1'    U  21           H1'        U  21  41.030  30.749  -6.032
  220    H3     U  21           H3         U  21  38.636  29.405  -2.432
  221    H5     U  21           H5         U  21  42.204  27.179  -2.127
  222    H6     U  21           H6         U  21  43.010  28.331  -4.104
  223    H5'    U  22           H5'        U  22  43.889  34.320  -5.990
  224   H5''    U  22          H5''        U  22  44.973  35.648  -5.525
  225    H4'    U  22           H4'        U  22  42.610  36.418  -5.637
  226    H3'    U  22           H3'        U  22  44.360  36.440  -3.246
  227    H2'    U  22          H2''        U  22  42.776  36.262  -1.635
  228   HO2'    U  22          H2'         U  22  41.557  38.255  -3.201
  229    H1'    U  22           H1'        U  22  40.400  35.932  -3.282
  230    H3     U  22           H3         U  22  39.074  33.252   0.060
  231    H5     U  22           H5         U  22  42.947  31.829  -0.797
  232    H6     U  22           H6         U  22  43.153  33.579  -2.462
  233    H5'    A  23           H5'        A  23  45.194  38.926  -0.631
  234   H5''    A  23          H5''        A  23  43.988  37.635  -0.791
  235    H4'    A  23           H4'        A  23  43.916  38.860   1.431
  236    H3'    A  23           H3'        A  23  41.747  38.267  -0.452
  237    H2'    A  23          H2''        A  23  40.300  39.978   0.005
  238   HO2'    A  23          H2'         A  23  39.781  40.529   2.023
  239    H1'    A  23           H1'        A  23  41.917  41.894   1.254
  240    H8     A  23           H8         A  23  43.503  41.269  -2.035
  241    H61    A  23           H61        A  23  38.980  44.499  -4.718
  242    H62    A  23           H62        A  23  40.627  43.931  -4.872
  243    H2     A  23           H2         A  23  37.689  43.535  -0.544
  244    H5'    A  24           H5'        A  24  38.744  36.302   2.355
  245   H5''    A  24          H5''        A  24  37.935  35.747   0.878
  246    H4'    A  24           H4'        A  24  37.490  38.189   2.294
  247    H3'    A  24           H3'        A  24  36.469  36.632   0.003
  248    H2'    A  24          H2''        A  24  36.285  38.314  -1.500
  249   HO2'    A  24          H2'         A  24  35.346  40.141   0.435
  250    H1'    A  24           H1'        A  24  37.357  40.533   0.068
  251    H8     A  24           H8         A  24  39.873  38.325  -1.552
  252    H61    A  24           H61        A  24  38.917  41.408  -6.831
  253    H62    A  24           H62        A  24  39.932  40.245  -6.008
  254    H2     A  24           H2         A  24  35.772  42.657  -3.887
  255    H5'    U  25           H5'        U  25  33.699  34.919  -0.712
  256   H5''    U  25          H5''        U  25  34.505  36.497  -0.776
  257    H4'    U  25           H4'        U  25  31.858  35.720  -1.777
  258    H3'    U  25           H3'        U  25  34.038  37.115  -2.662
  259    H2'    U  25          H2''        U  25  33.864  39.023  -1.297
  260   HO2'    U  25          H2'         U  25  32.052  39.494  -3.442
  261    H1'    U  25           H1'        U  25  30.881  39.080  -1.479
  262    H3     U  25           H3         U  25  30.473  42.103   1.786
  263    H5     U  25           H5         U  25  34.032  40.109   2.841
  264    H6     U  25           H6         U  25  33.761  38.714   0.875
  265    H5'    U  26           H5'        U  26  35.455  38.296  -3.459
  266   H5''    U  26          H5''        U  26  34.786  39.151  -4.863
  267    H4'    U  26           H4'        U  26  36.986  38.948  -5.620
  268    H3'    U  26           H3'        U  26  35.306  36.589  -6.308
  269    H2'    U  26          H2''        U  26  36.949  35.011  -6.502
  270   HO2'    U  26          H2'         U  26  38.058  35.944  -8.171
  271    H1'    U  26           H1'        U  26  39.024  36.095  -4.987
  272    H3     U  26           H3         U  26  38.524  32.057  -3.075
  273    H5     U  26           H5         U  26  34.943  34.043  -2.099
  274    H6     U  26           H6         U  26  35.637  35.883  -3.502
  275    H5'    C  27           H5'        C  27  36.286  37.298 -11.076
  276   H5''    C  27          H5''        C  27  34.911  36.262 -11.503
  277    H4'    C  27           H4'        C  27  37.416  35.464 -11.968
  278    H3'    C  27           H3'        C  27  34.919  34.050 -11.096
  279    H2'    C  27          H2''        C  27  35.970  32.127 -10.393
  280   HO2'    C  27          H2'         C  27  37.797  31.318 -11.373
  281    H1'    C  27           H1'        C  27  38.558  33.111  -9.854
  282    H41    C  27           H41        C  27  36.172  31.229  -4.277
  283    H42    C  27           H42        C  27  34.708  32.156  -4.521
  284    H5     C  27           H5         C  27  34.236  33.353  -6.556
  285    H6     C  27           H6         C  27  35.134  34.071  -8.717
  286    H5'    U  28           H5'        U  28  36.095  32.245 -15.650
  287   H5''    U  28          H5''        U  28  34.964  30.895 -15.877
  288    H4'    U  28           H4'        U  28  37.619  30.475 -15.754
  289    H3'    U  28           H3'        U  28  35.306  28.924 -14.543
  290    H2'    U  28          H2''        U  28  36.788  27.323 -13.693
  291   HO2'    U  28          H2'         U  28  38.591  26.836 -14.670
  292    H1'    U  28           H1'        U  28  38.689  29.133 -12.806
  293    H3     U  28           H3         U  28  36.387  26.882  -9.466
  294    H5     U  28           H5         U  28  34.027  30.215 -10.470
  295    H6     U  28           H6         U  28  35.530  30.656 -12.309
  296    H5'    U  29           H5'        U  29  37.550  26.070 -16.759
  297   H5''    U  29          H5''        U  29  36.597  24.644 -17.212
  298    H4'    U  29           H4'        U  29  38.542  24.403 -15.436
  299    H3'    U  29           H3'        U  29  35.762  23.263 -15.550
  300    H2'    U  29          H2''        U  29  35.785  22.471 -13.392
  301   HO2'    U  29          H2'         U  29  38.596  22.310 -13.728
  302    H1'    U  29           H1'        U  29  37.714  24.210 -12.254
  303    H3     U  29           H3         U  29  33.871  23.815  -9.702
  304    H5     U  29           H5         U  29  33.078  26.793 -12.569
  305    H6     U  29           H6         U  29  35.166  26.209 -13.663
  306    H5'    A  30           H5'        A  30  37.602  20.171 -13.698
  307   H5''    A  30          H5''        A  30  37.506  18.751 -14.755
  308    H4'    A  30           H4'        A  30  36.630  17.937 -12.719
  309    H3'    A  30           H3'        A  30  34.508  18.943 -14.617
  310    H2'    A  30          H2''        A  30  32.823  18.620 -13.062
  311   HO2'    A  30          H2'         A  30  34.536  16.646 -11.950
  312    H1'    A  30           H1'        A  30  34.437  18.818 -10.706
  313    H8     A  30           H8         A  30  34.054  21.830 -13.098
  314    H61    A  30           H61        A  30  29.114  23.286  -9.677
  315    H62    A  30           H62        A  30  30.254  23.867 -10.870
  316    H2     A  30           H2         A  30  30.643  19.296  -8.303
  317    H5'    A  31           H5'        A  31  33.640  14.595 -12.944
  318   H5''    A  31          H5''        A  31  32.592  13.847 -14.165
  319    H4'    A  31           H4'        A  31  31.713  13.747 -11.766
  320    H3'    A  31           H3'        A  31  30.291  14.899 -14.162
  321    H2'    A  31          H2''        A  31  28.551  15.739 -12.918
  322   HO2'    A  31          H2'         A  31  29.103  13.606 -11.126
  323    H1'    A  31           H1'        A  31  29.855  15.888 -10.371
  324    H8     A  31           H8         A  31  31.005  18.042 -13.368
  325    H61    A  31           H61        A  31  26.958  22.237 -11.303
  326    H62    A  31           H62        A  31  28.324  21.960 -12.359
  327    H2     A  31           H2         A  31  26.467  18.505  -8.863
  328    H5'    A  32           H5'        A  32  27.450  11.158 -12.477
  329   H5''    A  32          H5''        A  32  26.298  11.077 -13.823
  330    H4'    A  32           H4'        A  32  25.446  11.523 -11.336
  331    H3'    A  32           H3'        A  32  24.608  12.618 -14.013
  332    H2'    A  32          H2''        A  32  23.312  14.294 -13.131
  333   HO2'    A  32          H2'         A  32  21.810  13.608 -11.852
  334    H1'    A  32           H1'        A  32  24.485  14.484 -10.536
  335    H8     A  32           H8         A  32  26.740  15.384 -13.491
  336    H61    A  32           H61        A  32  24.199  21.016 -13.219
  337    H62    A  32           H62        A  32  25.514  20.060 -13.869
  338    H2     A  32           H2         A  32  22.044  18.374 -10.306
  339    H5'    A  33           H5'        A  33  20.549  10.873 -11.712
  340   H5''    A  33          H5''        A  33  19.438  10.871 -13.095
  341    H4'    A  33           H4'        A  33  18.848  12.246 -10.891
  342    H3'    A  33           H3'        A  33  18.467  12.811 -13.819
  343    H2'    A  33          H2''        A  33  17.887  15.024 -13.522
  344   HO2'    A  33          H2'         A  33  17.103  14.268 -10.896
  345    H1'    A  33           H1'        A  33  19.246  15.582 -11.124
  346    H8     A  33           H8         A  33  21.487  14.225 -13.889
  347    H61    A  33           H61        A  33  21.783  20.027 -15.998
  348    H62    A  33           H62        A  33  22.511  18.437 -16.057
  349    H2     A  33           H2         A  33  18.663  19.871 -12.780
  350    H5'    A  34           H5'        A  34  14.984  14.139 -11.581
  351   H5''    A  34          H5''        A  34  13.479  13.765 -12.445
  352    H4'    A  34           H4'        A  34  13.711  16.202 -11.771
  353    H3'    A  34           H3'        A  34  13.284  15.107 -14.527
  354    H2'    A  34          H2''        A  34  13.723  17.061 -15.638
  355   HO2'    A  34          H2'         A  34  12.833  18.407 -13.292
  356    H1'    A  34           H1'        A  34  15.244  18.432 -13.643
  357    H8     A  34           H8         A  34  16.667  15.153 -15.074
  358    H61    A  34           H61        A  34  19.602  18.777 -19.128
  359    H62    A  34           H62        A  34  19.573  17.201 -18.369
  360    H2     A  34           H2         A  34  16.592  21.285 -16.943
  361    H5'    C  35           H5'        C  35   9.588  15.990 -16.179
  362   H5''    C  35          H5''        C  35  10.262  14.764 -17.272
  363    H4'    C  35           H4'        C  35  11.199  17.564 -16.739
  364    H3'    C  35           H3'        C  35  10.292  15.950 -18.922
  365    H2'    C  35          H2''        C  35  12.316  14.968 -19.470
  366   HO2'    C  35          H2'         C  35  12.034  16.565 -21.118
  367    H1'    C  35           H1'        C  35  13.947  17.229 -18.375
  368    H41    C  35           H41        C  35  18.364  12.666 -18.657
  369    H42    C  35           H42        C  35  17.246  11.465 -18.053
  370    H5     C  35           H5         C  35  14.982  11.985 -17.406
  371    H6     C  35           H6         C  35  13.250  13.718 -17.375
  372    H5'    U  36           H5'        U  36   8.753  18.198 -17.803
  373   H5''    U  36          H5''        U  36   7.207  18.585 -18.585
  374    H4'    U  36           H4'        U  36   7.127  20.071 -16.794
  375    H3'    U  36           H3'        U  36   8.349  21.237 -19.255
  376    H2'    U  36          H2''        U  36   9.327  23.083 -18.235
  377   HO2'    U  36          H2'         U  36   8.575  23.958 -16.323
  378    H1'    U  36           H1'        U  36   9.985  22.051 -15.774
  379    H3     U  36           H3         U  36  13.219  23.223 -19.204
  380    H5     U  36           H5         U  36  13.357  19.120 -18.274
  381    H6     U  36           H6         U  36  11.247  19.373 -17.119
  382    H5'    A  37           H5'        A  37   7.596  24.990 -18.729
  383   H5''    A  37          H5''        A  37   6.241  25.303 -19.834
  384    H4'    A  37           H4'        A  37   7.979  26.788 -20.556
  385    H3'    A  37           H3'        A  37   7.688  24.215 -22.098
  386    H2'    A  37          H2''        A  37   9.431  24.705 -23.517
  387   HO2'    A  37          H2'         A  37   8.925  26.839 -24.027
  388    H1'    A  37           H1'        A  37  11.138  25.852 -21.590
  389    H8     A  37           H8         A  37   9.452  22.715 -20.263
  390    H61    A  37           H61        A  37  13.948  19.528 -23.040
  391    H62    A  37           H62        A  37  12.717  19.493 -21.797
  392    H2     A  37           H2         A  37  14.172  23.776 -24.469
  393    H5'    C  38           H5'        C  38   7.096  27.351 -25.581
  394   H5''    C  38          H5''        C  38   6.344  26.311 -26.806
  395    H4'    C  38           H4'        C  38   8.752  27.357 -27.229
  396    H3'    C  38           H3'        C  38   7.589  24.643 -27.824
  397    H2'    C  38          H2''        C  38   9.613  23.745 -28.494
  398   HO2'    C  38          H2'         C  38  10.542  26.406 -28.897
  399    H1'    C  38           H1'        C  38  11.352  25.270 -26.899
  400    H41    C  38           H41        C  38  11.366  19.319 -24.619
  401    H42    C  38           H42        C  38   9.787  19.561 -23.911
  402    H5     C  38           H5         C  38   8.541  21.613 -24.139
  403    H6     C  38           H6         C  38   8.504  23.833 -25.157
  404    H5'    A  39           H5'        A  39   8.288  25.650 -32.225
  405   H5''    A  39          H5''        A  39   7.242  24.437 -32.988
  406    H4'    A  39           H4'        A  39   9.891  24.119 -32.957
  407    H3'    A  39           H3'        A  39   7.604  22.194 -32.645
  408    H2'    A  39          H2''        A  39   8.934  20.471 -31.925
  409   HO2'    A  39          H2'         A  39  10.173  20.637 -33.935
  410    H1'    A  39           H1'        A  39  11.198  21.974 -31.024
  411    H8     A  39           H8         A  39   7.964  22.492 -29.068
  412    H61    A  39           H61        A  39   9.479  17.387 -25.922
  413    H62    A  39           H62        A  39   8.480  18.823 -25.934
  414    H2     A  39           H2         A  39  12.325  17.796 -29.365
  415    H5'    A  40           H5'        A  40   9.984  21.324 -36.715
  416   H5''    A  40          H5''        A  40   9.009  20.279 -37.769
  417    H4'    A  40           H4'        A  40  11.276  19.292 -37.177
  418    H3'    A  40           H3'        A  40   8.620  18.056 -36.349
  419    H2'    A  40          H2''        A  40   9.689  16.257 -35.328
  420   HO2'    A  40          H2'         A  40  11.341  15.375 -36.259
  421    H1'    A  40           H1'        A  40  11.912  17.649 -34.377
  422    H8     A  40           H8         A  40   8.486  19.293 -33.757
  423    H61    A  40           H61        A  40   8.390  16.063 -28.486
  424    H62    A  40           H62        A  40   7.664  17.380 -29.381
  425    H2     A  40           H2         A  40  11.938  14.716 -30.879
  426    H5'    U  41           H5'        U  41   9.896  14.644 -39.164
  427   H5''    U  41          H5''        U  41   8.436  13.637 -39.195
  428    H4'    U  41           H4'        U  41  10.607  12.936 -37.755
  429    H3'    U  41           H3'        U  41   7.633  12.661 -37.216
  430    H2'    U  41          H2''        U  41   8.010  11.898 -35.049
  431   HO2'    U  41          H2'         U  41  10.567  11.057 -35.978
  432    H1'    U  41           H1'        U  41  10.518  13.125 -34.595
  433    H3     U  41           H3         U  41   7.653  13.811 -31.079
  434    H5     U  41           H5         U  41   6.286  16.390 -34.121
  435    H6     U  41           H6         U  41   7.943  15.414 -35.600
  436    H5'    C  42           H5'        C  42   9.489   8.056 -37.138
  437   H5''    C  42          H5''        C  42   7.951   7.195 -37.353
  438    H4'    C  42           H4'        C  42   9.391   6.528 -35.308
  439    H3'    C  42           H3'        C  42   6.472   7.302 -35.367
  440    H2'    C  42          H2''        C  42   6.265   7.147 -33.051
  441   HO2'    C  42          H2'         C  42   7.253   5.037 -32.975
  442    H1'    C  42           H1'        C  42   8.820   7.991 -32.326
  443    H41    C  42           H41        C  42   4.828  12.775 -31.043
  444    H42    C  42           H42        C  42   4.597  13.089 -32.747
  445    H5     C  42           H5         C  42   5.673  11.806 -34.481
  446    H6     C  42           H6         C  42   7.105   9.879 -34.954
  447    H5'    A  43           H5'        A  43   5.359   2.875 -34.437
  448   H5''    A  43          H5''        A  43   3.650   3.020 -34.888
  449    H4'    A  43           H4'        A  43   4.404   2.930 -32.315
  450    H3'    A  43           H3'        A  43   2.277   4.547 -33.738
  451    H2'    A  43          H2''        A  43   1.729   5.700 -31.816
  452   HO2'    A  43          H2'         A  43   2.138   4.905 -29.737
  453    H1'    A  43           H1'        A  43   4.275   5.676 -30.587
  454    H8     A  43           H8         A  43   4.479   7.213 -34.025
  455    H61    A  43           H61        A  43   1.952  12.301 -31.568
  456    H62    A  43           H62        A  43   2.836  11.651 -32.930
  457    H2     A  43           H2         A  43   1.754   9.023 -28.511
  458    H5'    G  44           H5'        G  44  -0.043   1.388 -30.134
  459   H5''    G  44          H5''        G  44  -1.619   1.757 -30.859
  460    H4'    G  44           H4'        G  44  -1.260   1.983 -28.230
  461    H3'    G  44           H3'        G  44  -2.762   3.676 -30.222
  462    H2'    G  44          H2''        G  44  -3.280   5.325 -28.660
  463   HO2'    G  44          H2'         G  44  -4.017   3.859 -27.041
  464    H1'    G  44           H1'        G  44  -0.906   5.319 -27.220
  465    H8     G  44           H8         G  44   0.368   5.279 -30.630
  466    H1     G  44           H1         G  44  -2.537  10.825 -29.279
  467    H21    G  44           H21        G  44  -3.691  10.643 -27.410
  468    H22    G  44           H22        G  44  -3.904   9.113 -26.591
  469    H5'    C  45           H5'        C  45  -6.622   3.193 -28.012
  470   H5''    C  45          H5''        C  45  -7.662   3.388 -29.434
  471    H4'    C  45           H4'        C  45  -7.475   5.328 -27.617
  472    H3'    C  45           H3'        C  45  -7.531   5.465 -30.646
  473    H2'    C  45          H2''        C  45  -7.409   7.789 -30.584
  474   HO2'    C  45          H2'         C  45  -9.044   8.169 -29.081
  475    H1'    C  45           H1'        C  45  -5.742   8.008 -28.347
  476    H41    C  45           H41        C  45  -2.598   9.397 -33.742
  477    H42    C  45           H42        C  45  -2.295   7.697 -34.012
  478    H5     C  45           H5         C  45  -3.103   5.960 -32.533
  479    H6     C  45           H6         C  45  -4.464   5.484 -30.558
  480    H5'    U  46           H5'        U  46 -11.076   8.220 -29.564
  481   H5''    U  46          H5''        U  46 -12.193   7.844 -30.889
  482    H4'    U  46           H4'        U  46 -11.493  10.314 -30.647
  483    H3'    U  46           H3'        U  46 -11.396   8.563 -33.093
  484    H2'    U  46          H2''        U  46 -10.225  10.084 -34.364
  485   HO2'    U  46          H2'         U  46 -11.365  11.872 -34.432
  486    H1'    U  46           H1'        U  46  -8.924  11.540 -32.317
  487    H3     U  46           H3         U  46  -5.821  10.400 -35.437
  488    H5     U  46           H5         U  46  -6.687   6.787 -33.453
  489    H6     U  46           H6         U  46  -8.448   7.948 -32.245
  490    H5'    C  47           H5'        C  47 -13.877  12.610 -34.591
  491   H5''    C  47          H5''        C  47 -14.799  11.732 -35.827
  492    H4'    C  47           H4'        C  47 -13.516  13.777 -36.676
  493    H3'    C  47           H3'        C  47 -13.103  10.950 -37.684
  494    H2'    C  47          H2''        C  47 -11.680  11.731 -39.352
  495   HO2'    C  47          H2'         C  47 -12.579  14.355 -38.699
  496    H1'    C  47           H1'        C  47 -10.380  13.640 -37.726
  497    H41    C  47           H41        C  47  -6.321   8.810 -37.919
  498    H42    C  47           H42        C  47  -7.357   7.834 -36.907
  499    H5     C  47           H5         C  47  -9.438   8.651 -35.990
  500    H6     C  47           H6         C  47 -11.163  10.386 -36.198
  501    H5'    C  48           H5'        C  48 -13.238  13.530 -41.133
  502   H5''    C  48          H5''        C  48 -14.351  12.770 -42.285
  503    H4'    C  48           H4'        C  48 -12.190  13.303 -43.372
  504    H3'    C  48           H3'        C  48 -13.048  10.448 -42.902
  505   HO3'    C  48          H3T         C  48 -14.144  11.067 -44.591
  506    H2'    C  48          H2''        C  48 -11.083   9.589 -43.746
  507   HO2'    C  48          H2'         C  48 -10.744  12.032 -45.173
  508    H1'    C  48           H1'        C  48  -9.400  11.828 -43.209
  509    H41    C  48           H41        C  48  -7.233   6.880 -39.832
  510    H42    C  48           H42        C  48  -8.722   6.804 -38.921
  511    H5     C  48           H5         C  48 -10.522   8.369 -39.211
  512    H6     C  48           H6         C  48 -11.388  10.196 -40.588
  Start of MODEL    5
    1    H5'    G   1           H5'        G   1  -3.343   5.308 -46.735
    2   H5''    G   1          H5''        G   1  -2.160   6.507 -46.172
    3    H4'    G   1           H4'        G   1  -4.225   7.584 -47.103
    4    H3'    G   1           H3'        G   1  -3.253   7.837 -44.275
    5    H2'    G   1          H2''        G   1  -5.141   8.769 -43.450
    6   HO2'    G   1          H2'         G   1  -5.452   9.900 -46.031
    7    H1'    G   1           H1'        G   1  -7.015   7.998 -45.480
    8    H8     G   1           H8         G   1  -5.581   5.108 -43.470
    9    H1     G   1           H1         G   1 -10.412   8.188 -40.587
   10    H21    G   1           H21        G   1 -10.847  10.071 -41.647
   11    H22    G   1           H22        G   1 -10.082  10.485 -43.165
   12   HO5'    G   1          H5T         G   1  -3.961   4.966 -44.609
   13    H5'    G   2           H5'        G   2  -3.327  12.895 -45.641
   14   H5''    G   2          H5''        G   2  -2.616  13.267 -44.059
   15    H4'    G   2           H4'        G   2  -4.949  14.351 -44.833
   16    H3'    G   2           H3'        G   2  -3.971  13.351 -42.147
   17    H2'    G   2          H2''        G   2  -6.045  13.791 -41.141
   18   HO2'    G   2          H2'         G   2  -6.635  15.329 -43.460
   19    H1'    G   2           H1'        G   2  -7.666  12.910 -43.171
   20    H8     G   2           H8         G   2  -4.758  10.538 -42.854
   21    H1     G   2           H1         G   2  -9.106   9.883 -38.188
   22    H21    G   2           H21        G   2 -10.557  11.545 -38.280
   23    H22    G   2           H22        G   2 -10.346  12.909 -39.353
   24    H5'    G   3           H5'        G   3  -4.580  18.017 -40.915
   25   H5''    G   3          H5''        G   3  -3.777  17.911 -39.337
   26    H4'    G   3           H4'        G   3  -6.410  18.426 -39.548
   27    H3'    G   3           H3'        G   3  -4.909  16.675 -37.570
   28    H2'    G   3          H2''        G   3  -6.926  16.334 -36.390
   29   HO2'    G   3          H2'         G   3  -8.748  17.535 -36.718
   30    H1'    G   3           H1'        G   3  -8.433  15.838 -38.670
   31    H8     G   3           H8         G   3  -5.335  14.090 -39.517
   32    H1     G   3           H1         G   3  -8.373  11.209 -34.659
   33    H21    G   3           H21        G   3  -9.905  12.551 -33.817
   34    H22    G   3           H22        G   3 -10.094  14.207 -34.349
   35    H5'    G   4           H5'        G   4  -6.614  18.777 -35.111
   36   H5''    G   4          H5''        G   4  -5.755  19.821 -33.962
   37    H4'    G   4           H4'        G   4  -7.024  18.422 -32.542
   38    H3'    G   4           H3'        G   4  -4.213  17.438 -33.038
   39    H2'    G   4          H2''        G   4  -4.538  15.503 -31.827
   40   HO2'    G   4          H2'         G   4  -5.548  15.617 -30.000
   41    H1'    G   4           H1'        G   4  -7.217  15.051 -32.462
   42    H8     G   4           H8         G   4  -5.020  15.769 -35.517
   43    H1     G   4           H1         G   4  -4.519   9.788 -33.252
   44    H21    G   4           H21        G   4  -5.628   9.623 -31.344
   45    H22    G   4           H22        G   4  -6.316  11.016 -30.540
   46    H5'    U   5           H5'        U   5  -4.758  17.573 -28.156
   47   H5''    U   5          H5''        U   5  -3.036  17.541 -27.733
   48    H4'    U   5           H4'        U   5  -4.671  15.625 -26.868
   49    H3'    U   5           H3'        U   5  -1.841  15.549 -27.912
   50    H2'    U   5          H2''        U   5  -1.752  13.230 -27.915
   51   HO2'    U   5          H2'         U   5  -3.854  13.371 -26.013
   52    H1'    U   5           H1'        U   5  -4.428  12.662 -28.478
   53    H3     U   5           H3         U   5  -1.696  10.759 -31.623
   54    H5     U   5           H5         U   5  -1.860  14.843 -32.654
   55    H6     U   5           H6         U   5  -3.146  15.229 -30.632
   56    H5'    U   6           H5'        U   6  -2.215  13.046 -24.315
   57   H5''    U   6          H5''        U   6  -0.911  13.478 -23.193
   58    H4'    U   6           H4'        U   6  -1.013  11.053 -23.315
   59    H3'    U   6           H3'        U   6   1.251  12.468 -24.739
   60    H2'    U   6          H2''        U   6   2.149  10.437 -25.484
   61   HO2'    U   6          H2'         U   6   0.418   9.063 -23.693
   62    H1'    U   6           H1'        U   6  -0.247   9.131 -26.009
   63    H3     U   6           H3         U   6   1.794   9.623 -30.040
   64    H5     U   6           H5         U   6   0.541  13.519 -29.044
   65    H6     U   6           H6         U   6  -0.174  12.667 -26.889
   66    H5'    G   7           H5'        G   7   4.017  10.883 -21.263
   67   H5''    G   7          H5''        G   7   5.451  11.858 -21.638
   68    H4'    G   7           H4'        G   7   5.346   9.235 -22.217
   69    H3'    G   7           H3'        G   7   6.561  11.592 -23.676
   70    H2'    G   7          H2''        G   7   7.136  10.284 -25.514
   71   HO2'    G   7          H2'         G   7   7.948   8.372 -25.236
   72    H1'    G   7           H1'        G   7   4.989   8.476 -25.429
   73    H8     G   7           H8         G   7   3.537  11.914 -25.422
   74    H1     G   7           H1         G   7   6.136  10.332 -31.070
   75    H21    G   7           H21        G   7   7.428   8.559 -30.833
   76    H22    G   7           H22        G   7   7.527   7.669 -29.331
   77    H5'    G   8           H5'        G   8  10.416   8.529 -22.853
   78   H5''    G   8          H5''        G   8  11.675   9.726 -23.209
   79    H4'    G   8           H4'        G   8  11.560   7.439 -24.571
   80    H3'    G   8           H3'        G   8  12.079  10.270 -25.517
   81    H2'    G   8          H2''        G   8  12.370   9.526 -27.719
   82   HO2'    G   8          H2'         G   8  12.975   7.521 -28.248
   83    H1'    G   8           H1'        G   8  10.353   7.606 -27.695
   84    H8     G   8           H8         G   8   8.851  10.641 -26.150
   85    H1     G   8           H1         G   8   9.824  11.350 -32.446
   86    H21    G   8           H21        G   8  11.109   9.728 -33.204
   87    H22    G   8           H22        G   8  11.869   8.565 -32.142
   88    H5'    U   9           H5'        U   9  14.815   8.361 -27.225
   89   H5''    U   9          H5''        U   9  16.515   8.646 -26.802
   90    H4'    U   9           H4'        U   9  16.505   8.782 -29.170
   91    H3'    U   9           H3'        U   9  16.461  11.362 -27.658
   92    H2'    U   9          H2''        U   9  15.893  12.710 -29.437
   93   HO2'    U   9          H2'         U   9  16.739  12.461 -31.371
   94    H1'    U   9           H1'        U   9  14.482  10.918 -31.050
   95    H3     U   9           H3         U   9  11.452  14.182 -30.307
   96    H5     U   9           H5         U   9  12.105  12.561 -26.472
   97    H6     U   9           H6         U   9  13.791  11.120 -27.438
   98    H5'    G  10           H5'        G  10  18.711  12.393 -30.687
   99   H5''    G  10          H5''        G  10  20.358  12.919 -30.287
  100    H4'    G  10           H4'        G  10  19.366  14.660 -31.644
  101    H3'    G  10           H3'        G  10  19.651  15.125 -28.677
  102    H2'    G  10          H2''        G  10  18.455  17.080 -28.715
  103   HO2'    G  10          H2'         G  10  19.836  18.153 -30.132
  104    H1'    G  10           H1'        G  10  16.993  16.659 -31.144
  105    H8     G  10           H8         G  10  16.128  14.264 -28.323
  106    H1     G  10           H1         G  10  13.329  20.013 -27.820
  107    H21    G  10           H21        G  10  14.276  21.436 -29.216
  108    H22    G  10           H22        G  10  15.451  20.929 -30.409
  109    H5'    U  11           H5'        U  11  22.467  18.910 -30.743
  110   H5''    U  11          H5''        U  11  23.121  19.345 -29.152
  111    H4'    U  11           H4'        U  11  21.841  21.154 -30.634
  112    H3'    U  11           H3'        U  11  21.798  20.594 -27.664
  113    H2'    U  11          H2''        U  11  20.151  22.191 -27.279
  114   HO2'    U  11          H2'         U  11  20.915  23.982 -28.233
  115    H1'    U  11           H1'        U  11  18.735  21.943 -29.674
  116    H3     U  11           H3         U  11  15.950  21.143 -26.132
  117    H5     U  11           H5         U  11  18.134  17.578 -26.624
  118    H6     U  11           H6         U  11  19.532  18.733 -28.238
  119    H5'    A  12           H5'        A  12  23.700  24.921 -27.457
  120   H5''    A  12          H5''        A  12  24.051  25.022 -25.721
  121    H4'    A  12           H4'        A  12  22.010  26.383 -26.819
  122    H3'    A  12           H3'        A  12  22.327  24.973 -24.161
  123    H2'    A  12          H2''        A  12  20.102  25.396 -23.559
  124   HO2'    A  12          H2'         A  12  20.093  27.607 -24.197
  125    H1'    A  12           H1'        A  12  18.933  24.922 -26.008
  126    H8     A  12           H8         A  12  21.404  22.154 -25.663
  127    H61    A  12           H61        A  12  17.754  19.716 -21.306
  128    H62    A  12           H62        A  12  19.032  19.388 -22.455
  129    H2     A  12           H2         A  12  16.312  23.878 -22.172
  130    H5'    U  13           H5'        U  13  20.563  29.014 -22.635
  131   H5''    U  13          H5''        U  13  21.392  29.043 -21.069
  132    H4'    U  13           H4'        U  13  18.741  28.985 -21.182
  133    H3'    U  13           H3'        U  13  20.669  27.505 -19.373
  134    H2'    U  13          H2''        U  13  18.899  26.368 -18.328
  135   HO2'    U  13          H2'         U  13  17.292  28.516 -19.259
  136    H1'    U  13           H1'        U  13  17.136  26.276 -20.500
  137    H3     U  13           H3         U  13  18.034  22.159 -18.527
  138    H5     U  13           H5         U  13  21.123  22.843 -21.310
  139    H6     U  13           H6         U  13  20.276  25.086 -21.613
  140    H5'    U  14           H5'        U  14  17.616  29.164 -16.995
  141   H5''    U  14          H5''        U  14  18.279  30.321 -15.821
  142    H4'    U  14           H4'        U  14  16.667  28.933 -14.645
  143    H3'    U  14           H3'        U  14  19.602  28.686 -14.166
  144    H2'    U  14          H2''        U  14  19.561  26.662 -13.103
  145   HO2'    U  14          H2'         U  14  18.247  26.385 -11.494
  146    H1'    U  14           H1'        U  14  17.179  25.546 -14.051
  147    H3     U  14           H3         U  14  20.189  22.331 -15.003
  148    H5     U  14           H5         U  14  21.356  25.538 -17.473
  149    H6     U  14           H6         U  14  19.686  26.909 -16.370
  150    H5'    U  15           H5'        U  15  17.406  28.730  -9.748
  151   H5''    U  15          H5''        U  15  18.813  29.064  -8.722
  152    H4'    U  15           H4'        U  15  17.390  26.837  -8.378
  153    H3'    U  15           H3'        U  15  20.320  27.455  -8.227
  154    H2'    U  15          H2''        U  15  21.025  25.277  -8.297
  155   HO2'    U  15          H2'         U  15  18.691  24.854  -6.826
  156    H1'    U  15           H1'        U  15  18.773  24.035  -9.495
  157    H3     U  15           H3         U  15  22.458  22.460 -11.646
  158    H5     U  15           H5         U  15  22.034  26.420 -13.017
  159    H6     U  15           H6         U  15  20.300  26.742 -11.357
  160    H5'    U  16           H5'        U  16  19.127  24.716  -4.417
  161   H5''    U  16          H5''        U  16  20.302  25.302  -3.224
  162    H4'    U  16           H4'        U  16  20.231  22.750  -3.611
  163    H3'    U  16           H3'        U  16  22.571  24.621  -3.601
  164    H2'    U  16          H2''        U  16  24.064  23.153  -4.527
  165   HO2'    U  16          H2'         U  16  22.506  21.193  -3.224
  166    H1'    U  16           H1'        U  16  22.318  21.383  -5.870
  167    H3     U  16           H3         U  16  25.467  22.528  -8.924
  168    H5     U  16           H5         U  16  23.233  26.057  -8.378
  169    H6     U  16           H6         U  16  22.056  24.954  -6.568
  170    H5'    U  17           H5'        U  17  24.067  20.867  -0.665
  171   H5''    U  17          H5''        U  17  25.369  21.800   0.098
  172    H4'    U  17           H4'        U  17  25.921  19.570  -1.251
  173    H3'    U  17           H3'        U  17  27.318  22.225  -1.035
  174    H2'    U  17          H2''        U  17  28.759  21.830  -2.774
  175   HO2'    U  17          H2'         U  17  28.589  19.192  -1.855
  176    H1'    U  17           H1'        U  17  27.281  19.857  -4.195
  177    H3     U  17           H3         U  17  28.728  22.839  -7.286
  178    H5     U  17           H5         U  17  25.829  24.960  -5.084
  179    H6     U  17           H6         U  17  25.725  23.086  -3.545
  180    H5'    A  18           H5'        A  18  30.550  18.572  -0.252
  181   H5''    A  18          H5''        A  18  31.833  19.493   0.557
  182    H4'    A  18           H4'        A  18  32.433  18.076  -1.578
  183    H3'    A  18           H3'        A  18  33.219  20.875  -0.783
  184    H2'    A  18          H2''        A  18  34.134  21.377  -2.821
  185   HO2'    A  18          H2'         A  18  35.676  20.074  -3.363
  186    H1'    A  18           H1'        A  18  32.802  19.425  -4.429
  187    H8     A  18           H8         A  18  30.606  22.112  -2.870
  188    H61    A  18           H61        A  18  31.933  25.528  -7.843
  189    H62    A  18           H62        A  18  31.014  25.448  -6.356
  190    H2     A  18           H2         A  18  34.650  21.955  -7.841
  191    H5'    A  19           H5'        A  19  37.481  18.483  -1.776
  192   H5''    A  19          H5''        A  19  38.535  19.650  -0.954
  193    H4'    A  19           H4'        A  19  38.922  19.110  -3.517
  194    H3'    A  19           H3'        A  19  38.963  21.713  -1.996
  195    H2'    A  19          H2''        A  19  39.119  22.998  -3.895
  196   HO2'    A  19          H2'         A  19  40.438  20.744  -4.977
  197    H1'    A  19           H1'        A  19  37.988  21.181  -5.772
  198    H8     A  19           H8         A  19  35.678  22.305  -2.958
  199    H61    A  19           H61        A  19  34.449  27.277  -6.394
  200    H62    A  19           H62        A  19  33.910  26.275  -5.065
  201    H2     A  19           H2         A  19  37.885  25.088  -8.293
  202    H5'    A  20           H5'        A  20  42.620  21.476  -4.753
  203   H5''    A  20          H5''        A  20  43.908  22.364  -3.916
  204    H4'    A  20           H4'        A  20  43.483  23.183  -6.267
  205    H3'    A  20           H3'        A  20  43.201  24.852  -3.772
  206    H2'    A  20          H2''        A  20  42.413  26.700  -4.926
  207   HO2'    A  20          H2'         A  20  43.798  25.581  -7.126
  208    H1'    A  20           H1'        A  20  41.157  25.384  -7.073
  209    H8     A  20           H8         A  20  40.236  24.479  -3.416
  210    H61    A  20           H61        A  20  35.898  28.851  -3.917
  211    H62    A  20           H62        A  20  36.502  27.526  -2.949
  212    H2     A  20           H2         A  20  38.457  29.005  -7.594
  213    H5'    U  21           H5'        U  21  45.045  27.514  -6.242
  214   H5''    U  21          H5''        U  21  46.148  28.558  -5.325
  215    H4'    U  21           H4'        U  21  44.191  29.818  -6.262
  216    H3'    U  21           H3'        U  21  44.810  29.526  -3.335
  217    H2'    U  21          H2''        U  21  42.861  30.559  -2.622
  218   HO2'    U  21          H2'         U  21  42.457  32.386  -3.562
  219    H1'    U  21           H1'        U  21  41.138  29.791  -4.672
  220    H3     U  21           H3         U  21  39.253  28.015  -0.965
  221    H5     U  21           H5         U  21  42.909  25.942  -1.291
  222    H6     U  21           H6         U  21  43.428  27.302  -3.232
  223    H5'    U  22           H5'        U  22  44.670  33.366  -5.120
  224   H5''    U  22          H5''        U  22  45.772  34.735  -4.864
  225    H4'    U  22           H4'        U  22  43.448  35.533  -4.763
  226    H3'    U  22           H3'        U  22  45.344  35.566  -2.492
  227    H2'    U  22          H2''        U  22  43.870  35.345  -0.782
  228   HO2'    U  22          H2'         U  22  43.353  37.594  -1.273
  229    H1'    U  22           H1'        U  22  41.386  35.100  -2.292
  230    H3     U  22           H3         U  22  40.189  32.496   1.168
  231    H5     U  22           H5         U  22  43.925  30.906   0.038
  232    H6     U  22           H6         U  22  44.066  32.619  -1.668
  233    H5'    A  23           H5'        A  23  46.498  37.913  -0.026
  234   H5''    A  23          H5''        A  23  45.296  36.611  -0.107
  235    H4'    A  23           H4'        A  23  45.499  37.695   2.176
  236    H3'    A  23           H3'        A  23  43.113  37.170   0.563
  237    H2'    A  23          H2''        A  23  41.731  38.854   1.250
  238   HO2'    A  23          H2'         A  23  41.281  38.928   3.289
  239    H1'    A  23           H1'        A  23  43.467  40.708   2.441
  240    H8     A  23           H8         A  23  44.683  40.348  -1.032
  241    H61    A  23           H61        A  23  39.855  43.672  -2.966
  242    H62    A  23           H62        A  23  41.472  43.124  -3.349
  243    H2     A  23           H2         A  23  39.032  42.371   1.236
  244    H5'    A  24           H5'        A  24  40.555  35.010   3.667
  245   H5''    A  24          H5''        A  24  39.564  34.475   2.298
  246    H4'    A  24           H4'        A  24  39.230  36.840   3.851
  247    H3'    A  24           H3'        A  24  38.000  35.375   1.589
  248    H2'    A  24          H2''        A  24  37.547  37.154   0.266
  249   HO2'    A  24          H2'         A  24  36.809  38.769   2.464
  250    H1'    A  24           H1'        A  24  38.751  39.285   1.873
  251    H8     A  24           H8         A  24  41.083  37.346  -0.280
  252    H61    A  24           H61        A  24  39.324  40.875  -5.047
  253    H62    A  24           H62        A  24  40.482  39.692  -4.484
  254    H2     A  24           H2         A  24  36.572  41.698  -1.602
  255    H5'    U  25           H5'        U  25  35.113  33.663   1.063
  256   H5''    U  25          H5''        U  25  35.883  35.260   1.046
  257    H4'    U  25           H4'        U  25  33.130  34.519   0.363
  258    H3'    U  25           H3'        U  25  35.137  36.074  -0.659
  259    H2'    U  25          H2''        U  25  35.123  37.832   0.896
  260   HO2'    U  25          H2'         U  25  32.973  38.444  -0.868
  261    H1'    U  25           H1'        U  25  32.151  37.798   1.190
  262    H3     U  25           H3         U  25  32.230  40.409   4.818
  263    H5     U  25           H5         U  25  35.943  38.431   5.046
  264    H6     U  25           H6         U  25  35.377  37.260   3.000
  265    H5'    U  26           H5'        U  26  36.386  37.393  -1.503
  266   H5''    U  26          H5''        U  26  35.487  38.327  -2.714
  267    H4'    U  26           H4'        U  26  37.569  38.327  -3.770
  268    H3'    U  26           H3'        U  26  35.910  35.959  -4.470
  269    H2'    U  26          H2''        U  26  37.573  34.504  -5.056
  270   HO2'    U  26          H2'         U  26  38.595  35.384  -6.693
  271    H1'    U  26           H1'        U  26  39.785  35.523  -3.708
  272    H3     U  26           H3         U  26  39.661  31.292  -2.197
  273    H5     U  26           H5         U  26  36.185  33.008  -0.557
  274    H6     U  26           H6         U  26  36.633  35.013  -1.827
  275    H5'    C  27           H5'        C  27  36.329  37.211  -9.278
  276   H5''    C  27          H5''        C  27  34.964  36.137  -9.643
  277    H4'    C  27           H4'        C  27  37.406  35.591 -10.570
  278    H3'    C  27           H3'        C  27  35.151  33.908  -9.546
  279    H2'    C  27          H2''        C  27  36.392  31.995  -9.216
  280   HO2'    C  27          H2'         C  27  38.106  32.987 -11.259
  281    H1'    C  27           H1'        C  27  38.970  33.072  -8.910
  282    H41    C  27           H41        C  27  37.436  30.527  -3.297
  283    H42    C  27           H42        C  27  35.910  31.381  -3.257
  284    H5     C  27           H5         C  27  35.117  32.737  -5.081
  285    H6     C  27           H6         C  27  35.682  33.705  -7.257
  286    H5'    U  28           H5'        U  28  35.788  32.617 -14.373
  287   H5''    U  28          H5''        U  28  34.661  31.261 -14.584
  288    H4'    U  28           H4'        U  28  37.315  30.899 -14.824
  289    H3'    U  28           H3'        U  28  35.190  29.205 -13.470
  290    H2'    U  28          H2''        U  28  36.779  27.578 -12.910
  291   HO2'    U  28          H2'         U  28  38.636  27.302 -13.949
  292    H1'    U  28           H1'        U  28  38.721  29.346 -12.072
  293    H3     U  28           H3         U  28  36.753  26.961  -8.620
  294    H5     U  28           H5         U  28  34.239  30.256  -9.336
  295    H6     U  28           H6         U  28  35.572  30.785 -11.274
  296    H5'    U  29           H5'        U  29  37.104  26.415 -16.103
  297   H5''    U  29          H5''        U  29  36.051  25.016 -16.394
  298    H4'    U  29           H4'        U  29  38.215  24.748 -14.887
  299    H3'    U  29           H3'        U  29  35.425  23.665 -14.653
  300    H2'    U  29          H2''        U  29  35.674  22.895 -12.495
  301   HO2'    U  29          H2'         U  29  38.474  22.822 -12.991
  302    H1'    U  29           H1'        U  29  37.668  24.648 -11.560
  303    H3     U  29           H3         U  29  33.961  24.457  -8.795
  304    H5     U  29           H5         U  29  33.101  27.356 -11.724
  305    H6     U  29           H6         U  29  35.097  26.660 -12.912
  306    H5'    A  30           H5'        A  30  37.211  20.594 -12.901
  307   H5''    A  30          H5''        A  30  36.964  19.140 -13.889
  308    H4'    A  30           H4'        A  30  36.161  18.493 -11.754
  309    H3'    A  30           H3'        A  30  34.031  19.457 -13.659
  310    H2'    A  30          H2''        A  30  32.375  19.389 -12.049
  311   HO2'    A  30          H2'         A  30  32.187  17.764 -10.697
  312    H1'    A  30           H1'        A  30  34.040  19.644  -9.739
  313    H8     A  30           H8         A  30  33.860  22.496 -12.337
  314    H61    A  30           H61        A  30  29.104  24.596  -8.993
  315    H62    A  30           H62        A  30  30.273  24.993 -10.233
  316    H2     A  30           H2         A  30  30.304  20.595  -7.355
  317    H5'    A  31           H5'        A  31  32.957  15.380 -11.596
  318   H5''    A  31          H5''        A  31  31.881  14.544 -12.731
  319    H4'    A  31           H4'        A  31  30.983  14.728 -10.355
  320    H3'    A  31           H3'        A  31  29.640  15.712 -12.864
  321    H2'    A  31          H2''        A  31  27.958  16.804 -11.745
  322   HO2'    A  31          H2'         A  31  28.365  14.952  -9.622
  323    H1'    A  31           H1'        A  31  29.239  17.162  -9.214
  324    H8     A  31           H8         A  31  30.562  18.797 -12.464
  325    H61    A  31           H61        A  31  26.977  23.597 -10.943
  326    H62    A  31           H62        A  31  28.305  23.059 -11.946
  327    H2     A  31           H2         A  31  26.164  20.274  -8.040
  328    H5'    A  32           H5'        A  32  26.594  12.425 -10.732
  329   H5''    A  32          H5''        A  32  25.406  12.229 -12.035
  330    H4'    A  32           H4'        A  32  24.637  13.061  -9.625
  331    H3'    A  32           H3'        A  32  23.813  13.834 -12.413
  332    H2'    A  32          H2''        A  32  22.631  15.692 -11.758
  333   HO2'    A  32          H2'         A  32  21.122  15.171 -10.394
  334    H1'    A  32           H1'        A  32  23.898  16.218  -9.268
  335    H8     A  32           H8         A  32  26.134  16.388 -12.373
  336    H61    A  32           H61        A  32  24.056  22.164 -13.097
  337    H62    A  32           H62        A  32  25.269  21.000 -13.582
  338    H2     A  32           H2         A  32  21.803  20.292  -9.698
  339    H5'    A  33           H5'        A  33  19.724  12.785  -9.927
  340   H5''    A  33          H5''        A  33  18.580  12.618 -11.272
  341    H4'    A  33           H4'        A  33  18.163  14.428  -9.363
  342    H3'    A  33           H3'        A  33  17.759  14.471 -12.343
  343    H2'    A  33          H2''        A  33  17.344  16.741 -12.448
  344   HO2'    A  33          H2'         A  33  16.243  17.802 -10.942
  345    H1'    A  33           H1'        A  33  18.830  17.616 -10.228
  346    H8     A  33           H8         A  33  20.831  15.558 -12.745
  347    H61    A  33           H61        A  33  21.567  20.821 -15.904
  348    H62    A  33           H62        A  33  22.141  19.182 -15.686
  349    H2     A  33           H2         A  33  18.584  21.562 -12.637
  350    H5'    A  34           H5'        A  34  14.421  16.342 -10.326
  351   H5''    A  34          H5''        A  34  12.861  15.998 -11.100
  352    H4'    A  34           H4'        A  34  13.376  18.474 -10.799
  353    H3'    A  34           H3'        A  34  12.681  17.029 -13.334
  354    H2'    A  34          H2''        A  34  13.294  18.740 -14.747
  355   HO2'    A  34          H2'         A  34  12.631  20.522 -12.627
  356    H1'    A  34           H1'        A  34  14.994  20.238 -13.006
  357    H8     A  34           H8         A  34  16.094  16.700 -14.040
  358    H61    A  34           H61        A  34  19.109  19.520 -18.640
  359    H62    A  34           H62        A  34  19.008  18.070 -17.667
  360    H2     A  34           H2         A  34  16.368  22.512 -16.725
  361    H5'    C  35           H5'        C  35   8.952  18.239 -14.784
  362   H5''    C  35          H5''        C  35   9.269  16.802 -15.778
  363    H4'    C  35           H4'        C  35  10.642  19.440 -15.771
  364    H3'    C  35           H3'        C  35   9.516  17.528 -17.595
  365    H2'    C  35          H2''        C  35  11.414  16.285 -18.007
  366   HO2'    C  35          H2'         C  35  11.269  17.653 -19.876
  367    H1'    C  35           H1'        C  35  13.296  18.493 -17.282
  368    H41    C  35           H41        C  35  17.086  13.396 -16.882
  369    H42    C  35           H42        C  35  15.970  12.604 -15.792
  370    H5     C  35           H5         C  35  13.765  13.460 -15.320
  371    H6     C  35           H6         C  35  12.245  15.361 -15.607
  372    H5'    U  36           H5'        U  36   9.666  21.640 -16.747
  373   H5''    U  36          H5''        U  36   8.251  22.603 -17.220
  374    H4'    U  36           H4'        U  36   9.770  24.334 -17.190
  375    H3'    U  36           H3'        U  36   9.906  22.888 -19.814
  376    H2'    U  36          H2''        U  36  11.920  23.748 -20.450
  377   HO2'    U  36          H2'         U  36  11.327  26.027 -18.847
  378    H1'    U  36           H1'        U  36  12.926  24.560 -17.892
  379    H3     U  36           H3         U  36  15.915  22.384 -20.809
  380    H5     U  36           H5         U  36  14.458  19.612 -18.015
  381    H6     U  36           H6         U  36  12.711  21.191 -17.435
  382    H5'    A  37           H5'        A  37   8.830  27.202 -21.253
  383   H5''    A  37          H5''        A  37   7.661  26.930 -22.561
  384    H4'    A  37           H4'        A  37   9.696  28.190 -23.333
  385    H3'    A  37           H3'        A  37   8.980  25.429 -24.327
  386    H2'    A  37          H2''        A  37  10.768  25.393 -25.795
  387   HO2'    A  37          H2'         A  37  10.725  27.322 -26.806
  388    H1'    A  37           H1'        A  37  12.619  26.665 -24.089
  389    H8     A  37           H8         A  37  10.588  23.995 -22.283
  390    H61    A  37           H61        A  37  14.630  19.899 -24.532
  391    H62    A  37           H62        A  37  13.411  20.193 -23.313
  392    H2     A  37           H2         A  37  15.365  23.832 -26.560
  393    H5'    C  38           H5'        C  38   8.877  28.023 -28.246
  394   H5''    C  38          H5''        C  38   7.958  26.986 -29.355
  395    H4'    C  38           H4'        C  38  10.478  27.574 -29.896
  396    H3'    C  38           H3'        C  38   8.949  24.984 -30.101
  397    H2'    C  38          H2''        C  38  10.827  23.753 -30.658
  398   HO2'    C  38          H2'         C  38  11.505  24.978 -32.400
  399    H1'    C  38           H1'        C  38  12.776  25.248 -29.290
  400    H41    C  38           H41        C  38  12.093  19.648 -26.316
  401    H42    C  38           H42        C  38  10.555  20.157 -25.656
  402    H5     C  38           H5         C  38   9.582  22.319 -26.100
  403    H6     C  38           H6         C  38   9.788  24.381 -27.390
  404    H5'    A  39           H5'        A  39   9.595  25.411 -34.676
  405   H5''    A  39          H5''        A  39   8.407  24.228 -35.256
  406    H4'    A  39           H4'        A  39  11.023  23.678 -35.306
  407    H3'    A  39           H3'        A  39   8.605  21.994 -34.693
  408    H2'    A  39          H2''        A  39   9.854  20.227 -33.919
  409   HO2'    A  39          H2'         A  39  10.984  20.133 -35.988
  410    H1'    A  39           H1'        A  39  12.260  21.641 -33.256
  411    H8     A  39           H8         A  39   9.172  22.538 -31.204
  412    H61    A  39           H61        A  39  10.575  17.655 -27.673
  413    H62    A  39           H62        A  39   9.587  19.091 -27.818
  414    H2     A  39           H2         A  39  13.207  17.552 -31.302
  415    H5'    A  40           H5'        A  40  10.759  20.648 -38.684
  416   H5''    A  40          H5''        A  40   9.720  19.612 -39.684
  417    H4'    A  40           H4'        A  40  11.910  18.505 -39.101
  418    H3'    A  40           H3'        A  40   9.233  17.498 -38.060
  419    H2'    A  40          H2''        A  40  10.247  15.714 -36.967
  420   HO2'    A  40          H2'         A  40  12.573  16.184 -38.544
  421    H1'    A  40           H1'        A  40  12.626  17.024 -36.275
  422    H8     A  40           H8         A  40   9.334  18.864 -35.485
  423    H61    A  40           H61        A  40   9.467  15.860 -30.080
  424    H62    A  40           H62        A  40   8.731  17.165 -30.984
  425    H2     A  40           H2         A  40  12.799  14.278 -32.633
  426    H5'    U  41           H5'        U  41  10.214  13.918 -40.857
  427   H5''    U  41          H5''        U  41   8.738  12.938 -40.764
  428    H4'    U  41           H4'        U  41  10.998  12.215 -39.485
  429    H3'    U  41           H3'        U  41   8.073  12.006 -38.699
  430    H2'    U  41          H2''        U  41   8.630  11.185 -36.590
  431   HO2'    U  41          H2'         U  41   9.873   9.449 -37.147
  432    H1'    U  41           H1'        U  41  11.141  12.461 -36.313
  433    H3     U  41           H3         U  41   8.503  13.177 -32.634
  434    H5     U  41           H5         U  41   6.970  15.749 -35.601
  435    H6     U  41           H6         U  41   8.509  14.735 -37.182
  436    H5'    C  42           H5'        C  42   9.900   7.648 -38.823
  437   H5''    C  42          H5''        C  42   8.501   6.576 -39.034
  438    H4'    C  42           H4'        C  42   9.974   6.026 -37.031
  439    H3'    C  42           H3'        C  42   7.022   6.674 -36.925
  440    H2'    C  42          H2''        C  42   6.967   6.492 -34.604
  441   HO2'    C  42          H2'         C  42   9.365   4.981 -34.845
  442    H1'    C  42           H1'        C  42   9.565   7.383 -34.047
  443    H41    C  42           H41        C  42   5.489  11.893 -32.163
  444    H42    C  42           H42        C  42   5.102  12.290 -33.820
  445    H5     C  42           H5         C  42   6.105  11.173 -35.711
  446    H6     C  42           H6         C  42   7.557   9.332 -36.412
  447    H5'    A  43           H5'        A  43   6.153   2.028 -36.231
  448   H5''    A  43          H5''        A  43   4.413   2.169 -36.546
  449    H4'    A  43           H4'        A  43   5.350   1.786 -34.062
  450    H3'    A  43           H3'        A  43   3.071   3.460 -35.135
  451    H2'    A  43          H2''        A  43   2.599   4.341 -33.035
  452   HO2'    A  43          H2'         A  43   2.478   2.540 -31.784
  453    H1'    A  43           H1'        A  43   5.210   4.484 -32.054
  454    H8     A  43           H8         A  43   5.084   6.032 -35.495
  455    H61    A  43           H61        A  43   2.523  11.000 -32.841
  456    H62    A  43           H62        A  43   3.337  10.389 -34.264
  457    H2     A  43           H2         A  43   2.691   7.716 -29.788
  458    H5'    G  44           H5'        G  44   0.817   0.130 -32.286
  459   H5''    G  44          H5''        G  44  -0.855   0.403 -32.812
  460    H4'    G  44           H4'        G  44  -0.153   0.737 -30.255
  461    H3'    G  44           H3'        G  44  -1.986   2.354 -32.044
  462    H2'    G  44          H2''        G  44  -2.442   3.860 -30.316
  463   HO2'    G  44          H2'         G  44  -2.364   3.350 -28.226
  464    H1'    G  44           H1'        G  44   0.119   3.898 -29.184
  465    H8     G  44           H8         G  44   0.779   4.399 -32.770
  466    H1     G  44           H1         G  44  -2.103   9.467 -30.108
  467    H21    G  44           H21        G  44  -2.859   8.946 -28.106
  468    H22    G  44           H22        G  44  -2.846   7.304 -27.503
  469    H5'    C  45           H5'        C  45  -4.032   2.149 -28.770
  470   H5''    C  45          H5''        C  45  -5.681   1.510 -28.919
  471    H4'    C  45           H4'        C  45  -5.880   3.653 -27.837
  472    H3'    C  45           H3'        C  45  -6.548   3.556 -30.788
  473    H2'    C  45          H2''        C  45  -7.004   5.822 -30.848
  474   HO2'    C  45          H2'         C  45  -8.401   6.254 -29.293
  475    H1'    C  45           H1'        C  45  -5.186   6.648 -28.860
  476    H41    C  45           H41        C  45  -3.220   8.851 -34.494
  477    H42    C  45           H42        C  45  -2.881   7.233 -35.061
  478    H5     C  45           H5         C  45  -3.197   5.263 -33.696
  479    H6     C  45           H6         C  45  -4.059   4.416 -31.569
  480    H5'    U  46           H5'        U  46 -10.650   5.325 -28.531
  481   H5''    U  46          H5''        U  46 -11.723   4.989 -29.903
  482    H4'    U  46           H4'        U  46 -11.477   7.467 -28.961
  483    H3'    U  46           H3'        U  46 -11.700   6.373 -31.761
  484    H2'    U  46          H2''        U  46 -11.270   8.417 -32.764
  485   HO2'    U  46          H2'         U  46 -12.688   9.791 -31.922
  486    H1'    U  46           H1'        U  46  -9.580   9.549 -30.848
  487    H3     U  46           H3         U  46  -7.314   9.483 -34.789
  488    H5     U  46           H5         U  46  -7.301   5.476 -33.499
  489    H6     U  46           H6         U  46  -8.818   6.112 -31.717
  490    H5'    C  47           H5'        C  47 -14.876   9.758 -31.412
  491   H5''    C  47          H5''        C  47 -16.206   9.180 -32.433
  492    H4'    C  47           H4'        C  47 -15.463  11.482 -33.073
  493    H3'    C  47           H3'        C  47 -15.070   9.116 -34.922
  494    H2'    C  47          H2''        C  47 -14.301  10.550 -36.615
  495   HO2'    C  47          H2'         C  47 -16.014  12.193 -35.920
  496    H1'    C  47           H1'        C  47 -12.755  12.162 -34.932
  497    H41    C  47           H41        C  47  -8.515   8.165 -37.381
  498    H42    C  47           H42        C  47  -9.140   6.846 -36.418
  499    H5     C  47           H5         C  47 -10.944   7.121 -34.842
  500    H6     C  47           H6         C  47 -12.821   8.559 -34.193
  501    H5'    C  48           H5'        C  48 -17.603  12.054 -37.124
  502   H5''    C  48          H5''        C  48 -18.742  11.166 -38.156
  503    H4'    C  48           H4'        C  48 -17.311  12.806 -39.431
  504    H3'    C  48           H3'        C  48 -17.396   9.837 -39.872
  505   HO3'    C  48          H3T         C  48 -18.495  10.505 -41.706
  506    H2'    C  48          H2''        C  48 -15.658   9.796 -41.375
  507   HO2'    C  48          H2'         C  48 -16.184  12.552 -41.867
  508    H1'    C  48           H1'        C  48 -14.212  12.045 -40.482
  509    H41    C  48           H41        C  48 -10.777   6.825 -39.222
  510    H42    C  48           H42        C  48 -11.804   6.454 -37.857
  511    H5     C  48           H5         C  48 -13.876   7.609 -37.422
  512    H6     C  48           H6         C  48 -15.297   9.494 -38.073
  Start of MODEL    6
    1    H5'    G   1           H5'        G   1  -3.361   8.114 -47.460
    2   H5''    G   1          H5''        G   1  -2.243   9.351 -46.851
    3    H4'    G   1           H4'        G   1  -4.401  10.367 -47.574
    4    H3'    G   1           H3'        G   1  -3.392  10.360 -44.745
    5    H2'    G   1          H2''        G   1  -5.324  11.129 -43.802
    6   HO2'    G   1          H2'         G   1  -5.671  13.006 -44.802
    7    H1'    G   1           H1'        G   1  -7.217  10.235 -45.702
    8    H8     G   1           H8         G   1  -5.130   7.371 -44.368
    9    H1     G   1           H1         G   1  -9.919   9.125 -40.481
   10    H21    G   1           H21        G   1 -10.737  11.073 -41.125
   11    H22    G   1           H22        G   1 -10.243  11.847 -42.612
   12   HO5'    G   1          H5T         G   1  -2.450   8.602 -44.867
   13    H5'    G   2           H5'        G   2  -3.925  15.015 -44.973
   14   H5''    G   2          H5''        G   2  -2.993  15.428 -43.523
   15    H4'    G   2           H4'        G   2  -5.674  15.658 -43.589
   16    H3'    G   2           H3'        G   2  -3.770  14.785 -41.400
   17    H2'    G   2          H2''        G   2  -5.493  14.200 -40.002
   18   HO2'    G   2          H2'         G   2  -7.520  15.203 -40.055
   19    H1'    G   2           H1'        G   2  -7.491  13.699 -42.004
   20    H8     G   2           H8         G   2  -4.549  11.333 -42.141
   21    H1     G   2           H1         G   2  -8.786  10.038 -37.499
   22    H21    G   2           H21        G   2 -10.245  11.680 -37.338
   23    H22    G   2           H22        G   2 -10.058  13.179 -38.221
   24    H5'    G   3           H5'        G   3  -5.885  19.056 -39.274
   25   H5''    G   3          H5''        G   3  -4.861  18.821 -37.845
   26    H4'    G   3           H4'        G   3  -7.541  18.948 -37.652
   27    H3'    G   3           H3'        G   3  -5.595  17.110 -36.212
   28    H2'    G   3          H2''        G   3  -7.399  16.381 -34.861
   29   HO2'    G   3          H2'         G   3  -8.915  18.480 -36.064
   30    H1'    G   3           H1'        G   3  -9.132  16.074 -37.028
   31    H8     G   3           H8         G   3  -5.989  14.827 -38.405
   32    H1     G   3           H1         G   3  -8.228  10.925 -33.841
   33    H21    G   3           H21        G   3  -9.806  11.940 -32.684
   34    H22    G   3           H22        G   3 -10.180  13.634 -32.903
   35    H5'    G   4           H5'        G   4  -7.148  18.564 -33.263
   36   H5''    G   4          H5''        G   4  -6.248  19.487 -32.042
   37    H4'    G   4           H4'        G   4  -7.223  17.738 -30.779
   38    H3'    G   4           H3'        G   4  -4.401  17.159 -31.698
   39    H2'    G   4          H2''        G   4  -4.423  15.042 -30.776
   40   HO2'    G   4          H2'         G   4  -5.356  14.628 -28.933
   41    H1'    G   4           H1'        G   4  -7.129  14.446 -31.183
   42    H8     G   4           H8         G   4  -5.273  15.700 -34.301
   43    H1     G   4           H1         G   4  -4.224   9.529 -32.888
   44    H21    G   4           H21        G   4  -5.148   9.051 -30.933
   45    H22    G   4           H22        G   4  -5.842  10.281 -29.903
   46    H5'    U   5           H5'        U   5  -4.506  16.460 -26.895
   47   H5''    U   5          H5''        U   5  -2.762  16.503 -26.569
   48    H4'    U   5           H4'        U   5  -4.189  14.336 -25.979
   49    H3'    U   5           H3'        U   5  -1.437  14.656 -27.185
   50    H2'    U   5          H2''        U   5  -1.199  12.370 -27.527
   51   HO2'    U   5          H2'         U   5  -1.975  10.899 -26.189
   52    H1'    U   5           H1'        U   5  -3.884  11.711 -27.983
   53    H3     U   5           H3         U   5  -1.258  10.338 -31.478
   54    H5     U   5           H5         U   5  -1.704  14.495 -32.017
   55    H6     U   5           H6         U   5  -2.878  14.573 -29.893
   56    H5'    U   6           H5'        U   6  -1.516  11.673 -24.090
   57   H5''    U   6          H5''        U   6  -0.278  12.009 -22.864
   58    H4'    U   6           H4'        U   6  -0.168   9.645 -23.283
   59    H3'    U   6           H3'        U   6   1.946  11.350 -24.619
   60    H2'    U   6          H2''        U   6   2.931   9.472 -25.616
   61   HO2'    U   6          H2'         U   6   3.114   8.018 -24.010
   62    H1'    U   6           H1'        U   6   0.592   8.090 -26.209
   63    H3     U   6           H3         U   6   2.418   9.171 -30.230
   64    H5     U   6           H5         U   6   1.001  12.842 -28.728
   65    H6     U   6           H6         U   6   0.437  11.704 -26.663
   66    H5'    G   7           H5'        G   7   4.945   9.582 -21.441
   67   H5''    G   7          H5''        G   7   6.305  10.676 -21.768
   68    H4'    G   7           H4'        G   7   6.315   8.126 -22.622
   69    H3'    G   7           H3'        G   7   7.323  10.688 -23.881
   70    H2'    G   7          H2''        G   7   7.894   9.597 -25.856
   71   HO2'    G   7          H2'         G   7   7.777   7.149 -24.403
   72    H1'    G   7           H1'        G   7   5.846   7.671 -25.865
   73    H8     G   7           H8         G   7   4.248  11.028 -25.461
   74    H1     G   7           H1         G   7   6.604  10.076 -31.352
   75    H21    G   7           H21        G   7   7.865   8.264 -31.372
   76    H22    G   7           H22        G   7   8.290   7.409 -29.907
   77    H5'    G   8           H5'        G   8  11.333   7.774 -23.550
   78   H5''    G   8          H5''        G   8  12.532   9.050 -23.834
   79    H4'    G   8           H4'        G   8  12.432   6.910 -25.418
   80    H3'    G   8           H3'        G   8  12.797   9.840 -26.099
   81    H2'    G   8          H2''        G   8  13.015   9.323 -28.371
   82   HO2'    G   8          H2'         G   8  13.430   6.636 -27.524
   83    H1'    G   8           H1'        G   8  11.098   7.293 -28.438
   84    H8     G   8           H8         G   8   9.512  10.124 -26.614
   85    H1     G   8           H1         G   8  10.192  11.343 -32.871
   86    H21    G   8           H21        G   8  11.520   9.847 -33.796
   87    H22    G   8           H22        G   8  12.390   8.660 -32.850
   88    H5'    U   9           H5'        U   9  15.442   8.269 -28.132
   89   H5''    U   9          H5''        U   9  17.154   8.673 -27.893
   90    H4'    U   9           H4'        U   9  16.783   9.029 -30.220
   91    H3'    U   9           H3'        U   9  16.810  11.435 -28.434
   92    H2'    U   9          H2''        U   9  15.969  12.904 -29.990
   93   HO2'    U   9          H2'         U   9  16.870  11.145 -32.040
   94    H1'    U   9           H1'        U   9  14.528  11.142 -31.646
   95    H3     U   9           H3         U   9  11.473  14.271 -30.504
   96    H5     U   9           H5         U   9  12.350  12.360 -26.851
   97    H6     U   9           H6         U   9  14.035  11.062 -28.007
   98    H5'    G  10           H5'        G  10  18.432  12.927 -31.591
   99   H5''    G  10          H5''        G  10  20.146  13.358 -31.433
  100    H4'    G  10           H4'        G  10  19.157  15.287 -32.403
  101    H3'    G  10           H3'        G  10  19.556  15.403 -29.415
  102    H2'    G  10          H2''        G  10  18.374  17.352 -29.183
  103   HO2'    G  10          H2'         G  10  19.719  18.571 -30.522
  104    H1'    G  10           H1'        G  10  16.830  17.218 -31.596
  105    H8     G  10           H8         G  10  16.097  14.555 -28.960
  106    H1     G  10           H1         G  10  13.184  20.178 -27.930
  107    H21    G  10           H21        G  10  14.050  21.724 -29.249
  108    H22    G  10           H22        G  10  15.193  21.335 -30.516
  109    H5'    U  11           H5'        U  11  22.251  19.374 -31.198
  110   H5''    U  11          H5''        U  11  22.981  19.704 -29.614
  111    H4'    U  11           H4'        U  11  21.588  21.589 -30.884
  112    H3'    U  11           H3'        U  11  21.726  20.801 -27.971
  113    H2'    U  11          H2''        U  11  20.044  22.279 -27.363
  114   HO2'    U  11          H2'         U  11  20.725  24.181 -28.157
  115    H1'    U  11           H1'        U  11  18.545  22.250 -29.734
  116    H3     U  11           H3         U  11  15.824  21.146 -26.236
  117    H5     U  11           H5         U  11  18.070  17.664 -26.990
  118    H6     U  11           H6         U  11  19.421  18.951 -28.545
  119    H5'    A  12           H5'        A  12  23.497  25.205 -27.746
  120   H5''    A  12          H5''        A  12  23.978  25.326 -26.043
  121    H4'    A  12           H4'        A  12  21.841  26.651 -26.985
  122    H3'    A  12           H3'        A  12  22.380  25.254 -24.358
  123    H2'    A  12          H2''        A  12  20.200  25.625 -23.590
  124   HO2'    A  12          H2'         A  12  19.590  27.620 -23.959
  125    H1'    A  12           H1'        A  12  18.854  25.170 -25.955
  126    H8     A  12           H8         A  12  21.410  22.448 -25.754
  127    H61    A  12           H61        A  12  17.893  19.793 -21.417
  128    H62    A  12           H62        A  12  19.173  19.540 -22.583
  129    H2     A  12           H2         A  12  16.355  23.952 -22.105
  130    H5'    U  13           H5'        U  13  20.816  29.265 -22.641
  131   H5''    U  13          H5''        U  13  21.684  29.219 -21.096
  132    H4'    U  13           H4'        U  13  19.031  29.141 -21.147
  133    H3'    U  13           H3'        U  13  21.026  27.604 -19.466
  134    H2'    U  13          H2''        U  13  19.309  26.365 -18.445
  135   HO2'    U  13          H2'         U  13  17.620  28.516 -19.220
  136    H1'    U  13           H1'        U  13  17.489  26.349 -20.564
  137    H3     U  13           H3         U  13  18.515  22.141 -18.909
  138    H5     U  13           H5         U  13  21.566  23.088 -21.655
  139    H6     U  13           H6         U  13  20.675  25.333 -21.779
  140    H5'    U  14           H5'        U  14  18.336  29.696 -17.174
  141   H5''    U  14          H5''        U  14  18.836  30.915 -15.983
  142    H4'    U  14           H4'        U  14  17.196  29.588 -14.853
  143    H3'    U  14           H3'        U  14  20.085  29.157 -14.232
  144    H2'    U  14          H2''        U  14  19.858  27.134 -13.192
  145   HO2'    U  14          H2'         U  14  17.302  28.104 -12.463
  146    H1'    U  14           H1'        U  14  17.437  26.204 -14.259
  147    H3     U  14           H3         U  14  20.233  22.748 -15.005
  148    H5     U  14           H5         U  14  21.773  25.812 -17.452
  149    H6     U  14           H6         U  14  20.162  27.327 -16.452
  150    H5'    U  15           H5'        U  15  17.653  29.378  -9.954
  151   H5''    U  15          H5''        U  15  19.008  29.605  -8.833
  152    H4'    U  15           H4'        U  15  17.398  27.496  -8.590
  153    H3'    U  15           H3'        U  15  20.354  27.879  -8.250
  154    H2'    U  15          H2''        U  15  20.875  25.649  -8.265
  155   HO2'    U  15          H2'         U  15  18.284  25.263  -7.178
  156    H1'    U  15           H1'        U  15  18.604  24.594  -9.605
  157    H3     U  15           H3         U  15  22.288  22.674 -11.469
  158    H5     U  15           H5         U  15  22.273  26.620 -12.942
  159    H6     U  15           H6         U  15  20.467  27.119 -11.405
  160    H5'    U  16           H5'        U  16  18.750  25.194  -4.723
  161   H5''    U  16          H5''        U  16  19.713  25.755  -3.342
  162    H4'    U  16           H4'        U  16  19.739  23.241  -3.650
  163    H3'    U  16           H3'        U  16  22.108  25.078  -3.601
  164    H2'    U  16          H2''        U  16  23.617  23.544  -4.379
  165   HO2'    U  16          H2'         U  16  21.939  21.624  -3.146
  166    H1'    U  16           H1'        U  16  21.903  21.738  -5.718
  167    H3     U  16           H3         U  16  25.149  22.601  -8.742
  168    H5     U  16           H5         U  16  23.154  26.288  -8.332
  169    H6     U  16           H6         U  16  21.857  25.312  -6.531
  170    H5'    U  17           H5'        U  17  23.315  21.413  -0.410
  171   H5''    U  17          H5''        U  17  24.645  22.307   0.351
  172    H4'    U  17           H4'        U  17  25.103  19.979  -0.861
  173    H3'    U  17           H3'        U  17  26.657  22.553  -0.738
  174    H2'    U  17          H2''        U  17  28.132  21.963  -2.393
  175   HO2'    U  17          H2'         U  17  29.037  20.178  -1.532
  176    H1'    U  17           H1'        U  17  26.573  20.001  -3.748
  177    H3     U  17           H3         U  17  28.335  22.660  -6.963
  178    H5     U  17           H5         U  17  25.518  25.120  -5.022
  179    H6     U  17           H6         U  17  25.229  23.366  -3.368
  180    H5'    A  18           H5'        A  18  29.765  18.810   0.514
  181   H5''    A  18          H5''        A  18  31.043  19.831   1.199
  182    H4'    A  18           H4'        A  18  31.592  18.140  -0.779
  183    H3'    A  18           H3'        A  18  32.503  20.959  -0.223
  184    H2'    A  18          H2''        A  18  33.502  21.207  -2.270
  185   HO2'    A  18          H2'         A  18  34.245  18.630  -1.773
  186    H1'    A  18           H1'        A  18  32.080  19.193  -3.720
  187    H8     A  18           H8         A  18  30.004  22.131  -2.492
  188    H61    A  18           H61        A  18  31.752  25.040  -7.656
  189    H62    A  18           H62        A  18  30.668  25.067  -6.283
  190    H2     A  18           H2         A  18  34.187  21.289  -7.277
  191    H5'    A  19           H5'        A  19  36.743  18.371  -0.784
  192   H5''    A  19          H5''        A  19  37.767  19.619  -0.046
  193    H4'    A  19           H4'        A  19  38.222  18.806  -2.540
  194    H3'    A  19           H3'        A  19  38.294  21.540  -1.266
  195    H2'    A  19          H2''        A  19  38.568  22.627  -3.275
  196   HO2'    A  19          H2'         A  19  39.831  21.887  -4.850
  197    H1'    A  19           H1'        A  19  37.429  20.671  -5.002
  198    H8     A  19           H8         A  19  35.060  22.141  -2.406
  199    H61    A  19           H61        A  19  34.179  26.814  -6.339
  200    H62    A  19           H62        A  19  33.552  25.973  -4.939
  201    H2     A  19           H2         A  19  37.586  24.325  -7.878
  202    H5'    A  20           H5'        A  20  42.002  20.966  -3.854
  203   H5''    A  20          H5''        A  20  43.301  21.872  -3.052
  204    H4'    A  20           H4'        A  20  42.975  22.518  -5.469
  205    H3'    A  20           H3'        A  20  42.668  24.391  -3.126
  206    H2'    A  20          H2''        A  20  41.985  26.163  -4.453
  207   HO2'    A  20          H2'         A  20  42.707  26.503  -6.459
  208    H1'    A  20           H1'        A  20  40.749  24.717  -6.524
  209    H8     A  20           H8         A  20  39.689  24.134  -2.840
  210    H61    A  20           H61        A  20  35.574  28.644  -3.785
  211    H62    A  20           H62        A  20  36.040  27.320  -2.741
  212    H2     A  20           H2         A  20  38.196  28.374  -7.412
  213    H5'    U  21           H5'        U  21  44.770  26.719  -5.773
  214   H5''    U  21          H5''        U  21  45.906  27.786  -4.923
  215    H4'    U  21           H4'        U  21  44.086  29.056  -6.092
  216    H3'    U  21           H3'        U  21  44.558  29.063  -3.123
  217    H2'    U  21          H2''        U  21  42.655  30.297  -2.632
  218   HO2'    U  21          H2'         U  21  42.719  31.146  -5.349
  219    H1'    U  21           H1'        U  21  40.975  29.418  -4.671
  220    H3     U  21           H3         U  21  38.810  28.225  -0.884
  221    H5     U  21           H5         U  21  42.312  25.880  -0.788
  222    H6     U  21           H6         U  21  43.008  26.960  -2.845
  223    H5'    U  22           H5'        U  22  44.589  32.698  -5.243
  224   H5''    U  22          H5''        U  22  45.773  34.012  -5.088
  225    H4'    U  22           H4'        U  22  43.506  34.965  -5.143
  226    H3'    U  22           H3'        U  22  45.337  35.099  -2.823
  227    H2'    U  22          H2''        U  22  43.809  35.155  -1.149
  228   HO2'    U  22          H2'         U  22  42.444  37.001  -2.819
  229    H1'    U  22           H1'        U  22  41.352  34.900  -2.697
  230    H3     U  22           H3         U  22  39.925  32.707   0.952
  231    H5     U  22           H5         U  22  43.597  30.822   0.097
  232    H6     U  22           H6         U  22  43.880  32.357  -1.756
  233    H5'    A  23           H5'        A  23  46.530  37.666  -0.531
  234   H5''    A  23          H5''        A  23  45.248  36.441  -0.524
  235    H4'    A  23           H4'        A  23  45.406  37.779   1.621
  236    H3'    A  23           H3'        A  23  43.077  37.217  -0.060
  237    H2'    A  23          H2''        A  23  41.784  39.058   0.339
  238   HO2'    A  23          H2'         A  23  41.230  38.980   2.370
  239    H1'    A  23           H1'        A  23  43.584  40.927   1.406
  240    H8     A  23           H8         A  23  44.937  40.045  -1.926
  241    H61    A  23           H61        A  23  40.507  43.486  -4.509
  242    H62    A  23           H62        A  23  42.058  42.713  -4.750
  243    H2     A  23           H2         A  23  39.375  42.762  -0.241
  244    H5'    A  24           H5'        A  24  40.150  35.624   3.072
  245   H5''    A  24          H5''        A  24  39.223  35.034   1.680
  246    H4'    A  24           H4'        A  24  38.992  37.570   2.978
  247    H3'    A  24           H3'        A  24  37.757  35.955   0.832
  248    H2'    A  24          H2''        A  24  37.545  37.580  -0.729
  249   HO2'    A  24          H2'         A  24  36.665  39.681  -0.027
  250    H1'    A  24           H1'        A  24  38.831  39.802   0.668
  251    H8     A  24           H8         A  24  41.117  37.408  -1.029
  252    H61    A  24           H61        A  24  40.030  40.423  -6.317
  253    H62    A  24           H62        A  24  40.919  39.116  -5.568
  254    H2     A  24           H2         A  24  37.098  41.876  -3.246
  255    H5'    U  25           H5'        U  25  34.765  34.402   0.355
  256   H5''    U  25          H5''        U  25  35.686  35.905   0.161
  257    H4'    U  25           H4'        U  25  32.929  35.309  -0.623
  258    H3'    U  25           H3'        U  25  35.129  36.546  -1.680
  259    H2'    U  25          H2''        U  25  35.169  38.491  -0.363
  260   HO2'    U  25          H2'         U  25  34.354  40.126  -1.565
  261    H1'    U  25           H1'        U  25  32.192  38.737  -0.316
  262    H3     U  25           H3         U  25  32.234  41.799   2.942
  263    H5     U  25           H5         U  25  35.748  39.605   3.718
  264    H6     U  25           H6         U  25  35.228  38.213   1.801
  265    H5'    U  26           H5'        U  26  36.556  37.609  -2.598
  266   H5''    U  26          H5''        U  26  35.824  38.447  -3.979
  267    H4'    U  26           H4'        U  26  37.953  38.115  -4.881
  268    H3'    U  26           H3'        U  26  36.120  35.823  -5.370
  269    H2'    U  26          H2''        U  26  37.667  34.161  -5.631
  270   HO2'    U  26          H2'         U  26  39.502  36.163  -6.484
  271    H1'    U  26           H1'        U  26  39.887  35.170  -4.287
  272    H3     U  26           H3         U  26  39.290  31.231  -2.210
  273    H5     U  26           H5         U  26  35.896  33.448  -1.076
  274    H6     U  26           H6         U  26  36.596  35.199  -2.584
  275    H5'    C  27           H5'        C  27  36.935  36.362 -10.263
  276   H5''    C  27          H5''        C  27  35.501  35.366 -10.582
  277    H4'    C  27           H4'        C  27  37.933  34.503 -11.257
  278    H3'    C  27           H3'        C  27  35.483  33.155 -10.177
  279    H2'    C  27          H2''        C  27  36.537  31.204  -9.558
  280   HO2'    C  27          H2'         C  27  38.263  30.351 -10.688
  281    H1'    C  27           H1'        C  27  39.194  32.117  -9.263
  282    H41    C  27           H41        C  27  37.346  30.319  -3.461
  283    H42    C  27           H42        C  27  35.871  31.251  -3.573
  284    H5     C  27           H5         C  27  35.210  32.429  -5.566
  285    H6     C  27           H6         C  27  35.894  33.110  -7.817
  286    H5'    U  28           H5'        U  28  36.209  31.248 -14.784
  287   H5''    U  28          H5''        U  28  34.989  29.964 -14.887
  288    H4'    U  28           H4'        U  28  37.617  29.386 -14.949
  289    H3'    U  28           H3'        U  28  35.310  28.017 -13.527
  290    H2'    U  28          H2''        U  28  36.747  26.356 -12.712
  291   HO2'    U  28          H2'         U  28  38.690  27.389 -14.528
  292    H1'    U  28           H1'        U  28  38.781  28.071 -11.979
  293    H3     U  28           H3         U  28  36.515  26.224  -8.386
  294    H5     U  28           H5         U  28  34.267  29.575  -9.573
  295    H6     U  28           H6         U  28  35.709  29.795 -11.496
  296    H5'    U  29           H5'        U  29  37.092  24.842 -15.832
  297   H5''    U  29          H5''        U  29  35.956  23.494 -16.030
  298    H4'    U  29           H4'        U  29  38.058  23.219 -14.443
  299    H3'    U  29           H3'        U  29  35.191  22.358 -14.182
  300    H2'    U  29          H2''        U  29  35.356  21.758 -11.962
  301   HO2'    U  29          H2'         U  29  37.438  21.243 -11.018
  302    H1'    U  29           H1'        U  29  37.434  23.463 -11.134
  303    H3     U  29           H3         U  29  33.657  23.759  -8.475
  304    H5     U  29           H5         U  29  33.049  26.415 -11.683
  305    H6     U  29           H6         U  29  35.029  25.496 -12.740
  306    H5'    A  30           H5'        A  30  36.704  19.364 -12.175
  307   H5''    A  30          H5''        A  30  36.409  17.839 -13.032
  308    H4'    A  30           H4'        A  30  35.515  17.413 -10.887
  309    H3'    A  30           H3'        A  30  33.476  18.368 -12.894
  310    H2'    A  30          H2''        A  30  31.803  18.529 -11.313
  311   HO2'    A  30          H2'         A  30  31.536  17.093  -9.735
  312    H1'    A  30           H1'        A  30  33.450  18.866  -9.001
  313    H8     A  30           H8         A  30  33.517  21.501 -11.821
  314    H61    A  30           H61        A  30  28.855  24.186  -8.778
  315    H62    A  30           H62        A  30  30.076  24.400 -10.013
  316    H2     A  30           H2         A  30  29.730  20.254  -6.804
  317    H5'    A  31           H5'        A  31  31.988  14.556 -10.602
  318   H5''    A  31          H5''        A  31  30.882  13.758 -11.735
  319    H4'    A  31           H4'        A  31  29.903  14.203  -9.427
  320    H3'    A  31           H3'        A  31  28.785  15.146 -12.061
  321    H2'    A  31          H2''        A  31  27.175  16.469 -11.095
  322   HO2'    A  31          H2'         A  31  25.934  15.264  -9.888
  323    H1'    A  31           H1'        A  31  28.379  16.855  -8.528
  324    H8     A  31           H8         A  31  29.971  18.158 -11.810
  325    H61    A  31           H61        A  31  26.807  23.353 -10.717
  326    H62    A  31           H62        A  31  28.096  22.627 -11.649
  327    H2     A  31           H2         A  31  25.591  20.310  -7.652
  328    H5'    A  32           H5'        A  32  25.289  12.333  -9.860
  329   H5''    A  32          H5''        A  32  24.162  12.196 -11.224
  330    H4'    A  32           H4'        A  32  23.353  13.223  -8.902
  331    H3'    A  32           H3'        A  32  22.772  13.935 -11.766
  332    H2'    A  32          H2''        A  32  21.755  15.935 -11.268
  333   HO2'    A  32          H2'         A  32  21.141  14.790  -8.737
  334    H1'    A  32           H1'        A  32  22.945  16.476  -8.749
  335    H8     A  32           H8         A  32  25.342  16.184 -11.724
  336    H61    A  32           H61        A  32  24.017  22.105 -12.900
  337    H62    A  32           H62        A  32  25.099  20.776 -13.249
  338    H2     A  32           H2         A  32  21.366  20.726  -9.554
  339    H5'    A  33           H5'        A  33  18.493  13.543  -9.493
  340   H5''    A  33          H5''        A  33  17.401  13.391 -10.882
  341    H4'    A  33           H4'        A  33  17.109  15.395  -9.155
  342    H3'    A  33           H3'        A  33  16.863  15.225 -12.149
  343    H2'    A  33          H2''        A  33  16.743  17.507 -12.462
  344   HO2'    A  33          H2'         A  33  15.774  17.622  -9.791
  345    H1'    A  33           H1'        A  33  18.143  18.390 -10.173
  346    H8     A  33           H8         A  33  20.132  16.037 -12.417
  347    H61    A  33           H61        A  33  21.565  21.036 -15.762
  348    H62    A  33           H62        A  33  21.924  19.350 -15.467
  349    H2     A  33           H2         A  33  18.401  22.199 -12.805
  350    H5'    A  34           H5'        A  34  13.730  17.670 -10.547
  351   H5''    A  34          H5''        A  34  12.159  17.386 -11.323
  352    H4'    A  34           H4'        A  34  12.856  19.813 -11.318
  353    H3'    A  34           H3'        A  34  12.240  18.133 -13.722
  354    H2'    A  34          H2''        A  34  13.067  19.618 -15.262
  355   HO2'    A  34          H2'         A  34  12.472  21.701 -13.415
  356    H1'    A  34           H1'        A  34  14.769  21.181 -13.569
  357    H8     A  34           H8         A  34  15.607  17.464 -14.131
  358    H61    A  34           H61        A  34  19.225  19.489 -18.715
  359    H62    A  34           H62        A  34  18.886  18.155 -17.635
  360    H2     A  34           H2         A  34  16.696  22.920 -17.320
  361    H5'    C  35           H5'        C  35   9.308  18.299 -16.729
  362   H5''    C  35          H5''        C  35  10.533  17.623 -15.634
  363    H4'    C  35           H4'        C  35  11.281  20.217 -16.878
  364    H3'    C  35           H3'        C  35  10.096  18.211 -18.533
  365    H2'    C  35          H2''        C  35  11.847  16.699 -18.541
  366   HO2'    C  35          H2'         C  35  12.765  18.811 -20.194
  367    H1'    C  35           H1'        C  35  13.945  18.775 -18.050
  368    H41    C  35           H41        C  35  17.040  13.427 -16.535
  369    H42    C  35           H42        C  35  15.753  12.938 -15.456
  370    H5     C  35           H5         C  35  13.646  14.100 -15.312
  371    H6     C  35           H6         C  35  12.398  16.090 -16.012
  372    H5'    U  36           H5'        U  36   9.228  20.841 -18.213
  373   H5''    U  36          H5''        U  36   7.707  21.177 -19.065
  374    H4'    U  36           H4'        U  36   7.867  23.167 -17.904
  375    H3'    U  36           H3'        U  36   9.331  23.295 -20.502
  376    H2'    U  36          H2''        U  36  10.623  25.168 -20.005
  377   HO2'    U  36          H2'         U  36   8.873  25.788 -17.852
  378    H1'    U  36           H1'        U  36  11.003  24.865 -17.304
  379    H3     U  36           H3         U  36  14.503  24.364 -20.635
  380    H5     U  36           H5         U  36  13.833  20.774 -18.535
  381    H6     U  36           H6         U  36  11.782  21.731 -17.687
  382    H5'    A  37           H5'        A  37   9.108  26.620 -21.000
  383   H5''    A  37          H5''        A  37   7.779  27.171 -22.039
  384    H4'    A  37           H4'        A  37   9.647  28.171 -23.071
  385    H3'    A  37           H3'        A  37   8.991  25.453 -24.203
  386    H2'    A  37          H2''        A  37  10.747  25.525 -25.697
  387   HO2'    A  37          H2'         A  37  10.507  27.597 -26.517
  388    H1'    A  37           H1'        A  37  12.614  26.721 -23.962
  389    H8     A  37           H8         A  37  10.618  23.984 -22.219
  390    H61    A  37           H61        A  37  14.600  19.971 -24.711
  391    H62    A  37           H62        A  37  13.402  20.218 -23.460
  392    H2     A  37           H2         A  37  15.296  23.976 -26.608
  393    H5'    C  38           H5'        C  38   8.717  28.188 -27.828
  394   H5''    C  38          H5''        C  38   7.754  27.325 -29.044
  395    H4'    C  38           H4'        C  38  10.259  27.824 -29.581
  396    H3'    C  38           H3'        C  38   8.704  25.258 -29.869
  397    H2'    C  38          H2''        C  38  10.566  24.045 -30.514
  398   HO2'    C  38          H2'         C  38  11.157  25.436 -32.215
  399    H1'    C  38           H1'        C  38  12.546  25.494 -29.128
  400    H41    C  38           H41        C  38  12.001  19.753 -26.405
  401    H42    C  38           H42        C  38  10.476  20.212 -25.684
  402    H5     C  38           H5         C  38   9.465  22.380 -26.008
  403    H6     C  38           H6         C  38   9.614  24.501 -27.203
  404    H5'    A  39           H5'        A  39   9.278  25.842 -34.407
  405   H5''    A  39          H5''        A  39   8.072  24.690 -35.015
  406    H4'    A  39           H4'        A  39  10.680  24.111 -35.097
  407    H3'    A  39           H3'        A  39   8.251  22.434 -34.507
  408    H2'    A  39          H2''        A  39   9.498  20.631 -33.811
  409   HO2'    A  39          H2'         A  39  11.460  21.615 -35.606
  410    H1'    A  39           H1'        A  39  11.918  22.013 -33.124
  411    H8     A  39           H8         A  39   8.843  22.848 -31.021
  412    H61    A  39           H61        A  39  10.231  17.830 -27.684
  413    H62    A  39           H62        A  39   9.322  19.324 -27.719
  414    H2     A  39           H2         A  39  12.884  17.874 -31.302
  415    H5'    A  40           H5'        A  40  10.427  21.192 -38.514
  416   H5''    A  40          H5''        A  40   9.398  20.178 -39.545
  417    H4'    A  40           H4'        A  40  11.609  19.087 -39.037
  418    H3'    A  40           H3'        A  40   8.976  17.991 -37.974
  419    H2'    A  40          H2''        A  40  10.056  16.186 -36.984
  420   HO2'    A  40          H2'         A  40  12.237  16.767 -38.716
  421    H1'    A  40           H1'        A  40  12.423  17.521 -36.299
  422    H8     A  40           H8         A  40   9.126  19.253 -35.324
  423    H61    A  40           H61        A  40   9.423  15.931 -30.116
  424    H62    A  40           H62        A  40   8.662  17.288 -30.913
  425    H2     A  40           H2         A  40  12.722  14.561 -32.831
  426    H5'    U  41           H5'        U  41  10.011  14.608 -41.047
  427   H5''    U  41          H5''        U  41   8.588  13.550 -40.981
  428    H4'    U  41           H4'        U  41  10.930  12.833 -39.862
  429    H3'    U  41           H3'        U  41   8.056  12.423 -38.982
  430    H2'    U  41          H2''        U  41   8.727  11.468 -36.971
  431   HO2'    U  41          H2'         U  41  10.098   9.899 -37.210
  432    H1'    U  41           H1'        U  41  11.198  12.824 -36.681
  433    H3     U  41           H3         U  41   8.702  13.138 -32.853
  434    H5     U  41           H5         U  41   6.941  15.870 -35.538
  435    H6     U  41           H6         U  41   8.446  15.045 -37.258
  436    H5'    C  42           H5'        C  42  10.270   8.359 -39.334
  437   H5''    C  42          H5''        C  42   9.040   7.137 -39.716
  438    H4'    C  42           H4'        C  42  10.466   6.475 -37.770
  439    H3'    C  42           H3'        C  42   7.495   6.999 -37.533
  440    H2'    C  42          H2''        C  42   7.513   6.570 -35.241
  441   HO2'    C  42          H2'         C  42  10.012   5.259 -35.631
  442    H1'    C  42           H1'        C  42  10.078   7.529 -34.660
  443    H41    C  42           H41        C  42   5.877  11.684 -32.294
  444    H42    C  42           H42        C  42   5.422  12.198 -33.902
  445    H5     C  42           H5         C  42   6.411  11.286 -35.905
  446    H6     C  42           H6         C  42   7.911   9.570 -36.799
  447    H5'    A  43           H5'        A  43   6.821   2.306 -37.238
  448   H5''    A  43          H5''        A  43   5.066   2.392 -37.485
  449    H4'    A  43           H4'        A  43   6.106   1.858 -35.071
  450    H3'    A  43           H3'        A  43   3.725   3.523 -35.923
  451    H2'    A  43          H2''        A  43   3.294   4.181 -33.732
  452   HO2'    A  43          H2'         A  43   4.984   2.051 -32.878
  453    H1'    A  43           H1'        A  43   5.938   4.348 -32.838
  454    H8     A  43           H8         A  43   5.600   6.209 -36.104
  455    H61    A  43           H61        A  43   2.944  10.778 -32.888
  456    H62    A  43           H62        A  43   3.741  10.351 -34.386
  457    H2     A  43           H2         A  43   3.396   7.239 -30.170
  458    H5'    G  44           H5'        G  44   1.702  -0.107 -33.352
  459   H5''    G  44          H5''        G  44  -0.004   0.135 -33.773
  460    H4'    G  44           H4'        G  44   0.822   0.310 -31.236
  461    H3'    G  44           H3'        G  44  -1.160   1.993 -32.796
  462    H2'    G  44          H2''        G  44  -1.589   3.307 -30.913
  463   HO2'    G  44          H2'         G  44  -0.303   1.289 -29.363
  464    H1'    G  44           H1'        G  44   1.030   3.329 -29.901
  465    H8     G  44           H8         G  44   1.474   4.269 -33.433
  466    H1     G  44           H1         G  44  -1.479   8.855 -30.066
  467    H21    G  44           H21        G  44  -2.103   8.073 -28.103
  468    H22    G  44           H22        G  44  -1.976   6.378 -27.691
  469    H5'    C  45           H5'        C  45  -2.907   1.472 -29.422
  470   H5''    C  45          H5''        C  45  -4.512   0.718 -29.474
  471    H4'    C  45           H4'        C  45  -4.790   2.717 -28.182
  472    H3'    C  45           H3'        C  45  -5.648   2.906 -31.079
  473    H2'    C  45          H2''        C  45  -6.257   5.123 -30.832
  474   HO2'    C  45          H2'         C  45  -7.484   5.483 -29.169
  475    H1'    C  45           H1'        C  45  -4.358   5.837 -28.874
  476    H41    C  45           H41        C  45  -2.948   8.844 -34.301
  477    H42    C  45           H42        C  45  -2.563   7.333 -35.093
  478    H5     C  45           H5         C  45  -2.662   5.195 -33.972
  479    H6     C  45           H6         C  45  -3.309   4.036 -31.918
  480    H5'    U  46           H5'        U  46  -9.675   4.110 -28.494
  481   H5''    U  46          H5''        U  46 -10.821   3.890 -29.830
  482    H4'    U  46           H4'        U  46 -10.581   6.258 -28.636
  483    H3'    U  46           H3'        U  46 -10.939   5.477 -31.528
  484    H2'    U  46          H2''        U  46 -10.641   7.639 -32.300
  485   HO2'    U  46          H2'         U  46 -11.920   8.994 -31.324
  486    H1'    U  46           H1'        U  46  -8.917   8.615 -30.309
  487    H3     U  46           H3         U  46  -6.910   9.301 -34.331
  488    H5     U  46           H5         U  46  -6.551   5.157 -33.663
  489    H6     U  46           H6         U  46  -7.977   5.413 -31.717
  490    H5'    C  47           H5'        C  47 -14.198   8.729 -30.566
  491   H5''    C  47          H5''        C  47 -15.555   8.197 -31.576
  492    H4'    C  47           H4'        C  47 -14.985  10.602 -31.963
  493    H3'    C  47           H3'        C  47 -14.572   8.511 -34.115
  494    H2'    C  47          H2''        C  47 -13.993  10.187 -35.652
  495   HO2'    C  47          H2'         C  47 -15.094  11.964 -35.550
  496    H1'    C  47           H1'        C  47 -12.434  11.676 -33.865
  497    H41    C  47           H41        C  47  -8.120   8.260 -36.984
  498    H42    C  47           H42        C  47  -8.632   6.798 -36.172
  499    H5     C  47           H5         C  47 -10.363   6.774 -34.498
  500    H6     C  47           H6         C  47 -12.273   8.012 -33.584
  501    H5'    C  48           H5'        C  48 -17.084  11.728 -35.762
  502   H5''    C  48          H5''        C  48 -18.300  11.020 -36.843
  503    H4'    C  48           H4'        C  48 -16.960  12.819 -37.959
  504    H3'    C  48           H3'        C  48 -16.948   9.933 -38.817
  505   HO3'    C  48          H3T         C  48 -17.935  12.372 -39.920
  506    H2'    C  48          H2''        C  48 -15.340  10.244 -40.430
  507   HO2'    C  48          H2'         C  48 -16.564  11.967 -41.436
  508    H1'    C  48           H1'        C  48 -14.001  12.465 -39.272
  509    H41    C  48           H41        C  48  -9.889   7.622 -39.211
  510    H42    C  48           H42        C  48 -10.870   6.746 -38.059
  511    H5     C  48           H5         C  48 -12.912   7.638 -37.128
  512    H6     C  48           H6         C  48 -14.584   9.422 -37.306
  Start of MODEL    7
    1    H5'    G   1           H5'        G   1   1.605   5.514 -41.516
    2   H5''    G   1          H5''        G   1   1.545   7.247 -41.135
    3    H4'    G   1           H4'        G   1   1.133   6.830 -43.576
    4    H3'    G   1           H3'        G   1  -1.036   7.930 -41.751
    5    H2'    G   1          H2''        G   1  -2.526   8.070 -43.664
    6   HO2'    G   1          H2'         G   1  -0.943   8.954 -45.096
    7    H1'    G   1           H1'        G   1  -1.934   5.687 -44.726
    8    H8     G   1           H8         G   1  -2.166   3.952 -41.846
    9    H1     G   1           H1         G   1  -7.171   7.949 -41.631
   10    H21    G   1           H21        G   1  -7.017   9.445 -43.248
   11    H22    G   1           H22        G   1  -5.579   9.618 -44.227
   12   HO5'    G   1          H5T         G   1  -0.692   5.528 -40.869
   13    H5'    G   2           H5'        G   2   0.175  11.750 -44.310
   14   H5''    G   2          H5''        G   2   0.604  12.929 -43.052
   15    H4'    G   2           H4'        G   2  -1.016  13.917 -44.652
   16    H3'    G   2           H3'        G   2  -1.575  13.411 -41.757
   17    H2'    G   2          H2''        G   2  -3.869  13.770 -41.853
   18   HO2'    G   2          H2'         G   2  -3.411  15.070 -44.346
   19    H1'    G   2           H1'        G   2  -4.472  12.681 -44.271
   20    H8     G   2           H8         G   2  -2.179  10.099 -43.182
   21    H1     G   2           H1         G   2  -7.045  10.539 -39.038
   22    H21    G   2           H21        G   2  -8.114  12.451 -39.344
   23    H22    G   2           H22        G   2  -7.760  13.513 -40.687
   24    H5'    G   3           H5'        G   3  -1.944  18.246 -41.229
   25   H5''    G   3          H5''        G   3  -1.511  18.178 -39.510
   26    H4'    G   3           H4'        G   3  -3.954  18.948 -40.292
   27    H3'    G   3           H3'        G   3  -3.054  17.213 -37.974
   28    H2'    G   3          H2''        G   3  -5.265  16.939 -37.249
   29   HO2'    G   3          H2'         G   3  -5.705  19.297 -37.857
   30    H1'    G   3           H1'        G   3  -6.363  16.488 -39.737
   31    H8     G   3           H8         G   3  -3.383  14.510 -40.211
   32    H1     G   3           H1         G   3  -6.975  12.079 -35.488
   33    H21    G   3           H21        G   3  -8.482  13.552 -34.847
   34    H22    G   3           H22        G   3  -8.494  15.196 -35.444
   35    H5'    G   4           H5'        G   4  -5.376  19.106 -35.866
   36   H5''    G   4          H5''        G   4  -4.641  20.283 -34.757
   37    H4'    G   4           H4'        G   4  -6.023  19.059 -33.301
   38    H3'    G   4           H3'        G   4  -3.216  17.964 -33.463
   39    H2'    G   4          H2''        G   4  -3.698  16.151 -32.129
   40   HO2'    G   4          H2'         G   4  -4.754  16.579 -30.371
   41    H1'    G   4           H1'        G   4  -6.338  15.721 -32.914
   42    H8     G   4           H8         G   4  -3.851  16.090 -35.814
   43    H1     G   4           H1         G   4  -3.836  10.298 -33.051
   44    H21    G   4           H21        G   4  -5.120  10.331 -31.248
   45    H22    G   4           H22        G   4  -5.816  11.809 -30.624
   46    H5'    U   5           H5'        U   5  -4.326  18.640 -28.601
   47   H5''    U   5          H5''        U   5  -2.649  18.564 -28.028
   48    H4'    U   5           H4'        U   5  -4.477  16.880 -27.071
   49    H3'    U   5           H3'        U   5  -1.582  16.532 -27.817
   50    H2'    U   5          H2''        U   5  -1.617  14.227 -27.589
   51   HO2'    U   5          H2'         U   5  -2.532  13.403 -25.901
   52    H1'    U   5           H1'        U   5  -4.241  13.697 -28.343
   53    H3     U   5           H3         U   5  -1.340  11.452 -31.080
   54    H5     U   5           H5         U   5  -1.226  15.441 -32.427
   55    H6     U   5           H6         U   5  -2.670  16.035 -30.567
   56    H5'    U   6           H5'        U   6  -2.321  14.372 -23.827
   57   H5''    U   6          H5''        U   6  -0.933  14.855 -22.836
   58    H4'    U   6           H4'        U   6  -1.252  12.407 -22.736
   59    H3'    U   6           H3'        U   6   1.149  13.615 -24.124
   60    H2'    U   6          H2''        U   6   1.987  11.506 -24.697
   61   HO2'    U   6          H2'         U   6   1.872  10.393 -22.817
   62    H1'    U   6           H1'        U   6  -0.429  10.259 -25.258
   63    H3     U   6           H3         U   6   1.795  10.427 -29.220
   64    H5     U   6           H5         U   6   0.665  14.421 -28.509
   65    H6     U   6           H6         U   6  -0.182  13.725 -26.347
   66    H5'    G   7           H5'        G   7   3.660  11.945 -20.637
   67   H5''    G   7          H5''        G   7   5.169  12.832 -20.928
   68    H4'    G   7           H4'        G   7   4.912  10.242 -21.603
   69    H3'    G   7           H3'        G   7   6.335  12.559 -22.929
   70    H2'    G   7          H2''        G   7   6.828  11.321 -24.820
   71   HO2'    G   7          H2'         G   7   6.522   8.985 -23.219
   72    H1'    G   7           H1'        G   7   4.659   9.491 -24.716
   73    H8     G   7           H8         G   7   3.265  12.932 -25.007
   74    H1     G   7           H1         G   7   6.119  10.960 -30.402
   75    H21    G   7           H21        G   7   7.247   9.104 -30.024
   76    H22    G   7           H22        G   7   7.473   8.464 -28.413
   77    H5'    G   8           H5'        G   8  10.017   9.006 -22.027
   78   H5''    G   8          H5''        G   8  11.279  10.208 -22.354
   79    H4'    G   8           H4'        G   8  11.250   7.890 -23.666
   80    H3'    G   8           H3'        G   8  11.783  10.704 -24.645
   81    H2'    G   8          H2''        G   8  12.168   9.933 -26.825
   82   HO2'    G   8          H2'         G   8  12.926   7.664 -25.520
   83    H1'    G   8           H1'        G   8  10.130   8.057 -26.885
   84    H8     G   8           H8         G   8   8.608  11.041 -25.285
   85    H1     G   8           H1         G   8   9.710  11.947 -31.534
   86    H21    G   8           H21        G   8  11.013  10.350 -32.314
   87    H22    G   8           H22        G   8  11.770   9.170 -31.268
   88    H5'    U   9           H5'        U   9  14.623   8.833 -26.183
   89   H5''    U   9          H5''        U   9  16.309   9.153 -25.726
   90    H4'    U   9           H4'        U   9  16.348   9.296 -28.091
   91    H3'    U   9           H3'        U   9  16.213  11.867 -26.574
   92    H2'    U   9          H2''        U   9  15.645  13.210 -28.357
   93   HO2'    U   9          H2'         U   9  16.848  11.226 -30.000
   94    H1'    U   9           H1'        U   9  14.302  11.399 -30.002
   95    H3     U   9           H3         U   9  11.181  14.580 -29.274
   96    H5     U   9           H5         U   9  11.798  12.920 -25.452
   97    H6     U   9           H6         U   9  13.543  11.540 -26.402
   98    H5'    G  10           H5'        G  10  18.517  13.015 -29.508
   99   H5''    G  10          H5''        G  10  20.122  13.611 -29.046
  100    H4'    G  10           H4'        G  10  19.065  15.339 -30.377
  101    H3'    G  10           H3'        G  10  19.285  15.724 -27.393
  102    H2'    G  10          H2''        G  10  17.994  17.619 -27.386
  103   HO2'    G  10          H2'         G  10  18.930  18.016 -30.037
  104    H1'    G  10           H1'        G  10  16.581  17.205 -29.842
  105    H8     G  10           H8         G  10  15.812  14.663 -27.125
  106    H1     G  10           H1         G  10  12.727  20.240 -26.422
  107    H21    G  10           H21        G  10  13.612  21.764 -27.751
  108    H22    G  10           H22        G  10  14.819  21.365 -28.952
  109    H5'    U  11           H5'        U  11  21.841  19.680 -29.467
  110   H5''    U  11          H5''        U  11  22.482  20.196 -27.896
  111    H4'    U  11           H4'        U  11  21.090  21.889 -29.408
  112    H3'    U  11           H3'        U  11  21.074  21.395 -26.424
  113    H2'    U  11          H2''        U  11  19.360  22.939 -26.085
  114   HO2'    U  11          H2'         U  11  19.304  24.743 -27.153
  115    H1'    U  11           H1'        U  11  17.942  22.517 -28.446
  116    H3     U  11           H3         U  11  15.294  21.663 -24.796
  117    H5     U  11           H5         U  11  17.557  18.161 -25.382
  118    H6     U  11           H6         U  11  18.890  19.372 -27.012
  119    H5'    A  12           H5'        A  12  22.625  25.738 -26.060
  120   H5''    A  12          H5''        A  12  22.998  25.747 -24.325
  121    H4'    A  12           H4'        A  12  20.795  26.947 -25.288
  122    H3'    A  12           H3'        A  12  21.311  25.371 -22.756
  123    H2'    A  12          H2''        A  12  19.069  25.513 -22.104
  124   HO2'    A  12          H2'         A  12  18.089  27.338 -22.394
  125    H1'    A  12           H1'        A  12  17.909  25.189 -24.595
  126    H8     A  12           H8         A  12  20.506  22.534 -24.503
  127    H61    A  12           H61        A  12  17.025  19.550 -20.351
  128    H62    A  12           H62        A  12  18.292  19.383 -21.545
  129    H2     A  12           H2         A  12  15.406  23.713 -20.805
  130    H5'    U  13           H5'        U  13  19.250  29.177 -20.863
  131   H5''    U  13          H5''        U  13  20.109  29.106 -19.313
  132    H4'    U  13           H4'        U  13  17.461  28.900 -19.394
  133    H3'    U  13           H3'        U  13  19.510  27.380 -17.759
  134    H2'    U  13          H2''        U  13  17.835  26.045 -16.801
  135   HO2'    U  13          H2'         U  13  15.848  26.756 -16.400
  136    H1'    U  13           H1'        U  13  16.047  26.025 -18.948
  137    H3     U  13           H3         U  13  17.269  21.816 -17.394
  138    H5     U  13           H5         U  13  20.246  22.978 -20.141
  139    H6     U  13           H6         U  13  19.244  25.177 -20.207
  140    H5'    U  14           H5'        U  14  16.299  28.331 -15.094
  141   H5''    U  14          H5''        U  14  16.984  29.329 -13.798
  142    H4'    U  14           H4'        U  14  15.594  27.603 -12.775
  143    H3'    U  14           H3'        U  14  18.571  27.605 -12.535
  144    H2'    U  14          H2''        U  14  18.800  25.452 -11.803
  145   HO2'    U  14          H2'         U  14  17.593  24.696 -10.237
  146    H1'    U  14           H1'        U  14  16.432  24.272 -12.737
  147    H3     U  14           H3         U  14  19.568  21.454 -14.315
  148    H5     U  14           H5         U  14  20.365  25.053 -16.355
  149    H6     U  14           H6         U  14  18.687  26.129 -14.974
  150    H5'    U  15           H5'        U  15  16.710  26.776  -8.026
  151   H5''    U  15          H5''        U  15  18.161  27.077  -7.052
  152    H4'    U  15           H4'        U  15  16.948  24.708  -6.961
  153    H3'    U  15           H3'        U  15  19.829  25.545  -6.922
  154    H2'    U  15          H2''        U  15  20.676  23.460  -7.347
  155   HO2'    U  15          H2'         U  15  18.377  22.540  -5.980
  156    H1'    U  15           H1'        U  15  18.435  22.228  -8.572
  157    H3     U  15           H3         U  15  22.065  21.281 -11.150
  158    H5     U  15           H5         U  15  21.275  25.355 -11.875
  159    H6     U  15           H6         U  15  19.635  25.290 -10.093
  160    H5'    U  16           H5'        U  16  19.227  22.118  -3.731
  161   H5''    U  16          H5''        U  16  20.316  22.632  -2.428
  162    H4'    U  16           H4'        U  16  20.670  20.237  -3.195
  163    H3'    U  16           H3'        U  16  22.706  22.440  -3.127
  164    H2'    U  16          H2''        U  16  24.290  21.324  -4.345
  165   HO2'    U  16          H2'         U  16  24.842  19.491  -3.507
  166    H1'    U  16           H1'        U  16  22.667  19.457  -5.725
  167    H3     U  16           H3         U  16  25.313  21.251  -8.930
  168    H5     U  16           H5         U  16  22.857  24.457  -7.734
  169    H6     U  16           H6         U  16  21.985  23.045  -5.966
  170    H5'    U  17           H5'        U  17  24.963  18.635  -0.756
  171   H5''    U  17          H5''        U  17  26.228  19.656  -0.046
  172    H4'    U  17           H4'        U  17  26.872  17.632  -1.655
  173    H3'    U  17           H3'        U  17  27.975  20.420  -1.354
  174    H2'    U  17          H2''        U  17  29.269  20.301  -3.246
  175   HO2'    U  17          H2'         U  17  29.413  17.564  -2.595
  176    H1'    U  17           H1'        U  17  27.853  18.264  -4.653
  177    H3     U  17           H3         U  17  28.733  21.567  -7.636
  178    H5     U  17           H5         U  17  25.828  23.228  -5.074
  179    H6     U  17           H6         U  17  26.048  21.264  -3.664
  180    H5'    A  18           H5'        A  18  31.582  17.102  -1.190
  181   H5''    A  18          H5''        A  18  32.863  18.058  -0.421
  182    H4'    A  18           H4'        A  18  33.392  16.880  -2.697
  183    H3'    A  18           H3'        A  18  33.945  19.713  -1.815
  184    H2'    A  18          H2''        A  18  34.646  20.374  -3.896
  185   HO2'    A  18          H2'         A  18  35.451  17.675  -4.237
  186    H1'    A  18           H1'        A  18  33.360  18.347  -5.461
  187    H8     A  18           H8         A  18  31.033  20.770  -3.686
  188    H61    A  18           H61        A  18  31.881  24.533  -8.520
  189    H62    A  18           H62        A  18  30.911  24.211  -7.099
  190    H2     A  18           H2         A  18  34.798  21.140  -8.861
  191    H5'    A  19           H5'        A  19  38.454  17.916  -3.186
  192   H5''    A  19          H5''        A  19  39.333  19.226  -2.375
  193    H4'    A  19           H4'        A  19  39.653  18.803  -4.983
  194    H3'    A  19           H3'        A  19  39.414  21.350  -3.378
  195    H2'    A  19          H2''        A  19  39.328  22.676  -5.255
  196   HO2'    A  19          H2'         A  19  40.823  20.614  -6.507
  197    H1'    A  19           H1'        A  19  38.385  20.727  -7.119
  198    H8     A  19           H8         A  19  35.976  21.540  -4.297
  199    H61    A  19           H61        A  19  34.235  26.441  -7.630
  200    H62    A  19           H62        A  19  33.797  25.364  -6.322
  201    H2     A  19           H2         A  19  37.885  24.670  -9.551
  202    H5'    A  20           H5'        A  20  42.887  21.671  -6.309
  203   H5''    A  20          H5''        A  20  44.132  22.620  -5.476
  204    H4'    A  20           H4'        A  20  43.575  23.541  -7.740
  205    H3'    A  20           H3'        A  20  43.117  25.040  -5.161
  206    H2'    A  20          H2''        A  20  42.127  26.838  -6.231
  207   HO2'    A  20          H2'         A  20  42.761  27.562  -8.151
  208    H1'    A  20           H1'        A  20  41.071  25.481  -8.473
  209    H8     A  20           H8         A  20  40.119  24.347  -4.896
  210    H61    A  20           H61        A  20  35.476  28.401  -5.329
  211    H62    A  20           H62        A  20  36.126  27.050  -4.428
  212    H2     A  20           H2         A  20  38.079  28.878  -8.949
  213    H5'    U  21           H5'        U  21  44.792  27.942  -7.665
  214   H5''    U  21          H5''        U  21  45.840  29.022  -6.726
  215    H4'    U  21           H4'        U  21  43.881  30.214  -7.757
  216    H3'    U  21           H3'        U  21  44.414  30.010  -4.802
  217    H2'    U  21          H2''        U  21  42.431  31.058  -4.200
  218   HO2'    U  21          H2'         U  21  42.004  32.839  -5.208
  219    H1'    U  21           H1'        U  21  40.805  30.221  -6.309
  220    H3     U  21           H3         U  21  38.732  28.654  -2.605
  221    H5     U  21           H5         U  21  42.369  26.524  -2.670
  222    H6     U  21           H6         U  21  42.990  27.779  -4.651
  223    H5'    U  22           H5'        U  22  43.670  33.816  -6.507
  224   H5''    U  22          H5''        U  22  44.776  35.165  -6.177
  225    H4'    U  22           H4'        U  22  42.429  35.956  -6.177
  226    H3'    U  22           H3'        U  22  44.286  36.028  -3.873
  227    H2'    U  22          H2''        U  22  42.785  35.866  -2.183
  228   HO2'    U  22          H2'         U  22  42.249  38.107  -2.857
  229    H1'    U  22           H1'        U  22  40.327  35.542  -3.709
  230    H3     U  22           H3         U  22  39.106  32.917  -0.288
  231    H5     U  22           H5         U  22  42.937  31.454  -1.265
  232    H6     U  22           H6         U  22  43.095  33.181  -2.958
  233    H5'    A  23           H5'        A  23  45.262  38.556  -1.358
  234   H5''    A  23          H5''        A  23  44.050  37.265  -1.440
  235    H4'    A  23           H4'        A  23  44.093  38.514   0.769
  236    H3'    A  23           H3'        A  23  41.827  37.904  -0.995
  237    H2'    A  23          H2''        A  23  40.410  39.627  -0.489
  238   HO2'    A  23          H2'         A  23  39.841  39.570   1.521
  239    H1'    A  23           H1'        A  23  42.092  41.552   0.659
  240    H8     A  23           H8         A  23  43.506  40.872  -2.699
  241    H61    A  23           H61        A  23  38.948  44.239  -5.147
  242    H62    A  23           H62        A  23  40.450  43.400  -5.464
  243    H2     A  23           H2         A  23  37.798  43.219  -0.943
  244    H5'    A  24           H5'        A  24  38.889  36.062   1.945
  245   H5''    A  24          H5''        A  24  38.034  35.497   0.497
  246    H4'    A  24           H4'        A  24  37.671  37.970   1.888
  247    H3'    A  24           H3'        A  24  36.550  36.391  -0.345
  248    H2'    A  24          H2''        A  24  36.320  38.057  -1.859
  249   HO2'    A  24          H2'         A  24  35.338  40.088  -1.149
  250    H1'    A  24           H1'        A  24  37.497  40.278  -0.380
  251    H8     A  24           H8         A  24  39.930  38.005  -2.018
  252    H61    A  24           H61        A  24  38.900  41.016  -7.321
  253    H62    A  24           H62        A  24  39.822  39.746  -6.548
  254    H2     A  24           H2         A  24  35.798  42.310  -4.348
  255    H5'    U  25           H5'        U  25  33.769  34.619  -0.914
  256   H5''    U  25          H5''        U  25  34.603  36.175  -1.078
  257    H4'    U  25           H4'        U  25  31.949  35.394  -2.026
  258    H3'    U  25           H3'        U  25  34.118  36.777  -2.954
  259    H2'    U  25          H2''        U  25  33.948  38.713  -1.628
  260   HO2'    U  25          H2'         U  25  32.131  39.130  -3.779
  261    H1'    U  25           H1'        U  25  30.965  38.763  -1.799
  262    H3     U  25           H3         U  25  30.560  41.830   1.430
  263    H5     U  25           H5         U  25  34.154  39.892   2.469
  264    H6     U  25           H6         U  25  33.871  38.461   0.531
  265    H5'    U  26           H5'        U  26  35.576  37.893  -3.831
  266   H5''    U  26          H5''        U  26  34.832  38.669  -5.243
  267    H4'    U  26           H4'        U  26  37.015  38.444  -6.065
  268    H3'    U  26           H3'        U  26  35.279  36.095  -6.628
  269    H2'    U  26          H2''        U  26  36.885  34.483  -6.843
  270   HO2'    U  26          H2'         U  26  37.938  35.379  -8.579
  271    H1'    U  26           H1'        U  26  39.032  35.557  -5.432
  272    H3     U  26           H3         U  26  38.488  31.577  -3.404
  273    H5     U  26           H5         U  26  35.010  33.697  -2.337
  274    H6     U  26           H6         U  26  35.706  35.482  -3.808
  275    H5'    C  27           H5'        C  27  36.252  36.657 -11.480
  276   H5''    C  27          H5''        C  27  34.851  35.632 -11.846
  277    H4'    C  27           H4'        C  27  37.320  34.817 -12.438
  278    H3'    C  27           H3'        C  27  34.866  33.414 -11.433
  279    H2'    C  27          H2''        C  27  35.949  31.485 -10.795
  280   HO2'    C  27          H2'         C  27  37.893  32.131 -12.771
  281    H1'    C  27           H1'        C  27  38.576  32.465 -10.430
  282    H41    C  27           H41        C  27  36.658  30.555  -4.689
  283    H42    C  27           H42        C  27  35.151  31.433  -4.830
  284    H5     C  27           H5         C  27  34.500  32.610  -6.827
  285    H6     C  27           H6         C  27  35.212  33.333  -9.056
  286    H5'    U  28           H5'        U  28  35.763  31.579 -16.042
  287   H5''    U  28          H5''        U  28  34.611  30.236 -16.183
  288    H4'    U  28           H4'        U  28  37.266  29.795 -16.209
  289    H3'    U  28           H3'        U  28  35.014  28.281 -14.844
  290    H2'    U  28          H2''        U  28  36.532  26.682 -14.048
  291   HO2'    U  28          H2'         U  28  38.471  26.311 -14.919
  292    H1'    U  28           H1'        U  28  38.477  28.491 -13.280
  293    H3     U  28           H3         U  28  36.378  26.428  -9.720
  294    H5     U  28           H5         U  28  33.882  29.633 -10.810
  295    H6     U  28           H6         U  28  35.291  30.002 -12.737
  296    H5'    U  29           H5'        U  29  37.087  25.303 -17.075
  297   H5''    U  29          H5''        U  29  36.062  23.890 -17.393
  298    H4'    U  29           H4'        U  29  38.093  23.665 -15.723
  299    H3'    U  29           H3'        U  29  35.264  22.653 -15.582
  300    H2'    U  29          H2''        U  29  35.419  21.968 -13.389
  301   HO2'    U  29          H2'         U  29  38.226  21.779 -13.807
  302    H1'    U  29           H1'        U  29  37.466  23.704 -12.488
  303    H3     U  29           H3         U  29  33.791  23.628  -9.683
  304    H5     U  29           H5         U  29  32.904  26.427 -12.697
  305    H6     U  29           H6         U  29  34.892  25.693 -13.879
  306    H5'    A  30           H5'        A  30  37.037  19.649 -13.645
  307   H5''    A  30          H5''        A  30  36.850  18.161 -14.593
  308    H4'    A  30           H4'        A  30  36.035  17.505 -12.483
  309    H3'    A  30           H3'        A  30  33.856  18.508 -14.318
  310    H2'    A  30          H2''        A  30  32.251  18.365 -12.658
  311   HO2'    A  30          H2'         A  30  32.141  16.715 -11.329
  312    H1'    A  30           H1'        A  30  33.998  18.618 -10.407
  313    H8     A  30           H8         A  30  33.659  21.503 -12.955
  314    H61    A  30           H61        A  30  28.973  23.435  -9.415
  315    H62    A  30           H62        A  30  30.055  23.856 -10.723
  316    H2     A  30           H2         A  30  30.336  19.442  -7.880
  317    H5'    A  31           H5'        A  31  32.864  14.340 -12.336
  318   H5''    A  31          H5''        A  31  31.733  13.561 -13.459
  319    H4'    A  31           H4'        A  31  30.949  13.651 -11.034
  320    H3'    A  31           H3'        A  31  29.485  14.742 -13.433
  321    H2'    A  31          H2''        A  31  27.849  15.748 -12.172
  322   HO2'    A  31          H2'         A  31  26.844  14.614 -10.727
  323    H1'    A  31           H1'        A  31  29.268  15.971  -9.694
  324    H8     A  31           H8         A  31  30.409  17.873 -12.857
  325    H61    A  31           H61        A  31  26.703  22.418 -10.897
  326    H62    A  31           H62        A  31  27.994  21.991 -11.997
  327    H2     A  31           H2         A  31  26.087  18.866  -8.228
  328    H5'    A  32           H5'        A  32  26.545  11.308 -11.343
  329   H5''    A  32          H5''        A  32  25.314  11.187 -12.613
  330    H4'    A  32           H4'        A  32  24.631  11.863 -10.126
  331    H3'    A  32           H3'        A  32  23.695  12.801 -12.829
  332    H2'    A  32          H2''        A  32  22.532  14.604 -12.011
  333   HO2'    A  32          H2'         A  32  21.122  14.224 -10.520
  334    H1'    A  32           H1'        A  32  23.872  14.941  -9.518
  335    H8     A  32           H8         A  32  26.005  15.445 -12.650
  336    H61    A  32           H61        A  32  23.771  21.208 -12.803
  337    H62    A  32           H62        A  32  25.001  20.126 -13.416
  338    H2     A  32           H2         A  32  21.629  18.971  -9.557
  339    H5'    A  33           H5'        A  33  19.747  11.454 -10.152
  340   H5''    A  33          H5''        A  33  18.525  11.381 -11.436
  341    H4'    A  33           H4'        A  33  18.167  12.963  -9.324
  342    H3'    A  33           H3'        A  33  17.569  13.289 -12.251
  343    H2'    A  33          H2''        A  33  17.093  15.542 -12.110
  344   HO2'    A  33          H2'         A  33  16.507  15.053  -9.371
  345    H1'    A  33           H1'        A  33  18.670  16.254  -9.896
  346    H8     A  33           H8         A  33  20.633  14.544 -12.674
  347    H61    A  33           H61        A  33  20.929  20.081 -15.400
  348    H62    A  33           H62        A  33  21.623  18.478 -15.328
  349    H2     A  33           H2         A  33  18.068  20.375 -11.957
  350    H5'    A  34           H5'        A  34  14.265  14.898  -9.828
  351   H5''    A  34          H5''        A  34  12.702  14.527 -10.583
  352    H4'    A  34           H4'        A  34  13.052  16.988 -10.059
  353    H3'    A  34           H3'        A  34  12.404  15.764 -12.720
  354    H2'    A  34          H2''        A  34  12.863  17.653 -13.951
  355   HO2'    A  34          H2'         A  34  12.129  19.155 -11.646
  356    H1'    A  34           H1'        A  34  14.486  19.081 -12.078
  357    H8     A  34           H8         A  34  15.812  15.771 -13.529
  358    H61    A  34           H61        A  34  18.512  19.308 -17.818
  359    H62    A  34           H62        A  34  18.534  17.752 -17.018
  360    H2     A  34           H2         A  34  15.624  21.860 -15.521
  361    H5'    C  35           H5'        C  35   8.492  17.022 -13.849
  362   H5''    C  35          H5''        C  35   8.772  15.773 -15.081
  363    H4'    C  35           H4'        C  35  10.003  18.447 -14.808
  364    H3'    C  35           H3'        C  35   8.959  16.672 -16.805
  365    H2'    C  35          H2''        C  35  10.921  15.587 -17.366
  366   HO2'    C  35          H2'         C  35  10.571  17.355 -19.001
  367    H1'    C  35           H1'        C  35  12.687  17.829 -16.483
  368    H41    C  35           H41        C  35  16.801  12.984 -16.584
  369    H42    C  35           H42        C  35  15.714  11.981 -15.650
  370    H5     C  35           H5         C  35  13.497  12.676 -15.015
  371    H6     C  35           H6         C  35  11.862  14.498 -15.093
  372    H5'    U  36           H5'        U  36   8.943  20.623 -15.413
  373   H5''    U  36          H5''        U  36   7.476  21.577 -15.712
  374    H4'    U  36           H4'        U  36   8.926  23.350 -15.456
  375    H3'    U  36           H3'        U  36   9.054  22.320 -18.271
  376    H2'    U  36          H2''        U  36  11.001  23.384 -18.809
  377   HO2'    U  36          H2'         U  36  10.088  25.455 -18.394
  378    H1'    U  36           H1'        U  36  12.041  23.829 -16.180
  379    H3     U  36           H3         U  36  15.002  22.274 -19.510
  380    H5     U  36           H5         U  36  13.814  19.055 -17.096
  381    H6     U  36           H6         U  36  12.018  20.437 -16.227
  382    H5'    A  37           H5'        A  37   7.616  26.714 -19.420
  383   H5''    A  37          H5''        A  37   6.554  26.268 -20.771
  384    H4'    A  37           H4'        A  37   8.526  27.781 -21.390
  385    H3'    A  37           H3'        A  37   7.950  25.056 -22.558
  386    H2'    A  37          H2''        A  37   9.741  25.193 -24.009
  387   HO2'    A  37          H2'         A  37   9.646  27.146 -24.933
  388    H1'    A  37           H1'        A  37  11.514  26.485 -22.223
  389    H8     A  37           H8         A  37   9.694  23.577 -20.582
  390    H61    A  37           H61        A  37  14.006  19.925 -23.083
  391    H62    A  37           H62        A  37  12.780  20.058 -21.842
  392    H2     A  37           H2         A  37  14.432  24.014 -24.881
  393    H5'    C  38           H5'        C  38   7.775  27.950 -26.375
  394   H5''    C  38          H5''        C  38   6.932  26.888 -27.518
  395    H4'    C  38           H4'        C  38   9.401  27.716 -28.035
  396    H3'    C  38           H3'        C  38   8.044  25.054 -28.416
  397    H2'    C  38          H2''        C  38   9.993  23.978 -29.044
  398   HO2'    C  38          H2'         C  38  11.018  26.550 -29.696
  399    H1'    C  38           H1'        C  38  11.854  25.492 -27.586
  400    H41    C  38           H41        C  38  11.502  19.691 -24.960
  401    H42    C  38           H42        C  38   9.938  20.067 -24.274
  402    H5     C  38           H5         C  38   8.842  22.194 -24.584
  403    H6     C  38           H6         C  38   8.927  24.342 -25.742
  404    H5'    A  39           H5'        A  39   8.768  25.811 -32.952
  405   H5''    A  39          H5''        A  39   7.651  24.612 -33.633
  406    H4'    A  39           H4'        A  39  10.292  24.218 -33.720
  407    H3'    A  39           H3'        A  39   7.975  22.358 -33.250
  408    H2'    A  39          H2''        A  39   9.315  20.612 -32.592
  409   HO2'    A  39          H2'         A  39  11.335  21.774 -34.223
  410    H1'    A  39           H1'        A  39  11.644  22.096 -31.823
  411    H8     A  39           H8         A  39   8.513  22.680 -29.723
  412    H61    A  39           H61        A  39  10.184  17.655 -26.526
  413    H62    A  39           H62        A  39   9.164  19.076 -26.541
  414    H2     A  39           H2         A  39  12.829  17.952 -30.136
  415    H5'    A  40           H5'        A  40  10.263  21.373 -37.323
  416   H5''    A  40          H5''        A  40   9.256  20.343 -38.360
  417    H4'    A  40           H4'        A  40  11.530  19.341 -37.889
  418    H3'    A  40           H3'        A  40   8.929  18.105 -36.903
  419    H2'    A  40          H2''        A  40  10.057  16.307 -35.947
  420   HO2'    A  40          H2'         A  40  12.313  17.042 -37.520
  421    H1'    A  40           H1'        A  40  12.336  17.701 -35.135
  422    H8     A  40           H8         A  40   8.947  19.331 -34.301
  423    H61    A  40           H61        A  40   9.157  16.054 -29.063
  424    H62    A  40           H62        A  40   8.380  17.377 -29.902
  425    H2     A  40           H2         A  40  12.577  14.751 -31.655
  426    H5'    U  41           H5'        U  41  10.065  14.744 -39.883
  427   H5''    U  41          H5''        U  41   8.626  13.706 -39.843
  428    H4'    U  41           H4'        U  41  10.906  13.008 -38.585
  429    H3'    U  41           H3'        U  41   7.984  12.657 -37.846
  430    H2'    U  41          H2''        U  41   8.527  11.827 -35.739
  431   HO2'    U  41          H2'         U  41  11.009  11.071 -36.905
  432    H1'    U  41           H1'        U  41  11.017  13.122 -35.400
  433    H3     U  41           H3         U  41   8.347  13.666 -31.713
  434    H5     U  41           H5         U  41   6.753  16.279 -34.612
  435    H6     U  41           H6         U  41   8.331  15.362 -36.210
  436    H5'    C  42           H5'        C  42   9.972   8.217 -38.025
  437   H5''    C  42          H5''        C  42   8.515   7.226 -38.235
  438    H4'    C  42           H4'        C  42  10.028   6.577 -36.269
  439    H3'    C  42           H3'        C  42   7.083   7.239 -36.155
  440    H2'    C  42          H2''        C  42   7.003   7.009 -33.837
  441   HO2'    C  42          H2'         C  42   9.420   5.524 -34.073
  442    H1'    C  42           H1'        C  42   9.567   7.919 -33.220
  443    H41    C  42           H41        C  42   5.480  12.494 -31.539
  444    H42    C  42           H42        C  42   5.134  12.854 -33.213
  445    H5     C  42           H5         C  42   6.158  11.678 -35.053
  446    H6     C  42           H6         C  42   7.627   9.824 -35.678
  447    H5'    A  43           H5'        A  43   6.182   2.725 -35.348
  448   H5''    A  43          H5''        A  43   4.449   2.824 -35.714
  449    H4'    A  43           H4'        A  43   5.322   2.646 -33.185
  450    H3'    A  43           H3'        A  43   3.078   4.244 -34.438
  451    H2'    A  43          H2''        A  43   2.572   5.287 -32.439
  452   HO2'    A  43          H2'         A  43   2.389   3.386 -31.197
  453    H1'    A  43           H1'        A  43   5.169   5.347 -31.340
  454    H8     A  43           H8         A  43   5.148   6.950 -34.753
  455    H61    A  43           H61        A  43   2.560  11.897 -32.081
  456    H62    A  43           H62        A  43   3.417  11.309 -33.489
  457    H2     A  43           H2         A  43   2.636   8.565 -29.078
  458    H5'    G  44           H5'        G  44   0.904   0.960 -31.081
  459   H5''    G  44          H5''        G  44  -0.731   1.264 -31.699
  460    H4'    G  44           H4'        G  44  -0.196   1.503 -29.097
  461    H3'    G  44           H3'        G  44  -1.908   3.150 -30.963
  462    H2'    G  44          H2''        G  44  -2.412   4.719 -29.313
  463   HO2'    G  44          H2'         G  44  -2.952   3.149 -27.703
  464    H1'    G  44           H1'        G  44   0.061   4.775 -28.032
  465    H8     G  44           H8         G  44   1.014   4.986 -31.562
  466    H1     G  44           H1         G  44  -1.937  10.309 -29.562
  467    H21    G  44           H21        G  44  -2.886   9.962 -27.605
  468    H22    G  44           H22        G  44  -2.955   8.376 -26.869
  469    H5'    C  45           H5'        C  45  -5.523   2.426 -28.411
  470   H5''    C  45          H5''        C  45  -6.716   2.617 -29.710
  471    H4'    C  45           H4'        C  45  -6.444   4.489 -27.833
  472    H3'    C  45           H3'        C  45  -6.810   4.759 -30.832
  473    H2'    C  45          H2''        C  45  -6.826   7.078 -30.654
  474   HO2'    C  45          H2'         C  45  -8.330   7.261 -28.978
  475    H1'    C  45           H1'        C  45  -4.966   7.288 -28.565
  476    H41    C  45           H41        C  45  -2.465   9.241 -34.115
  477    H42    C  45           H42        C  45  -2.119   7.586 -34.557
  478    H5     C  45           H5         C  45  -2.675   5.700 -33.147
  479    H6     C  45           H6         C  45  -3.794   4.998 -31.088
  480    H5'    U  46           H5'        U  46 -10.431   7.219 -29.185
  481   H5''    U  46          H5''        U  46 -11.622   6.875 -30.453
  482    H4'    U  46           H4'        U  46 -11.044   9.365 -30.022
  483    H3'    U  46           H3'        U  46 -11.125   7.847 -32.620
  484    H2'    U  46          H2''        U  46 -10.192   9.553 -33.857
  485   HO2'    U  46          H2'         U  46 -11.488  11.231 -33.598
  486    H1'    U  46           H1'        U  46  -8.751  10.899 -31.831
  487    H3     U  46           H3         U  46  -5.965  10.246 -35.366
  488    H5     U  46           H5         U  46  -6.397   6.423 -33.649
  489    H6     U  46           H6         U  46  -8.074   7.353 -32.158
  490    H5'    C  47           H5'        C  47 -13.996  11.817 -33.442
  491   H5''    C  47          H5''        C  47 -15.000  11.000 -34.656
  492    H4'    C  47           H4'        C  47 -13.937  13.196 -35.427
  493    H3'    C  47           H3'        C  47 -13.480  10.509 -36.752
  494    H2'    C  47          H2''        C  47 -12.302  11.540 -38.475
  495   HO2'    C  47          H2'         C  47 -13.302  14.009 -37.470
  496    H1'    C  47           H1'        C  47 -10.937  13.368 -36.812
  497    H41    C  47           H41        C  47  -6.661   8.863 -37.923
  498    H42    C  47           H42        C  47  -7.517   7.729 -36.906
  499    H5     C  47           H5         C  47  -9.524   8.316 -35.693
  500    H6     C  47           H6         C  47 -11.358   9.941 -35.543
  501    H5'    C  48           H5'        C  48 -14.183  13.383 -39.891
  502   H5''    C  48          H5''        C  48 -15.372  12.651 -40.986
  503    H4'    C  48           H4'        C  48 -13.386  13.446 -42.239
  504    H3'    C  48           H3'        C  48 -14.012  10.506 -41.980
  505   HO3'    C  48          H3T         C  48 -15.313  11.970 -43.243
  506    H2'    C  48          H2''        C  48 -12.107   9.869 -43.111
  507   HO2'    C  48          H2'         C  48 -12.633  11.144 -44.971
  508    H1'    C  48           H1'        C  48 -10.506  12.155 -42.526
  509    H41    C  48           H41        C  48  -7.705   7.071 -39.904
  510    H42    C  48           H42        C  48  -9.078   6.811 -38.856
  511    H5     C  48           H5         C  48 -10.983   8.270 -38.800
  512    H6     C  48           H6         C  48 -12.100  10.154 -39.891
  Start of MODEL    8
    1    H5'    G   1           H5'        G   1  -3.615   6.968 -47.505
    2   H5''    G   1          H5''        G   1  -2.532   8.169 -46.772
    3    H4'    G   1           H4'        G   1  -4.697   9.177 -47.557
    4    H3'    G   1           H3'        G   1  -3.683   9.153 -44.735
    5    H2'    G   1          H2''        G   1  -5.624   9.792 -43.764
    6   HO2'    G   1          H2'         G   1  -6.900  11.366 -44.558
    7    H1'    G   1           H1'        G   1  -7.480   9.138 -45.849
    8    H8     G   1           H8         G   1  -5.752   6.142 -44.272
    9    H1     G   1           H1         G   1 -10.742   8.375 -40.918
   10    H21    G   1           H21        G   1 -11.369  10.334 -41.712
   11    H22    G   1           H22        G   1 -10.667  11.025 -43.157
   12   HO5'    G   1          H5T         G   1  -4.116   7.163 -44.876
   13    H5'    G   2           H5'        G   2  -4.259  14.306 -45.436
   14   H5''    G   2          H5''        G   2  -3.514  14.548 -43.845
   15    H4'    G   2           H4'        G   2  -5.968  15.488 -44.392
   16    H3'    G   2           H3'        G   2  -4.779  14.259 -41.894
   17    H2'    G   2          H2''        G   2  -6.831  14.350 -40.769
   18   HO2'    G   2          H2'         G   2  -7.558  16.375 -41.153
   19    H1'    G   2           H1'        G   2  -8.470  13.624 -42.857
   20    H8     G   2           H8         G   2  -5.378  11.468 -42.908
   21    H1     G   2           H1         G   2  -9.563   9.855 -38.327
   22    H21    G   2           H21        G   2 -11.144  11.392 -38.184
   23    H22    G   2           H22        G   2 -11.058  12.900 -39.064
   24    H5'    G   3           H5'        G   3  -5.842  18.642 -40.061
   25   H5''    G   3          H5''        G   3  -4.965  18.433 -38.533
   26    H4'    G   3           H4'        G   3  -7.642  18.691 -38.596
   27    H3'    G   3           H3'        G   3  -5.904  16.859 -36.905
   28    H2'    G   3          H2''        G   3  -7.835  16.208 -35.708
   29   HO2'    G   3          H2'         G   3  -9.506  17.477 -35.502
   30    H1'    G   3           H1'        G   3  -9.384  15.860 -37.997
   31    H8     G   3           H8         G   3  -6.167  14.495 -39.096
   32    H1     G   3           H1         G   3  -8.866  10.788 -34.611
   33    H21    G   3           H21        G   3 -10.494  11.879 -33.602
   34    H22    G   3           H22        G   3 -10.820  13.570 -33.912
   35    H5'    G   4           H5'        G   4  -7.653  18.507 -34.153
   36   H5''    G   4          H5''        G   4  -6.827  19.441 -32.891
   37    H4'    G   4           H4'        G   4  -7.946  17.756 -31.662
   38    H3'    G   4           H3'        G   4  -5.079  17.087 -32.341
   39    H2'    G   4          H2''        G   4  -5.220  14.996 -31.369
   40   HO2'    G   4          H2'         G   4  -6.217  14.764 -29.545
   41    H1'    G   4           H1'        G   4  -7.881  14.426 -32.007
   42    H8     G   4           H8         G   4  -5.802  15.645 -34.988
   43    H1     G   4           H1         G   4  -4.841   9.494 -33.435
   44    H21    G   4           H21        G   4  -5.901   9.036 -31.544
   45    H22    G   4           H22        G   4  -6.667  10.276 -30.580
   46    H5'    U   5           H5'        U   5  -5.470  16.546 -27.535
   47   H5''    U   5          H5''        U   5  -3.746  16.591 -27.120
   48    H4'    U   5           H4'        U   5  -5.213  14.447 -26.547
   49    H3'    U   5           H3'        U   5  -2.402  14.735 -27.608
   50    H2'    U   5          H2''        U   5  -2.143  12.447 -27.903
   51   HO2'    U   5          H2'         U   5  -2.861  11.067 -26.485
   52    H1'    U   5           H1'        U   5  -4.796  11.770 -28.494
   53    H3     U   5           H3         U   5  -1.996  10.370 -31.836
   54    H5     U   5           H5         U   5  -2.421  14.521 -32.440
   55    H6     U   5           H6         U   5  -3.710  14.615 -30.384
   56    H5'    U   6           H5'        U   6  -2.613  11.823 -24.518
   57   H5''    U   6          H5''        U   6  -1.466  12.167 -23.210
   58    H4'    U   6           H4'        U   6  -1.296   9.809 -23.615
   59    H3'    U   6           H3'        U   6   0.873  11.526 -24.847
   60    H2'    U   6          H2''        U   6   1.925   9.648 -25.769
   61   HO2'    U   6          H2'         U   6   0.298   8.038 -24.076
   62    H1'    U   6           H1'        U   6  -0.368   8.236 -26.465
   63    H3     U   6           H3         U   6   1.692   9.265 -30.391
   64    H5     U   6           H5         U   6   0.165  12.949 -29.037
   65    H6     U   6           H6         U   6  -0.522  11.840 -26.994
   66    H5'    G   7           H5'        G   7   3.683   9.767 -21.499
   67   H5''    G   7          H5''        G   7   5.071  10.845 -21.747
   68    H4'    G   7           H4'        G   7   5.110   8.288 -22.580
   69    H3'    G   7           H3'        G   7   6.223  10.830 -23.796
   70    H2'    G   7          H2''        G   7   6.910   9.707 -25.715
   71   HO2'    G   7          H2'         G   7   6.713   7.290 -24.220
   72    H1'    G   7           H1'        G   7   4.866   7.773 -25.809
   73    H8     G   7           H8         G   7   3.254  11.140 -25.643
   74    H1     G   7           H1         G   7   6.089  10.020 -31.290
   75    H21    G   7           H21        G   7   7.436   8.284 -31.124
   76    H22    G   7           H22        G   7   7.547   7.319 -29.669
   77    H5'    G   8           H5'        G   8   9.779   7.578 -23.231
   78   H5''    G   8          H5''        G   8  11.201   8.638 -23.198
   79    H4'    G   8           H4'        G   8  11.251   6.656 -24.863
   80    H3'    G   8           H3'        G   8  11.716   9.578 -25.525
   81    H2'    G   8          H2''        G   8  12.205   9.005 -27.764
   82   HO2'    G   8          H2'         G   8  13.464   7.048 -26.888
   83    H1'    G   8           H1'        G   8  10.256   7.052 -28.031
   84    H8     G   8           H8         G   8   8.633   9.956 -26.329
   85    H1     G   8           H1         G   8   9.917  11.143 -32.495
   86    H21    G   8           H21        G   8  11.261   9.597 -33.301
   87    H22    G   8           H22        G   8  11.963   8.350 -32.295
   88    H5'    U   9           H5'        U   9  15.175   8.177 -26.645
   89   H5''    U   9          H5''        U   9  16.669   8.855 -25.964
   90    H4'    U   9           H4'        U   9  16.767   9.225 -28.348
   91    H3'    U   9           H3'        U   9  16.168  11.522 -26.511
   92    H2'    U   9          H2''        U   9  15.520  12.972 -28.163
   93   HO2'    U   9          H2'         U   9  17.037  13.292 -29.566
   94    H1'    U   9           H1'        U   9  14.870  11.111 -30.225
   95    H3     U   9           H3         U   9  11.553  14.229 -30.087
   96    H5     U   9           H5         U   9  10.831  11.737 -26.779
   97    H6     U   9           H6         U   9  13.015  10.723 -27.142
   98    H5'    G  10           H5'        G  10  19.082  12.666 -29.486
   99   H5''    G  10          H5''        G  10  20.552  13.350 -28.765
  100    H4'    G  10           H4'        G  10  19.801  14.712 -30.697
  101    H3'    G  10           H3'        G  10  19.844  15.707 -27.865
  102    H2'    G  10          H2''        G  10  18.666  17.625 -28.283
  103   HO2'    G  10          H2'         G  10  19.813  17.466 -30.868
  104    H1'    G  10           H1'        G  10  17.289  16.878 -30.647
  105    H8     G  10           H8         G  10  16.371  14.659 -27.742
  106    H1     G  10           H1         G  10  13.587  20.431 -27.486
  107    H21    G  10           H21        G  10  14.538  21.796 -28.935
  108    H22    G  10           H22        G  10  15.794  21.272 -30.033
  109    H5'    U  11           H5'        U  11  22.787  19.221 -30.091
  110   H5''    U  11          H5''        U  11  23.420  19.701 -28.505
  111    H4'    U  11           H4'        U  11  22.201  21.480 -30.067
  112    H3'    U  11           H3'        U  11  22.107  21.012 -27.086
  113    H2'    U  11          H2''        U  11  20.449  22.605 -26.758
  114   HO2'    U  11          H2'         U  11  21.436  24.314 -27.824
  115    H1'    U  11           H1'        U  11  19.069  22.324 -29.167
  116    H3     U  11           H3         U  11  16.203  21.567 -25.688
  117    H5     U  11           H5         U  11  18.401  17.997 -26.084
  118    H6     U  11           H6         U  11  19.848  19.139 -27.665
  119    H5'    A  12           H5'        A  12  24.076  25.349 -27.095
  120   H5''    A  12          H5''        A  12  24.412  25.564 -25.367
  121    H4'    A  12           H4'        A  12  22.436  26.917 -26.578
  122    H3'    A  12           H3'        A  12  22.682  25.675 -23.834
  123    H2'    A  12          H2''        A  12  20.463  26.186 -23.281
  124   HO2'    A  12          H2'         A  12  20.495  28.349 -24.032
  125    H1'    A  12           H1'        A  12  19.297  25.590 -25.702
  126    H8     A  12           H8         A  12  21.770  22.845 -25.141
  127    H61    A  12           H61        A  12  17.843  20.504 -20.977
  128    H62    A  12           H62        A  12  19.242  20.182 -21.976
  129    H2     A  12           H2         A  12  16.473  24.647 -22.009
  130    H5'    U  13           H5'        U  13  21.264  29.735 -22.446
  131   H5''    U  13          H5''        U  13  22.016  29.791 -20.841
  132    H4'    U  13           H4'        U  13  19.384  29.719 -21.050
  133    H3'    U  13           H3'        U  13  21.252  28.225 -19.197
  134    H2'    U  13          H2''        U  13  19.486  27.005 -18.260
  135   HO2'    U  13          H2'         U  13  17.685  27.954 -17.773
  136    H1'    U  13           H1'        U  13  17.783  26.937 -20.476
  137    H3     U  13           H3         U  13  18.717  22.763 -18.676
  138    H5     U  13           H5         U  13  21.904  23.655 -21.283
  139    H6     U  13           H6         U  13  21.024  25.896 -21.497
  140    H5'    U  14           H5'        U  14  18.196  29.805 -16.974
  141   H5''    U  14          H5''        U  14  18.678  30.998 -15.750
  142    H4'    U  14           H4'        U  14  17.107  29.550 -14.651
  143    H3'    U  14           H3'        U  14  20.024  29.287 -14.068
  144    H2'    U  14          H2''        U  14  19.939  27.227 -13.081
  145   HO2'    U  14          H2'         U  14  17.289  27.928 -12.341
  146    H1'    U  14           H1'        U  14  17.560  26.177 -14.138
  147    H3     U  14           H3         U  14  20.508  22.893 -15.028
  148    H5     U  14           H5         U  14  21.894  26.114 -17.363
  149    H6     U  14           H6         U  14  20.213  27.512 -16.314
  150    H5'    U  15           H5'        U  15  17.657  29.215  -9.730
  151   H5''    U  15          H5''        U  15  19.035  29.494  -8.647
  152    H4'    U  15           H4'        U  15  17.573  27.279  -8.421
  153    H3'    U  15           H3'        U  15  20.515  27.826  -8.184
  154    H2'    U  15          H2''        U  15  21.150  25.627  -8.266
  155   HO2'    U  15          H2'         U  15  20.271  24.328  -6.888
  156    H1'    U  15           H1'        U  15  18.886  24.492  -9.554
  157    H3     U  15           H3         U  15  22.576  22.783 -11.592
  158    H5     U  15           H5         U  15  22.399  26.783 -12.898
  159    H6     U  15           H6         U  15  20.611  27.157 -11.307
  160    H5'    U  16           H5'        U  16  19.195  24.952  -4.711
  161   H5''    U  16          H5''        U  16  20.189  25.495  -3.345
  162    H4'    U  16           H4'        U  16  20.314  23.000  -3.780
  163    H3'    U  16           H3'        U  16  22.600  24.942  -3.727
  164    H2'    U  16          H2''        U  16  24.143  23.507  -4.618
  165   HO2'    U  16          H2'         U  16  24.374  21.742  -3.524
  166    H1'    U  16           H1'        U  16  22.443  21.671  -5.950
  167    H3     U  16           H3         U  16  25.609  22.718  -9.012
  168    H5     U  16           H5         U  16  23.453  26.304  -8.513
  169    H6     U  16           H6         U  16  22.240  25.246  -6.699
  170    H5'    U  17           H5'        U  17  23.994  21.207  -0.640
  171   H5''    U  17          H5''        U  17  25.307  22.131   0.114
  172    H4'    U  17           H4'        U  17  25.822  19.830  -1.121
  173    H3'    U  17           H3'        U  17  27.292  22.451  -0.991
  174    H2'    U  17          H2''        U  17  28.762  21.933  -2.673
  175   HO2'    U  17          H2'         U  17  28.361  19.227  -1.907
  176    H1'    U  17           H1'        U  17  27.258  19.942  -4.042
  177    H3     U  17           H3         U  17  28.912  22.762  -7.193
  178    H5     U  17           H5         U  17  25.962  25.027  -5.212
  179    H6     U  17           H6         U  17  25.758  23.225  -3.600
  180    H5'    A  18           H5'        A  18  30.204  18.707  -0.157
  181   H5''    A  18          H5''        A  18  31.507  19.431   0.804
  182    H4'    A  18           H4'        A  18  32.228  18.068  -1.264
  183    H3'    A  18           H3'        A  18  33.014  20.882  -0.518
  184    H2'    A  18          H2''        A  18  34.072  21.286  -2.509
  185   HO2'    A  18          H2'         A  18  35.640  19.898  -2.750
  186    H1'    A  18           H1'        A  18  32.795  19.296  -4.121
  187    H8     A  18           H8         A  18  30.592  22.117  -2.812
  188    H61    A  18           H61        A  18  32.286  25.227  -7.874
  189    H62    A  18           H62        A  18  31.293  25.257  -6.434
  190    H2     A  18           H2         A  18  34.885  21.583  -7.541
  191    H5'    A  19           H5'        A  19  37.329  18.371  -1.131
  192   H5''    A  19          H5''        A  19  38.325  19.599  -0.327
  193    H4'    A  19           H4'        A  19  38.850  18.878  -2.832
  194    H3'    A  19           H3'        A  19  38.857  21.567  -1.465
  195    H2'    A  19          H2''        A  19  39.152  22.732  -3.426
  196   HO2'    A  19          H2'         A  19  40.400  20.370  -4.391
  197    H1'    A  19           H1'        A  19  38.086  20.823  -5.252
  198    H8     A  19           H8         A  19  35.645  22.161  -2.650
  199    H61    A  19           H61        A  19  34.695  26.900  -6.490
  200    H62    A  19           H62        A  19  34.124  26.058  -5.067
  201    H2     A  19           H2         A  19  38.222  24.566  -8.001
  202    H5'    A  20           H5'        A  20  42.617  21.153  -3.975
  203   H5''    A  20          H5''        A  20  43.892  22.032  -3.109
  204    H4'    A  20           H4'        A  20  43.624  22.797  -5.488
  205    H3'    A  20           H3'        A  20  43.187  24.556  -3.077
  206    H2'    A  20          H2''        A  20  42.507  26.367  -4.354
  207   HO2'    A  20          H2'         A  20  43.258  26.787  -6.345
  208    H1'    A  20           H1'        A  20  41.366  24.986  -6.517
  209    H8     A  20           H8         A  20  40.252  24.229  -2.876
  210    H61    A  20           H61        A  20  35.973  28.594  -3.766
  211    H62    A  20           H62        A  20  36.501  27.285  -2.733
  212    H2     A  20           H2         A  20  38.671  28.549  -7.347
  213    H5'    U  21           H5'        U  21  45.240  27.064  -5.543
  214   H5''    U  21          H5''        U  21  46.303  28.145  -4.620
  215    H4'    U  21           H4'        U  21  44.445  29.378  -5.770
  216    H3'    U  21           H3'        U  21  44.850  29.266  -2.792
  217    H2'    U  21          H2''        U  21  42.881  30.391  -2.296
  218   HO2'    U  21          H2'         U  21  42.954  32.205  -3.452
  219    H1'    U  21           H1'        U  21  41.296  29.534  -4.423
  220    H3     U  21           H3         U  21  39.086  28.106  -0.741
  221    H5     U  21           H5         U  21  42.674  25.895  -0.648
  222    H6     U  21           H6         U  21  43.376  27.082  -2.643
  223    H5'    U  22           H5'        U  22  44.705  32.970  -4.755
  224   H5''    U  22          H5''        U  22  45.830  34.326  -4.543
  225    H4'    U  22           H4'        U  22  43.537  35.197  -4.630
  226    H3'    U  22           H3'        U  22  45.286  35.326  -2.247
  227    H2'    U  22          H2''        U  22  43.699  35.270  -0.627
  228   HO2'    U  22          H2'         U  22  43.292  37.496  -1.327
  229    H1'    U  22           H1'        U  22  41.311  34.994  -2.281
  230    H3     U  22           H3         U  22  39.776  32.646   1.222
  231    H5     U  22           H5         U  22  43.552  30.911   0.512
  232    H6     U  22           H6         U  22  43.880  32.513  -1.276
  233    H5'    A  23           H5'        A  23  46.330  37.856   0.150
  234   H5''    A  23          H5''        A  23  45.097  36.583   0.073
  235    H4'    A  23           H4'        A  23  45.140  37.848   2.269
  236    H3'    A  23           H3'        A  23  42.883  37.267   0.495
  237    H2'    A  23          H2''        A  23  41.508  39.038   0.932
  238   HO2'    A  23          H2'         A  23  41.153  38.435   3.063
  239    H1'    A  23           H1'        A  23  43.207  40.930   2.112
  240    H8     A  23           H8         A  23  44.679  40.220  -1.212
  241    H61    A  23           H61        A  23  40.196  43.597  -3.785
  242    H62    A  23           H62        A  23  41.783  42.897  -4.011
  243    H2     A  23           H2         A  23  38.982  42.680   0.421
  244    H5'    A  24           H5'        A  24  39.921  35.427   3.457
  245   H5''    A  24          H5''        A  24  39.066  34.868   2.007
  246    H4'    A  24           H4'        A  24  38.694  37.331   3.414
  247    H3'    A  24           H3'        A  24  37.591  35.772   1.152
  248    H2'    A  24          H2''        A  24  37.345  37.466  -0.328
  249   HO2'    A  24          H2'         A  24  36.376  39.500   0.468
  250    H1'    A  24           H1'        A  24  38.509  39.660   1.209
  251    H8     A  24           H8         A  24  40.949  37.457  -0.522
  252    H61    A  24           H61        A  24  39.843  40.623  -5.719
  253    H62    A  24           H62        A  24  40.837  39.396  -4.967
  254    H2     A  24           H2         A  24  36.779  41.819  -2.669
  255    H5'    U  25           H5'        U  25  34.716  34.074   0.515
  256   H5''    U  25          H5''        U  25  35.570  35.625   0.400
  257    H4'    U  25           H4'        U  25  32.894  34.923  -0.536
  258    H3'    U  25           H3'        U  25  35.059  36.341  -1.419
  259    H2'    U  25          H2''        U  25  34.924  38.210  -0.002
  260   HO2'    U  25          H2'         U  25  34.145  39.845  -1.187
  261    H1'    U  25           H1'        U  25  31.940  38.291  -0.092
  262    H3     U  25           H3         U  25  31.620  41.110   3.365
  263    H5     U  25           H5         U  25  35.273  39.153   4.127
  264    H6     U  25           H6         U  25  34.927  37.851   2.111
  265    H5'    U  26           H5'        U  26  36.484  37.504  -2.247
  266   H5''    U  26          H5''        U  26  35.725  38.336  -3.619
  267    H4'    U  26           H4'        U  26  37.905  38.174  -4.462
  268    H3'    U  26           H3'        U  26  36.196  35.831  -5.122
  269    H2'    U  26          H2''        U  26  37.824  34.252  -5.418
  270   HO2'    U  26          H2'         U  26  38.941  35.072  -7.077
  271    H1'    U  26           H1'        U  26  39.958  35.278  -3.962
  272    H3     U  26           H3         U  26  39.445  31.212  -2.108
  273    H5     U  26           H5         U  26  35.953  33.256  -0.946
  274    H6     U  26           H6         U  26  36.630  35.107  -2.344
  275    H5'    C  27           H5'        C  27  37.170  36.620  -9.975
  276   H5''    C  27          H5''        C  27  35.783  35.584 -10.365
  277    H4'    C  27           H4'        C  27  38.256  34.851 -11.042
  278    H3'    C  27           H3'        C  27  35.842  33.365 -10.077
  279    H2'    C  27          H2''        C  27  36.949  31.428  -9.502
  280   HO2'    C  27          H2'         C  27  37.819  31.393 -11.759
  281    H1'    C  27           H1'        C  27  39.550  32.405  -9.067
  282    H41    C  27           H41        C  27  37.448  30.406  -3.416
  283    H42    C  27           H42        C  27  35.970  31.328  -3.570
  284    H5     C  27           H5         C  27  35.395  32.567  -5.552
  285    H6     C  27           H6         C  27  36.177  33.321  -7.747
  286    H5'    U  28           H5'        U  28  36.780  31.654 -14.726
  287   H5''    U  28          H5''        U  28  35.617  30.326 -14.913
  288    H4'    U  28           H4'        U  28  38.265  29.854 -14.921
  289    H3'    U  28           H3'        U  28  35.979  28.348 -13.609
  290    H2'    U  28          H2''        U  28  37.457  26.715 -12.810
  291   HO2'    U  28          H2'         U  28  39.482  27.893 -14.439
  292    H1'    U  28           H1'        U  28  39.408  28.478 -11.971
  293    H3     U  28           H3         U  28  37.127  26.422  -8.502
  294    H5     U  28           H5         U  28  34.796  29.736  -9.621
  295    H6     U  28           H6         U  28  36.274  30.077 -11.494
  296    H5'    U  29           H5'        U  29  37.856  25.229 -15.982
  297   H5''    U  29          H5''        U  29  36.702  23.897 -16.193
  298    H4'    U  29           H4'        U  29  38.801  23.600 -14.594
  299    H3'    U  29           H3'        U  29  35.929  22.741 -14.364
  300    H2'    U  29          H2''        U  29  36.096  22.085 -12.157
  301   HO2'    U  29          H2'         U  29  38.903  21.856 -12.573
  302    H1'    U  29           H1'        U  29  38.142  23.802 -11.288
  303    H3     U  29           H3         U  29  34.324  24.015  -8.682
  304    H5     U  29           H5         U  29  33.720  26.699 -11.866
  305    H6     U  29           H6         U  29  35.736  25.830 -12.900
  306    H5'    A  30           H5'        A  30  37.401  19.775 -12.365
  307   H5''    A  30          H5''        A  30  37.169  18.252 -13.245
  308    H4'    A  30           H4'        A  30  36.233  17.755 -11.142
  309    H3'    A  30           H3'        A  30  34.199  18.758 -13.134
  310    H2'    A  30          H2''        A  30  32.511  18.830 -11.557
  311   HO2'    A  30          H2'         A  30  32.205  17.202 -10.270
  312    H1'    A  30           H1'        A  30  34.132  19.154  -9.233
  313    H8     A  30           H8         A  30  34.220  21.835 -12.008
  314    H61    A  30           H61        A  30  29.452  24.407  -9.032
  315    H62    A  30           H62        A  30  30.663  24.633 -10.275
  316    H2     A  30           H2         A  30  30.348  20.464  -7.089
  317    H5'    A  31           H5'        A  31  32.679  14.741 -11.081
  318   H5''    A  31          H5''        A  31  31.519  14.112 -12.266
  319    H4'    A  31           H4'        A  31  30.652  14.450  -9.853
  320    H3'    A  31           H3'        A  31  29.443  15.441 -12.432
  321    H2'    A  31          H2''        A  31  27.838  16.699 -11.373
  322   HO2'    A  31          H2'         A  31  26.637  15.720  -9.974
  323    H1'    A  31           H1'        A  31  29.130  17.026  -8.837
  324    H8     A  31           H8         A  31  30.651  18.519 -12.054
  325    H61    A  31           H61        A  31  27.241  23.524 -10.809
  326    H62    A  31           H62        A  31  28.570  22.890 -11.753
  327    H2     A  31           H2         A  31  26.117  20.310  -7.889
  328    H5'    A  32           H5'        A  32  26.084  12.522 -10.314
  329   H5''    A  32          H5''        A  32  24.956  12.326 -11.671
  330    H4'    A  32           H4'        A  32  24.108  13.355  -9.375
  331    H3'    A  32           H3'        A  32  23.539  14.069 -12.244
  332    H2'    A  32          H2''        A  32  22.473  16.037 -11.734
  333   HO2'    A  32          H2'         A  32  20.841  15.754 -10.454
  334    H1'    A  32           H1'        A  32  23.596  16.526  -9.158
  335    H8     A  32           H8         A  32  26.034  16.514 -12.111
  336    H61    A  32           H61        A  32  24.351  22.389 -13.042
  337    H62    A  32           H62        A  32  25.516  21.146 -13.438
  338    H2     A  32           H2         A  32  21.771  20.704  -9.781
  339    H5'    A  33           H5'        A  33  19.229  13.411  -9.922
  340   H5''    A  33          H5''        A  33  18.159  13.272 -11.330
  341    H4'    A  33           H4'        A  33  17.719  15.142  -9.489
  342    H3'    A  33           H3'        A  33  17.512  15.143 -12.489
  343    H2'    A  33          H2''        A  33  17.249  17.428 -12.668
  344   HO2'    A  33          H2'         A  33  16.032  18.543 -11.328
  345    H1'    A  33           H1'        A  33  18.596  18.267 -10.341
  346    H8     A  33           H8         A  33  20.705  16.109 -12.668
  347    H61    A  33           H61        A  33  21.882  21.289 -15.825
  348    H62    A  33           H62        A  33  22.392  19.644 -15.523
  349    H2     A  33           H2         A  33  18.677  22.188 -12.817
  350    H5'    A  34           H5'        A  34  14.195  17.295 -10.759
  351   H5''    A  34          H5''        A  34  12.664  16.970 -11.595
  352    H4'    A  34           H4'        A  34  13.220  19.434 -11.388
  353    H3'    A  34           H3'        A  34  12.707  17.902 -13.913
  354    H2'    A  34          H2''        A  34  13.464  19.537 -15.334
  355   HO2'    A  34          H2'         A  34  11.922  21.050 -14.743
  356    H1'    A  34           H1'        A  34  15.055  21.072 -13.507
  357    H8     A  34           H8         A  34  16.141  17.473 -14.343
  358    H61    A  34           H61        A  34  19.655  20.079 -18.708
  359    H62    A  34           H62        A  34  19.404  18.653 -17.728
  360    H2     A  34           H2         A  34  16.884  23.218 -17.099
  361    H5'    C  35           H5'        C  35   9.733  18.161 -16.906
  362   H5''    C  35          H5''        C  35  11.011  17.472 -15.880
  363    H4'    C  35           H4'        C  35  11.581  20.203 -16.913
  364    H3'    C  35           H3'        C  35  10.512  18.252 -18.711
  365    H2'    C  35          H2''        C  35  12.360  16.879 -18.869
  366   HO2'    C  35          H2'         C  35  13.926  17.705 -20.368
  367    H1'    C  35           H1'        C  35  14.328  19.029 -18.197
  368    H41    C  35           H41        C  35  17.761  13.791 -17.111
  369    H42    C  35           H42        C  35  16.479  13.091 -16.149
  370    H5     C  35           H5         C  35  14.329  14.137 -15.857
  371    H6     C  35           H6         C  35  12.960  16.100 -16.381
  372    H5'    U  36           H5'        U  36   9.369  20.844 -18.344
  373   H5''    U  36          H5''        U  36   7.885  21.110 -19.280
  374    H4'    U  36           H4'        U  36   7.843  23.065 -18.046
  375    H3'    U  36           H3'        U  36   9.412  23.365 -20.563
  376    H2'    U  36          H2''        U  36  10.586  25.278 -19.959
  377   HO2'    U  36          H2'         U  36   8.575  25.717 -17.991
  378    H1'    U  36           H1'        U  36  10.881  24.919 -17.256
  379    H3     U  36           H3         U  36  14.524  24.619 -20.456
  380    H5     U  36           H5         U  36  13.919  20.974 -18.437
  381    H6     U  36           H6         U  36  11.792  21.826 -17.668
  382    H5'    A  37           H5'        A  37   9.109  26.905 -20.934
  383   H5''    A  37          H5''        A  37   7.799  27.312 -22.061
  384    H4'    A  37           H4'        A  37   9.665  28.468 -22.965
  385    H3'    A  37           H3'        A  37   9.161  25.749 -24.161
  386    H2'    A  37          H2''        A  37  10.979  25.871 -25.568
  387   HO2'    A  37          H2'         A  37  11.718  27.686 -26.383
  388    H1'    A  37           H1'        A  37  12.745  27.099 -23.752
  389    H8     A  37           H8         A  37  10.708  24.353 -22.078
  390    H61    A  37           H61        A  37  14.902  20.388 -24.282
  391    H62    A  37           H62        A  37  13.613  20.622 -23.123
  392    H2     A  37           H2         A  37  15.607  24.373 -26.216
  393    H5'    C  38           H5'        C  38   8.855  28.302 -28.040
  394   H5''    C  38          H5''        C  38   8.012  27.172 -29.118
  395    H4'    C  38           H4'        C  38  10.536  27.859 -29.595
  396    H3'    C  38           H3'        C  38   9.101  25.212 -29.801
  397    H2'    C  38          H2''        C  38  11.044  24.062 -30.326
  398   HO2'    C  38          H2'         C  38  11.739  25.279 -32.045
  399    H1'    C  38           H1'        C  38  12.887  25.640 -28.902
  400    H41    C  38           H41        C  38  12.333  19.998 -25.980
  401    H42    C  38           H42        C  38  10.771  20.453 -25.341
  402    H5     C  38           H5         C  38   9.730  22.584 -25.801
  403    H6     C  38           H6         C  38   9.909  24.671 -27.054
  404    H5'    A  39           H5'        A  39   9.824  25.555 -34.312
  405   H5''    A  39          H5''        A  39   8.675  24.342 -34.907
  406    H4'    A  39           H4'        A  39  11.295  23.823 -34.840
  407    H3'    A  39           H3'        A  39   8.878  22.122 -34.261
  408    H2'    A  39          H2''        A  39  10.134  20.390 -33.415
  409   HO2'    A  39          H2'         A  39  11.331  20.284 -35.447
  410    H1'    A  39           H1'        A  39  12.490  21.866 -32.711
  411    H8     A  39           H8         A  39   9.372  22.779 -30.734
  412    H61    A  39           H61        A  39  10.609  17.869 -27.182
  413    H62    A  39           H62        A  39   9.726  19.375 -27.294
  414    H2     A  39           H2         A  39  13.350  17.747 -30.733
  415    H5'    A  40           H5'        A  40  11.108  20.976 -38.184
  416   H5''    A  40          H5''        A  40  10.218  19.942 -39.318
  417    H4'    A  40           H4'        A  40  12.345  18.853 -38.608
  418    H3'    A  40           H3'        A  40   9.661  17.778 -37.658
  419    H2'    A  40          H2''        A  40  10.704  16.000 -36.571
  420   HO2'    A  40          H2'         A  40  12.044  15.276 -38.211
  421    H1'    A  40           H1'        A  40  12.986  17.399 -35.748
  422    H8     A  40           H8         A  40   9.545  19.050 -35.140
  423    H61    A  40           H61        A  40   9.377  15.778 -29.893
  424    H62    A  40           H62        A  40   8.632  17.070 -30.808
  425    H2     A  40           H2         A  40  13.065  14.592 -32.155
  426    H5'    U  41           H5'        U  41  10.782  14.331 -40.596
  427   H5''    U  41          H5''        U  41   9.328  13.314 -40.603
  428    H4'    U  41           H4'        U  41  11.568  12.569 -39.302
  429    H3'    U  41           H3'        U  41   8.629  12.253 -38.611
  430    H2'    U  41          H2''        U  41   9.149  11.304 -36.542
  431   HO2'    U  41          H2'         U  41  10.818  10.004 -36.248
  432    H1'    U  41           H1'        U  41  11.577  12.671 -36.083
  433    H3     U  41           H3         U  41   8.696  13.125 -32.547
  434    H5     U  41           H5         U  41   7.287  15.813 -35.470
  435    H6     U  41           H6         U  41   8.923  14.897 -37.010
  436    H5'    C  42           H5'        C  42  10.229   7.792 -39.142
  437   H5''    C  42          H5''        C  42   8.735   6.853 -39.332
  438    H4'    C  42           H4'        C  42  10.299   6.255 -37.337
  439    H3'    C  42           H3'        C  42   7.319   6.771 -37.317
  440    H2'    C  42          H2''        C  42   7.189   6.499 -35.015
  441   HO2'    C  42          H2'         C  42   8.098   4.651 -34.493
  442    H1'    C  42           H1'        C  42   9.750   7.448 -34.337
  443    H41    C  42           H41        C  42   5.435  11.660 -32.294
  444    H42    C  42           H42        C  42   5.092  12.160 -33.932
  445    H5     C  42           H5         C  42   6.194  11.207 -35.860
  446    H6     C  42           H6         C  42   7.755   9.485 -36.630
  447    H5'    A  43           H5'        A  43   6.604   2.111 -36.769
  448   H5''    A  43          H5''        A  43   4.876   2.190 -37.163
  449    H4'    A  43           H4'        A  43   5.715   1.803 -34.644
  450    H3'    A  43           H3'        A  43   3.423   3.425 -35.779
  451    H2'    A  43          H2''        A  43   2.817   4.185 -33.663
  452   HO2'    A  43          H2'         A  43   4.429   2.107 -32.566
  453    H1'    A  43           H1'        A  43   5.388   4.378 -32.568
  454    H8     A  43           H8         A  43   5.308   6.121 -35.914
  455    H61    A  43           H61        A  43   2.439  10.809 -33.070
  456    H62    A  43           H62        A  43   3.334  10.322 -34.493
  457    H2     A  43           H2         A  43   2.672   7.369 -30.200
  458    H5'    G  44           H5'        G  44   1.210  -0.103 -33.239
  459   H5''    G  44          H5''        G  44  -0.466   0.105 -33.779
  460    H4'    G  44           H4'        G  44   0.191   0.385 -31.203
  461    H3'    G  44           H3'        G  44  -1.698   1.991 -32.949
  462    H2'    G  44          H2''        G  44  -2.262   3.362 -31.143
  463   HO2'    G  44          H2'         G  44  -1.161   1.311 -29.504
  464    H1'    G  44           H1'        G  44   0.285   3.428 -29.955
  465    H8     G  44           H8         G  44   0.957   4.303 -33.467
  466    H1     G  44           H1         G  44  -2.274   8.915 -30.405
  467    H21    G  44           H21        G  44  -3.019   8.165 -28.473
  468    H22    G  44           H22        G  44  -2.906   6.479 -28.021
  469    H5'    C  45           H5'        C  45  -3.727   1.505 -29.701
  470   H5''    C  45          H5''        C  45  -5.320   0.745 -29.884
  471    H4'    C  45           H4'        C  45  -5.692   2.782 -28.663
  472    H3'    C  45           H3'        C  45  -6.354   2.849 -31.617
  473    H2'    C  45          H2''        C  45  -6.974   5.070 -31.515
  474   HO2'    C  45          H2'         C  45  -8.423   5.276 -29.964
  475    H1'    C  45           H1'        C  45  -5.256   5.869 -29.416
  476    H41    C  45           H41        C  45  -3.465   8.800 -34.765
  477    H42    C  45           H42        C  45  -3.026   7.280 -35.511
  478    H5     C  45           H5         C  45  -3.193   5.154 -34.368
  479    H6     C  45           H6         C  45  -3.974   4.023 -32.345
  480    H5'    U  46           H5'        U  46 -10.591   4.028 -29.237
  481   H5''    U  46          H5''        U  46 -11.645   3.774 -30.641
  482    H4'    U  46           H4'        U  46 -11.567   6.141 -29.421
  483    H3'    U  46           H3'        U  46 -11.731   5.366 -32.330
  484    H2'    U  46          H2''        U  46 -11.478   7.547 -33.079
  485   HO2'    U  46          H2'         U  46 -12.918   8.771 -32.113
  486    H1'    U  46           H1'        U  46  -9.853   8.558 -31.037
  487    H3     U  46           H3         U  46  -7.649   9.166 -34.969
  488    H5     U  46           H5         U  46  -7.305   5.043 -34.191
  489    H6     U  46           H6         U  46  -8.836   5.330 -32.334
  490    H5'    C  47           H5'        C  47 -15.112   8.376 -31.543
  491   H5''    C  47          H5''        C  47 -16.455   7.857 -32.580
  492    H4'    C  47           H4'        C  47 -15.890  10.253 -32.956
  493    H3'    C  47           H3'        C  47 -15.360   8.180 -35.099
  494    H2'    C  47          H2''        C  47 -14.742   9.876 -36.601
  495   HO2'    C  47          H2'         C  47 -16.095  11.513 -36.459
  496    H1'    C  47           H1'        C  47 -13.289  11.376 -34.736
  497    H41    C  47           H41        C  47  -8.805   8.104 -37.755
  498    H42    C  47           H42        C  47  -9.293   6.623 -36.964
  499    H5     C  47           H5         C  47 -11.073   6.537 -35.339
  500    H6     C  47           H6         C  47 -13.044   7.716 -34.478
  501    H5'    C  48           H5'        C  48 -18.160  11.162 -36.885
  502   H5''    C  48          H5''        C  48 -19.236  10.320 -38.017
  503    H4'    C  48           H4'        C  48 -17.951  12.222 -39.073
  504    H3'    C  48           H3'        C  48 -17.819   9.337 -39.895
  505   HO3'    C  48          H3T         C  48 -19.507  10.112 -40.879
  506    H2'    C  48          H2''        C  48 -16.115   9.627 -41.407
  507   HO2'    C  48          H2'         C  48 -17.224  11.277 -42.573
  508    H1'    C  48           H1'        C  48 -14.835  11.855 -40.239
  509    H41    C  48           H41        C  48 -10.875   6.912 -39.616
  510    H42    C  48           H42        C  48 -11.973   6.120 -38.510
  511    H5     C  48           H5         C  48 -14.052   7.106 -37.793
  512    H6     C  48           H6         C  48 -15.643   8.931 -38.171
  Start of MODEL    9
    1    H5'    G   1           H5'        G   1  -2.707   6.350 -46.816
    2   H5''    G   1          H5''        G   1  -1.540   7.532 -46.189
    3    H4'    G   1           H4'        G   1  -3.570   8.634 -47.169
    4    H3'    G   1           H3'        G   1  -2.685   8.833 -44.309
    5    H2'    G   1          H2''        G   1  -4.595   9.757 -43.525
    6   HO2'    G   1          H2'         G   1  -4.400  11.607 -44.840
    7    H1'    G   1           H1'        G   1  -6.410   9.028 -45.620
    8    H8     G   1           H8         G   1  -5.043   6.091 -43.639
    9    H1     G   1           H1         G   1  -9.919   9.137 -40.796
   10    H21    G   1           H21        G   1 -10.312  11.051 -41.818
   11    H22    G   1           H22        G   1  -9.507  11.496 -43.306
   12   HO5'    G   1          H5T         G   1  -2.084   7.019 -44.153
   13    H5'    G   2           H5'        G   2  -2.671  13.920 -45.542
   14   H5''    G   2          H5''        G   2  -1.993  14.230 -43.933
   15    H4'    G   2           H4'        G   2  -4.293  15.369 -44.719
   16    H3'    G   2           H3'        G   2  -3.403  14.252 -42.047
   17    H2'    G   2          H2''        G   2  -5.494  14.717 -41.082
   18   HO2'    G   2          H2'         G   2  -6.279  16.143 -43.407
   19    H1'    G   2           H1'        G   2  -7.068  13.902 -43.174
   20    H8     G   2           H8         G   2  -4.182  11.498 -42.858
   21    H1     G   2           H1         G   2  -8.664  10.719 -38.341
   22    H21    G   2           H21        G   2 -10.104  12.393 -38.419
   23    H22    G   2           H22        G   2  -9.852  13.791 -39.439
   24    H5'    G   3           H5'        G   3  -4.145  18.761 -40.620
   25   H5''    G   3          H5''        G   3  -3.375  18.620 -39.029
   26    H4'    G   3           H4'        G   3  -6.024  19.015 -39.285
   27    H3'    G   3           H3'        G   3  -4.515  17.218 -37.351
   28    H2'    G   3          H2''        G   3  -6.559  16.815 -36.234
   29   HO2'    G   3          H2'         G   3  -7.981  18.354 -36.145
   30    H1'    G   3           H1'        G   3  -7.995  16.413 -38.590
   31    H8     G   3           H8         G   3  -4.914  14.623 -39.379
   32    H1     G   3           H1         G   3  -8.148  11.696 -34.677
   33    H21    G   3           H21        G   3  -9.687  13.046 -33.857
   34    H22    G   3           H22        G   3  -9.809  14.724 -34.337
   35    H5'    G   4           H5'        G   4  -6.427  19.088 -34.936
   36   H5''    G   4          H5''        G   4  -5.696  20.180 -33.744
   37    H4'    G   4           H4'        G   4  -6.962  18.772 -32.359
   38    H3'    G   4           H3'        G   4  -4.146  17.752 -32.759
   39    H2'    G   4          H2''        G   4  -4.553  15.831 -31.532
   40   HO2'    G   4          H2'         G   4  -5.602  16.072 -29.738
   41    H1'    G   4           H1'        G   4  -7.185  15.396 -32.314
   42    H8     G   4           H8         G   4  -4.820  16.152 -35.241
   43    H1     G   4           H1         G   4  -4.481  10.129 -33.052
   44    H21    G   4           H21        G   4  -5.710   9.940 -31.219
   45    H22    G   4           H22        G   4  -6.439  11.322 -30.436
   46    H5'    U   5           H5'        U   5  -4.721  17.806 -28.014
   47   H5''    U   5          H5''        U   5  -3.020  17.749 -27.515
   48    H4'    U   5           H4'        U   5  -4.685  15.781 -26.851
   49    H3'    U   5           H3'        U   5  -1.814  15.744 -27.796
   50    H2'    U   5          H2''        U   5  -1.751  13.427 -27.863
   51   HO2'    U   5          H2'         U   5  -2.713  12.208 -26.418
   52    H1'    U   5           H1'        U   5  -4.447  12.936 -28.483
   53    H3     U   5           H3         U   5  -1.672  10.860 -31.479
   54    H5     U   5           H5         U   5  -1.644  14.923 -32.605
   55    H6     U   5           H6         U   5  -3.009  15.400 -30.654
   56    H5'    U   6           H5'        U   6  -2.456  13.113 -24.337
   57   H5''    U   6          H5''        U   6  -1.250  13.517 -23.100
   58    H4'    U   6           H4'        U   6  -1.351  11.109 -23.206
   59    H3'    U   6           H3'        U   6   1.002  12.454 -24.548
   60    H2'    U   6          H2''        U   6   1.885  10.399 -25.238
   61   HO2'    U   6          H2'         U   6   0.112   9.190 -23.367
   62    H1'    U   6           H1'        U   6  -0.514   9.133 -25.849
   63    H3     U   6           H3         U   6   1.674   9.559 -29.814
   64    H5     U   6           H5         U   6   0.474  13.486 -28.877
   65    H6     U   6           H6         U   6  -0.337  12.659 -26.748
   66    H5'    G   7           H5'        G   7   3.560  10.608 -21.206
   67   H5''    G   7          H5''        G   7   5.071  11.500 -21.467
   68    H4'    G   7           H4'        G   7   4.785   8.953 -22.280
   69    H3'    G   7           H3'        G   7   6.199  11.328 -23.522
   70    H2'    G   7          H2''        G   7   6.675  10.151 -25.452
   71   HO2'    G   7          H2'         G   7   6.368   7.750 -23.948
   72    H1'    G   7           H1'        G   7   4.502   8.304 -25.355
   73    H8     G   7           H8         G   7   3.184  11.796 -25.635
   74    H1     G   7           H1         G   7   5.923   9.712 -31.050
   75    H21    G   7           H21        G   7   7.029   7.850 -30.668
   76    H22    G   7           H22        G   7   7.113   7.116 -29.083
   77    H5'    G   8           H5'        G   8   9.103   7.453 -22.920
   78   H5''    G   8          H5''        G   8  10.681   8.248 -22.776
   79    H4'    G   8           H4'        G   8  10.663   6.265 -24.351
   80    H3'    G   8           H3'        G   8  11.336   9.089 -25.225
   81    H2'    G   8          H2''        G   8  11.840   8.313 -27.399
   82   HO2'    G   8          H2'         G   8  13.082   6.544 -27.080
   83    H1'    G   8           H1'        G   8   9.756   6.500 -27.585
   84    H8     G   8           H8         G   8   8.303   9.588 -26.098
   85    H1     G   8           H1         G   8   9.814  10.353 -32.277
   86    H21    G   8           H21        G   8  11.071   8.679 -32.962
   87    H22    G   8           H22        G   8  11.686   7.463 -31.866
   88    H5'    U   9           H5'        U   9  14.591   7.469 -26.270
   89   H5''    U   9          H5''        U   9  16.148   8.021 -25.620
   90    H4'    U   9           H4'        U   9  16.293   8.340 -27.995
   91    H3'    U   9           H3'        U   9  15.788  10.738 -26.259
   92    H2'    U   9          H2''        U   9  15.252  12.149 -27.984
   93   HO2'    U   9          H2'         U   9  16.962  10.531 -29.576
   94    H1'    U   9           H1'        U   9  14.534  10.233 -29.974
   95    H3     U   9           H3         U   9  11.384  13.512 -30.070
   96    H5     U   9           H5         U   9  10.484  11.262 -26.635
   97    H6     U   9           H6         U   9  12.618  10.116 -26.901
   98    H5'    G  10           H5'        G  10  18.529  11.811 -29.266
   99   H5''    G  10          H5''        G  10  20.070  12.382 -28.596
  100    H4'    G  10           H4'        G  10  19.391  13.886 -30.401
  101    H3'    G  10           H3'        G  10  19.327  14.767 -27.527
  102    H2'    G  10          H2''        G  10  18.207  16.720 -27.945
  103   HO2'    G  10          H2'         G  10  19.503  16.639 -30.464
  104    H1'    G  10           H1'        G  10  17.007  16.063 -30.451
  105    H8     G  10           H8         G  10  15.818  13.949 -27.529
  106    H1     G  10           H1         G  10  13.041  19.723 -27.838
  107    H21    G  10           H21        G  10  14.138  21.010 -29.258
  108    H22    G  10           H22        G  10  15.423  20.397 -30.274
  109    H5'    U  11           H5'        U  11  22.432  18.249 -29.379
  110   H5''    U  11          H5''        U  11  23.019  18.666 -27.759
  111    H4'    U  11           H4'        U  11  21.829  20.504 -29.274
  112    H3'    U  11           H3'        U  11  21.723  19.903 -26.328
  113    H2'    U  11          H2''        U  11  19.928  21.276 -25.915
  114   HO2'    U  11          H2'         U  11  20.934  23.153 -26.657
  115    H1'    U  11           H1'        U  11  18.779  21.368 -28.514
  116    H3     U  11           H3         U  11  15.383  20.586 -25.601
  117    H5     U  11           H5         U  11  17.588  17.000 -25.602
  118    H6     U  11           H6         U  11  19.266  18.108 -26.963
  119    H5'    A  12           H5'        A  12  23.369  24.587 -26.620
  120   H5''    A  12          H5''        A  12  23.670  24.922 -24.904
  121    H4'    A  12           H4'        A  12  21.850  26.322 -26.289
  122    H3'    A  12           H3'        A  12  21.918  25.300 -23.451
  123    H2'    A  12          H2''        A  12  19.721  25.983 -23.009
  124   HO2'    A  12          H2'         A  12  19.984  28.079 -23.987
  125    H1'    A  12           H1'        A  12  18.576  25.269 -25.401
  126    H8     A  12           H8         A  12  20.942  22.480 -24.546
  127    H61    A  12           H61        A  12  16.868  20.657 -20.265
  128    H62    A  12           H62        A  12  18.309  20.224 -21.158
  129    H2     A  12           H2         A  12  15.602  24.686 -21.768
  130    H5'    U  13           H5'        U  13  20.783  29.437 -22.065
  131   H5''    U  13          H5''        U  13  21.585  29.359 -20.486
  132    H4'    U  13           H4'        U  13  18.930  29.397 -20.653
  133    H3'    U  13           H3'        U  13  20.797  27.824 -18.865
  134    H2'    U  13          H2''        U  13  19.009  26.644 -17.904
  135   HO2'    U  13          H2'         U  13  16.955  27.448 -17.791
  136    H1'    U  13           H1'        U  13  17.292  26.602 -20.093
  137    H3     U  13           H3         U  13  18.332  22.438 -18.283
  138    H5     U  13           H5         U  13  21.384  23.325 -21.050
  139    H6     U  13           H6         U  13  20.463  25.551 -21.263
  140    H5'    U  14           H5'        U  14  17.552  29.090 -16.429
  141   H5''    U  14          H5''        U  14  18.215  30.157 -15.174
  142    H4'    U  14           H4'        U  14  16.683  28.598 -14.098
  143    H3'    U  14           H3'        U  14  19.638  28.449 -13.699
  144    H2'    U  14          H2''        U  14  19.702  26.349 -12.797
  145   HO2'    U  14          H2'         U  14  17.347  27.206 -11.641
  146    H1'    U  14           H1'        U  14  17.321  25.230 -13.771
  147    H3     U  14           H3         U  14  20.371  22.147 -14.987
  148    H5     U  14           H5         U  14  21.452  25.542 -17.235
  149    H6     U  14           H6         U  14  19.776  26.801 -16.014
  150    H5'    U  15           H5'        U  15  17.507  28.113  -9.253
  151   H5''    U  15          H5''        U  15  18.919  28.402  -8.217
  152    H4'    U  15           H4'        U  15  17.546  26.126  -8.021
  153    H3'    U  15           H3'        U  15  20.465  26.791  -7.856
  154    H2'    U  15          H2''        U  15  21.208  24.638  -8.082
  155   HO2'    U  15          H2'         U  15  18.806  23.981  -6.754
  156    H1'    U  15           H1'        U  15  18.968  23.439  -9.344
  157    H3     U  15           H3         U  15  22.672  22.091 -11.618
  158    H5     U  15           H5         U  15  22.160  26.125 -12.714
  159    H6     U  15           H6         U  15  20.426  26.297 -11.030
  160    H5'    U  16           H5'        U  16  19.413  23.758  -4.190
  161   H5''    U  16          H5''        U  16  20.638  24.289  -3.021
  162    H4'    U  16           H4'        U  16  20.584  21.763  -3.604
  163    H3'    U  16           H3'        U  16  22.885  23.678  -3.499
  164    H2'    U  16          H2''        U  16  24.381  22.325  -4.577
  165   HO2'    U  16          H2'         U  16  22.910  20.240  -3.378
  166    H1'    U  16           H1'        U  16  22.637  20.625  -6.010
  167    H3     U  16           H3         U  16  25.701  22.072  -9.027
  168    H5     U  16           H5         U  16  23.400  25.495  -8.173
  169    H6     U  16           H6         U  16  22.285  24.230  -6.429
  170    H5'    U  17           H5'        U  17  24.598  19.737  -0.883
  171   H5''    U  17          H5''        U  17  25.870  20.695  -0.102
  172    H4'    U  17           H4'        U  17  26.498  18.580  -1.596
  173    H3'    U  17           H3'        U  17  27.760  21.290  -1.258
  174    H2'    U  17          H2''        U  17  29.173  21.073  -3.052
  175   HO2'    U  17          H2'         U  17  30.389  19.373  -2.685
  176    H1'    U  17           H1'        U  17  27.755  19.117  -4.555
  177    H3     U  17           H3         U  17  28.961  22.365  -7.477
  178    H5     U  17           H5         U  17  26.011  24.180  -5.077
  179    H6     U  17           H6         U  17  26.048  22.207  -3.663
  180    H5'    A  18           H5'        A  18  31.341  17.852  -0.642
  181   H5''    A  18          H5''        A  18  32.551  18.923   0.089
  182    H4'    A  18           H4'        A  18  33.122  17.553  -2.120
  183    H3'    A  18           H3'        A  18  33.793  20.361  -1.249
  184    H2'    A  18          H2''        A  18  34.592  20.980  -3.304
  185   HO2'    A  18          H2'         A  18  36.224  19.724  -3.778
  186    H1'    A  18           H1'        A  18  33.284  19.019  -4.923
  187    H8     A  18           H8         A  18  30.986  21.505  -3.204
  188    H61    A  18           H61        A  18  32.038  25.234  -8.018
  189    H62    A  18           H62        A  18  31.148  25.028  -6.525
  190    H2     A  18           H2         A  18  34.937  21.816  -8.245
  191    H5'    A  19           H5'        A  19  38.241  18.400  -2.392
  192   H5''    A  19          H5''        A  19  39.158  19.656  -1.539
  193    H4'    A  19           H4'        A  19  39.524  19.254  -4.147
  194    H3'    A  19           H3'        A  19  39.376  21.775  -2.495
  195    H2'    A  19          H2''        A  19  39.373  23.150  -4.337
  196   HO2'    A  19          H2'         A  19  40.798  21.059  -5.618
  197    H1'    A  19           H1'        A  19  38.379  21.301  -6.269
  198    H8     A  19           H8         A  19  35.987  22.140  -3.430
  199    H61    A  19           H61        A  19  34.422  27.158  -6.667
  200    H62    A  19           H62        A  19  33.949  26.070  -5.380
  201    H2     A  19           H2         A  19  38.016  25.303  -8.620
  202    H5'    A  20           H5'        A  20  42.868  21.925  -5.407
  203   H5''    A  20          H5''        A  20  44.176  22.793  -4.583
  204    H4'    A  20           H4'        A  20  43.686  23.744  -6.845
  205    H3'    A  20           H3'        A  20  43.297  25.278  -4.275
  206    H2'    A  20          H2''        A  20  42.428  27.128  -5.362
  207   HO2'    A  20          H2'         A  20  43.038  27.757  -7.353
  208    H1'    A  20           H1'        A  20  41.298  25.826  -7.598
  209    H8     A  20           H8         A  20  40.274  24.760  -4.019
  210    H61    A  20           H61        A  20  35.854  29.053  -4.491
  211    H62    A  20           H62        A  20  36.426  27.671  -3.583
  212    H2     A  20           H2         A  20  38.513  29.396  -8.085
  213    H5'    U  21           H5'        U  21  45.169  28.054  -6.683
  214   H5''    U  21          H5''        U  21  46.253  29.094  -5.739
  215    H4'    U  21           H4'        U  21  44.340  30.366  -6.745
  216    H3'    U  21           H3'        U  21  44.846  30.084  -3.793
  217    H2'    U  21          H2''        U  21  42.888  31.163  -3.172
  218   HO2'    U  21          H2'         U  21  42.740  32.245  -5.804
  219    H1'    U  21           H1'        U  21  41.243  30.410  -5.299
  220    H3     U  21           H3         U  21  39.139  28.763  -1.651
  221    H5     U  21           H5         U  21  42.744  26.580  -1.770
  222    H6     U  21           H6         U  21  43.391  27.886  -3.709
  223    H5'    U  22           H5'        U  22  44.099  34.027  -5.241
  224   H5''    U  22          H5''        U  22  45.204  35.322  -4.733
  225    H4'    U  22           H4'        U  22  42.824  36.060  -4.629
  226    H3'    U  22           H3'        U  22  44.757  35.953  -2.393
  227    H2'    U  22          H2''        U  22  43.325  35.589  -0.675
  228   HO2'    U  22          H2'         U  22  41.963  37.687  -1.943
  229    H1'    U  22           H1'        U  22  40.817  35.331  -2.121
  230    H3     U  22           H3         U  22  39.854  32.326   1.061
  231    H5     U  22           H5         U  22  43.669  31.106  -0.250
  232    H6     U  22           H6         U  22  43.688  33.004  -1.757
  233    H5'    A  23           H5'        A  23  45.786  38.212   0.306
  234   H5''    A  23          H5''        A  23  44.604  36.898   0.142
  235    H4'    A  23           H4'        A  23  44.726  37.894   2.470
  236    H3'    A  23           H3'        A  23  42.389  37.424   0.763
  237    H2'    A  23          H2''        A  23  40.968  39.051   1.511
  238   HO2'    A  23          H2'         A  23  40.850  38.137   3.584
  239    H1'    A  23           H1'        A  23  42.663  40.878   2.792
  240    H8     A  23           H8         A  23  43.951  40.634  -0.667
  241    H61    A  23           H61        A  23  39.196  44.094  -2.545
  242    H62    A  23           H62        A  23  40.711  43.354  -3.009
  243    H2     A  23           H2         A  23  38.243  42.553   1.549
  244    H5'    A  24           H5'        A  24  39.646  35.215   3.633
  245   H5''    A  24          H5''        A  24  38.730  34.773   2.181
  246    H4'    A  24           H4'        A  24  38.380  37.082   3.830
  247    H3'    A  24           H3'        A  24  37.191  35.708   1.496
  248    H2'    A  24          H2''        A  24  36.840  37.516   0.182
  249   HO2'    A  24          H2'         A  24  36.056  39.108   2.384
  250    H1'    A  24           H1'        A  24  38.029  39.601   1.845
  251    H8     A  24           H8         A  24  40.430  37.609  -0.169
  252    H61    A  24           H61        A  24  39.039  41.181  -5.022
  253    H62    A  24           H62        A  24  40.032  39.858  -4.452
  254    H2     A  24           H2         A  24  36.063  42.015  -1.768
  255    H5'    U  25           H5'        U  25  34.354  33.971   0.869
  256   H5''    U  25          H5''        U  25  35.158  35.552   0.840
  257    H4'    U  25           H4'        U  25  32.458  34.841  -0.024
  258    H3'    U  25           H3'        U  25  34.542  36.378  -0.901
  259    H2'    U  25          H2''        U  25  34.434  38.132   0.660
  260   HO2'    U  25          H2'         U  25  33.346  39.847  -0.275
  261    H1'    U  25           H1'        U  25  31.448  38.140   0.712
  262    H3     U  25           H3         U  25  31.240  40.717   4.360
  263    H5     U  25           H5         U  25  34.940  38.762   4.843
  264    H6     U  25           H6         U  25  34.529  37.599   2.755
  265    H5'    U  26           H5'        U  26  35.897  37.648  -1.694
  266   H5''    U  26          H5''        U  26  35.069  38.582  -2.955
  267    H4'    U  26           H4'        U  26  37.201  38.534  -3.911
  268    H3'    U  26           H3'        U  26  35.528  36.198  -4.671
  269    H2'    U  26          H2''        U  26  37.182  34.696  -5.158
  270   HO2'    U  26          H2'         U  26  38.945  36.863  -5.702
  271    H1'    U  26           H1'        U  26  39.350  35.674  -3.715
  272    H3     U  26           H3         U  26  39.036  31.472  -2.143
  273    H5     U  26           H5         U  26  35.528  33.307  -0.711
  274    H6     U  26           H6         U  26  36.095  35.277  -1.991
  275    H5'    C  27           H5'        C  27  36.147  37.426  -9.463
  276   H5''    C  27          H5''        C  27  34.785  36.366  -9.876
  277    H4'    C  27           H4'        C  27  37.257  35.784 -10.694
  278    H3'    C  27           H3'        C  27  34.942  34.131  -9.751
  279    H2'    C  27          H2''        C  27  36.149  32.205  -9.385
  280   HO2'    C  27          H2'         C  27  38.016  33.172 -11.306
  281    H1'    C  27           H1'        C  27  38.728  33.264  -8.985
  282    H41    C  27           H41        C  27  37.012  30.707  -3.432
  283    H42    C  27           H42        C  27  35.486  31.563  -3.439
  284    H5     C  27           H5         C  27  34.753  32.926  -5.283
  285    H6     C  27           H6         C  27  35.387  33.896  -7.439
  286    H5'    U  28           H5'        U  28  35.735  32.844 -14.556
  287   H5''    U  28          H5''        U  28  34.623  31.483 -14.804
  288    H4'    U  28           H4'        U  28  37.286  31.139 -14.962
  289    H3'    U  28           H3'        U  28  35.131  29.419 -13.689
  290    H2'    U  28          H2''        U  28  36.719  27.799 -13.107
  291   HO2'    U  28          H2'         U  28  37.863  28.191 -15.270
  292    H1'    U  28           H1'        U  28  38.634  29.572 -12.217
  293    H3     U  28           H3         U  28  36.683  27.116  -8.819
  294    H5     U  28           H5         U  28  34.090  30.351  -9.527
  295    H6     U  28           H6         U  28  35.433  30.939 -11.444
  296    H5'    U  29           H5'        U  29  37.193  26.687 -16.299
  297   H5''    U  29          H5''        U  29  36.175  25.272 -16.630
  298    H4'    U  29           H4'        U  29  38.323  25.045 -15.077
  299    H3'    U  29           H3'        U  29  35.569  23.855 -14.956
  300    H2'    U  29          H2''        U  29  35.785  23.038 -12.815
  301   HO2'    U  29          H2'         U  29  38.591  23.025 -13.278
  302    H1'    U  29           H1'        U  29  37.734  24.810 -11.798
  303    H3     U  29           H3         U  29  34.031  24.364  -9.049
  304    H5     U  29           H5         U  29  33.099  27.392 -11.822
  305    H6     U  29           H6         U  29  35.106  26.799 -13.050
  306    H5'    A  30           H5'        A  30  37.466  20.778 -13.247
  307   H5''    A  30          H5''        A  30  37.308  19.367 -14.310
  308    H4'    A  30           H4'        A  30  36.490  18.554 -12.248
  309    H3'    A  30           H3'        A  30  34.335  19.600 -14.082
  310    H2'    A  30          H2''        A  30  32.682  19.338 -12.483
  311   HO2'    A  30          H2'         A  30  32.602  17.661 -11.146
  312    H1'    A  30           H1'        A  30  34.342  19.508 -10.164
  313    H8     A  30           H8         A  30  34.033  22.495 -12.601
  314    H61    A  30           H61        A  30  29.242  24.225  -9.103
  315    H62    A  30           H62        A  30  30.382  24.734 -10.328
  316    H2     A  30           H2         A  30  30.619  20.194  -7.691
  317    H5'    A  31           H5'        A  31  33.395  15.361 -12.309
  318   H5''    A  31          H5''        A  31  32.329  14.573 -13.487
  319    H4'    A  31           H4'        A  31  31.461  14.569 -11.091
  320    H3'    A  31           H3'        A  31  30.049  15.680 -13.510
  321    H2'    A  31          H2''        A  31  28.350  16.630 -12.290
  322   HO2'    A  31          H2'         A  31  27.522  14.835 -11.346
  323    H1'    A  31           H1'        A  31  29.664  16.843  -9.757
  324    H8     A  31           H8         A  31  30.876  18.784 -12.876
  325    H61    A  31           H61        A  31  27.104  23.289 -10.951
  326    H62    A  31           H62        A  31  28.439  22.888 -12.009
  327    H2     A  31           H2         A  31  26.458  19.710  -8.324
  328    H5'    A  32           H5'        A  32  27.119  12.149 -11.568
  329   H5''    A  32          H5''        A  32  25.924  12.033 -12.874
  330    H4'    A  32           H4'        A  32  25.159  12.646 -10.397
  331    H3'    A  32           H3'        A  32  24.289  13.622 -13.106
  332    H2'    A  32          H2''        A  32  23.069  15.390 -12.292
  333   HO2'    A  32          H2'         A  32  21.588  14.698 -10.968
  334    H1'    A  32           H1'        A  32  24.350  15.752  -9.782
  335    H8     A  32           H8         A  32  26.552  16.205 -12.881
  336    H61    A  32           H61        A  32  24.348  21.973 -13.159
  337    H62    A  32           H62        A  32  25.577  20.872 -13.742
  338    H2     A  32           H2         A  32  22.156  19.803  -9.903
  339    H5'    A  33           H5'        A  33  20.234  12.202 -10.733
  340   H5''    A  33          H5''        A  33  19.077  12.176 -12.078
  341    H4'    A  33           H4'        A  33  18.671  13.758  -9.971
  342    H3'    A  33           H3'        A  33  18.226  14.137 -12.925
  343    H2'    A  33          H2''        A  33  17.747  16.394 -12.740
  344   HO2'    A  33          H2'         A  33  16.910  17.322 -10.888
  345    H1'    A  33           H1'        A  33  19.302  17.037 -10.504
  346    H8     A  33           H8         A  33  21.295  15.272 -13.223
  347    H61    A  33           H61        A  33  21.768  20.782 -15.984
  348    H62    A  33           H62        A  33  22.399  19.153 -15.909
  349    H2     A  33           H2         A  33  18.826  21.159 -12.619
  350    H5'    A  34           H5'        A  34  14.995  15.792 -10.601
  351   H5''    A  34          H5''        A  34  13.404  15.501 -11.330
  352    H4'    A  34           H4'        A  34  13.853  17.931 -10.770
  353    H3'    A  34           H3'        A  34  13.123  16.783 -13.439
  354    H2'    A  34          H2''        A  34  13.683  18.649 -14.663
  355   HO2'    A  34          H2'         A  34  13.015  20.187 -12.358
  356    H1'    A  34           H1'        A  34  15.344  20.009 -12.771
  357    H8     A  34           H8         A  34  16.568  16.675 -14.249
  358    H61    A  34           H61        A  34  19.344  20.128 -18.552
  359    H62    A  34           H62        A  34  19.302  18.564 -17.770
  360    H2     A  34           H2         A  34  16.560  22.774 -16.236
  361    H5'    C  35           H5'        C  35   9.470  17.431 -15.796
  362   H5''    C  35          H5''        C  35  11.027  16.763 -15.263
  363    H4'    C  35           H4'        C  35  11.010  19.713 -15.711
  364    H3'    C  35           H3'        C  35   9.767  18.007 -17.632
  365    H2'    C  35          H2''        C  35  11.621  17.014 -18.557
  366   HO2'    C  35          H2'         C  35  12.818  18.469 -19.981
  367    H1'    C  35           H1'        C  35  13.653  18.995 -17.818
  368    H41    C  35           H41        C  35  17.012  13.611 -18.004
  369    H42    C  35           H42        C  35  15.701  12.698 -17.291
  370    H5     C  35           H5         C  35  13.630  13.708 -16.580
  371    H6     C  35           H6         C  35  12.309  15.772 -16.547
  372    H5'    U  36           H5'        U  36   8.324  23.179 -16.903
  373   H5''    U  36          H5''        U  36   7.287  23.291 -18.341
  374    H4'    U  36           H4'        U  36   8.636  25.316 -18.242
  375    H3'    U  36           H3'        U  36   9.062  23.204 -20.301
  376    H2'    U  36          H2''        U  36  11.162  23.796 -20.936
  377   HO2'    U  36          H2'         U  36  10.303  26.442 -20.393
  378    H1'    U  36           H1'        U  36  11.958  25.436 -18.731
  379    H3     U  36           H3         U  36  15.349  22.632 -20.119
  380    H5     U  36           H5         U  36  13.119  20.563 -17.214
  381    H6     U  36           H6         U  36  11.376  22.182 -17.460
  382    H5'    A  37           H5'        A  37   8.504  27.166 -22.074
  383   H5''    A  37          H5''        A  37   7.297  27.383 -23.357
  384    H4'    A  37           H4'        A  37   9.325  28.356 -24.212
  385    H3'    A  37           H3'        A  37   8.640  25.575 -25.151
  386    H2'    A  37          H2''        A  37  10.519  25.406 -26.468
  387   HO2'    A  37          H2'         A  37  10.927  27.136 -27.603
  388    H1'    A  37           H1'        A  37  12.303  26.692 -24.705
  389    H8     A  37           H8         A  37   9.978  24.262 -22.912
  390    H61    A  37           H61        A  37  14.020  19.843 -24.427
  391    H62    A  37           H62        A  37  12.685  20.273 -23.381
  392    H2     A  37           H2         A  37  15.149  23.578 -26.640
  393    H5'    C  38           H5'        C  38   9.153  27.931 -29.093
  394   H5''    C  38          H5''        C  38   8.233  26.971 -30.268
  395    H4'    C  38           H4'        C  38  10.812  27.253 -30.628
  396    H3'    C  38           H3'        C  38   9.097  24.776 -30.769
  397    H2'    C  38          H2''        C  38  10.912  23.379 -31.104
  398   HO2'    C  38          H2'         C  38  12.628  23.933 -32.258
  399    H1'    C  38           H1'        C  38  12.870  24.853 -29.707
  400    H41    C  38           H41        C  38  11.694  19.541 -26.391
  401    H42    C  38           H42        C  38  10.138  20.163 -25.892
  402    H5     C  38           H5         C  38   9.308  22.327 -26.569
  403    H6     C  38           H6         C  38   9.712  24.275 -27.984
  404    H5'    A  39           H5'        A  39  10.114  24.749 -35.256
  405   H5''    A  39          H5''        A  39   8.883  23.612 -35.837
  406    H4'    A  39           H4'        A  39  11.436  22.858 -35.593
  407    H3'    A  39           H3'        A  39   8.843  21.427 -35.042
  408    H2'    A  39          H2''        A  39   9.893  19.638 -34.041
  409   HO2'    A  39          H2'         A  39  12.118  20.302 -35.684
  410    H1'    A  39           H1'        A  39  12.334  20.947 -33.286
  411    H8     A  39           H8         A  39   9.160  22.219 -31.593
  412    H61    A  39           H61        A  39   9.908  17.584 -27.565
  413    H62    A  39           H62        A  39   9.094  19.103 -27.875
  414    H2     A  39           H2         A  39  12.835  17.005 -30.913
  415    H5'    A  40           H5'        A  40  11.444  19.745 -38.473
  416   H5''    A  40          H5''        A  40  10.596  18.723 -39.652
  417    H4'    A  40           H4'        A  40  12.614  17.549 -38.844
  418    H3'    A  40           H3'        A  40   9.873  16.635 -37.888
  419    H2'    A  40          H2''        A  40  10.822  14.862 -36.707
  420   HO2'    A  40          H2'         A  40  12.180  14.091 -38.365
  421    H1'    A  40           H1'        A  40  13.118  16.207 -35.869
  422    H8     A  40           H8         A  40   9.741  18.053 -35.511
  423    H61    A  40           H61        A  40   9.193  15.125 -30.092
  424    H62    A  40           H62        A  40   8.566  16.407 -31.102
  425    H2     A  40           H2         A  40  12.915  13.637 -32.106
  426    H5'    U  41           H5'        U  41  10.858  12.971 -40.563
  427   H5''    U  41          H5''        U  41   9.349  12.038 -40.530
  428    H4'    U  41           H4'        U  41  11.517  11.271 -39.125
  429    H3'    U  41           H3'        U  41   8.551  11.162 -38.492
  430    H2'    U  41          H2''        U  41   8.966  10.367 -36.339
  431   HO2'    U  41          H2'         U  41  10.185   8.603 -36.658
  432    H1'    U  41           H1'        U  41  11.483  11.588 -35.937
  433    H3     U  41           H3         U  41   8.598  12.438 -32.472
  434    H5     U  41           H5         U  41   7.384  15.017 -35.577
  435    H6     U  41           H6         U  41   8.989  13.921 -37.030
  436    H5'    C  42           H5'        C  42  10.056   6.560 -38.497
  437   H5''    C  42          H5''        C  42   8.509   5.707 -38.670
  438    H4'    C  42           H4'        C  42   9.976   5.106 -36.615
  439    H3'    C  42           H3'        C  42   7.051   5.865 -36.675
  440    H2'    C  42          H2''        C  42   6.865   5.750 -34.361
  441   HO2'    C  42          H2'         C  42   7.916   4.327 -33.181
  442    H1'    C  42           H1'        C  42   9.454   6.578 -33.685
  443    H41    C  42           H41        C  42   5.475  11.318 -32.216
  444    H42    C  42           H42        C  42   5.225  11.683 -33.907
  445    H5     C  42           H5         C  42   6.273  10.442 -35.693
  446    H6     C  42           H6         C  42   7.696   8.527 -36.236
  447    H5'    A  43           H5'        A  43   5.957   1.479 -35.609
  448   H5''    A  43          H5''        A  43   4.242   1.610 -36.043
  449    H4'    A  43           H4'        A  43   5.027   1.574 -33.480
  450    H3'    A  43           H3'        A  43   2.885   3.191 -34.890
  451    H2'    A  43          H2''        A  43   2.338   4.289 -32.927
  452   HO2'    A  43          H2'         A  43   3.420   2.002 -31.676
  453    H1'    A  43           H1'        A  43   4.916   4.288 -31.762
  454    H8     A  43           H8         A  43   5.004   5.861 -35.190
  455    H61    A  43           H61        A  43   2.516  10.908 -32.613
  456    H62    A  43           H62        A  43   3.374  10.278 -34.001
  457    H2     A  43           H2         A  43   2.454   7.612 -29.570
  458    H5'    G  44           H5'        G  44   0.532   0.137 -31.584
  459   H5''    G  44          H5''        G  44  -1.106   0.437 -32.196
  460    H4'    G  44           H4'        G  44  -0.533   0.802 -29.616
  461    H3'    G  44           H3'        G  44  -2.215   2.434 -31.532
  462    H2'    G  44          H2''        G  44  -2.706   4.007 -29.880
  463   HO2'    G  44          H2'         G  44  -2.423   3.589 -27.671
  464    H1'    G  44           H1'        G  44  -0.217   3.983 -28.593
  465    H8     G  44           H8         G  44   0.689   4.359 -32.131
  466    H1     G  44           H1         G  44  -2.187   9.603 -29.830
  467    H21    G  44           H21        G  44  -3.090   9.173 -27.866
  468    H22    G  44           H22        G  44  -3.174   7.552 -27.213
  469    H5'    C  45           H5'        C  45  -4.365   2.512 -28.428
  470   H5''    C  45          H5''        C  45  -6.022   1.897 -28.582
  471    H4'    C  45           H4'        C  45  -6.236   4.105 -27.672
  472    H3'    C  45           H3'        C  45  -6.732   3.858 -30.649
  473    H2'    C  45          H2''        C  45  -7.112   6.124 -30.855
  474   HO2'    C  45          H2'         C  45  -8.369   7.065 -29.475
  475    H1'    C  45           H1'        C  45  -5.448   6.994 -28.730
  476    H41    C  45           H41        C  45  -3.097   9.177 -34.216
  477    H42    C  45           H42        C  45  -2.755   7.556 -34.773
  478    H5     C  45           H5         C  45  -3.183   5.584 -33.438
  479    H6     C  45           H6         C  45  -4.172   4.744 -31.364
  480    H5'    U  46           H5'        U  46 -10.886   5.796 -28.719
  481   H5''    U  46          H5''        U  46 -11.907   5.477 -30.134
  482    H4'    U  46           H4'        U  46 -11.586   7.963 -29.235
  483    H3'    U  46           H3'        U  46 -11.712   6.823 -32.024
  484    H2'    U  46          H2''        U  46 -11.151   8.830 -33.028
  485   HO2'    U  46          H2'         U  46 -12.038  10.102 -30.644
  486    H1'    U  46           H1'        U  46  -9.562   9.945 -31.000
  487    H3     U  46           H3         U  46  -7.111   9.917 -34.830
  488    H5     U  46           H5         U  46  -7.197   5.889 -33.602
  489    H6     U  46           H6         U  46  -8.780   6.518 -31.875
  490    H5'    C  47           H5'        C  47 -14.434  10.480 -31.687
  491   H5''    C  47          H5''        C  47 -15.896  10.074 -32.608
  492    H4'    C  47           H4'        C  47 -15.102  12.285 -33.307
  493    H3'    C  47           H3'        C  47 -14.681   9.949 -35.189
  494    H2'    C  47          H2''        C  47 -13.869  11.418 -36.838
  495   HO2'    C  47          H2'         C  47 -14.638  13.626 -35.224
  496    H1'    C  47           H1'        C  47 -12.351  12.980 -35.090
  497    H41    C  47           H41        C  47  -8.102   8.994 -37.549
  498    H42    C  47           H42        C  47  -8.763   7.660 -36.630
  499    H5     C  47           H5         C  47 -10.593   7.920 -35.085
  500    H6     C  47           H6         C  47 -12.470   9.362 -34.443
  501    H5'    C  48           H5'        C  48 -17.128  12.963 -37.363
  502   H5''    C  48          H5''        C  48 -18.263  12.127 -38.442
  503    H4'    C  48           H4'        C  48 -16.797  13.782 -39.645
  504    H3'    C  48           H3'        C  48 -16.881  10.825 -40.170
  505   HO3'    C  48          H3T         C  48 -18.564  12.138 -40.902
  506    H2'    C  48          H2''        C  48 -15.110  10.822 -41.638
  507   HO2'    C  48          H2'         C  48 -14.523  12.641 -42.854
  508    H1'    C  48           H1'        C  48 -13.675  13.036 -40.649
  509    H41    C  48           H41        C  48 -10.232   7.840 -39.358
  510    H42    C  48           H42        C  48 -11.442   7.267 -38.232
  511    H5     C  48           H5         C  48 -13.442   8.510 -37.711
  512    H6     C  48           H6         C  48 -14.836  10.422 -38.344
  Start of MODEL   10
    1    H5'    G   1           H5'        G   1   0.488   4.548 -41.362
    2   H5''    G   1          H5''        G   1   0.373   6.295 -41.069
    3    H4'    G   1           H4'        G   1   0.063   5.712 -43.505
    4    H3'    G   1           H3'        G   1  -2.148   6.943 -41.821
    5    H2'    G   1          H2''        G   1  -3.578   6.977 -43.783
    6   HO2'    G   1          H2'         G   1  -2.768   6.725 -45.814
    7    H1'    G   1           H1'        G   1  -2.984   4.526 -44.672
    8    H8     G   1           H8         G   1  -3.321   2.977 -41.699
    9    H1     G   1           H1         G   1  -8.266   7.048 -41.864
   10    H21    G   1           H21        G   1  -8.045   8.445 -43.558
   11    H22    G   1           H22        G   1  -6.592   8.516 -44.529
   12   HO5'    G   1          H5T         G   1  -1.098   5.792 -39.689
   13    H5'    G   2           H5'        G   2  -0.851  10.501 -44.619
   14   H5''    G   2          H5''        G   2  -0.387  11.784 -43.481
   15    H4'    G   2           H4'        G   2  -1.962  12.680 -45.165
   16    H3'    G   2           H3'        G   2  -2.583  12.425 -42.250
   17    H2'    G   2          H2''        G   2  -4.866  12.822 -42.418
   18   HO2'    G   2          H2'         G   2  -4.752  14.709 -43.650
   19    H1'    G   2           H1'        G   2  -5.452  11.570 -44.759
   20    H8     G   2           H8         G   2  -3.239   9.034 -43.402
   21    H1     G   2           H1         G   2  -8.238   9.875 -39.483
   22    H21    G   2           H21        G   2  -9.261  11.771 -39.973
   23    H22    G   2           H22        G   2  -8.834  12.728 -41.374
   24    H5'    G   3           H5'        G   3  -2.853  17.288 -42.125
   25   H5''    G   3          H5''        G   3  -2.473  17.354 -40.393
   26    H4'    G   3           H4'        G   3  -4.877  18.095 -41.309
   27    H3'    G   3           H3'        G   3  -4.080  16.535 -38.835
   28    H2'    G   3          H2''        G   3  -6.317  16.369 -38.158
   29   HO2'    G   3          H2'         G   3  -6.899  18.285 -40.188
   30    H1'    G   3           H1'        G   3  -7.349  15.737 -40.636
   31    H8     G   3           H8         G   3  -4.388  13.682 -40.835
   32    H1     G   3           H1         G   3  -8.215  11.674 -36.099
   33    H21    G   3           H21        G   3  -9.720  13.214 -35.635
   34    H22    G   3           H22        G   3  -9.675  14.809 -36.352
   35    H5'    G   4           H5'        G   4  -6.366  18.698 -36.970
   36   H5''    G   4          H5''        G   4  -5.639  19.934 -35.924
   37    H4'    G   4           H4'        G   4  -7.107  18.857 -34.436
   38    H3'    G   4           H3'        G   4  -4.323  17.698 -34.410
   39    H2'    G   4          H2''        G   4  -4.889  15.986 -32.979
   40   HO2'    G   4          H2'         G   4  -5.991  16.571 -31.296
   41    H1'    G   4           H1'        G   4  -7.498  15.533 -33.838
   42    H8     G   4           H8         G   4  -4.901  15.725 -36.659
   43    H1     G   4           H1         G   4  -5.062  10.086 -33.601
   44    H21    G   4           H21        G   4  -6.415  10.225 -31.854
   45    H22    G   4           H22        G   4  -7.116  11.741 -31.335
   46    H5'    U   5           H5'        U   5  -5.582  18.724 -29.665
   47   H5''    U   5          H5''        U   5  -3.930  18.669 -29.019
   48    H4'    U   5           H4'        U   5  -5.816  17.074 -28.025
   49    H3'    U   5           H3'        U   5  -2.898  16.645 -28.634
   50    H2'    U   5          H2''        U   5  -2.975  14.358 -28.253
   51   HO2'    U   5          H2'         U   5  -3.971  13.659 -26.556
   52    H1'    U   5           H1'        U   5  -5.569  13.807 -29.082
   53    H3     U   5           H3         U   5  -2.589  11.377 -31.566
   54    H5     U   5           H5         U   5  -2.378  15.279 -33.141
   55    H6     U   5           H6         U   5  -3.883  15.996 -31.377
   56    H5'    U   6           H5'        U   6  -3.814  14.826 -24.601
   57   H5''    U   6          H5''        U   6  -2.504  15.356 -23.529
   58    H4'    U   6           H4'        U   6  -2.842  12.928 -23.300
   59    H3'    U   6           H3'        U   6  -0.351  14.011 -24.630
   60    H2'    U   6          H2''        U   6   0.484  11.853 -25.002
   61   HO2'    U   6          H2'         U   6   0.294  10.704 -23.221
   62    H1'    U   6           H1'        U   6  -1.916  10.609 -25.627
   63    H3     U   6           H3         U   6   0.557  10.485 -29.438
   64    H5     U   6           H5         U   6  -0.556  14.531 -29.070
   65    H6     U   6           H6         U   6  -1.547  13.994 -26.925
   66    H5'    G   7           H5'        G   7   1.938  12.609 -20.859
   67   H5''    G   7          H5''        G   7   3.472  13.456 -21.141
   68    H4'    G   7           H4'        G   7   3.220  10.818 -21.597
   69    H3'    G   7           H3'        G   7   4.748  12.999 -23.033
   70    H2'    G   7          H2''        G   7   5.341  11.593 -24.778
   71   HO2'    G   7          H2'         G   7   5.904   9.563 -24.475
   72    H1'    G   7           H1'        G   7   3.129   9.834 -24.693
   73    H8     G   7           H8         G   7   1.811  13.268 -25.247
   74    H1     G   7           H1         G   7   5.002  11.020 -30.337
   75    H21    G   7           H21        G   7   6.083   9.177 -29.797
   76    H22    G   7           H22        G   7   6.188   8.610 -28.145
   77    H5'    G   8           H5'        G   8   8.169   9.387 -21.659
   78   H5''    G   8          H5''        G   8   9.531  10.492 -21.929
   79    H4'    G   8           H4'        G   8   9.521   8.115 -23.093
   80    H3'    G   8           H3'        G   8  10.210  10.834 -24.240
   81    H2'    G   8          H2''        G   8  10.742   9.854 -26.320
   82   HO2'    G   8          H2'         G   8  11.089   7.677 -26.585
   83    H1'    G   8           H1'        G   8   8.630   8.104 -26.412
   84    H8     G   8           H8         G   8   7.157  11.247 -25.075
   85    H1     G   8           H1         G   8   8.839  11.814 -31.233
   86    H21    G   8           H21        G   8  10.126  10.127 -31.826
   87    H22    G   8           H22        G   8  10.696   8.935 -30.679
   88    H5'    U   9           H5'        U   9  14.014   8.769 -24.406
   89   H5''    U   9          H5''        U   9  15.375   9.735 -23.802
   90    H4'    U   9           H4'        U   9  15.745   9.054 -26.161
   91    H3'    U   9           H3'        U   9  15.445  11.878 -25.227
   92    H2'    U   9          H2''        U   9  15.132  12.821 -27.297
   93   HO2'    U   9          H2'         U   9  16.612  10.630 -28.350
   94    H1'    U   9           H1'        U   9  14.186  10.605 -28.767
   95    H3     U   9           H3         U   9  11.434  14.210 -29.417
   96    H5     U   9           H5         U   9  10.159  12.424 -25.833
   97    H6     U   9           H6         U   9  12.201  11.099 -25.840
   98    H5'    G  10           H5'        G  10  18.790  12.194 -27.763
   99   H5''    G  10          H5''        G  10  20.156  13.041 -27.011
  100    H4'    G  10           H4'        G  10  19.388  14.141 -29.134
  101    H3'    G  10           H3'        G  10  19.426  15.396 -26.413
  102    H2'    G  10          H2''        G  10  18.168  17.224 -26.969
  103   HO2'    G  10          H2'         G  10  19.468  18.093 -28.512
  104    H1'    G  10           H1'        G  10  16.777  16.251 -29.231
  105    H8     G  10           H8         G  10  15.957  14.173 -26.214
  106    H1     G  10           H1         G  10  13.089  19.907 -26.140
  107    H21    G  10           H21        G  10  13.928  21.195 -27.721
  108    H22    G  10           H22        G  10  15.314  20.720 -28.675
  109    H5'    U  11           H5'        U  11  22.107  18.789 -29.170
  110   H5''    U  11          H5''        U  11  22.806  19.450 -27.680
  111    H4'    U  11           H4'        U  11  21.481  21.032 -29.361
  112    H3'    U  11           H3'        U  11  21.526  20.882 -26.346
  113    H2'    U  11          H2''        U  11  19.857  22.488 -26.116
  114   HO2'    U  11          H2'         U  11  20.729  24.084 -27.411
  115    H1'    U  11           H1'        U  11  18.351  21.897 -28.380
  116    H3     U  11           H3         U  11  15.774  21.418 -24.623
  117    H5     U  11           H5         U  11  17.949  17.828 -24.953
  118    H6     U  11           H6         U  11  19.279  18.871 -26.695
  119    H5'    A  12           H5'        A  12  23.363  25.188 -26.626
  120   H5''    A  12          H5''        A  12  23.800  25.417 -24.921
  121    H4'    A  12           H4'        A  12  21.668  26.648 -25.984
  122    H3'    A  12           H3'        A  12  22.181  25.416 -23.276
  123    H2'    A  12          H2''        A  12  19.970  25.725 -22.573
  124   HO2'    A  12          H2'         A  12  19.822  27.912 -23.291
  125    H1'    A  12           H1'        A  12  18.687  25.119 -24.935
  126    H8     A  12           H8         A  12  21.351  22.513 -24.582
  127    H61    A  12           H61        A  12  17.732  19.785 -20.379
  128    H62    A  12           H62        A  12  19.079  19.568 -21.472
  129    H2     A  12           H2         A  12  16.118  23.897 -21.149
  130    H5'    U  13           H5'        U  13  20.720  29.416 -21.537
  131   H5''    U  13          H5''        U  13  21.579  29.301 -19.989
  132    H4'    U  13           H4'        U  13  18.925  29.157 -20.069
  133    H3'    U  13           H3'        U  13  20.975  27.638 -18.452
  134    H2'    U  13          H2''        U  13  19.363  26.198 -17.548
  135   HO2'    U  13          H2'         U  13  17.333  26.806 -17.137
  136    H1'    U  13           H1'        U  13  17.548  26.165 -19.658
  137    H3     U  13           H3         U  13  18.939  21.936 -18.425
  138    H5     U  13           H5         U  13  21.906  23.409 -21.028
  139    H6     U  13           H6         U  13  20.839  25.577 -20.920
  140    H5'    U  14           H5'        U  14  17.796  28.684 -15.850
  141   H5''    U  14          H5''        U  14  18.392  29.682 -14.507
  142    H4'    U  14           H4'        U  14  16.943  27.973 -13.563
  143    H3'    U  14           H3'        U  14  19.900  27.927 -13.169
  144    H2'    U  14          H2''        U  14  20.071  25.761 -12.458
  145   HO2'    U  14          H2'         U  14  17.523  26.262 -11.382
  146    H1'    U  14           H1'        U  14  17.761  24.608 -13.539
  147    H3     U  14           H3         U  14  20.938  21.831 -15.087
  148    H5     U  14           H5         U  14  21.875  25.501 -16.927
  149    H6     U  14           H6         U  14  20.135  26.539 -15.591
  150    H5'    U  15           H5'        U  15  17.839  27.069  -8.750
  151   H5''    U  15          H5''        U  15  19.255  27.349  -7.720
  152    H4'    U  15           H4'        U  15  18.022  24.988  -7.702
  153    H3'    U  15           H3'        U  15  20.900  25.812  -7.536
  154    H2'    U  15          H2''        U  15  21.766  23.735  -7.969
  155   HO2'    U  15          H2'         U  15  21.127  22.253  -6.645
  156    H1'    U  15           H1'        U  15  19.585  22.523  -9.311
  157    H3     U  15           H3         U  15  23.289  21.673 -11.806
  158    H5     U  15           H5         U  15  22.537  25.774 -12.397
  159    H6     U  15           H6         U  15  20.836  25.647 -10.679
  160    H5'    U  16           H5'        U  16  20.155  22.380  -4.233
  161   H5''    U  16          H5''        U  16  21.314  22.889  -2.988
  162    H4'    U  16           H4'        U  16  21.519  20.452  -3.782
  163    H3'    U  16           H3'        U  16  23.643  22.565  -3.618
  164    H2'    U  16          H2''        U  16  25.207  21.414  -4.826
  165   HO2'    U  16          H2'         U  16  25.667  19.528  -4.054
  166    H1'    U  16           H1'        U  16  23.546  19.654  -6.296
  167    H3     U  16           H3         U  16  26.352  21.447  -9.366
  168    H5     U  16           H5         U  16  23.956  24.695  -8.162
  169    H6     U  16           H6         U  16  22.982  23.264  -6.463
  170    H5'    U  17           H5'        U  17  25.659  18.594  -1.323
  171   H5''    U  17          H5''        U  17  26.946  19.522  -0.530
  172    H4'    U  17           H4'        U  17  27.551  17.531  -2.193
  173    H3'    U  17           H3'        U  17  28.770  20.244  -1.730
  174    H2'    U  17          H2''        U  17  30.104  20.174  -3.592
  175   HO2'    U  17          H2'         U  17  30.184  17.438  -3.006
  176    H1'    U  17           H1'        U  17  28.663  18.276  -5.152
  177    H3     U  17           H3         U  17  29.731  21.721  -7.903
  178    H5     U  17           H5         U  17  26.780  23.305  -5.347
  179    H6     U  17           H6         U  17  26.910  21.261  -4.044
  180    H5'    A  18           H5'        A  18  32.290  16.814  -1.675
  181   H5''    A  18          H5''        A  18  33.540  17.696  -0.775
  182    H4'    A  18           H4'        A  18  34.180  16.686  -3.097
  183    H3'    A  18           H3'        A  18  34.691  19.449  -1.994
  184    H2'    A  18          H2''        A  18  35.473  20.263  -3.989
  185   HO2'    A  18          H2'         A  18  37.028  19.224  -4.919
  186    H1'    A  18           H1'        A  18  34.270  18.359  -5.756
  187    H8     A  18           H8         A  18  31.872  20.636  -3.878
  188    H61    A  18           H61        A  18  32.814  24.733  -8.407
  189    H62    A  18           H62        A  18  31.759  24.263  -7.093
  190    H2     A  18           H2         A  18  35.762  21.387  -8.917
  191    H5'    A  19           H5'        A  19  39.242  17.819  -3.255
  192   H5''    A  19          H5''        A  19  40.088  19.061  -2.312
  193    H4'    A  19           H4'        A  19  40.478  18.866  -4.937
  194    H3'    A  19           H3'        A  19  40.182  21.254  -3.116
  195    H2'    A  19          H2''        A  19  40.116  22.752  -4.862
  196   HO2'    A  19          H2'         A  19  41.720  20.841  -6.189
  197    H1'    A  19           H1'        A  19  39.212  20.994  -6.918
  198    H8     A  19           H8         A  19  36.820  21.507  -3.991
  199    H61    A  19           H61        A  19  34.922  26.621  -6.893
  200    H62    A  19           H62        A  19  34.566  25.468  -5.627
  201    H2     A  19           H2         A  19  38.561  25.083  -9.018
  202    H5'    A  20           H5'        A  20  43.947  21.977  -5.828
  203   H5''    A  20          H5''        A  20  44.932  23.054  -4.821
  204    H4'    A  20           H4'        A  20  44.326  23.937  -7.159
  205    H3'    A  20           H3'        A  20  43.845  25.300  -4.508
  206    H2'    A  20          H2''        A  20  42.744  27.088  -5.486
  207   HO2'    A  20          H2'         A  20  43.339  27.936  -7.346
  208    H1'    A  20           H1'        A  20  41.674  25.766  -7.733
  209    H8     A  20           H8         A  20  40.939  24.391  -4.194
  210    H61    A  20           H61        A  20  36.022  28.134  -4.249
  211    H62    A  20           H62        A  20  36.921  26.952  -3.323
  212    H2     A  20           H2         A  20  38.490  29.033  -7.883
  213    H5'    U  21           H5'        U  21  45.387  28.351  -6.911
  214   H5''    U  21          H5''        U  21  46.414  29.444  -5.962
  215    H4'    U  21           H4'        U  21  44.404  30.600  -6.920
  216    H3'    U  21           H3'        U  21  44.969  30.308  -3.977
  217    H2'    U  21          H2''        U  21  42.955  31.262  -3.324
  218   HO2'    U  21          H2'         U  21  42.044  32.873  -4.373
  219    H1'    U  21           H1'        U  21  41.337  30.426  -5.433
  220    H3     U  21           H3         U  21  39.403  28.620  -1.760
  221    H5     U  21           H5         U  21  43.125  26.653  -1.980
  222    H6     U  21           H6         U  21  43.658  28.020  -3.911
  223    H5'    U  22           H5'        U  22  43.776  34.210  -5.236
  224   H5''    U  22          H5''        U  22  44.839  35.527  -4.701
  225    H4'    U  22           H4'        U  22  42.425  36.135  -4.457
  226    H3'    U  22           H3'        U  22  44.324  35.799  -2.133
  227    H2'    U  22          H2''        U  22  42.702  35.766  -0.545
  228   HO2'    U  22          H2'         U  22  41.364  37.681  -2.166
  229    H1'    U  22           H1'        U  22  40.419  35.521  -2.359
  230    H3     U  22           H3         U  22  39.682  33.525   1.802
  231    H5     U  22           H5         U  22  41.238  30.637  -0.840
  232    H6     U  22           H6         U  22  41.918  32.454  -2.310
  233    H5'    A  23           H5'        A  23  45.074  38.215   0.783
  234   H5''    A  23          H5''        A  23  43.634  37.184   0.673
  235    H4'    A  23           H4'        A  23  43.834  38.710   2.755
  236    H3'    A  23           H3'        A  23  41.605  37.954   1.063
  237    H2'    A  23          H2''        A  23  40.375  39.873   0.989
  238   HO2'    A  23          H2'         A  23  39.611  39.841   3.006
  239    H1'    A  23           H1'        A  23  42.071  41.835   2.099
  240    H8     A  23           H8         A  23  43.699  40.704  -1.030
  241    H61    A  23           H61        A  23  39.569  44.018  -4.205
  242    H62    A  23           H62        A  23  41.043  43.080  -4.298
  243    H2     A  23           H2         A  23  38.044  43.559  -0.020
  244    H5'    A  24           H5'        A  24  38.395  36.900   4.118
  245   H5''    A  24          H5''        A  24  37.633  36.083   2.742
  246    H4'    A  24           H4'        A  24  37.289  38.799   3.569
  247    H3'    A  24           H3'        A  24  36.314  36.862   1.534
  248    H2'    A  24          H2''        A  24  36.201  38.310  -0.203
  249   HO2'    A  24          H2'         A  24  35.318  40.434   1.438
  250    H1'    A  24           H1'        A  24  37.365  40.671   1.087
  251    H8     A  24           H8         A  24  39.794  38.183  -0.232
  252    H61    A  24           H61        A  24  39.130  40.801  -5.794
  253    H62    A  24           H62        A  24  39.964  39.563  -4.883
  254    H2     A  24           H2         A  24  35.931  42.416  -3.092
  255    H5'    U  25           H5'        U  25  33.484  35.315   0.796
  256   H5''    U  25          H5''        U  25  34.312  36.879   0.687
  257    H4'    U  25           H4'        U  25  31.641  36.100  -0.290
  258    H3'    U  25           H3'        U  25  33.886  37.326  -1.270
  259    H2'    U  25          H2''        U  25  33.785  39.361  -0.113
  260   HO2'    U  25          H2'         U  25  33.542  40.061  -2.205
  261    H1'    U  25           H1'        U  25  30.808  39.518  -0.255
  262    H3     U  25           H3         U  25  30.594  42.801   2.771
  263    H5     U  25           H5         U  25  34.090  40.746   3.913
  264    H6     U  25           H6         U  25  33.716  39.210   2.074
  265    H5'    U  26           H5'        U  26  35.363  38.345  -2.133
  266   H5''    U  26          H5''        U  26  34.695  39.085  -3.600
  267    H4'    U  26           H4'        U  26  36.891  38.787  -4.331
  268    H3'    U  26           H3'        U  26  35.139  36.452  -4.872
  269    H2'    U  26          H2''        U  26  36.727  34.813  -4.996
  270   HO2'    U  26          H2'         U  26  38.628  36.811  -5.709
  271    H1'    U  26           H1'        U  26  38.821  35.870  -3.507
  272    H3     U  26           H3         U  26  38.003  31.927  -1.485
  273    H5     U  26           H5         U  26  34.586  34.218  -0.585
  274    H6     U  26           H6         U  26  35.437  35.964  -2.016
  275    H5'    C  27           H5'        C  27  36.237  37.224  -9.777
  276   H5''    C  27          H5''        C  27  34.918  36.121 -10.214
  277    H4'    C  27           H4'        C  27  37.432  35.546 -10.881
  278    H3'    C  27           H3'        C  27  35.127  33.878  -9.917
  279    H2'    C  27          H2''        C  27  36.388  32.008  -9.479
  280   HO2'    C  27          H2'         C  27  38.177  32.968 -11.472
  281    H1'    C  27           H1'        C  27  38.945  33.211  -9.152
  282    H41    C  27           H41        C  27  37.643  30.619  -3.506
  283    H42    C  27           H42        C  27  36.054  31.351  -3.466
  284    H5     C  27           H5         C  27  35.135  32.597  -5.315
  285    H6     C  27           H6         C  27  35.613  33.588  -7.504
  286    H5'    U  28           H5'        U  28  35.971  32.584 -14.707
  287   H5''    U  28          H5''        U  28  34.919  31.177 -14.969
  288    H4'    U  28           H4'        U  28  37.590  30.945 -15.121
  289    H3'    U  28           H3'        U  28  35.513  29.136 -13.843
  290    H2'    U  28          H2''        U  28  37.168  27.586 -13.260
  291   HO2'    U  28          H2'         U  28  38.964  29.064 -14.915
  292    H1'    U  28           H1'        U  28  39.015  29.448 -12.385
  293    H3     U  28           H3         U  28  37.142  26.822  -9.050
  294    H5     U  28           H5         U  28  34.514  30.057  -9.605
  295    H6     U  28           H6         U  28  35.821  30.721 -11.522
  296    H5'    U  29           H5'        U  29  37.444  26.547 -16.819
  297   H5''    U  29          H5''        U  29  36.450  25.112 -17.134
  298    H4'    U  29           H4'        U  29  38.717  24.882 -15.775
  299    H3'    U  29           H3'        U  29  36.013  23.617 -15.463
  300    H2'    U  29          H2''        U  29  36.434  22.716 -13.383
  301   HO2'    U  29          H2'         U  29  38.430  22.051 -12.723
  302    H1'    U  29           H1'        U  29  38.328  24.543 -12.411
  303    H3     U  29           H3         U  29  34.709  23.935  -9.585
  304    H5     U  29           H5         U  29  33.588  26.945 -12.303
  305    H6     U  29           H6         U  29  35.603  26.468 -13.568
  306    H5'    A  30           H5'        A  30  38.036  20.548 -14.042
  307   H5''    A  30          H5''        A  30  37.860  19.170 -15.144
  308    H4'    A  30           H4'        A  30  37.189  18.266 -13.066
  309    H3'    A  30           H3'        A  30  34.905  19.277 -14.755
  310    H2'    A  30          H2''        A  30  33.346  18.939 -13.085
  311   HO2'    A  30          H2'         A  30  33.322  17.164 -11.942
  312    H1'    A  30           H1'        A  30  35.105  19.104 -10.841
  313    H8     A  30           H8         A  30  34.665  22.154 -13.162
  314    H61    A  30           H61        A  30  29.919  23.664  -9.501
  315    H62    A  30           H62        A  30  31.011  24.230 -10.745
  316    H2     A  30           H2         A  30  31.395  19.608  -8.273
  317    H5'    A  31           H5'        A  31  34.037  14.903 -13.136
  318   H5''    A  31          H5''        A  31  32.913  14.240 -14.337
  319    H4'    A  31           H4'        A  31  32.129  14.133 -11.896
  320    H3'    A  31           H3'        A  31  30.666  15.337 -14.240
  321    H2'    A  31          H2''        A  31  28.998  16.237 -12.942
  322   HO2'    A  31          H2'         A  31  28.001  15.020 -11.556
  323    H1'    A  31           H1'        A  31  30.379  16.340 -10.437
  324    H8     A  31           H8         A  31  31.513  18.433 -13.486
  325    H61    A  31           H61        A  31  27.745  22.815 -11.284
  326    H62    A  31           H62        A  31  29.022  22.455 -12.424
  327    H2     A  31           H2         A  31  27.175  19.114  -8.813
  328    H5'    A  32           H5'        A  32  27.749  11.715 -12.375
  329   H5''    A  32          H5''        A  32  26.551  11.666 -13.683
  330    H4'    A  32           H4'        A  32  25.794  12.146 -11.172
  331    H3'    A  32           H3'        A  32  24.906  13.256 -13.824
  332    H2'    A  32          H2''        A  32  23.694  14.980 -12.915
  333   HO2'    A  32          H2'         A  32  22.253  14.483 -11.487
  334    H1'    A  32           H1'        A  32  24.962  15.170 -10.370
  335    H8     A  32           H8         A  32  27.158  15.908 -13.414
  336    H61    A  32           H61        A  32  24.858  21.641 -13.226
  337    H62    A  32           H62        A  32  26.103  20.611 -13.896
  338    H2     A  32           H2         A  32  22.682  19.170 -10.180
  339    H5'    A  33           H5'        A  33  20.906  11.705 -11.357
  340   H5''    A  33          H5''        A  33  19.736  11.682 -12.690
  341    H4'    A  33           H4'        A  33  19.264  13.143 -10.516
  342    H3'    A  33           H3'        A  33  18.789  13.620 -13.444
  343    H2'    A  33          H2''        A  33  18.274  15.857 -13.207
  344   HO2'    A  33          H2'         A  33  17.118  16.611 -11.579
  345    H1'    A  33           H1'        A  33  19.765  16.482 -10.917
  346    H8     A  33           H8         A  33  21.848  14.876 -13.666
  347    H61    A  33           H61        A  33  22.271  20.520 -16.149
  348    H62    A  33           H62        A  33  22.913  18.893 -16.157
  349    H2     A  33           H2         A  33  19.246  20.675 -12.844
  350    H5'    A  34           H5'        A  34  15.431  15.098 -11.095
  351   H5''    A  34          H5''        A  34  13.883  14.733 -11.882
  352    H4'    A  34           H4'        A  34  14.191  17.177 -11.263
  353    H3'    A  34           H3'        A  34  13.570  16.027 -13.953
  354    H2'    A  34          H2''        A  34  14.056  17.915 -15.159
  355   HO2'    A  34          H2'         A  34  13.191  19.770 -14.636
  356    H1'    A  34           H1'        A  34  15.633  19.347 -13.246
  357    H8     A  34           H8         A  34  17.032  16.059 -14.676
  358    H61    A  34           H61        A  34  19.874  19.658 -18.818
  359    H62    A  34           H62        A  34  19.849  18.082 -18.059
  360    H2     A  34           H2         A  34  16.909  22.181 -16.591
  361    H5'    C  35           H5'        C  35  10.244  16.439 -16.558
  362   H5''    C  35          H5''        C  35  11.704  15.769 -15.801
  363    H4'    C  35           H4'        C  35  11.831  18.679 -16.432
  364    H3'    C  35           H3'        C  35  10.800  16.875 -18.398
  365    H2'    C  35          H2''        C  35  12.761  15.786 -18.939
  366   HO2'    C  35          H2'         C  35  14.066  17.033 -20.415
  367    H1'    C  35           H1'        C  35  14.556  18.034 -18.134
  368    H41    C  35           H41        C  35  18.617  13.149 -18.015
  369    H42    C  35           H42        C  35  17.445  12.123 -17.218
  370    H5     C  35           H5         C  35  15.271  12.902 -16.530
  371    H6     C  35           H6         C  35  13.669  14.751 -16.653
  372    H5'    U  36           H5'        U  36   9.255  19.283 -17.561
  373   H5''    U  36          H5''        U  36   7.743  19.626 -18.426
  374    H4'    U  36           H4'        U  36   7.666  21.314 -16.822
  375    H3'    U  36           H3'        U  36   8.986  22.136 -19.366
  376    H2'    U  36          H2''        U  36  10.042  24.035 -18.552
  377   HO2'    U  36          H2'         U  36   8.021  24.814 -17.626
  378    H1'    U  36           H1'        U  36  10.582  23.294 -15.959
  379    H3     U  36           H3         U  36  13.975  23.895 -19.377
  380    H5     U  36           H5         U  36  13.880  19.931 -17.958
  381    H6     U  36           H6         U  36  11.742  20.412 -16.938
  382    H5'    A  37           H5'        A  37   8.340  25.973 -19.321
  383   H5''    A  37          H5''        A  37   7.023  26.176 -20.494
  384    H4'    A  37           H4'        A  37   8.837  27.512 -21.335
  385    H3'    A  37           H3'        A  37   8.439  24.797 -22.579
  386    H2'    A  37          H2''        A  37  10.222  25.027 -24.011
  387   HO2'    A  37          H2'         A  37  11.178  26.977 -24.538
  388    H1'    A  37           H1'        A  37  11.962  26.323 -22.207
  389    H8     A  37           H8         A  37  10.139  23.444 -20.533
  390    H61    A  37           H61        A  37  14.481  19.754 -22.908
  391    H62    A  37           H62        A  37  13.253  19.917 -21.673
  392    H2     A  37           H2         A  37  14.907  23.800 -24.803
  393    H5'    C  38           H5'        C  38   8.031  27.520 -26.421
  394   H5''    C  38          H5''        C  38   7.223  26.376 -27.510
  395    H4'    C  38           H4'        C  38   9.680  27.235 -28.051
  396    H3'    C  38           H3'        C  38   8.397  24.516 -28.294
  397    H2'    C  38          H2''        C  38  10.382  23.481 -28.894
  398   HO2'    C  38          H2'         C  38  11.359  26.061 -29.596
  399    H1'    C  38           H1'        C  38  12.180  25.089 -27.461
  400    H41    C  38           H41        C  38  11.865  19.387 -24.623
  401    H42    C  38           H42        C  38  10.297  19.777 -23.957
  402    H5     C  38           H5         C  38   9.178  21.873 -24.365
  403    H6     C  38           H6         C  38   9.259  23.982 -25.594
  404    H5'    A  39           H5'        A  39   8.905  25.207 -32.882
  405   H5''    A  39          H5''        A  39   7.827  23.945 -33.511
  406    H4'    A  39           H4'        A  39  10.482  23.669 -33.644
  407    H3'    A  39           H3'        A  39   8.257  21.719 -33.100
  408    H2'    A  39          H2''        A  39   9.682  20.043 -32.435
  409   HO2'    A  39          H2'         A  39  11.596  21.260 -34.148
  410    H1'    A  39           H1'        A  39  11.954  21.635 -31.721
  411    H8     A  39           H8         A  39   8.864  22.174 -29.567
  412    H61    A  39           H61        A  39  10.664  17.192 -26.372
  413    H62    A  39           H62        A  39   9.645  18.614 -26.363
  414    H2     A  39           H2         A  39  13.225  17.495 -30.045
  415    H5'    A  40           H5'        A  40  10.236  20.940 -37.334
  416   H5''    A  40          H5''        A  40   9.258  19.873 -38.363
  417    H4'    A  40           H4'        A  40  11.532  18.903 -37.825
  418    H3'    A  40           H3'        A  40   8.926  17.671 -36.845
  419    H2'    A  40          H2''        A  40  10.058  15.910 -35.825
  420   HO2'    A  40          H2'         A  40  12.381  16.635 -37.304
  421    H1'    A  40           H1'        A  40  12.302  17.356 -35.002
  422    H8     A  40           H8         A  40   8.826  18.903 -34.331
  423    H61    A  40           H61        A  40   8.936  15.727 -29.025
  424    H62    A  40           H62        A  40   8.069  16.910 -29.979
  425    H2     A  40           H2         A  40  12.556  14.577 -31.410
  426    H5'    U  41           H5'        U  41  10.019  14.194 -39.602
  427   H5''    U  41          H5''        U  41   8.535  13.221 -39.560
  428    H4'    U  41           H4'        U  41  10.728  12.527 -38.148
  429    H3'    U  41           H3'        U  41   7.763  12.329 -37.528
  430    H2'    U  41          H2''        U  41   8.188  11.594 -35.350
  431   HO2'    U  41          H2'         U  41   9.467   9.835 -35.816
  432    H1'    U  41           H1'        U  41  10.663  12.877 -34.953
  433    H3     U  41           H3         U  41   7.704  13.731 -31.546
  434    H5     U  41           H5         U  41   6.462  16.196 -34.729
  435    H6     U  41           H6         U  41   8.119  15.113 -36.130
  436    H5'    C  42           H5'        C  42   9.188   7.660 -37.641
  437   H5''    C  42          H5''        C  42   7.598   6.879 -37.740
  438    H4'    C  42           H4'        C  42   9.152   6.298 -35.712
  439    H3'    C  42           H3'        C  42   6.218   7.025 -35.756
  440    H2'    C  42          H2''        C  42   6.056   6.970 -33.433
  441   HO2'    C  42          H2'         C  42   7.016   4.902 -33.203
  442    H1'    C  42           H1'        C  42   8.617   7.872 -32.796
  443    H41    C  42           H41        C  42   4.481  12.558 -31.580
  444    H42    C  42           H42        C  42   4.244  12.841 -33.287
  445    H5     C  42           H5         C  42   5.362  11.564 -35.005
  446    H6     C  42           H6         C  42   6.853   9.675 -35.446
  447    H5'    A  43           H5'        A  43   5.194   2.468 -34.812
  448   H5''    A  43          H5''        A  43   3.477   2.619 -35.238
  449    H4'    A  43           H4'        A  43   4.261   2.397 -32.682
  450    H3'    A  43           H3'        A  43   2.085   4.023 -34.012
  451    H2'    A  43          H2''        A  43   1.522   5.097 -32.033
  452   HO2'    A  43          H2'         A  43   1.294   3.277 -30.729
  453    H1'    A  43           H1'        A  43   4.067   5.233 -30.885
  454    H8     A  43           H8         A  43   4.244   6.557 -34.406
  455    H61    A  43           H61        A  43   1.569  11.723 -32.302
  456    H62    A  43           H62        A  43   2.495  11.013 -33.606
  457    H2     A  43           H2         A  43   1.421   8.646 -29.042
  458    H5'    G  44           H5'        G  44  -0.383   0.886 -30.951
  459   H5''    G  44          H5''        G  44  -1.993   1.152 -31.648
  460    H4'    G  44           H4'        G  44  -1.549   1.566 -29.048
  461    H3'    G  44           H3'        G  44  -3.186   3.089 -31.081
  462    H2'    G  44          H2''        G  44  -3.751   4.753 -29.546
  463   HO2'    G  44          H2'         G  44  -3.730   4.468 -27.365
  464    H1'    G  44           H1'        G  44  -1.325   4.889 -28.187
  465    H8     G  44           H8         G  44  -0.273   4.900 -31.709
  466    H1     G  44           H1         G  44  -3.260  10.325 -30.064
  467    H21    G  44           H21        G  44  -4.249  10.087 -28.111
  468    H22    G  44           H22        G  44  -4.348   8.540 -27.299
  469    H5'    C  45           H5'        C  45  -6.886   2.490 -28.592
  470   H5''    C  45          H5''        C  45  -8.048   2.612 -29.928
  471    H4'    C  45           H4'        C  45  -7.832   4.574 -28.139
  472    H3'    C  45           H3'        C  45  -8.119   4.693 -31.156
  473    H2'    C  45          H2''        C  45  -8.141   7.018 -31.098
  474   HO2'    C  45          H2'         C  45  -8.811   8.186 -29.406
  475    H1'    C  45           H1'        C  45  -6.326   7.342 -28.987
  476    H41    C  45           H41        C  45  -3.682   8.959 -34.576
  477    H42    C  45           H42        C  45  -3.341   7.280 -34.917
  478    H5     C  45           H5         C  45  -3.940   5.480 -33.415
  479    H6     C  45           H6         C  45  -5.124   4.901 -31.354
  480    H5'    U  46           H5'        U  46 -11.891   7.171 -29.674
  481   H5''    U  46          H5''        U  46 -13.008   6.752 -30.988
  482    H4'    U  46           H4'        U  46 -12.529   9.275 -30.587
  483    H3'    U  46           H3'        U  46 -12.489   7.686 -33.139
  484    H2'    U  46          H2''        U  46 -11.555   9.370 -34.407
  485   HO2'    U  46          H2'         U  46 -12.914  11.021 -34.191
  486    H1'    U  46           H1'        U  46 -10.147  10.778 -32.421
  487    H3     U  46           H3         U  46  -7.258   9.856 -35.811
  488    H5     U  46           H5         U  46  -7.825   6.156 -33.881
  489    H6     U  46           H6         U  46  -9.537   7.206 -32.513
  490    H5'    C  47           H5'        C  47 -15.392  11.554 -34.269
  491   H5''    C  47          H5''        C  47 -16.323  10.645 -35.475
  492    H4'    C  47           H4'        C  47 -15.239  12.818 -36.314
  493    H3'    C  47           H3'        C  47 -14.756  10.062 -37.476
  494    H2'    C  47          H2''        C  47 -13.506  10.985 -39.210
  495   HO2'    C  47          H2'         C  47 -14.537  13.505 -38.383
  496    H1'    C  47           H1'        C  47 -12.174  12.886 -37.605
  497    H41    C  47           H41        C  47  -7.928   8.266 -38.255
  498    H42    C  47           H42        C  47  -8.842   7.210 -37.207
  499    H5     C  47           H5         C  47 -10.890   7.895 -36.120
  500    H6     C  47           H6         C  47 -12.702   9.550 -36.148
  501    H5'    C  48           H5'        C  48 -15.239  12.680 -40.749
  502   H5''    C  48          H5''        C  48 -16.408  11.956 -41.868
  503    H4'    C  48           H4'        C  48 -14.346  12.576 -43.074
  504    H3'    C  48           H3'        C  48 -15.062   9.677 -42.640
  505   HO3'    C  48          H3T         C  48 -15.014  11.406 -44.911
  506    H2'    C  48          H2''        C  48 -13.127   8.922 -43.637
  507   HO2'    C  48          H2'         C  48 -12.967  11.415 -45.007
  508    H1'    C  48           H1'        C  48 -11.505  11.221 -43.145
  509    H41    C  48           H41        C  48  -8.877   6.279 -40.107
  510    H42    C  48           H42        C  48 -10.287   6.106 -39.090
  511    H5     C  48           H5         C  48 -12.174   7.592 -39.196
  512    H6     C  48           H6         C  48 -13.222   9.417 -40.445
  Start of MODEL   11
    1    H5'    G   1           H5'        G   1  -2.750   4.532 -47.767
    2   H5''    G   1          H5''        G   1  -1.632   5.792 -47.209
    3    H4'    G   1           H4'        G   1  -3.656   6.754 -48.336
    4    H3'    G   1           H3'        G   1  -2.868   7.217 -45.477
    5    H2'    G   1          H2''        G   1  -4.822   8.161 -44.837
    6   HO2'    G   1          H2'         G   1  -4.665   9.909 -46.247
    7    H1'    G   1           H1'        G   1  -6.547   7.211 -46.923
    8    H8     G   1           H8         G   1  -5.204   4.494 -44.633
    9    H1     G   1           H1         G   1 -10.251   7.673 -42.277
   10    H21    G   1           H21        G   1 -10.646   9.471 -43.493
   11    H22    G   1           H22        G   1  -9.785   9.799 -44.981
   12   HO5'    G   1          H5T         G   1  -3.473   4.272 -45.681
   13    H5'    G   2           H5'        G   2  -2.906  12.166 -47.148
   14   H5''    G   2          H5''        G   2  -2.293  12.645 -45.555
   15    H4'    G   2           H4'        G   2  -4.595  13.636 -46.522
   16    H3'    G   2           H3'        G   2  -3.766  12.812 -43.728
   17    H2'    G   2          H2''        G   2  -5.900  13.290 -42.878
   18   HO2'    G   2          H2'         G   2  -6.805  15.038 -43.599
   19    H1'    G   2           H1'        G   2  -7.384  12.268 -44.951
   20    H8     G   2           H8         G   2  -4.492   9.946 -44.279
   21    H1     G   2           H1         G   2  -9.163   9.556 -39.903
   22    H21    G   2           H21        G   2 -10.615  11.191 -40.215
   23    H22    G   2           H22        G   2 -10.334  12.482 -41.361
   24    H5'    G   3           H5'        G   3  -4.518  17.530 -42.842
   25   H5''    G   3          H5''        G   3  -3.833  17.548 -41.206
   26    H4'    G   3           H4'        G   3  -6.452  17.993 -41.649
   27    H3'    G   3           H3'        G   3  -5.081  16.421 -39.439
   28    H2'    G   3          H2''        G   3  -7.175  16.138 -38.389
   29   HO2'    G   3          H2'         G   3  -8.257  17.939 -40.320
   30    H1'    G   3           H1'        G   3  -8.506  15.462 -40.736
   31    H8     G   3           H8         G   3  -5.358  13.667 -41.203
   32    H1     G   3           H1         G   3  -8.768  11.164 -36.382
   33    H21    G   3           H21        G   3 -10.372  12.553 -35.785
   34    H22    G   3           H22        G   3 -10.493  14.174 -36.434
   35    H5'    G   4           H5'        G   4  -6.969  18.686 -37.249
   36   H5''    G   4          H5''        G   4  -6.177  19.798 -36.117
   37    H4'    G   4           H4'        G   4  -7.549  18.476 -34.708
   38    H3'    G   4           H3'        G   4  -4.693  17.518 -34.927
   39    H2'    G   4          H2''        G   4  -5.080  15.664 -33.618
   40   HO2'    G   4          H2'         G   4  -7.438  16.959 -32.683
   41    H1'    G   4           H1'        G   4  -7.734  15.163 -34.367
   42    H8     G   4           H8         G   4  -5.315  15.562 -37.314
   43    H1     G   4           H1         G   4  -5.082   9.823 -34.453
   44    H21    G   4           H21        G   4  -6.328   9.857 -32.624
   45    H22    G   4           H22        G   4  -7.046  11.328 -32.011
   46    H5'    U   5           H5'        U   5  -5.779  18.087 -30.089
   47   H5''    U   5          H5''        U   5  -4.106  18.099 -29.499
   48    H4'    U   5           H4'        U   5  -5.844  16.313 -28.569
   49    H3'    U   5           H3'        U   5  -2.932  16.111 -29.314
   50    H2'    U   5          H2''        U   5  -2.861  13.805 -29.071
   51   HO2'    U   5          H2'         U   5  -5.233  14.012 -27.510
   52    H1'    U   5           H1'        U   5  -5.463  13.162 -29.825
   53    H3     U   5           H3         U   5  -2.431  11.009 -32.503
   54    H5     U   5           H5         U   5  -2.513  14.975 -33.927
   55    H6     U   5           H6         U   5  -3.986  15.532 -32.079
   56    H5'    U   6           H5'        U   6  -3.717  13.983 -25.501
   57   H5''    U   6          H5''        U   6  -2.506  14.524 -24.322
   58    H4'    U   6           H4'        U   6  -2.657  12.095 -24.195
   59    H3'    U   6           H3'        U   6  -0.235  13.333 -25.520
   60    H2'    U   6          H2''        U   6   0.695  11.225 -25.953
   61   HO2'    U   6          H2'         U   6   0.536  10.100 -24.120
   62    H1'    U   6           H1'        U   6  -1.645   9.902 -26.615
   63    H3     U   6           H3         U   6   0.817  10.042 -30.434
   64    H5     U   6           H5         U   6  -0.514  14.004 -29.924
   65    H6     U   6           H6         U   6  -1.448  13.347 -27.787
   66    H5'    G   7           H5'        G   7   2.112  12.040 -21.631
   67   H5''    G   7          H5''        G   7   3.613  12.939 -21.931
   68    H4'    G   7           H4'        G   7   3.481  10.276 -22.273
   69    H3'    G   7           H3'        G   7   4.937  12.461 -23.769
   70    H2'    G   7          H2''        G   7   5.604  11.036 -25.471
   71   HO2'    G   7          H2'         G   7   6.475   9.227 -24.890
   72    H1'    G   7           H1'        G   7   3.449   9.233 -25.426
   73    H8     G   7           H8         G   7   2.062  12.671 -25.885
   74    H1     G   7           H1         G   7   5.233  10.579 -31.052
   75    H21    G   7           H21        G   7   6.352   8.747 -30.563
   76    H22    G   7           H22        G   7   6.459   8.127 -28.931
   77    H5'    G   8           H5'        G   8   8.369   8.921 -22.389
   78   H5''    G   8          H5''        G   8   9.739  10.027 -22.601
   79    H4'    G   8           H4'        G   8   9.797   7.685 -23.797
   80    H3'    G   8           H3'        G   8  10.419  10.423 -24.933
   81    H2'    G   8          H2''        G   8  10.986   9.462 -27.019
   82   HO2'    G   8          H2'         G   8  10.870   6.918 -25.741
   83    H1'    G   8           H1'        G   8   8.911   7.686 -27.140
   84    H8     G   8           H8         G   8   7.411  10.789 -25.722
   85    H1     G   8           H1         G   8   9.012  11.494 -31.886
   86    H21    G   8           H21        G   8  10.300   9.826 -32.531
   87    H22    G   8           H22        G   8  10.915   8.634 -31.409
   88    H5'    U   9           H5'        U   9  14.059   8.384 -25.221
   89   H5''    U   9          H5''        U   9  15.504   9.154 -24.534
   90    H4'    U   9           H4'        U   9  15.937   8.681 -26.886
   91    H3'    U   9           H3'        U   9  15.587  11.467 -25.865
   92    H2'    U   9          H2''        U   9  15.322  12.483 -27.908
   93   HO2'    U   9          H2'         U   9  16.864  10.341 -28.962
   94    H1'    U   9           H1'        U   9  14.401  10.330 -29.473
   95    H3     U   9           H3         U   9  11.585  13.891 -30.011
   96    H5     U   9           H5         U   9  10.361  12.007 -26.460
   97    H6     U   9           H6         U   9  12.421  10.711 -26.512
   98    H5'    G  10           H5'        G  10  18.754  11.918 -28.335
   99   H5''    G  10          H5''        G  10  20.200  12.691 -27.654
  100    H4'    G  10           H4'        G  10  19.382  13.954 -29.619
  101    H3'    G  10           H3'        G  10  19.387  15.040 -26.824
  102    H2'    G  10          H2''        G  10  18.096  16.876 -27.281
  103   HO2'    G  10          H2'         G  10  19.209  17.964 -28.753
  104    H1'    G  10           H1'        G  10  16.719  15.995 -29.587
  105    H8     G  10           H8         G  10  16.018  13.751 -26.640
  106    H1     G  10           H1         G  10  12.858  19.324 -26.369
  107    H21    G  10           H21        G  10  13.618  20.702 -27.917
  108    H22    G  10           H22        G  10  15.028  20.333 -28.884
  109    H5'    U  11           H5'        U  11  22.196  18.648 -28.922
  110   H5''    U  11          H5''        U  11  22.809  19.114 -27.324
  111    H4'    U  11           H4'        U  11  21.459  20.860 -28.822
  112    H3'    U  11           H3'        U  11  21.464  20.296 -25.859
  113    H2'    U  11          H2''        U  11  19.676  21.707 -25.432
  114   HO2'    U  11          H2'         U  11  20.549  23.535 -26.441
  115    H1'    U  11           H1'        U  11  18.293  21.461 -27.850
  116    H3     U  11           H3         U  11  15.491  20.357 -24.420
  117    H5     U  11           H5         U  11  17.967  16.987 -24.912
  118    H6     U  11           H6         U  11  19.313  18.283 -26.461
  119    H5'    A  12           H5'        A  12  23.206  24.811 -25.924
  120   H5''    A  12          H5''        A  12  23.547  25.078 -24.203
  121    H4'    A  12           H4'        A  12  21.530  26.349 -25.439
  122    H3'    A  12           H3'        A  12  21.834  25.200 -22.663
  123    H2'    A  12          H2''        A  12  19.599  25.631 -22.102
  124   HO2'    A  12          H2'         A  12  19.474  27.757 -22.857
  125    H1'    A  12           H1'        A  12  18.431  24.933 -24.494
  126    H8     A  12           H8         A  12  21.039  22.315 -23.894
  127    H61    A  12           H61        A  12  17.261  19.892 -19.642
  128    H62    A  12           H62        A  12  18.626  19.585 -20.693
  129    H2     A  12           H2         A  12  15.670  23.927 -20.781
  130    H5'    U  13           H5'        U  13  20.283  29.232 -21.178
  131   H5''    U  13          H5''        U  13  21.096  29.214 -19.603
  132    H4'    U  13           H4'        U  13  18.447  29.057 -19.751
  133    H3'    U  13           H3'        U  13  20.440  27.619 -17.989
  134    H2'    U  13          H2''        U  13  18.768  26.279 -17.035
  135   HO2'    U  13          H2'         U  13  16.992  28.340 -17.848
  136    H1'    U  13           H1'        U  13  17.019  26.152 -19.204
  137    H3     U  13           H3         U  13  18.277  22.002 -17.564
  138    H5     U  13           H5         U  13  21.324  23.179 -20.225
  139    H6     U  13           H6         U  13  20.291  25.362 -20.348
  140    H5'    U  14           H5'        U  14  17.378  28.924 -15.490
  141   H5''    U  14          H5''        U  14  17.949  30.067 -14.257
  142    H4'    U  14           H4'        U  14  16.548  28.470 -13.108
  143    H3'    U  14           H3'        U  14  19.515  28.393 -12.797
  144    H2'    U  14          H2''        U  14  19.663  26.293 -11.906
  145   HO2'    U  14          H2'         U  14  18.459  25.795 -10.263
  146    H1'    U  14           H1'        U  14  17.307  25.098 -12.826
  147    H3     U  14           H3         U  14  20.424  22.158 -14.198
  148    H5     U  14           H5         U  14  21.335  25.637 -16.391
  149    H6     U  14           H6         U  14  19.633  26.806 -15.117
  150    H5'    U  15           H5'        U  15  17.638  27.914  -8.242
  151   H5''    U  15          H5''        U  15  19.113  28.258  -7.317
  152    H4'    U  15           H4'        U  15  17.872  25.915  -7.051
  153    H3'    U  15           H3'        U  15  20.764  26.713  -7.121
  154    H2'    U  15          H2''        U  15  21.573  24.591  -7.418
  155   HO2'    U  15          H2'         U  15  19.294  23.810  -5.942
  156    H1'    U  15           H1'        U  15  19.295  23.316  -8.527
  157    H3     U  15           H3         U  15  22.811  22.142 -11.152
  158    H5     U  15           H5         U  15  22.161  26.210 -12.024
  159    H6     U  15           H6         U  15  20.562  26.280 -10.205
  160    H5'    U  16           H5'        U  16  20.443  23.711  -3.113
  161   H5''    U  16          H5''        U  16  21.922  24.350  -2.372
  162    H4'    U  16           H4'        U  16  21.722  21.760  -2.930
  163    H3'    U  16           H3'        U  16  23.974  23.731  -3.147
  164    H2'    U  16          H2''        U  16  25.320  22.394  -4.437
  165   HO2'    U  16          H2'         U  16  24.526  20.566  -2.687
  166    H1'    U  16           H1'        U  16  23.382  20.684  -5.600
  167    H3     U  16           H3         U  16  26.024  22.149  -8.996
  168    H5     U  16           H5         U  16  23.763  25.529  -7.896
  169    H6     U  16           H6         U  16  22.916  24.266  -6.006
  170    H5'    U  17           H5'        U  17  25.772  19.776  -0.790
  171   H5''    U  17          H5''        U  17  27.227  20.527  -0.105
  172    H4'    U  17           H4'        U  17  27.434  18.419  -1.719
  173    H3'    U  17           H3'        U  17  29.058  20.927  -1.399
  174    H2'    U  17          H2''        U  17  30.246  20.665  -3.342
  175   HO2'    U  17          H2'         U  17  29.791  17.879  -3.016
  176    H1'    U  17           H1'        U  17  28.468  19.014  -4.807
  177    H3     U  17           H3         U  17  29.797  22.404  -7.539
  178    H5     U  17           H5         U  17  27.170  24.229  -4.798
  179    H6     U  17           H6         U  17  27.125  22.143  -3.557
  180    H5'    A  18           H5'        A  18  31.648  17.211  -2.040
  181   H5''    A  18          H5''        A  18  33.040  17.368  -0.952
  182    H4'    A  18           H4'        A  18  33.775  16.743  -3.236
  183    H3'    A  18           H3'        A  18  34.417  19.447  -2.050
  184    H2'    A  18          H2''        A  18  35.459  20.167  -3.981
  185   HO2'    A  18          H2'         A  18  36.800  18.927  -5.030
  186    H1'    A  18           H1'        A  18  34.064  18.523  -5.841
  187    H8     A  18           H8         A  18  32.026  20.993  -3.711
  188    H61    A  18           H61        A  18  33.569  25.274  -7.893
  189    H62    A  18           H62        A  18  32.506  24.888  -6.559
  190    H2     A  18           H2         A  18  35.756  21.488  -8.904
  191    H5'    A  19           H5'        A  19  38.457  17.443  -3.572
  192   H5''    A  19          H5''        A  19  39.647  18.213  -2.505
  193    H4'    A  19           H4'        A  19  40.032  18.417  -5.065
  194    H3'    A  19           H3'        A  19  40.050  20.587  -2.970
  195    H2'    A  19          H2''        A  19  40.231  22.284  -4.513
  196   HO2'    A  19          H2'         A  19  41.665  22.171  -6.044
  197    H1'    A  19           H1'        A  19  39.136  20.940  -6.783
  198    H8     A  19           H8         A  19  36.841  21.461  -3.762
  199    H61    A  19           H61        A  19  35.594  27.022  -6.149
  200    H62    A  19           H62        A  19  35.076  25.796  -5.013
  201    H2     A  19           H2         A  19  38.935  25.204  -8.528
  202    H5'    A  20           H5'        A  20  44.312  21.289  -5.163
  203   H5''    A  20          H5''        A  20  45.011  22.323  -3.903
  204    H4'    A  20           H4'        A  20  44.562  23.286  -6.347
  205    H3'    A  20           H3'        A  20  44.223  24.476  -3.599
  206    H2'    A  20          H2''        A  20  43.142  26.366  -4.374
  207   HO2'    A  20          H2'         A  20  44.562  25.859  -6.768
  208    H1'    A  20           H1'        A  20  41.971  25.310  -6.709
  209    H8     A  20           H8         A  20  41.322  23.698  -3.244
  210    H61    A  20           H61        A  20  36.444  27.479  -2.927
  211    H62    A  20           H62        A  20  37.332  26.203  -2.123
  212    H2     A  20           H2         A  20  38.850  28.613  -6.539
  213    H5'    U  21           H5'        U  21  46.346  27.770  -6.103
  214   H5''    U  21          H5''        U  21  47.129  28.753  -4.851
  215    H4'    U  21           H4'        U  21  45.299  29.879  -6.349
  216    H3'    U  21           H3'        U  21  45.692  29.939  -3.367
  217    H2'    U  21          H2''        U  21  43.701  31.062  -2.949
  218   HO2'    U  21          H2'         U  21  43.657  31.826  -5.693
  219    H1'    U  21           H1'        U  21  42.149  30.052  -5.021
  220    H3     U  21           H3         U  21  39.950  28.803  -1.269
  221    H5     U  21           H5         U  21  43.565  26.648  -1.053
  222    H6     U  21           H6         U  21  44.264  27.746  -3.100
  223    H5'    U  22           H5'        U  22  44.649  33.556  -5.099
  224   H5''    U  22          H5''        U  22  45.708  34.955  -4.823
  225    H4'    U  22           H4'        U  22  43.353  35.650  -4.640
  226    H3'    U  22           H3'        U  22  45.326  35.715  -2.441
  227    H2'    U  22          H2''        U  22  43.920  35.613  -0.646
  228   HO2'    U  22          H2'         U  22  43.035  37.703  -1.529
  229    H1'    U  22           H1'        U  22  41.481  34.782  -1.821
  230    H3     U  22           H3         U  22  41.560  31.791   1.518
  231    H5     U  22           H5         U  22  45.275  31.177  -0.373
  232    H6     U  22           H6         U  22  44.741  33.005  -1.873
  233    H5'    A  23           H5'        A  23  46.538  39.030  -0.143
  234   H5''    A  23          H5''        A  23  45.767  37.458   0.145
  235    H4'    A  23           H4'        A  23  45.480  38.753   2.165
  236    H3'    A  23           H3'        A  23  43.214  38.108   0.392
  237    H2'    A  23          H2''        A  23  41.757  39.771   1.012
  238   HO2'    A  23          H2'         A  23  43.084  39.772   3.528
  239    H1'    A  23           H1'        A  23  43.422  41.744   2.017
  240    H8     A  23           H8         A  23  43.363  39.934  -1.505
  241    H61    A  23           H61        A  23  41.433  45.355  -3.645
  242    H62    A  23           H62        A  23  41.899  43.720  -4.056
  243    H2     A  23           H2         A  23  41.485  45.579   0.825
  244    H5'    A  24           H5'        A  24  40.416  37.470   3.915
  245   H5''    A  24          H5''        A  24  39.220  36.610   2.926
  246    H4'    A  24           H4'        A  24  38.999  39.256   3.622
  247    H3'    A  24           H3'        A  24  37.876  37.409   1.631
  248    H2'    A  24          H2''        A  24  37.828  38.825  -0.139
  249   HO2'    A  24          H2'         A  24  37.013  41.138   1.027
  250    H1'    A  24           H1'        A  24  38.944  41.228   1.158
  251    H8     A  24           H8         A  24  41.190  38.609  -0.453
  252    H61    A  24           H61        A  24  40.502  41.777  -5.707
  253    H62    A  24           H62        A  24  41.250  40.384  -4.959
  254    H2     A  24           H2         A  24  38.045  43.761  -2.516
  255    H5'    U  25           H5'        U  25  33.916  36.845   0.936
  256   H5''    U  25          H5''        U  25  35.241  37.978   0.608
  257    H4'    U  25           H4'        U  25  32.383  38.295   0.131
  258    H3'    U  25           H3'        U  25  34.795  38.872  -1.087
  259    H2'    U  25          H2''        U  25  35.418  40.790   0.079
  260   HO2'    U  25          H2'         U  25  35.173  42.056  -1.577
  261    H1'    U  25           H1'        U  25  32.624  41.740   0.499
  262    H3     U  25           H3         U  25  33.997  44.759   3.494
  263    H5     U  25           H5         U  25  36.650  41.554   4.160
  264    H6     U  25           H6         U  25  35.542  40.346   2.372
  265    H5'    U  26           H5'        U  26  36.179  39.877  -1.877
  266   H5''    U  26          H5''        U  26  35.881  40.811  -3.352
  267    H4'    U  26           H4'        U  26  37.901  40.012  -4.078
  268    H3'    U  26           H3'        U  26  35.928  37.794  -4.329
  269    H2'    U  26          H2''        U  26  37.404  36.050  -4.237
  270   HO2'    U  26          H2'         U  26  38.809  36.209  -5.790
  271    H1'    U  26           H1'        U  26  39.574  37.219  -2.888
  272    H3     U  26           H3         U  26  38.806  33.548  -0.420
  273    H5     U  26           H5         U  26  35.295  35.803   0.102
  274    H6     U  26           H6         U  26  36.128  37.396  -1.512
  275    H5'    C  27           H5'        C  27  37.573  37.988  -9.149
  276   H5''    C  27          H5''        C  27  36.261  36.945  -9.732
  277    H4'    C  27           H4'        C  27  38.729  36.181 -10.149
  278    H3'    C  27           H3'        C  27  36.341  34.667  -9.135
  279    H2'    C  27          H2''        C  27  37.531  32.817  -8.474
  280   HO2'    C  27          H2'         C  27  38.614  33.118 -10.828
  281    H1'    C  27           H1'        C  27  40.110  33.991  -8.161
  282    H41    C  27           H41        C  27  38.597  32.015  -2.324
  283    H42    C  27           H42        C  27  37.007  32.738  -2.422
  284    H5     C  27           H5         C  27  36.162  33.784  -4.419
  285    H6     C  27           H6         C  27  36.716  34.527  -6.689
  286    H5'    U  28           H5'        U  28  37.347  33.015 -13.773
  287   H5''    U  28          H5''        U  28  36.270  31.625 -14.014
  288    H4'    U  28           H4'        U  28  38.934  31.320 -14.058
  289    H3'    U  28           H3'        U  28  36.770  29.626 -12.778
  290    H2'    U  28          H2''        U  28  38.356  28.060 -12.080
  291   HO2'    U  28          H2'         U  28  40.190  29.405 -13.802
  292    H1'    U  28           H1'        U  28  40.205  29.892 -11.189
  293    H3     U  28           H3         U  28  37.803  27.229  -8.132
  294    H5     U  28           H5         U  28  35.768  30.883  -8.520
  295    H6     U  28           H6         U  28  37.237  31.454 -10.342
  296    H5'    U  29           H5'        U  29  38.651  26.861 -15.773
  297   H5''    U  29          H5''        U  29  37.362  25.978 -16.615
  298    H4'    U  29           H4'        U  29  39.135  24.491 -15.568
  299    H3'    U  29           H3'        U  29  36.178  24.419 -15.122
  300    H2'    U  29          H2''        U  29  36.220  23.026 -13.287
  301   HO2'    U  29          H2'         U  29  38.716  22.112 -14.286
  302    H1'    U  29           H1'        U  29  38.716  23.624 -12.201
  303    H3     U  29           H3         U  29  35.152  24.245  -9.279
  304    H5     U  29           H5         U  29  35.930  27.936 -11.145
  305    H6     U  29           H6         U  29  37.278  26.753 -12.776
  306    H5'    A  30           H5'        A  30  37.325  20.421 -14.829
  307   H5''    A  30          H5''        A  30  36.327  19.403 -15.886
  308    H4'    A  30           H4'        A  30  36.278  18.537 -13.572
  309    H3'    A  30           H3'        A  30  33.852  19.771 -14.862
  310    H2'    A  30          H2''        A  30  32.593  19.665 -12.938
  311   HO2'    A  30          H2'         A  30  34.262  17.507 -12.124
  312    H1'    A  30           H1'        A  30  34.732  19.580 -11.038
  313    H8     A  30           H8         A  30  34.392  22.775 -13.116
  314    H61    A  30           H61        A  30  30.308  24.610  -8.854
  315    H62    A  30           H62        A  30  31.146  25.053 -10.324
  316    H2     A  30           H2         A  30  31.258  20.289  -8.108
  317    H5'    A  31           H5'        A  31  33.344  15.633 -12.906
  318   H5''    A  31          H5''        A  31  32.210  14.678 -13.882
  319    H4'    A  31           H4'        A  31  31.742  14.490 -11.428
  320    H3'    A  31           H3'        A  31  29.849  15.596 -13.474
  321    H2'    A  31          H2''        A  31  28.351  16.456 -11.964
  322   HO2'    A  31          H2'         A  31  29.111  14.217 -10.494
  323    H1'    A  31           H1'        A  31  30.015  16.794  -9.703
  324    H8     A  31           H8         A  31  30.985  18.632 -12.928
  325    H61    A  31           H61        A  31  27.229  23.146 -11.006
  326    H62    A  31           H62        A  31  28.530  22.729 -12.097
  327    H2     A  31           H2         A  31  26.692  19.629  -8.276
  328    H5'    A  32           H5'        A  32  27.342  12.228 -11.016
  329   H5''    A  32          H5''        A  32  26.048  11.908 -12.188
  330    H4'    A  32           H4'        A  32  25.419  12.744  -9.765
  331    H3'    A  32           H3'        A  32  24.372  13.513 -12.481
  332    H2'    A  32          H2''        A  32  23.194  15.328 -11.719
  333   HO2'    A  32          H2'         A  32  21.835  15.003 -10.166
  334    H1'    A  32           H1'        A  32  24.593  15.808  -9.277
  335    H8     A  32           H8         A  32  26.571  16.241 -12.527
  336    H61    A  32           H61        A  32  24.277  21.979 -12.701
  337    H62    A  32           H62        A  32  25.498  20.900 -13.337
  338    H2     A  32           H2         A  32  22.265  19.777  -9.348
  339    H5'    A  33           H5'        A  33  20.461  12.290  -9.676
  340   H5''    A  33          H5''        A  33  19.270  12.108 -10.979
  341    H4'    A  33           H4'        A  33  18.842  13.837  -9.003
  342    H3'    A  33           H3'        A  33  18.336  13.957 -11.964
  343    H2'    A  33          H2''        A  33  17.839  16.207 -11.986
  344   HO2'    A  33          H2'         A  33  16.608  17.096 -10.508
  345    H1'    A  33           H1'        A  33  19.299  17.057  -9.723
  346    H8     A  33           H8         A  33  21.373  15.307 -12.403
  347    H61    A  33           H61        A  33  21.717  20.806 -15.203
  348    H62    A  33           H62        A  33  22.405  19.202 -15.099
  349    H2     A  33           H2         A  33  18.762  21.134 -11.843
  350    H5'    A  34           H5'        A  34  14.832  15.554  -9.796
  351   H5''    A  34          H5''        A  34  13.332  15.127 -10.642
  352    H4'    A  34           H4'        A  34  13.656  17.623 -10.206
  353    H3'    A  34           H3'        A  34  13.110  16.248 -12.813
  354    H2'    A  34          H2''        A  34  13.606  18.055 -14.139
  355   HO2'    A  34          H2'         A  34  12.637  19.878 -13.769
  356    H1'    A  34           H1'        A  34  15.165  19.602 -12.301
  357    H8     A  34           H8         A  34  16.537  16.205 -13.477
  358    H61    A  34           H61        A  34  19.483  19.469 -17.823
  359    H62    A  34           H62        A  34  19.376  17.928 -17.004
  360    H2     A  34           H2         A  34  16.487  22.161 -15.852
  361    H5'    C  35           H5'        C  35   9.938  16.404 -15.578
  362   H5''    C  35          H5''        C  35  11.332  15.768 -14.679
  363    H4'    C  35           H4'        C  35  11.599  18.597 -15.569
  364    H3'    C  35           H3'        C  35  10.604  16.647 -17.416
  365    H2'    C  35          H2''        C  35  12.556  15.471 -17.767
  366   HO2'    C  35          H2'         C  35  13.921  16.491 -19.310
  367    H1'    C  35           H1'        C  35  14.363  17.750 -17.064
  368    H41    C  35           H41        C  35  18.290  12.788 -16.458
  369    H42    C  35           H42        C  35  17.130  11.929 -15.470
  370    H5     C  35           H5         C  35  14.923  12.768 -14.996
  371    H6     C  35           H6         C  35  13.362  14.625 -15.337
  372    H5'    U  36           H5'        U  36   9.213  19.142 -16.954
  373   H5''    U  36          H5''        U  36   7.688  19.316 -17.845
  374    H4'    U  36           H4'        U  36   7.531  21.235 -16.565
  375    H3'    U  36           H3'        U  36   9.009  21.705 -19.108
  376    H2'    U  36          H2''        U  36  10.067  23.678 -18.489
  377   HO2'    U  36          H2'         U  36   9.257  25.005 -16.814
  378    H1'    U  36           H1'        U  36  10.449  23.287 -15.799
  379    H3     U  36           H3         U  36  14.034  23.301 -19.078
  380    H5     U  36           H5         U  36  13.717  19.583 -17.129
  381    H6     U  36           H6         U  36  11.556  20.272 -16.296
  382    H5'    A  37           H5'        A  37   8.294  25.246 -19.424
  383   H5''    A  37          H5''        A  37   6.920  25.521 -20.515
  384    H4'    A  37           H4'        A  37   8.652  26.894 -21.413
  385    H3'    A  37           H3'        A  37   8.323  24.190 -22.694
  386    H2'    A  37          H2''        A  37  10.067  24.496 -24.159
  387   HO2'    A  37          H2'         A  37  10.134  27.256 -23.442
  388    H1'    A  37           H1'        A  37  11.813  25.782 -22.364
  389    H8     A  37           H8         A  37  10.005  22.861 -20.721
  390    H61    A  37           H61        A  37  14.394  19.245 -23.129
  391    H62    A  37           H62        A  37  13.138  19.371 -21.917
  392    H2     A  37           H2         A  37  14.789  23.319 -24.967
  393    H5'    C  38           H5'        C  38   7.789  26.924 -26.373
  394   H5''    C  38          H5''        C  38   6.962  25.867 -27.532
  395    H4'    C  38           H4'        C  38   9.425  26.685 -28.034
  396    H3'    C  38           H3'        C  38   8.121  23.986 -28.356
  397    H2'    C  38          H2''        C  38  10.097  22.946 -28.960
  398   HO2'    C  38          H2'         C  38  11.163  25.510 -29.587
  399    H1'    C  38           H1'        C  38  11.910  24.537 -27.516
  400    H41    C  38           H41        C  38  11.691  18.769 -24.813
  401    H42    C  38           H42        C  38  10.119  19.116 -24.134
  402    H5     C  38           H5         C  38   8.972  21.212 -24.476
  403    H6     C  38           H6         C  38   9.006  23.342 -25.668
  404    H5'    A  39           H5'        A  39   8.697  24.862 -32.931
  405   H5''    A  39          H5''        A  39   7.644  23.618 -33.633
  406    H4'    A  39           H4'        A  39  10.302  23.391 -33.764
  407    H3'    A  39           H3'        A  39   8.108  21.379 -33.328
  408    H2'    A  39          H2''        A  39   9.561  19.696 -32.749
  409   HO2'    A  39          H2'         A  39  11.484  21.033 -34.363
  410    H1'    A  39           H1'        A  39  11.807  21.290 -31.961
  411    H8     A  39           H8         A  39   8.697  21.619 -29.780
  412    H61    A  39           H61        A  39  10.674  16.540 -26.855
  413    H62    A  39           H62        A  39   9.613  17.928 -26.764
  414    H2     A  39           H2         A  39  13.224  17.134 -30.500
  415    H5'    A  40           H5'        A  40  10.067  20.843 -37.647
  416   H5''    A  40          H5''        A  40   9.092  19.780 -38.682
  417    H4'    A  40           H4'        A  40  11.419  18.879 -38.236
  418    H3'    A  40           H3'        A  40   8.876  17.513 -37.273
  419    H2'    A  40          H2''        A  40  10.082  15.745 -36.351
  420   HO2'    A  40          H2'         A  40  11.409  15.287 -38.122
  421    H1'    A  40           H1'        A  40  12.272  17.226 -35.468
  422    H8     A  40           H8         A  40   8.747  18.642 -34.751
  423    H61    A  40           H61        A  40   9.009  15.372 -29.511
  424    H62    A  40           H62        A  40   8.023  16.427 -30.498
  425    H2     A  40           H2         A  40  12.612  14.339 -31.976
  426    H5'    U  41           H5'        U  41  10.038  14.186 -40.185
  427   H5''    U  41          H5''        U  41   8.588  13.165 -40.158
  428    H4'    U  41           H4'        U  41  10.826  12.498 -38.799
  429    H3'    U  41           H3'        U  41   7.877  12.171 -38.153
  430    H2'    U  41          H2''        U  41   8.352  11.384 -36.003
  431   HO2'    U  41          H2'         U  41   9.698   9.689 -36.574
  432    H1'    U  41           H1'        U  41  10.778  12.747 -35.584
  433    H3     U  41           H3         U  41   7.814  13.411 -32.140
  434    H5     U  41           H5         U  41   6.476  15.918 -35.250
  435    H6     U  41           H6         U  41   8.148  14.918 -36.691
  436    H5'    C  42           H5'        C  42   9.417   7.571 -38.504
  437   H5''    C  42          H5''        C  42   7.857   6.729 -38.594
  438    H4'    C  42           H4'        C  42   9.471   6.165 -36.607
  439    H3'    C  42           H3'        C  42   6.509   6.756 -36.596
  440    H2'    C  42          H2''        C  42   6.377   6.659 -34.276
  441   HO2'    C  42          H2'         C  42   7.413   4.627 -34.089
  442    H1'    C  42           H1'        C  42   8.914   7.641 -33.646
  443    H41    C  42           H41        C  42   4.641  12.143 -32.244
  444    H42    C  42           H42        C  42   4.374  12.470 -33.939
  445    H5     C  42           H5         C  42   5.509  11.279 -35.706
  446    H6     C  42           H6         C  42   7.052   9.452 -36.221
  447    H5'    A  43           H5'        A  43   5.660   2.128 -35.757
  448   H5''    A  43          H5''        A  43   3.941   2.251 -36.178
  449    H4'    A  43           H4'        A  43   4.730   1.960 -33.630
  450    H3'    A  43           H3'        A  43   2.514   3.573 -34.907
  451    H2'    A  43          H2''        A  43   1.912   4.552 -32.882
  452   HO2'    A  43          H2'         A  43   3.351   2.432 -31.646
  453    H1'    A  43           H1'        A  43   4.448   4.790 -31.763
  454    H8     A  43           H8         A  43   4.573   6.090 -35.299
  455    H61    A  43           H61        A  43   1.758  11.194 -33.232
  456    H62    A  43           H62        A  43   2.708  10.503 -34.528
  457    H2     A  43           H2         A  43   1.724   8.151 -29.935
  458    H5'    G  44           H5'        G  44   0.041   0.376 -32.164
  459   H5''    G  44          H5''        G  44  -1.585   0.599 -32.837
  460    H4'    G  44           H4'        G  44  -1.082   1.120 -30.263
  461    H3'    G  44           H3'        G  44  -2.781   2.575 -32.303
  462    H2'    G  44          H2''        G  44  -3.361   4.222 -30.755
  463   HO2'    G  44          H2'         G  44  -3.445   3.897 -28.625
  464    H1'    G  44           H1'        G  44  -0.902   4.362 -29.421
  465    H8     G  44           H8         G  44   0.062   4.580 -32.964
  466    H1     G  44           H1         G  44  -3.032   9.832 -30.978
  467    H21    G  44           H21        G  44  -3.964   9.468 -29.014
  468    H22    G  44           H22        G  44  -4.005   7.880 -28.281
  469    H5'    C  45           H5'        C  45  -5.107   2.632 -29.228
  470   H5''    C  45          H5''        C  45  -6.741   1.985 -29.476
  471    H4'    C  45           H4'        C  45  -7.015   4.226 -28.631
  472    H3'    C  45           H3'        C  45  -7.409   3.835 -31.607
  473    H2'    C  45          H2''        C  45  -7.823   6.084 -31.937
  474   HO2'    C  45          H2'         C  45  -9.317   6.769 -30.608
  475    H1'    C  45           H1'        C  45  -6.202   7.099 -29.863
  476    H41    C  45           H41        C  45  -3.692   8.768 -35.468
  477    H42    C  45           H42        C  45  -3.318   7.104 -35.849
  478    H5     C  45           H5         C  45  -3.779   5.271 -34.341
  479    H6     C  45           H6         C  45  -4.839   4.628 -32.234
  480    H5'    U  46           H5'        U  46 -11.645   5.873 -29.957
  481   H5''    U  46          H5''        U  46 -12.601   5.402 -31.374
  482    H4'    U  46           H4'        U  46 -12.375   7.967 -30.695
  483    H3'    U  46           H3'        U  46 -12.358   6.575 -33.371
  484    H2'    U  46          H2''        U  46 -11.805   8.503 -34.534
  485   HO2'    U  46          H2'         U  46 -13.564   9.604 -33.041
  486    H1'    U  46           H1'        U  46 -10.303   9.823 -32.571
  487    H3     U  46           H3         U  46  -7.688   9.435 -36.273
  488    H5     U  46           H5         U  46  -7.794   5.553 -34.644
  489    H6     U  46           H6         U  46  -9.460   6.332 -33.063
  490    H5'    C  47           H5'        C  47 -15.426  10.012 -33.607
  491   H5''    C  47          H5''        C  47 -16.725   9.386 -34.640
  492    H4'    C  47           H4'        C  47 -15.908  11.583 -35.465
  493    H3'    C  47           H3'        C  47 -15.375   9.053 -37.042
  494    H2'    C  47          H2''        C  47 -14.468  10.326 -38.795
  495   HO2'    C  47          H2'         C  47 -15.666  12.550 -37.497
  496    H1'    C  47           H1'        C  47 -13.064  12.101 -37.148
  497    H41    C  47           H41        C  47  -8.634   7.939 -38.882
  498    H42    C  47           H42        C  47  -9.337   6.702 -37.864
  499    H5     C  47           H5         C  47 -11.265   7.097 -36.472
  500    H6     C  47           H6         C  47 -13.192   8.572 -36.107
  501    H5'    C  48           H5'        C  48 -17.702  11.757 -39.674
  502   H5''    C  48          H5''        C  48 -18.776  10.801 -40.715
  503    H4'    C  48           H4'        C  48 -17.235  12.308 -42.013
  504    H3'    C  48           H3'        C  48 -17.293   9.310 -42.196
  505   HO3'    C  48          H3T         C  48 -18.935  10.502 -43.170
  506    H2'    C  48          H2''        C  48 -15.442   9.149 -43.548
  507   HO2'    C  48          H2'         C  48 -16.012  11.821 -44.344
  508    H1'    C  48           H1'        C  48 -14.079  11.490 -42.751
  509    H41    C  48           H41        C  48 -10.632   6.533 -40.735
  510    H42    C  48           H42        C  48 -11.885   6.068 -39.609
  511    H5     C  48           H5         C  48 -13.924   7.321 -39.322
  512    H6     C  48           H6         C  48 -15.309   9.132 -40.219