*HEADER    RNA                                     01-MAR-10   2KUV              
*TITLE     SOLUTION STRUCTURE OF K10 TLS RNA (GC MUTANT IN LOWER HELIX)          
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: K10 TLS RNA;                                               
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 ENGINEERED: YES;                                                     
*COMPND   5 MUTATION: YES;                                                       
*COMPND   6 OTHER_DETAILS: THE WILD-TYPE SEQUENCE OF K10 TLS RNA IS              
*COMPND   7 'GGCUUGAUUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAAUUAAGCC'. THE MUTATION IN  
*COMPND   8 THE GC MUTANT IN LOWER HELIX RNA ARE: U5C, U43C, U44G.               
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES;                                                      
*SOURCE   3 ORGANISM_SCIENTIFIC: DROSOPHILA MELANOGASTER;                        
*SOURCE   4 ORGANISM_COMMON: FRUIT FLY;                                          
*SOURCE   5 ORGANISM_TAXID: 7227;                                                
*SOURCE   6 OTHER_DETAILS: PREPARED BY IN VITRO TRANSCRIPTION USING T7 RNA       
*SOURCE   7 POLYMERASE                                                           
*KEYWDS    RNA TRANSPORT, RNA HAIRPIN, RNA                                       
*EXPDTA    SOLUTION NMR                                                          
*NUMMDL    10                                                                    
*AUTHOR    S.L.BULLOCK, I.RINGEL, D.ISH-HOROWICZ, P.J.LUKAVSKY                   
*REVDAT   1   19-MAY-10 2KUV    0                                                


{NOE-D2O}
assign (residue 1 and name h2'') (residue 2 and name h8) 1.8 0.4 1.2
assign (residue 2 and name h2'') (residue 3 and name h6) 1.8 0.4 1.2
assign (residue 3 and name h2'') (residue 4 and name h6) 1.8 0.4 1.2
assign (residue 7 and name h2'') (residue 8 and name h6) 1.8 0.4 1.2
assign (residue 8 and name h2'') (residue 9 and name h6) 1.8 0.4 1.2
assign (residue 9 and name h2'') (residue 10 and name h8) 1.8 0.4 1.2
assign (residue 10 and name h2'') (residue 11 and name h6) 1.8 0.4 1.2
assign (residue 11 and name h2'') (residue 12 and name h8) 1.8 0.4 1.2
assign (residue 12 and name h2'') (residue 13 and name h6) 1.8 0.4 1.2
assign (residue 13 and name h1') (residue 12 and name h2) 1.8 0.4 1.2
assign (residue 13 and name h2'') (residue 14 and name h6) 1.8 0.4 1.2
assign (residue 14 and name h2'') (residue 15 and name h6) 1.8 0.4 1.2
assign (residue 15 and name h2'') (residue 16 and name h6) 1.8 0.4 1.2
assign (residue 16 and name h2'') (residue 17 and name h6) 1.8 0.4 1.2
assign (residue 17 and name h2'') (residue 18 and name h8) 1.8 0.4 1.2
assign (residue 18 and name h2'') (residue 19 and name h8) 1.8 0.4 1.2
assign (residue 19 and name h2'') (residue 20 and name h8) 1.8 0.4 1.2
assign (residue 20 and name h2'') (residue 21 and name h6) 1.8 0.4 1.2
assign (residue 21 and name h2'') (residue 22 and name h6) 1.8 0.4 1.2
assign (residue 26 and name h2'') (residue 27 and name h6) 1.8 0.4 1.2
assign (residue 29 and name h2'') (residue 30 and name h8) 1.8 0.4 1.2
assign (residue 30 and name h1') (residue 18 and name h2) 1.8 0.4 1.2
assign (residue 31 and name h2'') (residue 32 and name h8) 1.8 0.4 1.2
assign (residue 32 and name h2'') (residue 33 and name h8) 1.8 0.4 1.2
assign (residue 33 and name h2'') (residue 34 and name h8) 1.8 0.4 1.2
assign (residue 36 and name h2'') (residue 37 and name h8) 1.8 0.4 1.2
assign (residue 37 and name h2'') (residue 38 and name h6) 1.8 0.4 1.2
assign (residue 38 and name h2'') (residue 39 and name h8) 1.8 0.4 1.2
assign (residue 40 and name h2'') (residue 41 and name h8) 1.8 0.4 1.2
assign (residue 41 and name h2'') (residue 42 and name h6) 1.8 0.4 1.2
assign (residue 46 and name h2'') (residue 47 and name h6) 1.8 0.4 1.2
assign (residue 47 and name h2'') (residue 48 and name h6) 1.8 0.4 1.2
assign (residue 1 and name h3') (residue 1 and name h8) 1.8 0 2.2
assign (residue 2 and name h3') (residue 2 and name h8) 1.8 0 2.2
assign (residue 2 and name h3') (residue 3 and name h6) 1.8 0 2.2
assign (residue 7 and name h3') (residue 8 and name h6) 1.8 0 2.2
assign (residue 8 and name h3') (residue 8 and name h6) 1.8 0 2.2
assign (residue 8 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 9 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 10 and name h3') (residue 10 and name h8) 1.8 0 2.2
assign (residue 11 and name h3') (residue 11 and name h6) 1.8 0 2.2
assign (residue 12 and name h1') (residue 37 and name h2) 1.8 0 2.2
assign (residue 12 and name h3') (residue 12 and name h8) 1.8 0 2.2
assign (residue 12 and name h3') (residue 13 and name h6) 1.8 0 2.2
assign (residue 13 and name h3') (residue 13 and name h6) 1.8 0 2.2
assign (residue 13 and name h3') (residue 14 and name h6) 1.8 0 2.2
assign (residue 14 and name h3') (residue 14 and name h6) 1.8 0 2.2
assign (residue 15 and name h1') (residue 33 and name h2) 1.8 0 2.2
assign (residue 15 and name h3') (residue 15 and name h6) 1.8 0 2.2
assign (residue 16 and name h1') (residue 32 and name h2) 1.8 0 2.2
assign (residue 16 and name h3') (residue 16 and name h6) 1.8 0 2.2
assign (residue 17 and name h1') (residue 31 and name h2) 1.8 0 2.2
assign (residue 17 and name h3') (residue 17 and name h6) 1.8 0 2.2
assign (residue 17 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 18 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 18 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 18 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 19 and name h1') (residue 18 and name h2) 1.8 0 2.2
assign (residue 19 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 20 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 21 and name h1') (residue 20 and name h2) 1.8 0 2.2
assign (residue 21 and name h2'') (residue 21 and name h6) 1.8 0 2.2
assign (residue 21 and name h3') (residue 21 and name h6) 1.8 0 2.2
assign (residue 22 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 22 and name h3') (residue 22 and name h6) 1.8 0 2.2
assign (residue 23 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 23 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 25 and name h2'') (residue 25 and name h6) 1.8 0 2.2
assign (residue 25 and name h3') (residue 25 and name h6) 1.8 0 2.2
assign (residue 26 and name h2'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h3') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h5'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 27 and name h3') (residue 27 and name h6) 1.8 0 2.2
assign (residue 28 and name h2'') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 29 and name h3') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 31 and name h8) 1.8 0 2.2
assign (residue 31 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 31 and name h3') (residue 31 and name h8) 1.8 0 2.2
assign (residue 31 and name h3') (residue 32 and name h8) 1.8 0 2.2
assign (residue 32 and name h3') (residue 32 and name h8) 1.8 0 2.2
assign (residue 33 and name h1') (residue 32 and name h2) 1.8 0 2.2
assign (residue 33 and name h3') (residue 33 and name h8) 1.8 0 2.2
assign (residue 34 and name h1') (residue 33 and name h2) 1.8 0 2.2
assign (residue 34 and name h3') (residue 34 and name h8) 1.8 0 2.2
assign (residue 35 and name h2'') (residue 35 and name h6) 1.8 0 2.2
assign (residue 35 and name h3') (residue 35 and name h6) 1.8 0 2.2
assign (residue 36 and name h3') (residue 36 and name h6) 1.8 0 2.2
assign (residue 36 and name h5) (residue 35 and name h1') 1.8 0 2.2
assign (residue 37 and name h3') (residue 37 and name h8) 1.8 0 2.2
assign (residue 37 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 38 and name h1') (residue 37 and name h2) 1.8 0 2.2
assign (residue 38 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 39 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 39 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 41 and name h8) 1.8 0 2.2
assign (residue 41 and name h3') (residue 41 and name h8) 1.8 0 2.2
assign (residue 41 and name h3') (residue 42 and name h6) 1.8 0 2.2
assign (residue 45 and name h2'') (residue 46 and name h8) 1.8 0 2.2
assign (residue 46 and name h3') (residue 46 and name h8) 1.8 0 2.2
assign (residue 46 and name h3') (residue 47 and name h6) 1.8 0 2.2
assign (residue 48 and name h3') (residue 48 and name h6) 1.8 0 2.2
assign (residue 1 and name h1') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 1 and name h2'') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h3') (residue 2 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 3 and name h6) 1.8 0 3.2
assign (residue 2 and name h2'') (residue 3 and name h1') 1.8 0 3.2
assign (residue 2 and name h2'') (residue 3 and name h5) 1.8 0 3.2
assign (residue 2 and name h3') (residue 3 and name h5) 1.8 0 3.2
assign (residue 3 and name h1') (residue 3 and name h6) 1.8 0 3.2
assign (residue 3 and name h1') (residue 4 and name h6) 1.8 0 3.2
assign (residue 3 and name h3') (residue 4 and name h5) 1.8 0 3.2
assign (residue 3 and name h5) (residue 4 and name h5) 1.8 0 3.2
assign (residue 3 and name h6) (residue 4 and name h6) 1.8 0 3.2
assign (residue 7 and name h1') (residue 8 and name h6) 1.8 0 3.2
assign (residue 7 and name h2'') (residue 8 and name h1') 1.8 0 3.2
assign (residue 7 and name h2'') (residue 8 and name h5) 1.8 0 3.2
assign (residue 7 and name h3') (residue 8 and name h5) 1.8 0 3.2
assign (residue 8 and name h1') (residue 7 and name h2) 1.8 0 3.2
assign (residue 8 and name h1') (residue 8 and name h6) 1.8 0 3.2
assign (residue 8 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 8 and name h6) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 9 and name h5) 1.8 0 3.2
assign (residue 8 and name h5) (residue 9 and name h5) 1.8 0 3.2
assign (residue 9 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 9 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 9 and name h1') (residue 41 and name h2) 1.8 0 3.2
assign (residue 10 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 10 and name h1') (residue 39 and name h2) 1.8 0 3.2
assign (residue 10 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h1') 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h5) 1.8 0 3.2
assign (residue 10 and name h3') (residue 11 and name h5) 1.8 0 3.2
assign (residue 10 and name h5'') (residue 10 and name h8) 1.8 0 3.2
assign (residue 11 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 11 and name h2'') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h5) (residue 10 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 12 and name h2) (residue 37 and name h2) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 13 and name h5) 1.8 0 3.2
assign (residue 12 and name h3') (residue 13 and name h5) 1.8 0 3.2
assign (residue 12 and name h5'') (residue 12 and name h8) 1.8 0 3.2
assign (residue 13 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h1') (residue 14 and name h6) 1.8 0 3.2
assign (residue 13 and name h2'') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h2'') (residue 14 and name h5) 1.8 0 3.2
assign (residue 13 and name h3') (residue 13 and name h5) 1.8 0 3.2
assign (residue 13 and name h3') (residue 14 and name h5) 1.8 0 3.2
assign (residue 13 and name h5) (residue 12 and name h8) 1.8 0 3.2
assign (residue 13 and name h5) (residue 14 and name h5) 1.8 0 3.2
assign (residue 14 and name h1') (residue 14 and name h6) 1.8 0 3.2
assign (residue 14 and name h1') (residue 15 and name h6) 1.8 0 3.2
assign (residue 14 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 14 and name h5) (residue 13 and name h6) 1.8 0 3.2
assign (residue 15 and name h1') (residue 14 and name h1') 1.8 0 3.2
assign (residue 15 and name h1') (residue 15 and name h6) 1.8 0 3.2
assign (residue 15 and name h1') (residue 16 and name h6) 1.8 0 3.2
assign (residue 15 and name h5) (residue 14 and name h1') 1.8 0 3.2
assign (residue 15 and name h6) (residue 14 and name h6) 1.8 0 3.2
assign (residue 16 and name h1') (residue 16 and name h6) 1.8 0 3.2
assign (residue 16 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 16 and name h5) (residue 15 and name h1') 1.8 0 3.2
assign (residue 16 and name h5) (residue 15 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 17 and name h6) (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 18 and name h2) (residue 19 and name h2) 1.8 0 3.2
assign (residue 18 and name h4') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h5'') (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 20 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h1') 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h5) 1.8 0 3.2
assign (residue 20 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h1') 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h5) (residue 20 and name h8) 1.8 0 3.2
assign (residue 21 and name h5') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h5'') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h6) (residue 20 and name h8) 1.8 0 3.2
assign (residue 22 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 22 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h4') (residue 22 and name h6) 1.8 0 3.2
assign (residue 23 and name h1') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h2) (residue 24 and name h2) 1.8 0 3.2
assign (residue 23 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h5'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 24 and name h1') (residue 23 and name h2) 1.8 0 3.2
assign (residue 24 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h5'') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h8) (residue 23 and name h8) 1.8 0 3.2
assign (residue 25 and name h1') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 26 and name h5) 1.8 0 3.2
assign (residue 25 and name h5') (residue 24 and name h3') 1.8 0 3.2
assign (residue 25 and name h5') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5'') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5'') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h1') (residue 22 and name h1') 1.8 0 3.2
assign (residue 26 and name h1') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 26 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 26 and name h4') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 26 and name h5') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5'') (residue 25 and name h1') 1.8 0 3.2
assign (residue 27 and name h1') (residue 27 and name h6) 1.8 0 3.2
assign (residue 27 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 27 and name h3') (residue 28 and name h5) 1.8 0 3.2
assign (residue 28 and name h1') (residue 20 and name h2) 1.8 0 3.2
assign (residue 28 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 28 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 28 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h6) 1.8 0 3.2
assign (residue 28 and name h6) (residue 20 and name h2) 1.8 0 3.2
assign (residue 29 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 29 and name h5) (residue 28 and name h6) 1.8 0 3.2
assign (residue 29 and name h5'') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h6) (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 31 and name h8) 1.8 0 3.2
assign (residue 30 and name h2) (residue 18 and name h2) 1.8 0 3.2
assign (residue 30 and name h5'') (residue 30 and name h8) 1.8 0 3.2
assign (residue 31 and name h1') (residue 31 and name h8) 1.8 0 3.2
assign (residue 31 and name h1') (residue 32 and name h8) 1.8 0 3.2
assign (residue 31 and name h2) (residue 32 and name h2) 1.8 0 3.2
assign (residue 32 and name h1') (residue 32 and name h8) 1.8 0 3.2
assign (residue 32 and name h1') (residue 33 and name h8) 1.8 0 3.2
assign (residue 32 and name h2) (residue 31 and name h2) 1.8 0 3.2
assign (residue 32 and name h2) (residue 33 and name h2) 1.8 0 3.2
assign (residue 32 and name h5'') (residue 32 and name h8) 1.8 0 3.2
assign (residue 32 and name h8) (residue 31 and name h8) 1.8 0 3.2
assign (residue 33 and name h1') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 33 and name h2) (residue 34 and name h2) 1.8 0 3.2
assign (residue 33 and name h2'') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h5'') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h8) (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 36 and name h5) 1.8 0 3.2
assign (residue 34 and name h3') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 35 and name h1') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h1') (residue 36 and name h6) 1.8 0 3.2
assign (residue 35 and name h2'') (residue 36 and name h6) 1.8 0 3.2
assign (residue 35 and name h4') (residue 36 and name h5) 1.8 0 3.2
assign (residue 36 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 36 and name h2'') (residue 36 and name h6) 1.8 0 3.2
assign (residue 36 and name h5) (residue 34 and name h1') 1.8 0 3.2
assign (residue 37 and name h1') (residue 12 and name h2) 1.8 0 3.2
assign (residue 37 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 38 and name h1') 1.8 0 3.2
assign (residue 37 and name h2'') (residue 38 and name h5) 1.8 0 3.2
assign (residue 37 and name h3') (residue 38 and name h5) 1.8 0 3.2
assign (residue 38 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 38 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 38 and name h2'') (residue 38 and name h6) 1.8 0 3.2
assign (residue 39 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 39 and name h5'') (residue 39 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 39 and name h2) 1.8 0 3.2
assign (residue 40 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 41 and name h8) 1.8 0 3.2
assign (residue 40 and name h2'') (residue 41 and name h1') 1.8 0 3.2
assign (residue 40 and name h8) (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 41 and name h1') (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 41 and name h2'') (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h2'') (residue 42 and name h5) 1.8 0 3.2
assign (residue 42 and name h5) (residue 41 and name h1') 1.8 0 3.2
assign (residue 45 and name h1') (residue 46 and name h8) 1.8 0 3.2
assign (residue 45 and name h3') (residue 46 and name h8) 1.8 0 3.2
assign (residue 46 and name h1') (residue 45 and name h2) 1.8 0 3.2
assign (residue 46 and name h1') (residue 46 and name h8) 1.8 0 3.2
assign (residue 46 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 46 and name h2'') (residue 47 and name h5) 1.8 0 3.2
assign (residue 46 and name h5') (residue 46 and name h8) 1.8 0 3.2
assign (residue 46 and name h5'') (residue 46 and name h8) 1.8 0 3.2
assign (residue 47 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 47 and name h4') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h5) (residue 48 and name h5) 1.8 0 3.2
assign (residue 47 and name h5'') (residue 47 and name h6) 1.8 0 3.2
assign (residue 48 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 48 and name h2'') (residue 48 and name h6) 1.8 0 3.2
assign (residue 1 and name h1') (residue 2 and name h1') 1.8 0 4.7
assign (residue 1 and name h2'') (residue 2 and name h1') 1.8 0 4.7
assign (residue 1 and name h4') (residue 1 and name h8) 1.8 0 4.7
assign (residue 1 and name h5') (residue 1 and name h8) 1.8 0 4.7
assign (residue 1 and name h5'') (residue 1 and name h8) 1.8 0 4.7
assign (residue 2 and name h8) (residue 1 and name h8) 1.8 0 4.7
assign (residue 2 and name h8) (residue 3 and name h6) 1.8 0 4.7
assign (residue 3 and name h1') (residue 2 and name h1') 1.8 0 4.7
assign (residue 3 and name h2'') (residue 4 and name h5) 1.8 0 4.7
assign (residue 3 and name h3') (residue 3 and name h5) 1.8 0 4.7
assign (residue 3 and name h5) (residue 2 and name h1') 1.8 0 4.7
assign (residue 3 and name h5) (residue 2 and name h8) 1.8 0 4.7
assign (residue 3 and name h5) (residue 3 and name h1') 1.8 0 4.7
assign (residue 3 and name h5) (residue 4 and name h6) 1.8 0 4.7
assign (residue 4 and name h5) (residue 3 and name h1') 1.8 0 4.7
assign (residue 4 and name h5) (residue 3 and name h6) 1.8 0 4.7
assign (residue 8 and name h1') (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h5) 1.8 0 4.7
assign (residue 8 and name h2'') (residue 8 and name h5) 1.8 0 4.7
assign (residue 8 and name h3') (residue 8 and name h5) 1.8 0 4.7
assign (residue 8 and name h5) (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h5) (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h5) (residue 8 and name h1') 1.8 0 4.7
assign (residue 8 and name h5) (residue 9 and name h6) 1.8 0 4.7
assign (residue 8 and name h6) (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h6) (residue 9 and name h6) 1.8 0 4.7
assign (residue 9 and name h5) (residue 8 and name h6) 1.8 0 4.7
assign (residue 9 and name h5) (residue 9 and name h1') 1.8 0 4.7
assign (residue 10 and name h8) (residue 9 and name h6) 1.8 0 4.7
assign (residue 11 and name h1') (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 11 and name h2'') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h3') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h5) (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 11 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h1') (residue 12 and name h2) 1.8 0 4.7
assign (residue 12 and name h2) (residue 13 and name h6) 1.8 0 4.7
assign (residue 12 and name h2'') (residue 13 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 14 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 14 and name h5) 1.8 0 4.7
assign (residue 13 and name h2'') (residue 13 and name h5) 1.8 0 4.7
assign (residue 13 and name h5) (residue 12 and name h1') 1.8 0 4.7
assign (residue 13 and name h5) (residue 13 and name h1') 1.8 0 4.7
assign (residue 13 and name h6) (residue 12 and name h8) 1.8 0 4.7
assign (residue 13 and name h6) (residue 14 and name h6) 1.8 0 4.7
assign (residue 14 and name h1') (residue 33 and name h2) 1.8 0 4.7
assign (residue 14 and name h5) (residue 34 and name h2) 1.8 0 4.7
assign (residue 15 and name h1') (residue 32 and name h2) 1.8 0 4.7
assign (residue 15 and name h2'') (residue 16 and name h1') 1.8 0 4.7
assign (residue 16 and name h1') (residue 31 and name h2) 1.8 0 4.7
assign (residue 17 and name h1') (residue 18 and name h1') 1.8 0 4.7
assign (residue 17 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 17 and name h5) (residue 18 and name h8) 1.8 0 4.7
assign (residue 18 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 18 and name h2) (residue 19 and name h8) 1.8 0 4.7
assign (residue 19 and name h1') (residue 19 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h8) 1.8 0 4.7
assign (residue 19 and name h2) (residue 29 and name h6) 1.8 0 4.7
assign (residue 21 and name h1') (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h2'') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h4') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h5) (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 21 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h6) (residue 22 and name h6) 1.8 0 4.7
assign (residue 22 and name h1') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h3') (residue 22 and name h5) 1.8 0 4.7
assign (residue 22 and name h4') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h5) (residue 21 and name h6) 1.8 0 4.7
assign (residue 23 and name h1') (residue 23 and name h2) 1.8 0 4.7
assign (residue 23 and name h1') (residue 24 and name h1') 1.8 0 4.7
assign (residue 23 and name h3') (residue 24 and name h1') 1.8 0 4.7
assign (residue 24 and name h1') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h2'') (residue 25 and name h1') 1.8 0 4.7
assign (residue 24 and name h3') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h5) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h4') (residue 24 and name h8) 1.8 0 4.7
assign (residue 24 and name h4') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h1') (residue 24 and name h2) 1.8 0 4.7
assign (residue 25 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h4') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 25 and name h5'') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h5) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h6) 1.8 0 4.7
assign (residue 26 and name h2'') (residue 26 and name h5) 1.8 0 4.7
assign (residue 26 and name h5) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h5') (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 27 and name h1') (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h5) (residue 28 and name h6) 1.8 0 4.7
assign (residue 27 and name h6) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h1') (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h1') (residue 28 and name h5) 1.8 0 4.7
assign (residue 28 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h5) (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h5) (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 29 and name h1') (residue 28 and name h1') 1.8 0 4.7
assign (residue 29 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 29 and name h5) (residue 28 and name h5) 1.8 0 4.7
assign (residue 29 and name h5) (residue 30 and name h8) 1.8 0 4.7
assign (residue 30 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 30 and name h2) (residue 31 and name h8) 1.8 0 4.7
assign (residue 31 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 31 and name h2) (residue 32 and name h8) 1.8 0 4.7
assign (residue 31 and name h8) (residue 30 and name h8) 1.8 0 4.7
assign (residue 32 and name h1') (residue 32 and name h2) 1.8 0 4.7
assign (residue 32 and name h2) (residue 33 and name h8) 1.8 0 4.7
assign (residue 33 and name h1') (residue 33 and name h2) 1.8 0 4.7
assign (residue 33 and name h2'') (residue 34 and name h1') 1.8 0 4.7
assign (residue 34 and name h1') (residue 34 and name h2) 1.8 0 4.7
assign (residue 34 and name h1') (residue 35 and name h6) 1.8 0 4.7
assign (residue 34 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 34 and name h2'') (residue 36 and name h6) 1.8 0 4.7
assign (residue 34 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h2'') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h4') (residue 36 and name h6) 1.8 0 4.7
assign (residue 35 and name h6) (residue 36 and name h6) 1.8 0 4.7
assign (residue 36 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 36 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 36 and name h5) (residue 34 and name h2) 1.8 0 4.7
assign (residue 36 and name h6) (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h1') (residue 37 and name h2) 1.8 0 4.7
assign (residue 37 and name h3') (residue 38 and name h1') 1.8 0 4.7
assign (residue 37 and name h4') (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h5'') (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h1') (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h1') (residue 39 and name h1') 1.8 0 4.7
assign (residue 38 and name h2'') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h3') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h4') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h5) (residue 39 and name h8) 1.8 0 4.7
assign (residue 38 and name h5'') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h6) (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h6) (residue 39 and name h8) 1.8 0 4.7
assign (residue 39 and name h2) (residue 40 and name h2) 1.8 0 4.7
assign (residue 40 and name h1') (residue 40 and name h2) 1.8 0 4.7
assign (residue 40 and name h1') (residue 41 and name h1') 1.8 0 4.7
assign (residue 42 and name h1') (residue 41 and name h1') 1.8 0 4.7
assign (residue 42 and name h5) (residue 41 and name h8) 1.8 0 4.7
assign (residue 42 and name h6) (residue 41 and name h8) 1.8 0 4.7
assign (residue 46 and name h8) (residue 45 and name h2) 1.8 0 4.7
assign (residue 46 and name h8) (residue 45 and name h8) 1.8 0 4.7
assign (residue 46 and name h8) (residue 47 and name h6) 1.8 0 4.7
assign (residue 47 and name h1') (residue 48 and name h1') 1.8 0 4.7
assign (residue 47 and name h2'') (residue 47 and name h5) 1.8 0 4.7
assign (residue 47 and name h5) (residue 46 and name h1') 1.8 0 4.7
assign (residue 47 and name h5) (residue 46 and name h8) 1.8 0 4.7
assign (residue 4 and name h2'') (residue 5 and name h6) 1.8 0 1.2
assign (residue 5 and name h2'') (residue 6 and name h8) 1.8 0 1.2
assign (residue 6 and name h2'') (residue 7 and name h8) 1.8 0 1.2
assign (residue 42 and name h2'') (residue 43 and name h6) 1.8 0 1.2
assign (residue 43 and name h2'') (residue 44 and name h8) 1.8 0 1.2
assign (residue 44 and name h2'') (residue 45 and name h8) 1.8 0 1.2
assign (residue 4 and name h3') (residue 4 and name h6) 1.8 0 2.2
assign (residue 4 and name h3') (residue 5 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 5 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 6 and name h8) 1.8 0 2.2
assign (residue 6 and name h3') (residue 6 and name h8) 1.8 0 2.2
assign (residue 6 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 7 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 42 and name h3') (residue 42 and name h6) 1.8 0 2.2
assign (residue 42 and name h3') (residue 43 and name h6) 1.8 0 2.2
assign (residue 43 and name h3') (residue 43 and name h6) 1.8 0 2.2
assign (residue 44 and name h3') (residue 44 and name h8) 1.8 0 2.2
assign (residue 44 and name h3') (residue 45 and name h8) 1.8 0 2.2
assign (residue 45 and name h3') (residue 45 and name h8) 1.8 0 2.2
assign (residue 4 and name h1') (residue 4 and name h6) 1.8 0 3.2
assign (residue 4 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h1') (residue 6 and name h8) 1.8 0 3.2
assign (residue 5 and name h1') (residue 45 and name h2) 1.8 0 3.2
assign (residue 5 and name h2'') (residue 5 and name h6) 1.8 0 3.2
assign (residue 6 and name h1') (residue 6 and name h8) 1.8 0 3.2
assign (residue 6 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h2'') (residue 7 and name h8) 1.8 0 3.2
assign (residue 42 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 42 and name h1') (residue 43 and name h6) 1.8 0 3.2
assign (residue 42 and name h2'') (residue 42 and name h6) 1.8 0 3.2
assign (residue 43 and name h1') (residue 7 and name h2) 1.8 0 3.2
assign (residue 43 and name h1') (residue 43 and name h6) 1.8 0 3.2
assign (residue 43 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 43 and name h2'') (residue 43 and name h6) 1.8 0 3.2
assign (residue 44 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h1') (residue 45 and name h8) 1.8 0 3.2
assign (residue 44 and name h2'') (residue 44 and name h8) 1.8 0 3.2
assign (residue 45 and name h1') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h2'') (residue 45 and name h8) 1.8 0 3.2
assign (residue 4 and name h2'') (residue 4 and name h5) 1.8 0 4.7
assign (residue 4 and name h2'') (residue 4 and name h6) 1.8 0 4.7
assign (residue 4 and name h5) (residue 5 and name h5) 1.8 0 4.7
assign (residue 4 and name h5'') (residue 4 and name h6) 1.8 0 4.7
assign (residue 5 and name h5) (residue 4 and name h6) 1.8 0 4.7
assign (residue 5 and name h5) (residue 6 and name h8) 1.8 0 4.7
assign (residue 5 and name h6) (residue 4 and name h6) 1.8 0 4.7
assign (residue 6 and name h2'') (residue 6 and name h8) 1.8 0 4.7
assign (residue 6 and name h8) (residue 5 and name h6) 1.8 0 4.7
assign (residue 6 and name h8) (residue 7 and name h8) 1.8 0 4.7
assign (residue 7 and name h1') (residue 7 and name h2) 1.8 0 4.7
assign (residue 42 and name h5) (residue 42 and name h1') 1.8 0 4.7
assign (residue 44 and name h1') (residue 45 and name h1') 1.8 0 4.7
assign (residue 44 and name h8) (residue 43 and name h6) 1.8 0 4.7
assign (residue 44 and name h8) (residue 45 and name h8) 1.8 0 4.7
{NOE-H2O}
assign (residue 3 and name h41) (residue 46 and name h1) 1.8 0 1.7
assign (residue 3 and name h42) (residue 46 and name h1) 1.8 0 1.7
assign (residue 18 and name h2) (residue 29 and name h3) 1.8 0 1.7
assign (residue 30 and name h2) (residue 17 and name h3) 1.8 0 1.7
assign (residue 31 and name h2) (residue 16 and name h3) 1.8 0 1.7
assign (residue 32 and name h2) (residue 15 and name h3) 1.8 0 1.7
assign (residue 33 and name h2) (residue 14 and name h3) 1.8 0 1.7
assign (residue 37 and name h2) (residue 11 and name h3) 1.8 0 1.7
assign (residue 38 and name h41) (residue 10 and name h1) 1.8 0 1.7
assign (residue 38 and name h42) (residue 10 and name h1) 1.8 0 1.7
assign (residue 40 and name h2) (residue 9 and name h3) 1.8 0 1.7
assign (residue 41 and name h2) (residue 8 and name h3) 1.8 0 1.7
assign (residue 47 and name h41) (residue 2 and name h1) 1.8 0 1.7
assign (residue 47 and name h42) (residue 2 and name h1) 1.8 0 1.7
assign (residue 12 and name h2) (residue 36 and name h3) 1.8 0 2.7
assign (residue 19 and name h2) (residue 28 and name h3) 1.8 0 2.7
assign (residue 31 and name h2) (residue 17 and name h3) 1.8 0 2.7
assign (residue 32 and name h2) (residue 16 and name h3) 1.8 0 2.7
assign (residue 33 and name h2) (residue 15 and name h3) 1.8 0 2.7
assign (residue 34 and name h2) (residue 13 and name h3) 1.8 0 2.7
assign (residue 2 and name h1) (residue 46 and name h1) 1.8 0 4.2
assign (residue 3 and name h5) (residue 46 and name h1) 1.8 0 4.2
assign (residue 4 and name h1') (residue 46 and name h1) 1.8 0 4.2
assign (residue 8 and name h1') (residue 42 and name h3) 1.8 0 4.2
assign (residue 9 and name h1') (residue 8 and name h3) 1.8 0 4.2
assign (residue 11 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 11 and name h3) (residue 10 and name h1) 1.8 0 4.2
assign (residue 16 and name h1') (residue 15 and name h3) 1.8 0 4.2
assign (residue 16 and name h3) (residue 15 and name h3) 1.8 0 4.2
assign (residue 17 and name h3) (residue 16 and name h3) 1.8 0 4.2
assign (residue 18 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 18 and name h8) (residue 17 and name h3) 1.8 0 4.2
assign (residue 19 and name h1') (residue 29 and name h3) 1.8 0 4.2
assign (residue 31 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 38 and name h5) (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h2) (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h8) (residue 10 and name h1) 1.8 0 4.2
assign (residue 46 and name h1) (residue 4 and name h3) 1.8 0 4.2
assign (residue 47 and name h1') (residue 46 and name h1) 1.8 0 4.2
assign (residue 47 and name h5) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h1') (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h41) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h5) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h5) (residue 47 and name h41) 1.8 0 4.2
assign (residue 48 and name h6) (residue 2 and name h1) 1.8 0 4.2
assign (residue 3 and name h41) (residue 4 and name h3) 3.5 0 3.0
assign (residue 3 and name h42) (residue 4 and name h3) 3.5 0 3.0
assign (residue 3 and name h5) (residue 2 and name h1) 3.5 0 3.0
assign (residue 4 and name h5) (residue 3 and name h41) 3.5 0 3.0
assign (residue 4 and name h6) (residue 46 and name h1) 3.5 0 3.0
assign (residue 10 and name h8) (residue 9 and name h3) 3.5 0 3.0
assign (residue 17 and name h1') (residue 17 and name h3) 3.5 0 3.0
assign (residue 32 and name h1') (residue 16 and name h3) 3.5 0 3.0
assign (residue 33 and name h1') (residue 15 and name h3) 3.5 0 3.0
assign (residue 37 and name h2) (residue 10 and name h1) 3.5 0 3.0
assign (residue 39 and name h2) (residue 9 and name h3) 3.5 0 3.0
assign (residue 45 and name h2) (residue 46 and name h1) 3.5 0 3.0
assign (residue 47 and name h5) (residue 46 and name h1) 3.5 0 3.0
assign (residue 47 and name h6) (residue 2 and name h1) 3.5 0 3.0
assign (residue 5 and name h41) (residue 44 and name h1) 1.8 0 1.7
assign (residue 5 and name h42) (residue 44 and name h1) 1.8 0 1.7
assign (residue 7 and name h2) (residue 42 and name h3) 1.8 0 1.7
assign (residue 43 and name h41) (residue 6 and name h1) 1.8 0 1.7
assign (residue 43 and name h42) (residue 6 and name h1) 1.8 0 1.7
assign (residue 45 and name h2) (residue 4 and name h3) 1.8 0 1.7
assign (residue 5 and name h1') (residue 4 and name h3) 1.8 0 4.2
assign (residue 5 and name h41) (residue 4 and name h3) 1.8 0 4.2
assign (residue 5 and name h42) (residue 4 and name h3) 1.8 0 4.2
assign (residue 5 and name h5) (residue 44 and name h1) 1.8 0 4.2
assign (residue 6 and name h1') (residue 44 and name h1) 1.8 0 4.2
assign (residue 7 and name h1') (residue 6 and name h1) 1.8 0 4.2
assign (residue 7 and name h2) (residue 6 and name h1) 1.8 0 4.2
assign (residue 43 and name h5) (residue 6 and name h1) 1.8 0 4.2
assign (residue 44 and name h1) (residue 4 and name h3) 1.8 0 4.2
assign (residue 44 and name h1) (residue 6 and name h1) 1.8 0 4.2
assign (residue 44 and name h1') (residue 6 and name h1) 1.8 0 4.2
assign (residue 45 and name h1') (residue 44 and name h1) 1.8 0 4.2
assign (residue 45 and name h2) (residue 44 and name h1) 1.8 0 4.2
assign (residue 5 and name h1') (residue 44 and name h1) 3.5 0 3.0
assign (residue 5 and name h41) (residue 6 and name h1) 3.5 0 3.0
assign (residue 5 and name h42) (residue 6 and name h1) 3.5 0 3.0
assign (residue 6 and name h8) (residue 44 and name h1) 3.5 0 3.0
assign (residue 43 and name h1') (residue 6 and name h1) 3.5 0 3.0
assign (residue 43 and name h41) (residue 44 and name h1) 3.5 0 3.0
assign (residue 43 and name h42) (residue 44 and name h1) 3.5 0 3.0
assign (residue 44 and name h8) (residue 6 and name h1) 3.5 0 3.0
{hydrogen bonds}
assign (residue 1 and name n1) (residue 48 and name n3) 2.8 0.2 0.2
assign (residue 2 and name n1) (residue 47 and name n3) 2.8 0.2 0.2
assign (residue 46 and name n1) (residue 3 and name n3) 2.8 0.2 0.2
assign (residue 4 and name n3) (residue 45 and name n1) 2.8 0.2 0.2
assign (residue 44 and name n1) (residue 5 and name n3) 2.8 0.2 0.2
assign (residue 6 and name n1) (residue 43 and name n3) 2.8 0.2 0.2
assign (residue 42 and name n3) (residue 7 and name n1) 2.8 0.2 0.2
assign (residue 8 and name n3) (residue 41 and name n1) 2.8 0.2 0.2
assign (residue 9 and name n3) (residue 40 and name n1) 2.8 0.2 0.2
assign (residue 10 and name n1) (residue 38 and name n3) 2.8 0.2 0.2
assign (residue 11 and name n3) (residue 37 and name n1) 2.8 0.2 0.2
assign (residue 13 and name n3) (residue 34 and name n1) 2.8 0.2 0.2
assign (residue 14 and name n3) (residue 33 and name n1) 2.8 0.2 0.2
assign (residue 15 and name n3) (residue 32 and name n1) 2.8 0.2 0.2
assign (residue 16 and name n3) (residue 31 and name n1) 2.8 0.2 0.2
assign (residue 17 and name n3) (residue 30 and name n1) 2.8 0.2 0.2
assign (residue 29 and name n3) (residue 18 and name n1) 2.8 0.2 0.2
assign (residue 28 and name n3) (residue 19 and name n1) 2.8 0.2 0.2
{torsion angles}
assign (residue 1 and name c4') (residue 1 and name o4')
       (residue 1 and name c1') (residue 1 and name c2') 2 0 15 2
assign (residue 1 and name o4') (residue 1 and name c1')
       (residue 1 and name c2') (residue 1 and name c3') 2 -22 15 2
assign (residue 1 and name c1') (residue 1 and name c2')
       (residue 1 and name c3') (residue 1 and name c4') 2 36 15 2
assign (residue 1 and name c2') (residue 1 and name c3')
       (residue 1 and name c4') (residue 1 and name o4') 2 -36 15 2

assign (residue 2 and name c4') (residue 2 and name o4')
       (residue 2 and name c1') (residue 2 and name c2') 2 0 15 2
assign (residue 2 and name o4') (residue 2 and name c1') 
       (residue 2 and name c2') (residue 2 and name c3') 2 -22 15 2
assign (residue 2 and name c1') (residue 2 and name c2') 
       (residue 2 and name c3') (residue 2 and name c4') 2 36 15 2
assign (residue 2 and name c2') (residue 2 and name c3') 
       (residue 2 and name c4') (residue 2 and name o4') 2 -36 15 2

assign (residue 3 and name c4') (residue 3 and name o4') 
       (residue 3 and name c1') (residue 3 and name c2') 2 0 15 2
assign (residue 3 and name o4') (residue 3 and name c1') 
       (residue 3 and name c2') (residue 3 and name c3') 2 -22 15 2
assign (residue 3 and name c1') (residue 3 and name c2') 
       (residue 3 and name c3') (residue 3 and name c4') 2 36 15 2
assign (residue 3 and name c2') (residue 3 and name c3') 
       (residue 3 and name c4') (residue 3 and name o4') 2 -36 15 2

assign (residue 4 and name c4') (residue 4 and name o4') 
       (residue 4 and name c1') (residue 4 and name c2') 2 0 15 2
assign (residue 4 and name o4') (residue 4 and name c1') 
       (residue 4 and name c2') (residue 4 and name c3') 2 -22 15 2
assign (residue 4 and name c1') (residue 4 and name c2') 
       (residue 4 and name c3') (residue 4 and name c4') 2 36 15 2
assign (residue 4 and name c2') (residue 4 and name c3') 
       (residue 4 and name c4') (residue 4 and name o4') 2 -36 15 2

assign (residue 5 and name c4') (residue 5 and name o4') 
       (residue 5 and name c1') (residue 5 and name c2') 2 0 15 2
assign (residue 5 and name o4') (residue 5 and name c1') 
       (residue 5 and name c2') (residue 5 and name c3') 2 -22 15 2
assign (residue 5 and name c1') (residue 5 and name c2') 
       (residue 5 and name c3') (residue 5 and name c4') 2 36 15 2
assign (residue 5 and name c2') (residue 5 and name c3') 
       (residue 5 and name c4') (residue 5 and name o4') 2 -36 15 2

assign (residue 6 and name c4') (residue 6 and name o4')
       (residue 6 and name c1') (residue 6 and name c2') 2 0 15 2
assign (residue 6 and name o4') (residue 6 and name c1')
       (residue 6 and name c2') (residue 6 and name c3') 2 -22 15 2
assign (residue 6 and name c1') (residue 6 and name c2')
       (residue 6 and name c3') (residue 6 and name c4') 2 36 15 2
assign (residue 6 and name c2') (residue 6 and name c3')
       (residue 6 and name c4') (residue 6 and name o4') 2 -36 15 2

assign (residue 7 and name c4') (residue 7 and name o4')
       (residue 7 and name c1') (residue 7 and name c2') 2 0 15 2
assign (residue 7 and name o4') (residue 7 and name c1')
       (residue 7 and name c2') (residue 7 and name c3') 2 -22 15 2
assign (residue 7 and name c1') (residue 7 and name c2')
       (residue 7 and name c3') (residue 7 and name c4') 2 36 15 2
assign (residue 7 and name c2') (residue 7 and name c3')
       (residue 7 and name c4') (residue 7 and name o4') 2 -36 15 2

assign (residue 8 and name c4') (residue 8 and name o4')
       (residue 8 and name c1') (residue 8 and name c2') 2 0 15 2
assign (residue 8 and name o4') (residue 8 and name c1') 
       (residue 8 and name c2') (residue 8 and name c3') 2 -22 15 2
assign (residue 8 and name c1') (residue 8 and name c2') 
       (residue 8 and name c3') (residue 8 and name c4') 2 36 15 2
assign (residue 8 and name c2') (residue 8 and name c3') 
       (residue 8 and name c4') (residue 8 and name o4') 2 -36 15 2

assign (residue 9 and name c4') (residue 9 and name o4')
       (residue 9 and name c1') (residue 9 and name c2') 2 0 15 2
assign (residue 9 and name o4') (residue 9 and name c1') 
       (residue 9 and name c2') (residue 9 and name c3') 2 -22 15 2
assign (residue 9 and name c1') (residue 9 and name c2') 
       (residue 9 and name c3') (residue 9 and name c4') 2 36 15 2
assign (residue 9 and name c2') (residue 9 and name c3') 
       (residue 9 and name c4') (residue 9 and name o4') 2 -36 15 2

assign (residue 10 and name c4') (residue 10 and name o4') 
       (residue 10 and name c1') (residue 10 and name c2') 2 0 15 2 
assign (residue 10 and name o4') (residue 10 and name c1') 
       (residue 10 and name c2') (residue 10 and name c3')  2 -22 15 2
assign (residue 10 and name c1') (residue 10 and name c2') 
       (residue 10 and name c3') (residue 10 and name c4') 2 36 15 2
assign (residue 10 and name c2') (residue 10 and name c3') 
       (residue 10 and name c4') (residue 10 and name o4') 2 -36 15 2

assign (residue 11 and name c4') (residue 11 and name o4')
       (residue 11 and name c1') (residue 11 and name c2') 2 0 15 2
assign (residue 11 and name o4') (residue 11 and name c1')
       (residue 11 and name c2') (residue 11 and name c3')  2 -22 15 2
assign (residue 11 and name c1') (residue 11 and name c2')
       (residue 11 and name c3') (residue 11 and name c4') 2 36 15 2
assign (residue 11 and name c2') (residue 11 and name c3')
       (residue 11 and name c4') (residue 11 and name o4') 2 -36 15 2

assign (residue 12 and name c4') (residue 12 and name o4') 
       (residue 12 and name c1') (residue 12 and name c2') 2 0 15 2 
assign (residue 12 and name o4') (residue 12 and name c1') 
       (residue 12 and name c2') (residue 12 and name c3')  2 -22 15 2
assign (residue 12 and name c1') (residue 12 and name c2') 
       (residue 12 and name c3') (residue 12 and name c4') 2 36 15 2
assign (residue 12 and name c2') (residue 12 and name c3') 
       (residue 12 and name c4') (residue 12 and name o4') 2 -36 15 2

assign (residue 13 and name c4') (residue 13 and name o4')
       (residue 13 and name c1') (residue 13 and name c2') 2 0 15 2
assign (residue 13 and name o4') (residue 13 and name c1')
       (residue 13 and name c2') (residue 13 and name c3') 2 -22 15 2
assign (residue 13 and name c1') (residue 13 and name c2')
       (residue 13 and name c3') (residue 13 and name c4') 2 36 15 2
assign (residue 13 and name c2') (residue 13 and name c3')
       (residue 13 and name c4') (residue 13 and name o4') 2 -36 15 2

assign (residue 14 and name c4') (residue 14 and name o4')
       (residue 14 and name c1') (residue 14 and name c2') 2 0 15 2
assign (residue 14 and name o4') (residue 14 and name c1')
       (residue 14 and name c2') (residue 14 and name c3') 2 -22 15 2
assign (residue 14 and name c1') (residue 14 and name c2')
       (residue 14 and name c3') (residue 14 and name c4') 2 36 15 2
assign (residue 14 and name c2') (residue 14 and name c3')
       (residue 14 and name c4') (residue 14 and name o4') 2 -36 15 2

assign (residue 15 and name c4') (residue 15 and name o4')
       (residue 15 and name c1') (residue 15 and name c2') 2 0 15 2
assign (residue 15 and name o4') (residue 15 and name c1')
       (residue 15 and name c2') (residue 15 and name c3') 2 -22 15 2
assign (residue 15 and name c1') (residue 15 and name c2')
       (residue 15 and name c3') (residue 15 and name c4') 2 36 15 2
assign (residue 15 and name c2') (residue 15 and name c3')
       (residue 15 and name c4') (residue 15 and name o4') 2 -36 15 2

assign (residue 16 and name c4') (residue 16 and name o4')
       (residue 16 and name c1') (residue 16 and name c2') 2 0 15 2
assign (residue 16 and name o4') (residue 16 and name c1')
       (residue 16 and name c2') (residue 16 and name c3') 2 -22 15 2
assign (residue 16 and name c1') (residue 16 and name c2')
       (residue 16 and name c3') (residue 16 and name c4') 2 36 15 2
assign (residue 16 and name c2') (residue 16 and name c3')
       (residue 16 and name c4') (residue 16 and name o4') 2 -36 15 2

assign (residue 17 and name c4') (residue 17 and name o4')
       (residue 17 and name c1') (residue 17 and name c2') 2 0 15 2
assign (residue 17 and name o4') (residue 17 and name c1')
       (residue 17 and name c2') (residue 17 and name c3') 2 -22 15 2
assign (residue 17 and name c1') (residue 17 and name c2')
       (residue 17 and name c3') (residue 17 and name c4') 2 36 15 2
assign (residue 17 and name c2') (residue 17 and name c3')
       (residue 17 and name c4') (residue 17 and name o4') 2 -36 15 2

assign (residue 18 and name c4') (residue 18 and name o4')
       (residue 18 and name c1') (residue 18 and name c2') 2 0 15 2
assign (residue 18 and name o4') (residue 18 and name c1')
       (residue 18 and name c2') (residue 18 and name c3') 2 -22 15 2
assign (residue 18 and name c1') (residue 18 and name c2')
       (residue 18 and name c3') (residue 18 and name c4') 2 36 15 2
assign (residue 18 and name c2') (residue 18 and name c3')
       (residue 18 and name c4') (residue 18 and name o4') 2 -36 15 2

assign (residue 19 and name c4') (residue 19 and name o4')
       (residue 19 and name c1') (residue 19 and name c2') 2 0 15 2
assign (residue 19 and name o4') (residue 19 and name c1')
       (residue 19 and name c2') (residue 19 and name c3') 2 -22 15 2
assign (residue 19 and name c1') (residue 19 and name c2')
       (residue 19 and name c3') (residue 19 and name c4') 2 36 15 2
assign (residue 19 and name c2') (residue 19 and name c3')
       (residue 19 and name c4') (residue 19 and name o4') 2 -36 15 2

assign (residue 20 and name c4') (residue 20 and name o4')
       (residue 20 and name c1') (residue 20 and name c2') 2 0 15 2
assign (residue 20 and name o4') (residue 20 and name c1')
       (residue 20 and name c2') (residue 20 and name c3') 2 -22 15 2
assign (residue 20 and name c1') (residue 20 and name c2')
       (residue 20 and name c3') (residue 20 and name c4') 2 36 15 2
assign (residue 20 and name c2') (residue 20 and name c3')
       (residue 20 and name c4') (residue 20 and name o4') 2 -36 15 2

assign (residue 21 and name c4') (residue 21 and name o4')
       (residue 21 and name c1') (residue 21 and name c2') 2 0 15 2
assign (residue 21 and name o4') (residue 21 and name c1')
       (residue 21 and name c2') (residue 21 and name c3') 2 -22 15 2
assign (residue 21 and name c1') (residue 21 and name c2')
       (residue 21 and name c3') (residue 21 and name c4') 2 36 15 2
assign (residue 21 and name c2') (residue 21 and name c3')
       (residue 21 and name c4') (residue 21 and name o4') 2 -36 15 2

assign (residue 26 and name c4') (residue 26 and name o4') 
       (residue 26 and name c1') (residue 26 and name c2') 2 0 15 2
assign (residue 26 and name o4') (residue 26 and name c1') 
       (residue 26 and name c2') (residue 26 and name c3') 2 -22 15 2
assign (residue 26 and name c1') (residue 26 and name c2') 
       (residue 26 and name c3') (residue 26 and name c4') 2 36 15 2
assign (residue 26 and name c2') (residue 26 and name c3') 
       (residue 26 and name c4') (residue 26 and name o4') 2 -36 15 2

assign (residue 27 and name c4') (residue 27 and name o4')
       (residue 27 and name c1') (residue 27 and name c2') 2 0 15 2
assign (residue 27 and name o4') (residue 27 and name c1')
       (residue 27 and name c2') (residue 27 and name c3') 2 -22 15 2
assign (residue 27 and name c1') (residue 27 and name c2')
       (residue 27 and name c3') (residue 27 and name c4') 2 36 15 2
assign (residue 27 and name c2') (residue 27 and name c3')
       (residue 27 and name c4') (residue 27 and name o4') 2 -36 15 2

assign (residue 28 and name c4') (residue 28 and name o4') 
       (residue 28 and name c1') (residue 28 and name c2') 2 0 15 2
assign (residue 28 and name o4') (residue 28 and name c1') 
       (residue 28 and name c2') (residue 28 and name c3') 2 -22 15 2
assign (residue 28 and name c1') (residue 28 and name c2') 
       (residue 28 and name c3') (residue 28 and name c4') 2 36 15 2
assign (residue 28 and name c2') (residue 28 and name c3') 
       (residue 28 and name c4') (residue 28 and name o4') 2 -36 15 2

assign (residue 29 and name c4') (residue 29 and name o4')
       (residue 29 and name c1') (residue 29 and name c2') 2 0 15 2
assign (residue 29 and name o4') (residue 29 and name c1')
       (residue 29 and name c2') (residue 29 and name c3') 2 -22 15 2
assign (residue 29 and name c1') (residue 29 and name c2')
       (residue 29 and name c3') (residue 29 and name c4') 2 36 15 2
assign (residue 29 and name c2') (residue 29 and name c3')
       (residue 29 and name c4') (residue 29 and name o4') 2 -36 15 2

assign (residue 30 and name c4') (residue 30 and name o4')
       (residue 30 and name c1') (residue 30 and name c2') 2 0 15 2
assign (residue 30 and name o4') (residue 30 and name c1')
       (residue 30 and name c2') (residue 30 and name c3') 2 -22 15 2
assign (residue 30 and name c1') (residue 30 and name c2')
       (residue 30 and name c3') (residue 30 and name c4') 2 36 15 2
assign (residue 30 and name c2') (residue 30 and name c3')
       (residue 30 and name c4') (residue 30 and name o4') 2 -36 15 2

assign (residue 31 and name c4') (residue 31 and name o4')
       (residue 31 and name c1') (residue 31 and name c2') 2 0 15 2
assign (residue 31 and name o4') (residue 31 and name c1')
       (residue 31 and name c2') (residue 31 and name c3') 2 -22 15 2
assign (residue 31 and name c1') (residue 31 and name c2')
       (residue 31 and name c3') (residue 31 and name c4') 2 36 15 2
assign (residue 31 and name c2') (residue 31 and name c3')
       (residue 31 and name c4') (residue 31 and name o4') 2 -36 15 2

assign (residue 32 and name c4') (residue 32 and name o4')
       (residue 32 and name c1') (residue 32 and name c2') 2 0 15 2
assign (residue 32 and name o4') (residue 32 and name c1')
       (residue 32 and name c2') (residue 32 and name c3') 2 -22 15 2
assign (residue 32 and name c1') (residue 32 and name c2')
       (residue 32 and name c3') (residue 32 and name c4') 2 36 15 2
assign (residue 32 and name c2') (residue 32 and name c3')
       (residue 32 and name c4') (residue 32 and name o4') 2 -36 15 2

assign (residue 33 and name c4') (residue 33 and name o4')
       (residue 33 and name c1') (residue 33 and name c2') 2 0 15 2
assign (residue 33 and name o4') (residue 33 and name c1')
       (residue 33 and name c2') (residue 33 and name c3') 2 -22 15 2
assign (residue 33 and name c1') (residue 33 and name c2')
       (residue 33 and name c3') (residue 33 and name c4') 2 36 15 2
assign (residue 33 and name c2') (residue 33 and name c3')
       (residue 33 and name c4') (residue 33 and name o4') 2 -36 15 2

assign (residue 34 and name c4') (residue 34 and name o4')
       (residue 34 and name c1') (residue 34 and name c2') 2 0 15 2
assign (residue 34 and name o4') (residue 34 and name c1')
       (residue 34 and name c2') (residue 34 and name c3') 2 -22 15 2
assign (residue 34 and name c1') (residue 34 and name c2')
       (residue 34 and name c3') (residue 34 and name c4') 2 36 15 2
assign (residue 34 and name c2') (residue 34 and name c3')
       (residue 34 and name c4') (residue 34 and name o4') 2 -36 15 2

assign (residue 36 and name c4') (residue 36 and name o4')
       (residue 36 and name c1') (residue 36 and name c2') 2 0 15 2
assign (residue 36 and name o4') (residue 36 and name c1')
       (residue 36 and name c2') (residue 36 and name c3') 2 -22 15 2
assign (residue 36 and name c1') (residue 36 and name c2')
       (residue 36 and name c3') (residue 36 and name c4') 2 36 15 2
assign (residue 36 and name c2') (residue 36 and name c3')
       (residue 36 and name c4') (residue 36 and name o4') 2 -36 15 2

assign (residue 37 and name c4') (residue 37 and name o4')
       (residue 37 and name c1') (residue 37 and name c2') 2 0 15 2
assign (residue 37 and name o4') (residue 37 and name c1')
       (residue 37 and name c2') (residue 37 and name c3') 2 -22 15 2
assign (residue 37 and name c1') (residue 37 and name c2')
       (residue 37 and name c3') (residue 37 and name c4') 2 36 15 2
assign (residue 37 and name c2') (residue 37 and name c3')
       (residue 37 and name c4') (residue 37 and name o4') 2 -36 15 2

assign (residue 38 and name c4') (residue 38 and name o4')
       (residue 38 and name c1') (residue 38 and name c2') 2 0 15 2
assign (residue 38 and name o4') (residue 38 and name c1')
       (residue 38 and name c2') (residue 38 and name c3') 2 -22 15 2
assign (residue 38 and name c1') (residue 38 and name c2')
       (residue 38 and name c3') (residue 38 and name c4') 2 36 15 2
assign (residue 38 and name c2') (residue 38 and name c3')
       (residue 38 and name c4') (residue 38 and name o4') 2 -36 15 2

assign (residue 39 and name c4') (residue 39 and name o4')
       (residue 39 and name c1') (residue 39 and name c2') 2 0 15 2
assign (residue 39 and name o4') (residue 39 and name c1')
       (residue 39 and name c2') (residue 39 and name c3') 2 -22 15 2
assign (residue 39 and name c1') (residue 39 and name c2')
       (residue 39 and name c3') (residue 39 and name c4') 2 36 15 2
assign (residue 39 and name c2') (residue 39 and name c3')
       (residue 39 and name c4') (residue 39 and name o4') 2 -36 15 2

assign (residue 40 and name c4') (residue 40 and name o4')
       (residue 40 and name c1') (residue 40 and name c2') 2 0 15 2
assign (residue 40 and name o4') (residue 40 and name c1')
       (residue 40 and name c2') (residue 40 and name c3') 2 -22 15 2
assign (residue 40 and name c1') (residue 40 and name c2')
       (residue 40 and name c3') (residue 40 and name c4') 2 36 15 2
assign (residue 40 and name c2') (residue 40 and name c3')
       (residue 40 and name c4') (residue 40 and name o4') 2 -36 15 2

assign (residue 41 and name c4') (residue 41 and name o4')
       (residue 41 and name c1') (residue 41 and name c2') 2 0 15 2
assign (residue 41 and name o4') (residue 41 and name c1')
       (residue 41 and name c2') (residue 41 and name c3') 2 -22 15 2
assign (residue 41 and name c1') (residue 41 and name c2')
       (residue 41 and name c3') (residue 41 and name c4') 2 36 15 2
assign (residue 41 and name c2') (residue 41 and name c3')
       (residue 41 and name c4') (residue 41 and name o4') 2 -36 15 2

assign (residue 42 and name c4') (residue 42 and name o4')
       (residue 42 and name c1') (residue 42 and name c2') 2 0 15 2
assign (residue 42 and name o4') (residue 42 and name c1')
       (residue 42 and name c2') (residue 42 and name c3') 2 -22 15 2
assign (residue 42 and name c1') (residue 42 and name c2')
       (residue 42 and name c3') (residue 42 and name c4') 2 36 15 2
assign (residue 42 and name c2') (residue 42 and name c3')
       (residue 42 and name c4') (residue 42 and name o4') 2 -36 15 2

assign (residue 43 and name c4') (residue 43 and name o4')
       (residue 43 and name c1') (residue 43 and name c2') 2 0 15 2
assign (residue 43 and name o4') (residue 43 and name c1')
       (residue 43 and name c2') (residue 43 and name c3') 2 -22 15 2
assign (residue 43 and name c1') (residue 43 and name c2')
       (residue 43 and name c3') (residue 43 and name c4') 2 36 15 2
assign (residue 43 and name c2') (residue 43 and name c3')
       (residue 43 and name c4') (residue 43 and name o4') 2 -36 15 2

assign (residue 44 and name c4') (residue 44 and name o4')
       (residue 44 and name c1') (residue 44 and name c2') 2 0 15 2
assign (residue 44 and name o4') (residue 44 and name c1')
       (residue 44 and name c2') (residue 44 and name c3') 2 -22 15 2
assign (residue 44 and name c1') (residue 44 and name c2')
       (residue 44 and name c3') (residue 44 and name c4') 2 36 15 2
assign (residue 44 and name c2') (residue 44 and name c3')
       (residue 44 and name c4') (residue 44 and name o4') 2 -36 15 2

assign (residue 45 and name c4') (residue 45 and name o4')
       (residue 45 and name c1') (residue 45 and name c2') 2 0 15 2
assign (residue 45 and name o4') (residue 45 and name c1')
       (residue 45 and name c2') (residue 45 and name c3') 2 -22 15 2
assign (residue 45 and name c1') (residue 45 and name c2')
       (residue 45 and name c3') (residue 45 and name c4') 2 36 15 2
assign (residue 45 and name c2') (residue 45 and name c3')
       (residue 45 and name c4') (residue 45 and name o4') 2 -36 15 2

assign (residue 46 and name c4') (residue 46 and name o4')
       (residue 46 and name c1') (residue 46 and name c2') 2 0 15 2
assign (residue 46 and name o4') (residue 46 and name c1')
       (residue 46 and name c2') (residue 46 and name c3') 2 -22 15 2
assign (residue 46 and name c1') (residue 46 and name c2')
       (residue 46 and name c3') (residue 46 and name c4') 2 36 15 2
assign (residue 46 and name c2') (residue 46 and name c3')
       (residue 46 and name c4') (residue 46 and name o4') 2 -36 15 2

assign (residue 47 and name c4') (residue 47 and name o4')
       (residue 47 and name c1') (residue 47 and name c2') 2 0 15 2
assign (residue 47 and name o4') (residue 47 and name c1')
       (residue 47 and name c2') (residue 47 and name c3') 2 -22 15 2
assign (residue 47 and name c1') (residue 47 and name c2')
       (residue 47 and name c3') (residue 47 and name c4') 2 36 15 2
assign (residue 47 and name c2') (residue 47 and name c3')
       (residue 47 and name c4') (residue 47 and name o4') 2 -36 15 2

assign (residue 48 and name c4') (residue 48 and name o4')
       (residue 48 and name c1') (residue 48 and name c2') 2 0 15 2
assign (residue 48 and name o4') (residue 48 and name c1')
       (residue 48 and name c2') (residue 48 and name c3') 2 -22 15 2
assign (residue 48 and name c1') (residue 48 and name c2')
       (residue 48 and name c3') (residue 48 and name c4') 2 36 15 2
assign (residue 48 and name c2') (residue 48 and name c3')
       (residue 48 and name c4') (residue 48 and name o4') 2 -36 15 2

assign (residue 25 and name c4') (residue 25 and name o4')
       (residue 25 and name c1') (residue 25 and name c2') 2 -18 15 2
assign (residue 25 and name o4') (residue 25 and name c1')
       (residue 25 and name c2') (residue 25 and name c3') 2 34 15 2
assign (residue 25 and name c1') (residue 25 and name c2')
       (residue 25 and name c3') (residue 25 and name c4') 2 -37 15 2
assign (residue 25 and name c2') (residue 25 and name c3')
       (residue 25 and name c4') (residue 25 and name o4') 2 26 15 2

assign (residue 35 and name c4') (residue 35 and name o4')
       (residue 35 and name c1') (residue 35 and name c2') 2 -18 15 2
assign (residue 35 and name o4') (residue 35 and name c1')
       (residue 35 and name c2') (residue 35 and name c3') 2 34 15 2
assign (residue 35 and name c1') (residue 35 and name c2')
       (residue 35 and name c3') (residue 35 and name c4') 2 -37 15 2
assign (residue 35 and name c2') (residue 35 and name c3')
       (residue 35 and name c4') (residue 35 and name o4') 2 26 15 2

assign (residue 2 and name p) (residue 2 and name o5')
        (residue 2 and name c5') (residue 2 and name c4') 2 170 30 2
assign (residue 3 and name p) (residue 3 and name o5')
        (residue 3 and name c5') (residue 3 and name c4') 2 170 30 2
assign (residue 4 and name p) (residue 4 and name o5')
        (residue 4 and name c5') (residue 4 and name c4') 2 170 30 2
assign (residue 5 and name p) (residue 5 and name o5')
        (residue 5 and name c5') (residue 5 and name c4') 2 170 30 2
assign (residue 6 and name p) (residue 6 and name o5')
        (residue 6 and name c5') (residue 6 and name c4') 2 170 30 2
assign (residue 7 and name p) (residue 7 and name o5')
        (residue 7 and name c5') (residue 7 and name c4') 2 170 30 2
assign (residue 8 and name p) (residue 8 and name o5')
        (residue 8 and name c5') (residue 8 and name c4') 2 170 30 2
assign (residue 9 and name p) (residue 9 and name o5')
        (residue 9 and name c5') (residue 9 and name c4') 2 170 30 2
assign (residue 10 and name p) (residue 10 and name o5')
        (residue 10 and name c5') (residue 10 and name c4') 2 170 30 2
assign (residue 11 and name p) (residue 11 and name o5')
        (residue 11 and name c5') (residue 11 and name c4') 2 170 30 2
assign (residue 12 and name p) (residue 12 and name o5')
        (residue 12 and name c5') (residue 12 and name c4') 2 170 30 2
assign (residue 13 and name p) (residue 13 and name o5')
        (residue 13 and name c5') (residue 13 and name c4') 2 170 30 2
assign (residue 14 and name p) (residue 14 and name o5')
        (residue 14 and name c5') (residue 14 and name c4') 2 170 30 2
assign (residue 15 and name p) (residue 15 and name o5')
        (residue 15 and name c5') (residue 15 and name c4') 2 170 30 2
assign (residue 16 and name p) (residue 16 and name o5')
        (residue 16 and name c5') (residue 16 and name c4') 2 170 30 2
assign (residue 18 and name p) (residue 18 and name o5')
        (residue 18 and name c5') (residue 18 and name c4') 2 170 30 2
assign (residue 19 and name p) (residue 19 and name o5')
        (residue 19 and name c5') (residue 19 and name c4') 2 170 30 2
assign (residue 20 and name p) (residue 20 and name o5')
        (residue 20 and name c5') (residue 20 and name c4') 2 170 30 2
assign (residue 21 and name p) (residue 21 and name o5')
        (residue 21 and name c5') (residue 21 and name c4') 2 170 30 2
assign (residue 22 and name p) (residue 22 and name o5')
        (residue 22 and name c5') (residue 22 and name c4') 2 170 30 2
assign (residue 23 and name p) (residue 23 and name o5')
        (residue 23 and name c5') (residue 23 and name c4') 2 170 60 2
assign (residue 24 and name p) (residue 24 and name o5')
        (residue 24 and name c5') (residue 24 and name c4') 2 170 60 2
assign (residue 25 and name p) (residue 25 and name o5')
        (residue 25 and name c5') (residue 25 and name c4') 2 170 60 2
assign (residue 26 and name p) (residue 26 and name o5')
        (residue 26 and name c5') (residue 26 and name c4') 2 170 60 2
assign (residue 27 and name p) (residue 27 and name o5')
        (residue 27 and name c5') (residue 27 and name c4') 2 170 30 2
assign (residue 28 and name p) (residue 28 and name o5')
        (residue 28 and name c5') (residue 28 and name c4') 2 170 30 2
assign (residue 29 and name p) (residue 29 and name o5')
        (residue 29 and name c5') (residue 29 and name c4') 2 170 30 2
assign (residue 30 and name p) (residue 30 and name o5')
        (residue 30 and name c5') (residue 30 and name c4') 2 170 30 2
assign (residue 31 and name p) (residue 31 and name o5')
        (residue 31 and name c5') (residue 31 and name c4') 2 170 30 2
assign (residue 32 and name p) (residue 32 and name o5')
        (residue 32 and name c5') (residue 32 and name c4') 2 170 30 2
assign (residue 33 and name p) (residue 33 and name o5')
        (residue 33 and name c5') (residue 33 and name c4') 2 170 30 2
assign (residue 34 and name p) (residue 34 and name o5')
        (residue 34 and name c5') (residue 34 and name c4') 2 170 30 2
assign (residue 35 and name p) (residue 35 and name o5')
        (residue 35 and name c5') (residue 35 and name c4') 2 170 60 2
assign (residue 36 and name p) (residue 36 and name o5')
        (residue 36 and name c5') (residue 36 and name c4') 2 170 30 2
assign (residue 37 and name p) (residue 37 and name o5')
        (residue 37 and name c5') (residue 37 and name c4') 2 170 30 2
assign (residue 38 and name p) (residue 38 and name o5')
        (residue 38 and name c5') (residue 38 and name c4') 2 170 30 2
assign (residue 39 and name p) (residue 39 and name o5')
        (residue 39 and name c5') (residue 39 and name c4') 2 170 30 2
assign (residue 40 and name p) (residue 40 and name o5')
        (residue 40 and name c5') (residue 40 and name c4') 2 170 30 2
assign (residue 41 and name p) (residue 41 and name o5')
        (residue 41 and name c5') (residue 41 and name c4') 2 170 30 2
assign (residue 42 and name p) (residue 42 and name o5')
        (residue 42 and name c5') (residue 42 and name c4') 2 170 30 2
assign (residue 43 and name p) (residue 43 and name o5')
        (residue 43 and name c5') (residue 43 and name c4') 2 170 30 2
assign (residue 44 and name p) (residue 44 and name o5')
        (residue 44 and name c5') (residue 44 and name c4') 2 170 30 2
assign (residue 45 and name p) (residue 45 and name o5')
        (residue 45 and name c5') (residue 45 and name c4') 2 170 30 2
assign (residue 46 and name p) (residue 46 and name o5')
        (residue 46 and name c5') (residue 46 and name c4') 2 170 30 2
assign (residue 47 and name p) (residue 47 and name o5')
        (residue 47 and name c5') (residue 47 and name c4') 2 170 30 2
assign (residue 48 and name p) (residue 48 and name o5')
        (residue 48 and name c5') (residue 48 and name c4') 2 170 30 2

assign (residue 1 and name o5') (residue 1 and name c5')
        (residue 1 and name c4') (residue 1 and name c3') 2 55 30 2
assign (residue 2 and name o5') (residue 2 and name c5')
        (residue 2 and name c4') (residue 2 and name c3') 2 55 30 2
assign (residue 3 and name o5') (residue 3 and name c5')
        (residue 3 and name c4') (residue 3 and name c3') 2 55 30 2
assign (residue 4 and name o5') (residue 4 and name c5')
        (residue 4 and name c4') (residue 4 and name c3') 2 55 30 2
assign (residue 5 and name o5') (residue 5 and name c5')
        (residue 5 and name c4') (residue 5 and name c3') 2 55 30 2
assign (residue 6 and name o5') (residue 6 and name c5')
        (residue 6 and name c4') (residue 6 and name c3') 2 55 30 2
assign (residue 7 and name o5') (residue 7 and name c5')
        (residue 7 and name c4') (residue 7 and name c3') 2 55 30 2
assign (residue 8 and name o5') (residue 8 and name c5')
        (residue 8 and name c4') (residue 8 and name c3') 2 55 30 2
assign (residue 9 and name o5') (residue 9 and name c5')
        (residue 9 and name c4') (residue 9 and name c3') 2 55 30 2
assign (residue 10 and name o5') (residue 10 and name c5')
        (residue 10 and name c4') (residue 10 and name c3') 2 55 30 2
assign (residue 11 and name o5') (residue 11 and name c5')
        (residue 11 and name c4') (residue 11 and name c3') 2 55 30 2
assign (residue 12 and name o5') (residue 12 and name c5')
        (residue 12 and name c4') (residue 12 and name c3') 2 55 30 2
assign (residue 13 and name o5') (residue 13 and name c5')
        (residue 13 and name c4') (residue 13 and name c3') 2 55 30 2
assign (residue 14 and name o5') (residue 14 and name c5')
        (residue 14 and name c4') (residue 14 and name c3') 2 55 30 2
assign (residue 15 and name o5') (residue 15 and name c5')
        (residue 15 and name c4') (residue 15 and name c3') 2 55 30 2
assign (residue 16 and name o5') (residue 16 and name c5')
        (residue 16 and name c4') (residue 16 and name c3') 2 55 30 2
assign (residue 17 and name o5') (residue 17 and name c5')
        (residue 17 and name c4') (residue 17 and name c3') 2 55 30 2
assign (residue 18 and name o5') (residue 18 and name c5')
        (residue 18 and name c4') (residue 18 and name c3') 2 55 30 2
assign (residue 19 and name o5') (residue 19 and name c5')
        (residue 19 and name c4') (residue 19 and name c3') 2 55 30 2
assign (residue 20 and name o5') (residue 20 and name c5')
        (residue 20 and name c4') (residue 20 and name c3') 2 55 30 2
assign (residue 21 and name o5') (residue 21 and name c5')
        (residue 21 and name c4') (residue 21 and name c3') 2 55 30 2
assign (residue 22 and name o5') (residue 22 and name c5')
        (residue 22 and name c4') (residue 22 and name c3') 2 55 30 2
assign (residue 23 and name o5') (residue 23 and name c5')
        (residue 23 and name c4') (residue 23 and name c3') 2 55 60 2
assign (residue 24 and name o5') (residue 24 and name c5')
        (residue 24 and name c4') (residue 24 and name c3') 2 55 60 2

assign (residue 26 and name o5') (residue 26 and name c5')
        (residue 26 and name c4') (residue 26 and name c3') 2 55 60 2
assign (residue 27 and name o5') (residue 27 and name c5')
        (residue 27 and name c4') (residue 27 and name c3') 2 55 30 2
assign (residue 28 and name o5') (residue 28 and name c5')
        (residue 28 and name c4') (residue 28 and name c3') 2 55 30 2
assign (residue 29 and name o5') (residue 29 and name c5')
        (residue 29 and name c4') (residue 29 and name c3') 2 55 30 2
assign (residue 30 and name o5') (residue 30 and name c5')
        (residue 30 and name c4') (residue 30 and name c3') 2 55 30 2
assign (residue 31 and name o5') (residue 31 and name c5')
        (residue 31 and name c4') (residue 31 and name c3') 2 55 30 2
assign (residue 32 and name o5') (residue 32 and name c5')
        (residue 32 and name c4') (residue 32 and name c3') 2 55 30 2
assign (residue 33 and name o5') (residue 33 and name c5')
        (residue 33 and name c4') (residue 33 and name c3') 2 55 30 2
assign (residue 34 and name o5') (residue 34 and name c5')
        (residue 34 and name c4') (residue 34 and name c3') 2 55 30 2

assign (residue 36 and name o5') (residue 36 and name c5')
        (residue 36 and name c4') (residue 36 and name c3') 2 55 30 2
assign (residue 37 and name o5') (residue 37 and name c5')
        (residue 37 and name c4') (residue 37 and name c3') 2 55 30 2
assign (residue 38 and name o5') (residue 38 and name c5')
        (residue 38 and name c4') (residue 38 and name c3') 2 55 30 2
assign (residue 39 and name o5') (residue 39 and name c5')
        (residue 39 and name c4') (residue 39 and name c3') 2 55 30 2
assign (residue 40 and name o5') (residue 40 and name c5')
        (residue 40 and name c4') (residue 40 and name c3') 2 55 30 2
assign (residue 41 and name o5') (residue 41 and name c5')
        (residue 41 and name c4') (residue 41 and name c3') 2 55 30 2
assign (residue 42 and name o5') (residue 42 and name c5')
        (residue 42 and name c4') (residue 42 and name c3') 2 55 30 2
assign (residue 43 and name o5') (residue 43 and name c5')
        (residue 43 and name c4') (residue 43 and name c3') 2 55 30 2
assign (residue 44 and name o5') (residue 44 and name c5')
        (residue 44 and name c4') (residue 44 and name c3') 2 55 30 2
assign (residue 45 and name o5') (residue 45 and name c5')
        (residue 45 and name c4') (residue 45 and name c3') 2 55 30 2
assign (residue 46 and name o5') (residue 46 and name c5')
        (residue 46 and name c4') (residue 46 and name c3') 2 55 30 2
assign (residue 47 and name o5') (residue 47 and name c5')
        (residue 47 and name c4') (residue 47 and name c3') 2 55 30 2
assign (residue 48 and name o5') (residue 48 and name c5')
        (residue 48 and name c4') (residue 48 and name c3') 2 55 30 2
assign (residue 25 and name o5') (residue 25 and name c5')
        (residue 25 and name c4') (residue 25 and name c3') 2 155 60 2
assign (residue 35 and name o5') (residue 35 and name c5')
        (residue 35 and name c4') (residue 35 and name c3') 2 155 60 2

assign (residue 1 and name c4') (residue 1 and name c3')
        (residue 1 and name o3') (residue 2 and name p) 2 -155 30 2
assign (residue 2 and name c4') (residue 2 and name c3')
        (residue 2 and name o3') (residue 3 and name p) 2 -155 30 2
assign (residue 3 and name c4') (residue 3 and name c3')
        (residue 3 and name o3') (residue 4 and name p) 2 -155 30 2
assign (residue 4 and name c4') (residue 4 and name c3')
        (residue 4 and name o3') (residue 5 and name p) 2 -155 30 2
assign (residue 5 and name c4') (residue 5 and name c3')
        (residue 5 and name o3') (residue 6 and name p) 2 -155 30 2
assign (residue 6 and name c4') (residue 6 and name c3')
        (residue 6 and name o3') (residue 7 and name p) 2 -155 30 2
assign (residue 7 and name c4') (residue 7 and name c3')
        (residue 7 and name o3') (residue 8 and name p) 2 -155 30 2
assign (residue 8 and name c4') (residue 8 and name c3')
        (residue 8 and name o3') (residue 9 and name p) 2 -155 30 2
assign (residue 9 and name c4') (residue 9 and name c3')
        (residue 9 and name o3') (residue 10 and name p) 2 -155 30 2
assign (residue 10 and name c4') (residue 10 and name c3')
        (residue 10 and name o3') (residue 11 and name p) 2 -155 30 2
assign (residue 11 and name c4') (residue 11 and name c3')
        (residue 11 and name o3') (residue 12 and name p) 2 -155 30 2
assign (residue 12 and name c4') (residue 12 and name c3')
        (residue 12 and name o3') (residue 13 and name p) 2 -155 30 2
assign (residue 13 and name c4') (residue 13 and name c3')
        (residue 13 and name o3') (residue 14 and name p) 2 -155 30 2
assign (residue 14 and name c4') (residue 14 and name c3')
        (residue 14 and name o3') (residue 15 and name p) 2 -155 30 2
assign (residue 15 and name c4') (residue 15 and name c3')
        (residue 15 and name o3') (residue 16 and name p) 2 -155 30 2
assign (residue 17 and name c4') (residue 17 and name c3')
        (residue 17 and name o3') (residue 18 and name p) 2 -155 30 2
assign (residue 18 and name c4') (residue 18 and name c3')
        (residue 18 and name o3') (residue 19 and name p) 2 -155 30 2
assign (residue 19 and name c4') (residue 19 and name c3')
        (residue 19 and name o3') (residue 20 and name p) 2 -155 30 2
assign (residue 20 and name c4') (residue 20 and name c3')
        (residue 20 and name o3') (residue 21 and name p) 2 -155 30 2
assign (residue 21 and name c4') (residue 21 and name c3')
        (residue 21 and name o3') (residue 22 and name p) 2 -155 30 2
assign (residue 22 and name c4') (residue 22 and name c3')
        (residue 22 and name o3') (residue 23 and name p) 2 -155 30 2
assign (residue 23 and name c4') (residue 23 and name c3')
        (residue 23 and name o3') (residue 24 and name p) 2 -90 90 2
assign (residue 24 and name c4') (residue 24 and name c3')
        (residue 24 and name o3') (residue 25 and name p) 2 -90 90 2
assign (residue 25 and name c4') (residue 25 and name c3')
        (residue 25 and name o3') (residue 26 and name p) 2 -90 90 2
assign (residue 26 and name c4') (residue 26 and name c3')
        (residue 26 and name o3') (residue 27 and name p) 2 -90 90 2
assign (residue 27 and name c4') (residue 27 and name c3')
        (residue 27 and name o3') (residue 28 and name p) 2 -155 30 2
assign (residue 28 and name c4') (residue 28 and name c3')
        (residue 28 and name o3') (residue 29 and name p) 2 -155 30 2
assign (residue 29 and name c4') (residue 29 and name c3')
        (residue 29 and name o3') (residue 30 and name p) 2 -155 30 2
assign (residue 30 and name c4') (residue 30 and name c3')
        (residue 30 and name o3') (residue 31 and name p) 2 -155 30 2
assign (residue 31 and name c4') (residue 31 and name c3')
        (residue 31 and name o3') (residue 32 and name p) 2 -155 30 2
assign (residue 32 and name c4') (residue 32 and name c3')
        (residue 32 and name o3') (residue 33 and name p) 2 -155 30 2
assign (residue 33 and name c4') (residue 33 and name c3')
        (residue 33 and name o3') (residue 34 and name p) 2 -155 30 2
assign (residue 34 and name c4') (residue 34 and name c3')
        (residue 34 and name o3') (residue 35 and name p) 2 -155 30 2
assign (residue 35 and name c4') (residue 35 and name c3')
        (residue 35 and name o3') (residue 36 and name p) 2 -90 90 2
assign (residue 36 and name c4') (residue 36 and name c3')
        (residue 36 and name o3') (residue 37 and name p) 2 -155 30 2
assign (residue 37 and name c4') (residue 37 and name c3')
        (residue 37 and name o3') (residue 38 and name p) 2 -155 30 2
assign (residue 38 and name c4') (residue 38 and name c3')
        (residue 38 and name o3') (residue 39 and name p) 2 -155 30 2
assign (residue 39 and name c4') (residue 39 and name c3')
        (residue 39 and name o3') (residue 40 and name p) 2 -155 30 2
assign (residue 40 and name c4') (residue 40 and name c3')
        (residue 40 and name o3') (residue 41 and name p) 2 -155 30 2
assign (residue 41 and name c4') (residue 41 and name c3')
        (residue 41 and name o3') (residue 42 and name p) 2 -155 30 2
assign (residue 42 and name c4') (residue 42 and name c3')
        (residue 42 and name o3') (residue 43 and name p) 2 -155 30 2
assign (residue 43 and name c4') (residue 43 and name c3')
        (residue 43 and name o3') (residue 44 and name p) 2 -155 30 2
assign (residue 44 and name c4') (residue 44 and name c3')
        (residue 44 and name o3') (residue 45 and name p) 2 -155 30 2
assign (residue 45 and name c4') (residue 45 and name c3')
        (residue 45 and name o3') (residue 46 and name p) 2 -155 30 2
assign (residue 46 and name c4') (residue 46 and name c3')
        (residue 46 and name o3') (residue 47 and name p) 2 -155 30 2
assign (residue 47 and name c4') (residue 47 and name c3')
        (residue 47 and name o3') (residue 48 and name p) 2 -155 30 2
{RDCs}
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c8 )(residue 1 and name h8 ) 30.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 2 and name c8 )(residue 2 and name h8 ) 26.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 3 and name c5 )(residue 3 and name h5 ) 10.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 4 and name c5 )(residue 4 and name h5 ) 18.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 5 and name c5 )(residue 5 and name h5 ) 19.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 7 and name c2 )(residue 7 and name h2 ) 33.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 9 and name c5 )(residue 9 and name h5 ) 21.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 10 and name c8 )(residue 10 and name h8 ) 35.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c8 )(residue 12 and name h8 ) 25.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 13 and name c6 )(residue 13 and name h6 ) 13.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c2 )(residue 19 and name h2 ) 32.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c8 )(residue 19 and name h8 ) 26.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c8 )(residue 20 and name h8 ) 22.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c5 )(residue 21 and name h5 ) 9.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c6 )(residue 21 and name h6 ) 15.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c5 )(residue 22 and name h5 ) 12.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c2 )(residue 23 and name h2 ) 26.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c8 )(residue 23 and name h8 ) 13.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c2 )(residue 24 and name h2 ) 20.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c8 )(residue 24 and name h8 ) 13.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c5 )(residue 26 and name h5 ) 8.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c5 )(residue 27 and name h5 ) 11.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c6 )(residue 27 and name h6 ) 14.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 29 and name c5 )(residue 29 and name h5 ) 11.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c2 )(residue 31 and name h2 ) 32.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c8 )(residue 31 and name h8 ) 32.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 32 and name c2 )(residue 32 and name h2 ) 35.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 33 and name c2 )(residue 33 and name h2 ) 35.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c2 )(residue 34 and name h2 ) 33.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c8 )(residue 34 and name h8 ) 22.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c2 )(residue 37 and name h2 ) 23.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c8 )(residue 37 and name h8 ) 24.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c5 )(residue 38 and name h5 ) 11.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c6 )(residue 38 and name h6 ) 22.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c2 )(residue 39 and name h2 ) 35.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c8 )(residue 39 and name h8 ) 31.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c2 )(residue 40 and name h2 ) 28.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c8 )(residue 40 and name h8 ) 24.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c8 )(residue 41 and name h8 ) 24.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c6 )(residue 42 and name h6 ) 28.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c5 )(residue 43 and name h5 ) 9.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c2 )(residue 45 and name h2 ) 35.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c8 )(residue 46 and name h8 ) 27.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c5 )(residue 47 and name h5 ) 25.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c5 )(residue 48 and name h5 ) 21.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c6 )(residue 48 and name h6 ) 13.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c2' )(residue 1 and name h2'' ) 16.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 2 and name c4' )(residue 2 and name h4' ) 27.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 7 and name c1' )(residue 7 and name h1' ) -15.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 8 and name c1' )(residue 8 and name h1' ) -15.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 11 and name c1' )(residue 11 and name h1' ) -13.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c3' )(residue 12 and name h3' ) 29.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 13 and name c1' )(residue 13 and name h1' ) -40.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 18 and name c3' )(residue 18 and name h3' ) 21.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c1' )(residue 19 and name h1' ) -34.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c2' )(residue 20 and name h2'' ) 23.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c1' )(residue 21 and name h1' ) -18.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c2' )(residue 21 and name h2'' ) 21.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c3' )(residue 21 and name h3' ) 11.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c4' )(residue 21 and name h4' ) 23.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c1' )(residue 22 and name h1' ) -7.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c4' )(residue 22 and name h4' ) 14.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c1' )(residue 23 and name h1' ) 4.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c4' )(residue 23 and name h4' ) -7.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c1' )(residue 24 and name h1' ) 11.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c2' )(residue 24 and name h2'' ) -9.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c4' )(residue 24 and name h4' ) 16.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c1' )(residue 26 and name h1' ) -19.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c4' )(residue 26 and name h4' ) 9.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c1' )(residue 27 and name h1' ) -18.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c3' )(residue 27 and name h3' ) 7.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c4' )(residue 27 and name h4' ) 14.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c3' )(residue 28 and name h3' ) 9.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c4' )(residue 28 and name h4' ) 22.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c1' )(residue 34 and name h1' ) -2.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c2' )(residue 34 and name h2'' ) 16.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c1' )(residue 35 and name h1' ) -5.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c2' )(residue 35 and name h2'' ) 5.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 36 and name c4' )(residue 36 and name h4' ) 21.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c1' )(residue 37 and name h1' ) -45.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c3' )(residue 37 and name h3' ) 9.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c1' )(residue 38 and name h1' ) -36.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c2' )(residue 39 and name h2'' ) 15.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c3' )(residue 39 and name h3' ) 5.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c4' )(residue 39 and name h4' ) 20.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c1' )(residue 40 and name h1' ) -9.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c3' )(residue 40 and name h3' ) -1.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c4' )(residue 40 and name h4' ) 19.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c1' )(residue 41 and name h1' ) -25.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c3' )(residue 45 and name h3' ) 14.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c1' )(residue 47 and name h1' ) -12.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c3' )(residue 47 and name h3' ) 22.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c1' )(residue 48 and name h1' ) 1.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c2' )(residue 48 and name h2'' ) 19.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c3' )(residue 48 and name h3' ) 22.6 2.5

  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1    H5'    G   1           H5'        G   1   8.150 -17.011  62.193
    2   H5''    G   1          H5''        G   1   7.405 -16.656  60.621
    3    H4'    G   1           H4'        G   1   6.245 -15.268  62.194
    4    H3'    G   1           H3'        G   1   8.305 -14.028  60.415
    5    H2'    G   1          H2''        G   1   8.430 -11.999  61.526
    6   HO2'    G   1          H2'         G   1   6.694 -11.056  62.225
    7    H1'    G   1           H1'        G   1   8.035 -12.794  64.128
    8    H8     G   1           H8         G   1  10.411 -15.168  62.318
    9    H1     G   1           H1         G   1  13.204  -9.750  64.292
   10    H21    G   1           H21        G   1  11.685  -8.330  65.026
   11    H22    G   1           H22        G   1   9.969  -8.657  64.924
   12   HO5'    G   1          H5T         G   1   9.205 -15.817  59.945
   13    H5'    G   2           H5'        G   2   5.330 -10.855  59.660
   14   H5''    G   2          H5''        G   2   5.882 -10.221  58.099
   15    H4'    G   2           H4'        G   2   6.275  -8.828  60.329
   16    H3'    G   2           H3'        G   2   7.971  -9.285  57.891
   17    H2'    G   2          H2''        G   2   9.874  -8.397  58.824
   18   HO2'    G   2          H2'         G   2   8.084  -6.792  60.329
   19    H1'    G   2           H1'        G   2   9.205  -8.670  61.591
   20    H8     G   2           H8         G   2   9.624 -12.060  60.051
   21    H1     G   2           H1         G   2  15.215  -9.061  60.994
   22    H21    G   2           H21        G   2  14.863  -6.956  61.550
   23    H22    G   2           H22        G   2  13.273  -6.230  61.505
   24    H5'    C   3           H5'        C   3   7.357  -4.982  59.384
   25   H5''    C   3          H5''        C   3   7.318  -3.828  58.036
   26    H4'    C   3           H4'        C   3   8.726  -3.052  59.985
   27    H3'    C   3           H3'        C   3   9.613  -3.418  57.153
   28    H2'    C   3          H2''        C   3  11.875  -3.265  57.560
   29   HO2'    C   3          H2'         C   3  11.100  -1.692  59.780
   30    H1'    C   3           H1'        C   3  12.023  -4.159  60.202
   31    H41    C   3           H41        C   3  14.602  -8.662  56.491
   32    H42    C   3           H42        C   3  13.015  -9.147  55.938
   33    H5     C   3           H5         C   3  10.984  -8.107  56.703
   34    H6     C   3           H6         C   3  10.041  -6.261  58.002
   35    H5'    U   4           H5'        U   4  11.900  -0.122  58.268
   36   H5''    U   4          H5''        U   4  11.706   1.168  57.065
   37    H4'    U   4           H4'        U   4  14.088   0.623  57.283
   38    H3'    U   4           H3'        U   4  12.539  -0.071  54.797
   39    H2'    U   4          H2''        U   4  14.205  -1.342  53.884
   40   HO2'    U   4          H2'         U   4  16.045  -0.387  53.644
   41    H1'    U   4           H1'        U   4  15.688  -1.960  56.243
   42    H3     U   4           H3         U   4  15.464  -5.952  54.185
   43    H5     U   4           H5         U   4  11.415  -4.964  54.804
   44    H6     U   4           H6         U   4  12.139  -2.825  55.688
   45    H5'    C   5           H5'        C   5  16.641   1.988  53.587
   46   H5''    C   5          H5''        C   5  16.169   2.892  52.136
   47    H4'    C   5           H4'        C   5  18.200   1.475  51.758
   48    H3'    C   5           H3'        C   5  15.588   1.108  50.298
   49    H2'    C   5          H2''        C   5  16.245  -0.834  49.276
   50   HO2'    C   5          H2'         C   5  18.104  -0.966  48.284
   51    H1'    C   5           H1'        C   5  18.331  -1.618  51.068
   52    H41    C   5           H41        C   5  14.148  -6.376  51.018
   53    H42    C   5           H42        C   5  12.915  -5.361  51.723
   54    H5     C   5           H5         C   5  13.330  -3.076  52.402
   55    H6     C   5           H6         C   5  14.872  -1.179  52.188
   56    H5'    G   6           H5'        G   6  19.017   2.090  46.657
   57   H5''    G   6          H5''        G   6  17.821   2.184  45.350
   58    H4'    G   6           H4'        G   6  19.828   0.425  45.242
   59    H3'    G   6           H3'        G   6  16.933   0.284  44.424
   60    H2'    G   6          H2''        G   6  16.980  -2.000  44.001
   61   HO2'    G   6          H2'         G   6  18.727  -3.036  43.273
   62    H1'    G   6           H1'        G   6  18.829  -2.807  45.914
   63    H8     G   6           H8         G   6  16.116  -0.521  47.319
   64    H1     G   6           H1         G   6  14.322  -6.646  46.719
   65    H21    G   6           H21        G   6  15.862  -7.783  45.619
   66    H22    G   6           H22        G   6  17.235  -7.005  44.864
   67    H5'    A   7           H5'        A   7  19.298  -1.452  40.943
   68   H5''    A   7          H5''        A   7  18.212  -1.469  39.540
   69    H4'    A   7           H4'        A   7  19.019  -3.751  40.674
   70    H3'    A   7           H3'        A   7  16.402  -2.875  39.470
   71    H2'    A   7          H2''        A   7  15.243  -4.751  40.193
   72   HO2'    A   7          H2'         A   7  17.626  -6.139  40.818
   73    H1'    A   7           H1'        A   7  16.582  -5.248  42.584
   74    H8     A   7           H8         A   7  15.617  -1.606  42.475
   75    H61    A   7           H61        A   7   9.853  -3.342  43.876
   76    H62    A   7           H62        A   7  10.980  -2.005  43.829
   77    H2     A   7           H2         A   7  12.228  -7.030  42.948
   78    H5'    U   8           H5'        U   8  17.220  -6.544  36.674
   79   H5''    U   8          H5''        U   8  16.171  -6.160  35.296
   80    H4'    U   8           H4'        U   8  15.613  -8.221  36.893
   81    H3'    U   8           H3'        U   8  13.880  -6.161  35.539
   82    H2'    U   8          H2''        U   8  11.962  -6.788  36.661
   83   HO2'    U   8          H2'         U   8  11.465  -8.816  36.755
   84    H1'    U   8           H1'        U   8  13.125  -7.824  39.027
   85    H3     U   8           H3         U   8   9.836  -4.779  40.023
   86    H5     U   8           H5         U   8  13.324  -2.532  39.294
   87    H6     U   8           H6         U   8  14.366  -4.549  38.441
   88    H5'    U   9           H5'        U   9  11.940  -9.419  32.632
   89   H5''    U   9          H5''        U   9  11.645  -8.156  31.422
   90    H4'    U   9           H4'        U   9   9.613  -9.300  32.719
   91    H3'    U   9           H3'        U   9  10.143  -6.471  31.830
   92    H2'    U   9          H2''        U   9   8.400  -5.575  33.029
   93   HO2'    U   9          H2'         U   9   6.729  -6.656  32.101
   94    H1'    U   9           H1'        U   9   8.089  -7.631  34.993
   95    H3     U   9           H3         U   9   7.872  -3.694  37.212
   96    H5     U   9           H5         U   9  11.904  -3.975  36.019
   97    H6     U   9           H6         U   9  11.319  -5.950  34.734
   98    H5'    G  10           H5'        G  10   5.955  -8.111  30.478
   99   H5''    G  10          H5''        G  10   5.725  -7.494  28.830
  100    H4'    G  10           H4'        G  10   3.673  -7.292  30.304
  101    H3'    G  10           H3'        G  10   5.096  -5.022  28.924
  102    H2'    G  10          H2''        G  10   3.761  -3.385  29.892
  103   HO2'    G  10          H2'         G  10   1.893  -5.414  30.597
  104    H1'    G  10           H1'        G  10   3.313  -4.552  32.369
  105    H8     G  10           H8         G  10   6.987  -4.769  31.664
  106    H1     G  10           H1         G  10   5.088   1.201  33.048
  107    H21    G  10           H21        G  10   2.886   1.311  33.050
  108    H22    G  10           H22        G  10   1.883  -0.030  32.545
  109    H5'    U  11           H5'        U  11   0.863  -4.276  27.512
  110   H5''    U  11          H5''        U  11   1.090  -3.255  26.080
  111    H4'    U  11           H4'        U  11   0.008  -2.255  28.302
  112    H3'    U  11           H3'        U  11   2.000  -1.097  26.343
  113    H2'    U  11          H2''        U  11   2.264   0.839  27.604
  114   HO2'    U  11          H2'         U  11  -0.252   0.173  28.733
  115    H1'    U  11           H1'        U  11   1.895  -0.270  30.154
  116    H3     U  11           H3         U  11   5.927   1.927  29.756
  117    H5     U  11           H5         U  11   6.582  -1.974  28.308
  118    H6     U  11           H6         U  11   4.185  -2.333  28.378
  119    H5'    A  12           H5'        A  12  -1.173   1.976  24.713
  120   H5''    A  12          H5''        A  12  -0.218   2.286  23.251
  121    H4'    A  12           H4'        A  12  -0.380   4.109  25.207
  122    H3'    A  12           H3'        A  12   1.962   3.229  23.495
  123    H2'    A  12          H2''        A  12   3.357   4.785  24.548
  124   HO2'    A  12          H2'         A  12   2.656   6.593  25.490
  125    H1'    A  12           H1'        A  12   2.326   4.499  27.110
  126    H8     A  12           H8         A  12   2.915   1.031  25.778
  127    H61    A  12           H61        A  12   8.986   2.037  26.368
  128    H62    A  12           H62        A  12   7.747   0.842  26.053
  129    H2     A  12           H2         A  12   6.855   5.917  27.093
  130    H5'    U  13           H5'        U  13   1.469   7.657  23.750
  131   H5''    U  13          H5''        U  13   2.020   8.405  22.239
  132    H4'    U  13           H4'        U  13   3.058   9.250  24.486
  133    H3'    U  13           H3'        U  13   4.388   8.490  21.891
  134    H2'    U  13          H2''        U  13   6.527   8.685  22.739
  135   HO2'    U  13          H2'         U  13   5.402  10.387  24.721
  136    H1'    U  13           H1'        U  13   6.027   8.053  25.434
  137    H3     U  13           H3         U  13   9.358   5.413  23.657
  138    H5     U  13           H5         U  13   5.717   3.624  22.512
  139    H6     U  13           H6         U  13   4.569   5.597  23.300
  140    H5'    U  14           H5'        U  14   6.428  11.978  23.425
  141   H5''    U  14          H5''        U  14   6.277  13.249  22.195
  142    H4'    U  14           H4'        U  14   8.600  13.172  22.960
  143    H3'    U  14           H3'        U  14   7.781  12.331  20.211
  144    H2'    U  14          H2''        U  14   9.732  11.268  19.656
  145   HO2'    U  14          H2'         U  14  10.830  13.301  21.203
  146    H1'    U  14           H1'        U  14  10.769  10.636  22.190
  147    H3     U  14           H3         U  14  10.871   6.653  20.085
  148    H5     U  14           H5         U  14   6.758   7.540  20.302
  149    H6     U  14           H6         U  14   7.342   9.714  21.205
  150    H5'    U  15           H5'        U  15  11.673  15.336  19.793
  151   H5''    U  15          H5''        U  15  11.606  15.687  18.056
  152    H4'    U  15           H4'        U  15  13.769  14.553  19.117
  153    H3'    U  15           H3'        U  15  12.306  14.137  16.525
  154    H2'    U  15          H2''        U  15  13.397  12.194  15.991
  155   HO2'    U  15          H2'         U  15  15.506  13.597  16.899
  156    H1'    U  15           H1'        U  15  14.250  11.379  18.583
  157    H3     U  15           H3         U  15  12.508   7.707  16.532
  158    H5     U  15           H5         U  15   9.165  10.085  17.486
  159    H6     U  15           H6         U  15  10.690  11.858  18.130
  160    H5'    U  16           H5'        U  16  16.828  14.178  15.411
  161   H5''    U  16          H5''        U  16  16.809  15.103  13.897
  162    H4'    U  16           H4'        U  16  17.976  12.897  13.655
  163    H3'    U  16           H3'        U  16  15.505  13.714  12.151
  164    H2'    U  16          H2''        U  16  15.100  11.635  11.274
  165   HO2'    U  16          H2'         U  16  16.830  11.164  10.116
  166    H1'    U  16           H1'        U  16  16.505  10.025  13.153
  167    H3     U  16           H3         U  16  12.547   7.906  12.854
  168    H5     U  16           H5         U  16  11.517  11.681  14.413
  169    H6     U  16           H6         U  16  13.826  12.363  14.108
  170    H5'    U  17           H5'        U  17  18.781  12.238   8.650
  171   H5''    U  17          H5''        U  17  17.868  12.888   7.275
  172    H4'    U  17           H4'        U  17  18.428  10.286   7.413
  173    H3'    U  17           H3'        U  17  15.977  11.792   6.516
  174    H2'    U  17          H2''        U  17  14.663   9.923   6.398
  175   HO2'    U  17          H2'         U  17  17.052   8.444   5.941
  176    H1'    U  17           H1'        U  17  16.137   8.203   8.142
  177    H3     U  17           H3         U  17  11.762   7.637   9.157
  178    H5     U  17           H5         U  17  12.611  11.564  10.432
  179    H6     U  17           H6         U  17  14.795  11.352   9.390
  180    H5'    A  18           H5'        A  18  17.698   8.827   2.778
  181   H5''    A  18          H5''        A  18  16.519   9.223   1.513
  182    H4'    A  18           H4'        A  18  16.894   6.695   2.300
  183    H3'    A  18           H3'        A  18  14.388   8.218   1.550
  184    H2'    A  18          H2''        A  18  13.023   6.392   2.062
  185   HO2'    A  18          H2'         A  18  15.391   4.831   1.868
  186    H1'    A  18           H1'        A  18  14.461   5.381   4.218
  187    H8     A  18           H8         A  18  14.087   8.996   4.960
  188    H61    A  18           H61        A  18   8.215   7.886   6.514
  189    H62    A  18           H62        A  18   9.489   9.084   6.462
  190    H2     A  18           H2         A  18   9.774   4.291   4.329
  191    H5'    A  19           H5'        A  19  14.441   4.870  -1.455
  192   H5''    A  19          H5''        A  19  13.170   5.187  -2.653
  193    H4'    A  19           H4'        A  19  12.849   3.353  -0.711
  194    H3'    A  19           H3'        A  19  10.944   5.300  -2.020
  195    H2'    A  19          H2''        A  19   9.229   4.817  -0.536
  196   HO2'    A  19          H2'         A  19  10.474   2.315  -0.451
  197    H1'    A  19           H1'        A  19  10.811   4.119   1.721
  198    H8     A  19           H8         A  19  11.911   7.523   1.089
  199    H61    A  19           H61        A  19   6.548   9.509   3.418
  200    H62    A  19           H62        A  19   8.140   9.980   2.867
  201    H2     A  19           H2         A  19   6.102   5.156   2.390
  202    H5'    A  20           H5'        A  20   8.303   1.961  -3.857
  203   H5''    A  20          H5''        A  20   7.929   2.965  -5.272
  204    H4'    A  20           H4'        A  20   6.023   2.449  -3.531
  205    H3'    A  20           H3'        A  20   6.804   4.992  -4.935
  206    H2'    A  20          H2''        A  20   5.456   6.344  -3.644
  207   HO2'    A  20          H2'         A  20   3.589   5.023  -4.263
  208    H1'    A  20           H1'        A  20   5.218   4.739  -1.329
  209    H8     A  20           H8         A  20   8.707   5.953  -2.453
  210    H61    A  20           H61        A  20   7.504  11.098   0.751
  211    H62    A  20           H62        A  20   8.731  10.179  -0.094
  212    H2     A  20           H2         A  20   3.805   8.562   0.766
  213    H5'    U  21           H5'        U  21   2.224   5.218  -5.979
  214   H5''    U  21          H5''        U  21   2.402   6.328  -7.352
  215    H4'    U  21           H4'        U  21   1.191   7.171  -5.163
  216    H3'    U  21           H3'        U  21   3.255   8.486  -6.922
  217    H2'    U  21          H2''        U  21   3.496  10.334  -5.527
  218   HO2'    U  21          H2'         U  21   0.957   9.586  -4.499
  219    H1'    U  21           H1'        U  21   3.166   9.082  -3.073
  220    H3     U  21           H3         U  21   7.409  10.651  -2.979
  221    H5     U  21           H5         U  21   7.500   7.769  -6.053
  222    H6     U  21           H6         U  21   5.145   7.357  -5.640
  223    H5'    U  22           H5'        U  22  -0.329  10.789  -6.025
  224   H5''    U  22          H5''        U  22  -1.078  11.675  -7.369
  225    H4'    U  22           H4'        U  22  -0.946  13.056  -5.284
  226    H3'    U  22           H3'        U  22   0.143  13.678  -7.945
  227    H2'    U  22          H2''        U  22   1.968  14.892  -7.365
  228   HO2'    U  22          H2'         U  22   0.301  16.097  -5.402
  229    H1'    U  22           H1'        U  22   1.895  14.687  -4.482
  230    H3     U  22           H3         U  22   6.357  14.575  -4.965
  231    H5     U  22           H5         U  22   5.047  11.612  -7.662
  232    H6     U  22           H6         U  22   2.768  12.151  -7.047
  233    H5'    A  23           H5'        A  23   0.123  16.317 -10.247
  234   H5''    A  23          H5''        A  23   1.277  15.751  -9.025
  235    H4'    A  23           H4'        A  23   2.089  17.710 -10.446
  236    H3'    A  23           H3'        A  23   2.030  17.412  -7.496
  237    H2'    A  23          H2''        A  23   2.135  19.627  -6.905
  238   HO2'    A  23          H2'         A  23   3.420  21.044  -7.903
  239    H1'    A  23           H1'        A  23   1.091  20.909  -9.159
  240    H8     A  23           H8         A  23  -1.504  18.453  -8.221
  241    H61    A  23           H61        A  23  -3.001  22.038  -3.411
  242    H62    A  23           H62        A  23  -3.482  20.677  -4.399
  243    H2     A  23           H2         A  23   0.893  23.505  -5.078
  244    H5'    A  24           H5'        A  24   6.342  17.940  -6.297
  245   H5''    A  24          H5''        A  24   5.769  17.317  -4.739
  246    H4'    A  24           H4'        A  24   5.772  20.039  -5.666
  247    H3'    A  24           H3'        A  24   5.149  18.420  -3.230
  248    H2'    A  24          H2''        A  24   3.418  19.705  -2.479
  249   HO2'    A  24          H2'         A  24   3.721  21.767  -2.119
  250    H1'    A  24           H1'        A  24   2.865  21.279  -4.815
  251    H8     A  24           H8         A  24   1.829  17.820  -5.432
  252    H61    A  24           H61        A  24  -3.068  18.718  -1.768
  253    H62    A  24           H62        A  24  -2.282  17.608  -2.868
  254    H2     A  24           H2         A  24  -0.222  22.129  -1.161
  255    H5'    U  25           H5'        U  25   8.377  18.053  -0.040
  256   H5''    U  25          H5''        U  25   6.787  17.825  -0.793
  257    H4'    U  25           H4'        U  25   7.135  18.598   1.815
  258    H3'    U  25           H3'        U  25   5.028  18.205   0.028
  259    H2'    U  25          H2''        U  25   4.724  20.390  -0.730
  260   HO2'    U  25          H2'         U  25   2.942  20.960   0.209
  261    H1'    U  25           H1'        U  25   5.533  21.655   1.854
  262    H3     U  25           H3         U  25   6.361  25.677   0.076
  263    H5     U  25           H5         U  25   6.587  23.132  -3.273
  264    H6     U  25           H6         U  25   6.167  21.253  -1.800
  265    H5'    U  26           H5'        U  26   2.372  18.737  -0.887
  266   H5''    U  26          H5''        U  26   1.430  18.930   0.605
  267    H4'    U  26           H4'        U  26  -0.088  17.753  -0.766
  268    H3'    U  26           H3'        U  26   1.517  16.132   1.136
  269    H2'    U  26          H2''        U  26   1.301  14.087   0.130
  270   HO2'    U  26          H2'         U  26  -1.098  15.029  -1.080
  271    H1'    U  26           H1'        U  26   0.841  14.746  -2.519
  272    H3     U  26           H3         U  26   4.563  12.201  -2.722
  273    H5     U  26           H5         U  26   5.860  15.686  -0.746
  274    H6     U  26           H6         U  26   3.568  16.473  -0.763
  275    H5'    C  27           H5'        C  27  -2.701  14.157   2.642
  276   H5''    C  27          H5''        C  27  -1.937  13.502   4.105
  277    H4'    C  27           H4'        C  27  -2.807  11.872   2.162
  278    H3'    C  27           H3'        C  27  -0.265  11.850   3.807
  279    H2'    C  27          H2''        C  27   0.483   9.892   2.751
  280   HO2'    C  27          H2'         C  27  -0.963   8.395   2.489
  281    H1'    C  27           H1'        C  27  -0.497  10.529   0.198
  282    H41    C  27           H41        C  27   5.744  11.766   0.000
  283    H42    C  27           H42        C  27   5.575  13.042   1.184
  284    H5     C  27           H5         C  27   3.511  13.507   2.331
  285    H6     C  27           H6         C  27   1.142  12.917   2.524
  286    H5'    U  28           H5'        U  28  -2.565   8.043   4.962
  287   H5''    U  28          H5''        U  28  -2.063   7.496   6.575
  288    H4'    U  28           H4'        U  28  -1.663   5.844   4.635
  289    H3'    U  28           H3'        U  28   0.315   6.879   6.662
  290    H2'    U  28          H2''        U  28   2.145   5.864   5.672
  291   HO2'    U  28          H2'         U  28   2.030   3.909   4.891
  292    H1'    U  28           H1'        U  28   1.316   5.921   3.005
  293    H3     U  28           H3         U  28   5.281   8.138   3.236
  294    H5     U  28           H5         U  28   2.482  10.807   4.896
  295    H6     U  28           H6         U  28   0.834   9.038   4.794
  296    H5'    U  29           H5'        U  29   0.525   2.018   6.410
  297   H5''    U  29          H5''        U  29   1.441   1.613   7.874
  298    H4'    U  29           H4'        U  29   2.348   0.893   5.476
  299    H3'    U  29           H3'        U  29   3.737   1.945   7.934
  300    H2'    U  29          H2''        U  29   5.783   2.173   6.873
  301   HO2'    U  29          H2'         U  29   6.490   0.653   5.616
  302    H1'    U  29           H1'        U  29   4.908   2.717   4.270
  303    H3     U  29           H3         U  29   7.631   6.126   5.598
  304    H5     U  29           H5         U  29   4.104   6.689   7.828
  305    H6     U  29           H6         U  29   3.244   4.636   6.870
  306    H5'    A  30           H5'        A  30   6.398  -1.616   6.742
  307   H5''    A  30          H5''        A  30   7.210  -1.989   8.274
  308    H4'    A  30           H4'        A  30   8.605  -1.090   6.192
  309    H3'    A  30           H3'        A  30   8.775  -0.514   9.146
  310    H2'    A  30          H2''        A  30  10.245   1.228   8.885
  311   HO2'    A  30          H2'         A  30  12.003   0.763   7.862
  312    H1'    A  30           H1'        A  30   9.693   1.884   6.156
  313    H8     A  30           H8         A  30   6.746   2.524   8.434
  314    H61    A  30           H61        A  30   9.512   7.812  10.042
  315    H62    A  30           H62        A  30   8.000   6.932  10.013
  316    H2     A  30           H2         A  30  12.441   5.374   7.676
  317    H5'    A  31           H5'        A  31  13.108  -1.176   7.637
  318   H5''    A  31          H5''        A  31  13.768  -2.238   8.897
  319    H4'    A  31           H4'        A  31  15.291  -0.333   8.490
  320    H3'    A  31           H3'        A  31  13.801  -0.703  11.077
  321    H2'    A  31          H2''        A  31  14.377   1.349  11.934
  322   HO2'    A  31          H2'         A  31  16.746   0.754  10.703
  323    H1'    A  31           H1'        A  31  14.892   2.758   9.520
  324    H8     A  31           H8         A  31  11.435   1.199  10.329
  325    H61    A  31           H61        A  31  10.090   6.676  12.853
  326    H62    A  31           H62        A  31   9.443   5.139  12.324
  327    H2     A  31           H2         A  31  14.360   6.785  11.492
  328    H5'    A  32           H5'        A  32  18.628  -0.357  12.405
  329   H5''    A  32          H5''        A  32  18.380  -0.962  14.054
  330    H4'    A  32           H4'        A  32  19.451   1.440  13.650
  331    H3'    A  32           H3'        A  32  17.428   0.452  15.662
  332    H2'    A  32          H2''        A  32  17.016   2.568  16.485
  333   HO2'    A  32          H2'         A  32  18.763   3.559  17.085
  334    H1'    A  32           H1'        A  32  17.674   4.078  14.175
  335    H8     A  32           H8         A  32  14.889   1.426  13.935
  336    H61    A  32           H61        A  32  11.075   5.868  15.918
  337    H62    A  32           H62        A  32  11.177   4.284  15.182
  338    H2     A  32           H2         A  32  15.255   7.486  16.009
  339    H5'    A  33           H5'        A  33  20.910   2.604  18.223
  340   H5''    A  33          H5''        A  33  20.511   1.997  19.841
  341    H4'    A  33           H4'        A  33  20.456   4.611  19.324
  342    H3'    A  33           H3'        A  33  18.613   2.850  20.950
  343    H2'    A  33          H2''        A  33  17.140   4.588  21.361
  344   HO2'    A  33          H2'         A  33  18.308   6.160  22.228
  345    H1'    A  33           H1'        A  33  17.621   6.112  19.019
  346    H8     A  33           H8         A  33  16.500   2.530  18.348
  347    H61    A  33           H61        A  33  10.723   4.555  19.220
  348    H62    A  33           H62        A  33  11.712   3.261  18.581
  349    H2     A  33           H2         A  33  13.543   7.854  20.358
  350    H5'    A  34           H5'        A  34  20.339   5.985  23.929
  351   H5''    A  34          H5''        A  34  19.926   5.426  25.562
  352    H4'    A  34           H4'        A  34  18.873   7.675  24.576
  353    H3'    A  34           H3'        A  34  17.726   5.471  26.287
  354    H2'    A  34          H2''        A  34  15.566   6.258  26.118
  355   HO2'    A  34          H2'         A  34  16.741   8.821  25.739
  356    H1'    A  34           H1'        A  34  15.834   7.738  23.672
  357    H8     A  34           H8         A  34  16.369   4.066  23.113
  358    H61    A  34           H61        A  34  10.207   3.538  22.929
  359    H62    A  34           H62        A  34  11.725   2.806  22.460
  360    H2     A  34           H2         A  34  11.223   7.603  24.557
  361    H5'    C  35           H5'        C  35  17.618   6.849  30.769
  362   H5''    C  35          H5''        C  35  16.652   5.361  30.680
  363    H4'    C  35           H4'        C  35  15.850   8.143  29.750
  364    H3'    C  35           H3'        C  35  15.608   6.719  32.203
  365    H2'    C  35          H2''        C  35  13.877   5.300  31.712
  366   HO2'    C  35          H2'         C  35  12.521   7.798  31.672
  367    H1'    C  35           H1'        C  35  12.684   6.814  29.446
  368    H41    C  35           H41        C  35  11.038   0.703  28.674
  369    H42    C  35           H42        C  35  12.718   0.250  28.495
  370    H5     C  35           H5         C  35  14.525   1.847  28.584
  371    H6     C  35           H6         C  35  15.129   4.170  29.086
  372    H5'    U  36           H5'        U  36  13.564  10.702  28.188
  373   H5''    U  36          H5''        U  36  13.042  11.568  29.648
  374    H4'    U  36           H4'        U  36  10.981  11.361  28.616
  375    H3'    U  36           H3'        U  36  11.606   8.937  30.281
  376    H2'    U  36          H2''        U  36   9.878   7.674  29.445
  377   HO2'    U  36          H2'         U  36   8.441   9.624  29.966
  378    H1'    U  36           H1'        U  36   9.564   8.919  26.918
  379    H3     U  36           H3         U  36   9.759   4.347  26.512
  380    H5     U  36           H5         U  36  13.759   5.629  26.822
  381    H6     U  36           H6         U  36  12.943   7.837  27.405
  382    H5'    A  37           H5'        A  37   8.442  11.421  33.545
  383   H5''    A  37          H5''        A  37   8.299  10.072  34.690
  384    H4'    A  37           H4'        A  37   6.147  11.055  33.422
  385    H3'    A  37           H3'        A  37   6.944   8.226  34.151
  386    H2'    A  37          H2''        A  37   5.024   7.339  33.124
  387   HO2'    A  37          H2'         A  37   3.543   8.926  33.906
  388    H1'    A  37           H1'        A  37   5.155   8.841  30.830
  389    H8     A  37           H8         A  37   8.737   8.167  31.480
  390    H61    A  37           H61        A  37   7.802   2.366  29.586
  391    H62    A  37           H62        A  37   8.999   3.556  30.047
  392    H2     A  37           H2         A  37   3.800   4.208  30.444
  393    H5'    C  38           H5'        C  38   3.250   9.249  35.912
  394   H5''    C  38          H5''        C  38   2.782   8.685  37.528
  395    H4'    C  38           H4'        C  38   1.129   7.931  35.866
  396    H3'    C  38           H3'        C  38   2.977   5.973  37.238
  397    H2'    C  38          H2''        C  38   2.114   4.161  36.048
  398   HO2'    C  38          H2'         C  38  -0.091   5.801  35.308
  399    H1'    C  38           H1'        C  38   1.640   5.432  33.621
  400    H41    C  38           H41        C  38   6.949   1.959  32.957
  401    H42    C  38           H42        C  38   7.875   3.186  33.791
  402    H5     C  38           H5         C  38   6.899   5.198  34.665
  403    H6     C  38           H6         C  38   4.809   6.349  35.179
  404    H5'    A  39           H5'        A  39  -0.689   4.564  40.010
  405   H5''    A  39          H5''        A  39   0.369   3.694  41.139
  406    H4'    A  39           H4'        A  39  -1.222   2.393  39.395
  407    H3'    A  39           H3'        A  39   1.572   1.829  40.438
  408    H2'    A  39          H2''        A  39   1.840  -0.005  38.970
  409   HO2'    A  39          H2'         A  39  -0.998   0.017  38.734
  410    H1'    A  39           H1'        A  39   0.397   0.945  36.829
  411    H8     A  39           H8         A  39   2.793   3.636  37.918
  412    H61    A  39           H61        A  39   7.336   0.348  35.321
  413    H62    A  39           H62        A  39   6.874   1.906  35.967
  414    H2     A  39           H2         A  39   3.668  -2.225  35.463
  415    H5'    A  40           H5'        A  40  -1.301  -1.303  40.451
  416   H5''    A  40          H5''        A  40  -1.595  -2.114  42.003
  417    H4'    A  40           H4'        A  40  -1.745  -3.830  40.322
  418    H3'    A  40           H3'        A  40   0.719  -3.653  42.028
  419    H2'    A  40          H2''        A  40   1.980  -5.155  40.801
  420   HO2'    A  40          H2'         A  40   0.574  -6.873  40.771
  421    H1'    A  40           H1'        A  40   1.029  -4.697  38.262
  422    H8     A  40           H8         A  40   1.817  -1.565  40.380
  423    H61    A  40           H61        A  40   7.562  -2.023  38.165
  424    H62    A  40           H62        A  40   6.498  -1.130  39.228
  425    H2     A  40           H2         A  40   5.276  -5.663  36.873
  426    H5'    A  41           H5'        A  41  -0.171  -7.999  42.868
  427   H5''    A  41          H5''        A  41   0.848  -8.355  44.275
  428    H4'    A  41           H4'        A  41   1.530  -9.182  41.815
  429    H3'    A  41           H3'        A  41   3.137  -8.170  44.159
  430    H2'    A  41          H2''        A  41   5.085  -8.000  42.947
  431   HO2'    A  41          H2'         A  41   5.603  -9.856  42.112
  432    H1'    A  41           H1'        A  41   3.955  -7.760  40.325
  433    H8     A  41           H8         A  41   2.972  -4.835  42.457
  434    H61    A  41           H61        A  41   8.562  -2.458  41.311
  435    H62    A  41           H62        A  41   6.931  -2.107  41.836
  436    H2     A  41           H2         A  41   8.543  -6.712  39.891
  437    H5'    U  42           H5'        U  42   5.225 -12.681  43.790
  438   H5''    U  42          H5''        U  42   5.775 -12.633  45.476
  439    H4'    U  42           H4'        U  42   7.538 -12.857  43.497
  440    H3'    U  42           H3'        U  42   7.547 -11.363  46.099
  441    H2'    U  42          H2''        U  42   9.324 -10.009  45.585
  442   HO2'    U  42          H2'         U  42  10.238 -12.030  43.799
  443    H1'    U  42           H1'        U  42   9.286 -10.194  42.738
  444    H3     U  42           H3         U  42   9.820  -5.781  43.613
  445    H5     U  42           H5         U  42   5.862  -6.599  44.805
  446    H6     U  42           H6         U  42   6.305  -8.955  44.433
  447    H5'    C  43           H5'        C  43  10.723 -14.495  45.085
  448   H5''    C  43          H5''        C  43  11.621 -15.238  46.423
  449    H4'    C  43           H4'        C  43  13.070 -14.606  44.444
  450    H3'    C  43           H3'        C  43  13.378 -13.722  47.284
  451    H2'    C  43          H2''        C  43  14.865 -12.023  46.880
  452   HO2'    C  43          H2'         C  43  16.581 -12.760  45.919
  453    H1'    C  43           H1'        C  43  14.289 -11.409  44.196
  454    H41    C  43           H41        C  43  12.608  -6.379  47.720
  455    H42    C  43           H42        C  43  11.337  -7.294  48.496
  456    H5     C  43           H5         C  43  10.868  -9.598  47.978
  457    H6     C  43           H6         C  43  11.549 -11.535  46.642
  458    H5'    G  44           H5'        G  44  18.090 -15.161  46.286
  459   H5''    G  44          H5''        G  44  18.422 -15.391  48.014
  460    H4'    G  44           H4'        G  44  19.864 -13.666  46.606
  461    H3'    G  44           H3'        G  44  18.708 -13.547  49.383
  462    H2'    G  44          H2''        G  44  19.243 -11.318  49.705
  463   HO2'    G  44          H2'         G  44  21.448 -11.561  49.148
  464    H1'    G  44           H1'        G  44  19.025 -10.383  47.086
  465    H8     G  44           H8         G  44  16.099 -12.467  48.492
  466    H1     G  44           H1         G  44  15.866  -6.223  49.928
  467    H21    G  44           H21        G  44  17.701  -5.217  49.225
  468    H22    G  44           H22        G  44  19.064  -6.103  48.581
  469    H5'    A  45           H5'        A  45  23.137 -12.860  50.608
  470   H5''    A  45          H5''        A  45  23.043 -13.245  52.338
  471    H4'    A  45           H4'        A  45  23.422 -10.733  51.515
  472    H3'    A  45           H3'        A  45  21.853 -11.939  53.787
  473    H2'    A  45          H2''        A  45  20.668 -10.036  54.235
  474   HO2'    A  45          H2'         A  45  22.781  -8.947  54.585
  475    H1'    A  45           H1'        A  45  21.023  -8.646  51.758
  476    H8     A  45           H8         A  45  18.916 -11.817  51.582
  477    H61    A  45           H61        A  45  14.153  -8.325  53.407
  478    H62    A  45           H62        A  45  14.627  -9.841  52.674
  479    H2     A  45           H2         A  45  17.889  -5.860  53.739
  480    H5'    G  46           H5'        G  46  25.248  -8.836  56.422
  481   H5''    G  46          H5''        G  46  24.721  -9.706  57.875
  482    H4'    G  46           H4'        G  46  24.614  -7.041  57.771
  483    H3'    G  46           H3'        G  46  22.856  -9.139  58.994
  484    H2'    G  46          H2''        G  46  21.044  -7.762  59.357
  485   HO2'    G  46          H2'         G  46  23.024  -5.786  59.602
  486    H1'    G  46           H1'        G  46  21.402  -5.859  57.334
  487    H8     G  46           H8         G  46  21.389  -9.388  55.965
  488    H1     G  46           H1         G  46  15.541  -7.168  57.358
  489    H21    G  46           H21        G  46  15.695  -5.257  58.449
  490    H22    G  46           H22        G  46  17.227  -4.620  59.002
  491    H5'    C  47           H5'        C  47  23.425  -5.474  62.141
  492   H5''    C  47          H5''        C  47  22.998  -6.263  63.672
  493    H4'    C  47           H4'        C  47  21.660  -4.114  62.872
  494    H3'    C  47           H3'        C  47  20.740  -6.698  64.124
  495    H2'    C  47          H2''        C  47  18.488  -6.160  63.932
  496   HO2'    C  47          H2'         C  47  19.344  -3.467  63.591
  497    H1'    C  47           H1'        C  47  18.567  -4.801  61.510
  498    H41    C  47           H41        C  47  16.281 -10.665  60.448
  499    H42    C  47           H42        C  47  17.884 -11.344  60.599
  500    H5     C  47           H5         C  47  19.845 -10.007  61.041
  501    H6     C  47           H6         C  47  20.661  -7.767  61.577
  502    H5'    C  48           H5'        C  48  18.365  -3.567  65.821
  503   H5''    C  48          H5''        C  48  18.687  -3.559  67.567
  504    H4'    C  48           H4'        C  48  16.299  -3.391  67.334
  505    H3'    C  48           H3'        C  48  17.462  -6.064  68.070
  506   HO3'    C  48          H3T         C  48  15.790  -4.156  69.378
  507    H2'    C  48          H2''        C  48  15.454  -7.186  67.960
  508   HO2'    C  48          H2'         C  48  14.207  -5.920  69.279
  509    H1'    C  48           H1'        C  48  14.228  -5.706  65.925
  510    H41    C  48           H41        C  48  15.909 -11.279  63.354
  511    H42    C  48           H42        C  48  17.603 -10.852  63.447
  512    H5     C  48           H5         C  48  18.403  -8.908  64.625
  513    H6     C  48           H6         C  48  17.750  -6.855  65.785
  Start of MODEL    2
    1    H5'    G   1           H5'        G   1   7.800 -18.815  60.715
    2   H5''    G   1          H5''        G   1   7.293 -17.620  59.504
    3    H4'    G   1           H4'        G   1   6.818 -16.871  61.856
    4    H3'    G   1           H3'        G   1   8.552 -15.479  59.858
    5    H2'    G   1          H2''        G   1   9.612 -14.097  61.325
    6   HO2'    G   1          H2'         G   1   7.114 -13.732  62.151
    7    H1'    G   1           H1'        G   1   9.128 -15.443  63.788
    8    H8     G   1           H8         G   1  11.311 -17.561  61.615
    9    H1     G   1           H1         G   1  14.435 -12.545  64.112
   10    H21    G   1           H21        G   1  12.994 -11.085  64.927
   11    H22    G   1           H22        G   1  11.282 -11.429  65.039
   12   HO5'    G   1          H5T         G   1   9.868 -18.365  60.334
   13    H5'    G   2           H5'        G   2   5.110 -11.584  61.162
   14   H5''    G   2          H5''        G   2   5.537 -10.957  59.558
   15    H4'    G   2           H4'        G   2   5.751  -9.401  61.708
   16    H3'    G   2           H3'        G   2   7.358  -9.723  59.209
   17    H2'    G   2          H2''        G   2   9.267  -8.693  59.965
   18   HO2'    G   2          H2'         G   2   9.236  -6.908  61.178
   19    H1'    G   2           H1'        G   2   9.023  -9.021  62.745
   20    H8     G   2           H8         G   2   8.909 -12.329  60.926
   21    H1     G   2           H1         G   2  14.840  -9.998  61.592
   22    H21    G   2           H21        G   2  14.760  -7.896  62.259
   23    H22    G   2           H22        G   2  13.259  -7.100  62.673
   24    H5'    C   3           H5'        C   3   6.933  -5.359  60.632
   25   H5''    C   3          H5''        C   3   6.743  -4.323  59.204
   26    H4'    C   3           H4'        C   3   8.446  -3.450  60.844
   27    H3'    C   3           H3'        C   3   8.939  -4.154  57.975
   28    H2'    C   3          H2''        C   3  11.238  -4.026  58.085
   29   HO2'    C   3          H2'         C   3  11.930  -2.209  58.857
   30    H1'    C   3           H1'        C   3  11.679  -4.659  60.774
   31    H41    C   3           H41        C   3  13.710  -9.656  57.386
   32    H42    C   3           H42        C   3  12.093  -9.971  56.803
   33    H5     C   3           H5         C   3  10.177  -8.667  57.459
   34    H6     C   3           H6         C   3   9.421  -6.704  58.707
   35    H5'    U   4           H5'        U   4  11.145  -0.132  58.056
   36   H5''    U   4          H5''        U   4  11.033   0.312  56.342
   37    H4'    U   4           H4'        U   4  13.393  -0.257  57.396
   38    H3'    U   4           H3'        U   4  12.137  -0.973  54.758
   39    H2'    U   4          H2''        U   4  13.729  -2.522  54.200
   40   HO2'    U   4          H2'         U   4  15.899  -2.330  54.862
   41    H1'    U   4           H1'        U   4  14.758  -3.106  56.799
   42    H3     U   4           H3         U   4  14.281  -7.120  54.753
   43    H5     U   4           H5         U   4  10.324  -5.796  55.345
   44    H6     U   4           H6         U   4  11.216  -3.675  56.111
   45    H5'    C   5           H5'        C   5  16.496   0.396  54.431
   46   H5''    C   5          H5''        C   5  16.585   1.481  53.030
   47    H4'    C   5           H4'        C   5  18.474  -0.062  52.933
   48    H3'    C   5           H3'        C   5  16.185  -0.352  50.990
   49    H2'    C   5          H2''        C   5  17.047  -2.284  50.036
   50   HO2'    C   5          H2'         C   5  19.276  -2.851  50.259
   51    H1'    C   5           H1'        C   5  18.318  -3.372  52.276
   52    H41    C   5           H41        C   5  13.108  -6.885  51.242
   53    H42    C   5           H42        C   5  12.084  -5.590  51.819
   54    H5     C   5           H5         C   5  12.902  -3.368  52.248
   55    H6     C   5           H6         C   5  14.909  -1.990  52.533
   56    H5'    G   6           H5'        G   6  19.260   0.782  47.755
   57   H5''    G   6          H5''        G   6  18.164   1.178  46.418
   58    H4'    G   6           H4'        G   6  19.542  -1.114  46.434
   59    H3'    G   6           H3'        G   6  16.746  -0.414  45.541
   60    H2'    G   6          H2''        G   6  16.107  -2.609  45.288
   61   HO2'    G   6          H2'         G   6  17.379  -4.086  44.377
   62    H1'    G   6           H1'        G   6  18.069  -3.838  46.978
   63    H8     G   6           H8         G   6  15.559  -1.645  48.806
   64    H1     G   6           H1         G   6  13.396  -7.523  47.412
   65    H21    G   6           H21        G   6  14.808  -8.548  46.068
   66    H22    G   6           H22        G   6  16.185  -7.733  45.361
   67    H5'    A   7           H5'        A   7  19.311  -2.045  41.589
   68   H5''    A   7          H5''        A   7  18.132  -1.939  40.267
   69    H4'    A   7           H4'        A   7  19.216  -4.288  40.968
   70    H3'    A   7           H3'        A   7  16.500  -3.467  39.988
   71    H2'    A   7          H2''        A   7  15.469  -5.494  40.481
   72   HO2'    A   7          H2'         A   7  16.704  -7.417  40.843
   73    H1'    A   7           H1'        A   7  16.835  -6.189  42.790
   74    H8     A   7           H8         A   7  15.900  -2.544  43.027
   75    H61    A   7           H61        A   7  10.189  -4.350  44.519
   76    H62    A   7           H62        A   7  11.333  -3.027  44.545
   77    H2     A   7           H2         A   7  12.480  -7.968  43.181
   78    H5'    U   8           H5'        U   8  17.131  -6.466  36.837
   79   H5''    U   8          H5''        U   8  16.069  -5.947  35.513
   80    H4'    U   8           H4'        U   8  15.349  -7.953  37.106
   81    H3'    U   8           H3'        U   8  13.820  -5.677  35.868
   82    H2'    U   8          H2''        U   8  11.918  -6.028  37.115
   83   HO2'    U   8          H2'         U   8  11.586  -8.140  36.396
   84    H1'    U   8           H1'        U   8  13.068  -7.394  39.344
   85    H3     U   8           H3         U   8  10.143  -4.117  40.723
   86    H5     U   8           H5         U   8  13.860  -2.230  40.114
   87    H6     U   8           H6         U   8  14.635  -4.253  39.025
   88    H5'    U   9           H5'        U   9  11.310  -8.488  32.960
   89   H5''    U   9          H5''        U   9  11.196  -7.124  31.831
   90    H4'    U   9           H4'        U   9   9.041  -7.978  33.148
   91    H3'    U   9           H3'        U   9  10.026  -5.223  32.422
   92    H2'    U   9          H2''        U   9   8.472  -4.144  33.727
   93   HO2'    U   9          H2'         U   9   6.643  -4.909  32.750
   94    H1'    U   9           H1'        U   9   7.880  -6.267  35.557
   95    H3     U   9           H3         U   9   8.303  -2.553  38.090
   96    H5     U   9           H5         U   9  12.199  -3.224  36.633
   97    H6     U   9           H6         U   9  11.308  -5.021  35.265
   98    H5'    G  10           H5'        G  10   5.712  -6.168  31.050
   99   H5''    G  10          H5''        G  10   5.448  -5.421  29.462
  100    H4'    G  10           H4'        G  10   3.535  -5.101  31.108
  101    H3'    G  10           H3'        G  10   5.081  -2.945  29.689
  102    H2'    G  10          H2''        G  10   4.073  -1.205  30.840
  103   HO2'    G  10          H2'         G  10   2.000  -2.995  31.615
  104    H1'    G  10           H1'        G  10   3.638  -2.435  33.299
  105    H8     G  10           H8         G  10   7.208  -3.040  32.332
  106    H1     G  10           H1         G  10   6.131   3.021  34.143
  107    H21    G  10           H21        G  10   3.966   3.400  34.265
  108    H22    G  10           H22        G  10   2.777   2.207  33.798
  109    H5'    U  11           H5'        U  11   0.852  -1.677  28.814
  110   H5''    U  11          H5''        U  11   0.997  -0.639  27.383
  111    H4'    U  11           H4'        U  11   0.312   0.398  29.736
  112    H3'    U  11           H3'        U  11   2.163   1.401  27.569
  113    H2'    U  11          H2''        U  11   2.808   3.246  28.823
  114   HO2'    U  11          H2'         U  11   1.544   4.058  30.536
  115    H1'    U  11           H1'        U  11   2.588   2.107  31.389
  116    H3     U  11           H3         U  11   6.781   3.858  30.675
  117    H5     U  11           H5         U  11   6.840  -0.005  28.996
  118    H6     U  11           H6         U  11   4.436  -0.104  29.298
  119    H5'    A  12           H5'        A  12  -0.866   4.787  26.373
  120   H5''    A  12          H5''        A  12  -0.062   5.066  24.816
  121    H4'    A  12           H4'        A  12   0.192   6.807  26.837
  122    H3'    A  12           H3'        A  12   2.221   5.784  24.829
  123    H2'    A  12          H2''        A  12   3.875   7.155  25.760
  124   HO2'    A  12          H2'         A  12   3.419   8.908  27.068
  125    H1'    A  12           H1'        A  12   3.098   6.877  28.418
  126    H8     A  12           H8         A  12   3.242   3.442  26.852
  127    H61    A  12           H61        A  12   9.406   3.895  26.936
  128    H62    A  12           H62        A  12   8.047   2.806  26.773
  129    H2     A  12           H2         A  12   7.701   7.872  28.126
  130    H5'    U  13           H5'        U  13   2.377  10.052  25.218
  131   H5''    U  13          H5''        U  13   2.869  10.849  23.711
  132    H4'    U  13           H4'        U  13   4.310  11.265  25.849
  133    H3'    U  13           H3'        U  13   5.189  10.507  23.062
  134    H2'    U  13          H2''        U  13   7.412  10.341  23.675
  135   HO2'    U  13          H2'         U  13   8.303  11.464  25.394
  136    H1'    U  13           H1'        U  13   7.067   9.589  26.371
  137    H3     U  13           H3         U  13   9.864   6.683  24.149
  138    H5     U  13           H5         U  13   5.944   5.488  23.163
  139    H6     U  13           H6         U  13   5.130   7.515  24.191
  140    H5'    U  14           H5'        U  14   8.015  13.144  24.346
  141   H5''    U  14          H5''        U  14   7.919  14.628  23.376
  142    H4'    U  14           H4'        U  14  10.249  14.115  23.466
  143    H3'    U  14           H3'        U  14   8.758  13.390  20.965
  144    H2'    U  14          H2''        U  14  10.427  12.096  20.073
  145   HO2'    U  14          H2'         U  14  12.539  12.606  20.236
  146    H1'    U  14           H1'        U  14  11.853  11.406  22.418
  147    H3     U  14           H3         U  14  11.318   7.404  20.433
  148    H5     U  14           H5         U  14   7.362   8.641  21.194
  149    H6     U  14           H6         U  14   8.246  10.763  21.974
  150    H5'    U  15           H5'        U  15  12.797  15.934  19.857
  151   H5''    U  15          H5''        U  15  12.528  16.333  18.149
  152    H4'    U  15           H4'        U  15  14.695  14.985  18.855
  153    H3'    U  15           H3'        U  15  12.800  14.681  16.539
  154    H2'    U  15          H2''        U  15  13.641  12.656  15.873
  155   HO2'    U  15          H2'         U  15  15.692  13.047  15.406
  156    H1'    U  15           H1'        U  15  14.825  11.797  18.322
  157    H3     U  15           H3         U  15  12.528   8.271  16.572
  158    H5     U  15           H5         U  15   9.549  10.893  17.989
  159    H6     U  15           H6         U  15  11.283  12.536  18.406
  160    H5'    U  16           H5'        U  16  17.185  14.762  14.798
  161   H5''    U  16          H5''        U  16  16.966  15.524  13.210
  162    H4'    U  16           H4'        U  16  18.173  13.278  13.163
  163    H3'    U  16           H3'        U  16  15.684  14.042  11.654
  164    H2'    U  16          H2''        U  16  15.233  11.912  10.924
  165   HO2'    U  16          H2'         U  16  18.038  11.643  10.975
  166    H1'    U  16           H1'        U  16  16.643  10.418  12.899
  167    H3     U  16           H3         U  16  12.583   8.443  12.527
  168    H5     U  16           H5         U  16  11.763  12.148  14.359
  169    H6     U  16           H6         U  16  14.079  12.770  13.987
  170    H5'    U  17           H5'        U  17  18.996  12.081   8.974
  171   H5''    U  17          H5''        U  17  18.804  12.774   7.352
  172    H4'    U  17           H4'        U  17  18.961  10.239   7.392
  173    H3'    U  17           H3'        U  17  16.681  11.860   6.270
  174    H2'    U  17          H2''        U  17  15.357  10.025   5.869
  175   HO2'    U  17          H2'         U  17  16.273   8.554   4.698
  176    H1'    U  17           H1'        U  17  16.457   8.231   7.782
  177    H3     U  17           H3         U  17  11.952   8.020   8.245
  178    H5     U  17           H5         U  17  12.944  11.876   9.630
  179    H6     U  17           H6         U  17  15.220  11.481   8.887
  180    H5'    A  18           H5'        A  18  18.541   9.025   2.547
  181   H5''    A  18          H5''        A  18  17.515   9.626   1.232
  182    H4'    A  18           H4'        A  18  17.542   7.031   1.876
  183    H3'    A  18           H3'        A  18  15.241   8.858   1.129
  184    H2'    A  18          H2''        A  18  13.733   7.070   1.307
  185   HO2'    A  18          H2'         A  18  15.006   5.580   0.094
  186    H1'    A  18           H1'        A  18  14.942   5.809   3.487
  187    H8     A  18           H8         A  18  14.553   9.480   4.280
  188    H61    A  18           H61        A  18   8.501   8.441   5.029
  189    H62    A  18           H62        A  18   9.780   9.631   5.127
  190    H2     A  18           H2         A  18  10.349   4.730   3.319
  191    H5'    A  19           H5'        A  19  15.622   5.687  -1.994
  192   H5''    A  19          H5''        A  19  14.571   5.918  -3.404
  193    H4'    A  19           H4'        A  19  14.063   4.031  -1.545
  194    H3'    A  19           H3'        A  19  12.251   5.813  -3.190
  195    H2'    A  19          H2''        A  19  10.357   5.110  -2.046
  196   HO2'    A  19          H2'         A  19  10.827   2.865  -2.472
  197    H1'    A  19           H1'        A  19  11.627   4.458   0.441
  198    H8     A  19           H8         A  19  12.339   7.987   0.145
  199    H61    A  19           H61        A  19   6.459   9.219   1.573
  200    H62    A  19           H62        A  19   8.058   9.892   1.346
  201    H2     A  19           H2         A  19   6.709   4.921   0.303
  202    H5'    A  20           H5'        A  20  10.537   2.417  -5.938
  203   H5''    A  20          H5''        A  20  10.305   3.638  -7.205
  204    H4'    A  20           H4'        A  20   8.213   2.601  -5.913
  205    H3'    A  20           H3'        A  20   8.843   5.365  -6.920
  206    H2'    A  20          H2''        A  20   7.117   6.382  -5.777
  207   HO2'    A  20          H2'         A  20   5.809   3.857  -5.903
  208    H1'    A  20           H1'        A  20   6.735   4.523  -3.692
  209    H8     A  20           H8         A  20  10.160   6.273  -4.062
  210    H61    A  20           H61        A  20   7.719  10.857  -0.722
  211    H62    A  20           H62        A  20   9.164  10.249  -1.499
  212    H2     A  20           H2         A  20   4.444   7.951  -1.684
  213    H5'    U  21           H5'        U  21   4.435   4.990  -8.134
  214   H5''    U  21          H5''        U  21   4.336   6.223  -9.407
  215    H4'    U  21           H4'        U  21   3.054   6.623  -7.131
  216    H3'    U  21           H3'        U  21   4.786   8.482  -8.763
  217    H2'    U  21          H2''        U  21   4.623  10.206  -7.197
  218   HO2'    U  21          H2'         U  21   2.453   8.828  -5.971
  219    H1'    U  21           H1'        U  21   4.584   8.655  -4.880
  220    H3     U  21           H3         U  21   8.390  11.043  -4.445
  221    H5     U  21           H5         U  21   9.134   8.617  -7.809
  222    H6     U  21           H6         U  21   6.887   7.736  -7.587
  223    H5'    U  22           H5'        U  22   0.825   9.362  -7.742
  224   H5''    U  22          H5''        U  22  -0.417   9.863  -8.906
  225    H4'    U  22           H4'        U  22  -0.846  11.003  -6.797
  226    H3'    U  22           H3'        U  22  -0.048  12.376  -9.273
  227    H2'    U  22          H2''        U  22   0.990  14.204  -8.414
  228   HO2'    U  22          H2'         U  22  -1.202  14.129  -6.667
  229    H1'    U  22           H1'        U  22   1.217  13.540  -5.647
  230    H3     U  22           H3         U  22   5.303  15.281  -6.345
  231    H5     U  22           H5         U  22   5.071  12.224  -9.234
  232    H6     U  22           H6         U  22   2.819  11.757  -8.465
  233    H5'    A  23           H5'        A  23  -1.282  15.324 -11.113
  234   H5''    A  23          H5''        A  23  -0.013  15.113  -9.890
  235    H4'    A  23           H4'        A  23  -0.240  17.485 -10.772
  236    H3'    A  23           H3'        A  23  -0.195  16.514  -7.988
  237    H2'    A  23          H2''        A  23  -1.306  18.228  -6.950
  238   HO2'    A  23          H2'         A  23  -0.880  20.292  -7.370
  239    H1'    A  23           H1'        A  23  -2.770  19.389  -9.030
  240    H8     A  23           H8         A  23  -3.761  15.831  -9.067
  241    H61    A  23           H61        A  23  -7.235  16.899  -4.071
  242    H62    A  23           H62        A  23  -6.796  15.729  -5.294
  243    H2     A  23           H2         A  23  -4.431  20.356  -4.566
  244    H5'    A  24           H5'        A  24   3.324  18.878  -6.383
  245   H5''    A  24          H5''        A  24   3.245  17.781  -4.992
  246    H4'    A  24           H4'        A  24   1.792  20.217  -5.391
  247    H3'    A  24           H3'        A  24   2.235  18.084  -3.365
  248    H2'    A  24          H2''        A  24   0.113  17.940  -2.581
  249   HO2'    A  24          H2'         A  24  -0.480  20.656  -2.956
  250    H1'    A  24           H1'        A  24  -1.258  19.643  -4.494
  251    H8     A  24           H8         A  24  -0.431  16.291  -5.848
  252    H61    A  24           H61        A  24  -5.452  14.124  -2.956
  253    H62    A  24           H62        A  24  -4.147  13.732  -4.053
  254    H2     A  24           H2         A  24  -4.621  18.261  -1.425
  255    H5'    U  25           H5'        U  25   4.863  19.820   0.515
  256   H5''    U  25          H5''        U  25   3.862  18.654  -0.369
  257    H4'    U  25           H4'        U  25   3.181  19.613   2.080
  258    H3'    U  25           H3'        U  25   1.983  18.144  -0.019
  259    H2'    U  25          H2''        U  25   0.559  19.745  -0.881
  260   HO2'    U  25          H2'         U  25  -1.364  19.432  -0.051
  261    H1'    U  25           H1'        U  25   0.296  21.284   1.660
  262    H3     U  25           H3         U  25  -1.062  25.049  -0.339
  263    H5     U  25           H5         U  25   0.904  23.019  -3.462
  264    H6     U  25           H6         U  25   1.437  21.249  -1.897
  265    H5'    U  26           H5'        U  26  -1.001  17.543  -0.859
  266   H5''    U  26          H5''        U  26  -1.683  16.762   0.579
  267    H4'    U  26           H4'        U  26  -2.449  15.446  -1.273
  268    H3'    U  26           H3'        U  26  -0.257  14.416   0.449
  269    H2'    U  26          H2''        U  26   0.525  12.786  -0.967
  270   HO2'    U  26          H2'         U  26  -2.129  12.749  -1.953
  271    H1'    U  26           H1'        U  26  -0.170  13.789  -3.462
  272    H3     U  26           H3         U  26   4.320  13.312  -3.678
  273    H5     U  26           H5         U  26   3.786  16.350  -0.811
  274    H6     U  26           H6         U  26   1.395  16.052  -1.030
  275    H5'    C  27           H5'        C  27  -3.431  11.201  -0.830
  276   H5''    C  27          H5''        C  27  -3.667  10.149   0.581
  277    H4'    C  27           H4'        C  27  -3.435   8.730  -1.395
  278    H3'    C  27           H3'        C  27  -1.072   8.978   0.482
  279    H2'    C  27          H2''        C  27   0.169   7.430  -0.769
  280   HO2'    C  27          H2'         C  27  -2.235   6.708  -2.120
  281    H1'    C  27           H1'        C  27  -0.789   8.250  -3.289
  282    H41    C  27           H41        C  27   5.030  10.789  -2.796
  283    H42    C  27           H42        C  27   4.512  11.816  -1.477
  284    H5     C  27           H5         C  27   2.363  11.609  -0.418
  285    H6     C  27           H6         C  27   0.174  10.515  -0.511
  286    H5'    U  28           H5'        U  28  -2.290   4.958   0.905
  287   H5''    U  28          H5''        U  28  -1.995   4.128   2.447
  288    H4'    U  28           H4'        U  28  -0.524   3.344   0.516
  289    H3'    U  28           H3'        U  28   0.385   4.473   3.160
  290    H2'    U  28          H2''        U  28   2.588   4.641   2.567
  291   HO2'    U  28          H2'         U  28   3.552   3.213   1.042
  292    H1'    U  28           H1'        U  28   2.298   4.674  -0.273
  293    H3     U  28           H3         U  28   5.332   7.856   0.981
  294    H5     U  28           H5         U  28   1.565   9.496   1.917
  295    H6     U  28           H6         U  28   0.572   7.346   1.406
  296    H5'    U  29           H5'        U  29   2.648   0.630   1.870
  297   H5''    U  29          H5''        U  29   2.758  -0.353   3.342
  298    H4'    U  29           H4'        U  29   4.913  -0.410   2.180
  299    H3'    U  29           H3'        U  29   4.648   1.133   4.769
  300    H2'    U  29          H2''        U  29   6.863   1.844   4.683
  301   HO2'    U  29          H2'         U  29   7.309  -0.279   2.836
  302    H1'    U  29           H1'        U  29   7.152   1.985   1.896
  303    H3     U  29           H3         U  29   8.187   6.026   3.825
  304    H5     U  29           H5         U  29   3.989   5.953   3.497
  305    H6     U  29           H6         U  29   4.137   3.599   2.948
  306    H5'    A  30           H5'        A  30   8.177  -1.720   4.865
  307   H5''    A  30          H5''        A  30   8.666  -1.976   6.549
  308    H4'    A  30           H4'        A  30  10.348  -0.867   4.805
  309    H3'    A  30           H3'        A  30   9.764  -0.268   7.704
  310    H2'    A  30          H2''        A  30  11.051   1.640   7.712
  311   HO2'    A  30          H2'         A  30  13.016   1.519   7.009
  312    H1'    A  30           H1'        A  30  11.005   2.203   4.901
  313    H8     A  30           H8         A  30   7.575   2.504   6.419
  314    H61    A  30           H61        A  30   9.302   8.054   8.542
  315    H62    A  30           H62        A  30   7.957   6.964   8.287
  316    H2     A  30           H2         A  30  12.948   5.963   6.977
  317    H5'    A  31           H5'        A  31  13.998  -0.310   6.937
  318   H5''    A  31          H5''        A  31  14.814  -1.442   8.034
  319    H4'    A  31           H4'        A  31  16.166   0.555   7.973
  320    H3'    A  31           H3'        A  31  14.446   0.064  10.400
  321    H2'    A  31          H2''        A  31  14.918   2.112  11.349
  322   HO2'    A  31          H2'         A  31  16.957   2.539  11.523
  323    H1'    A  31           H1'        A  31  15.485   3.588   8.997
  324    H8     A  31           H8         A  31  12.057   1.849   9.399
  325    H61    A  31           H61        A  31  10.265   7.033  12.253
  326    H62    A  31           H62        A  31   9.738   5.513  11.566
  327    H2     A  31           H2         A  31  14.627   7.409  11.281
  328    H5'    A  32           H5'        A  32  18.839   0.893  11.630
  329   H5''    A  32          H5''        A  32  19.096   0.038  13.163
  330    H4'    A  32           H4'        A  32  19.717   2.511  13.194
  331    H3'    A  32           H3'        A  32  17.721   1.169  15.027
  332    H2'    A  32          H2''        A  32  17.156   3.161  16.045
  333   HO2'    A  32          H2'         A  32  19.671   4.199  15.204
  334    H1'    A  32           H1'        A  32  17.868   4.924  13.912
  335    H8     A  32           H8         A  32  15.072   2.305  13.405
  336    H61    A  32           H61        A  32  11.264   6.545  15.806
  337    H62    A  32           H62        A  32  11.363   5.028  14.939
  338    H2     A  32           H2         A  32  15.442   8.162  16.000
  339    H5'    A  33           H5'        A  33  21.188   3.251  17.746
  340   H5''    A  33          H5''        A  33  20.826   2.543  19.331
  341    H4'    A  33           H4'        A  33  20.787   5.183  18.990
  342    H3'    A  33           H3'        A  33  18.927   3.357  20.528
  343    H2'    A  33          H2''        A  33  17.566   5.136  21.134
  344   HO2'    A  33          H2'         A  33  18.791   6.635  22.021
  345    H1'    A  33           H1'        A  33  18.004   6.763  18.856
  346    H8     A  33           H8         A  33  16.735   3.266  18.031
  347    H61    A  33           H61        A  33  11.086   5.366  19.423
  348    H62    A  33           H62        A  33  11.992   4.088  18.646
  349    H2     A  33           H2         A  33  14.069   8.528  20.543
  350    H5'    A  34           H5'        A  34  20.888   6.171  23.649
  351   H5''    A  34          H5''        A  34  20.517   5.525  25.259
  352    H4'    A  34           H4'        A  34  19.551   7.888  24.478
  353    H3'    A  34           H3'        A  34  18.314   5.633  26.068
  354    H2'    A  34          H2''        A  34  16.237   6.644  26.094
  355   HO2'    A  34          H2'         A  34  17.459   9.168  25.606
  356    H1'    A  34           H1'        A  34  16.548   8.261  23.731
  357    H8     A  34           H8         A  34  16.642   4.622  22.863
  358    H61    A  34           H61        A  34  10.454   4.749  23.090
  359    H62    A  34           H62        A  34  11.852   3.884  22.494
  360    H2     A  34           H2         A  34  12.013   8.516  24.987
  361    H5'    C  35           H5'        C  35  18.366   6.842  31.213
  362   H5''    C  35          H5''        C  35  17.634   6.018  29.820
  363    H4'    C  35           H4'        C  35  17.081   8.933  30.002
  364    H3'    C  35           H3'        C  35  16.848   7.323  32.347
  365    H2'    C  35          H2''        C  35  14.938   6.156  31.890
  366   HO2'    C  35          H2'         C  35  13.970   8.796  32.211
  367    H1'    C  35           H1'        C  35  13.795   7.935  29.805
  368    H41    C  35           H41        C  35  11.482   2.081  28.788
  369    H42    C  35           H42        C  35  13.085   1.499  28.398
  370    H5     C  35           H5         C  35  15.045   2.902  28.454
  371    H6     C  35           H6         C  35  15.919   5.108  29.071
  372    H5'    U  36           H5'        U  36  15.027  12.010  28.947
  373   H5''    U  36          H5''        U  36  14.743  12.702  30.558
  374    H4'    U  36           H4'        U  36  12.601  12.883  29.631
  375    H3'    U  36           H3'        U  36  13.030  10.265  31.071
  376    H2'    U  36          H2''        U  36  11.042   9.364  30.359
  377   HO2'    U  36          H2'         U  36   9.214  10.513  30.148
  378    H1'    U  36           H1'        U  36  10.695  10.892  27.981
  379    H3     U  36           H3         U  36   9.961   6.398  27.275
  380    H5     U  36           H5         U  36  14.137   6.919  27.120
  381    H6     U  36           H6         U  36  13.825   9.177  27.943
  382    H5'    A  37           H5'        A  37  10.562  12.814  34.783
  383   H5''    A  37          H5''        A  37  10.375  11.419  35.865
  384    H4'    A  37           H4'        A  37   8.241  12.675  34.820
  385    H3'    A  37           H3'        A  37   8.802   9.748  35.354
  386    H2'    A  37          H2''        A  37   6.725   9.111  34.443
  387   HO2'    A  37          H2'         A  37   6.065  11.884  34.478
  388    H1'    A  37           H1'        A  37   6.852  10.710  32.211
  389    H8     A  37           H8         A  37  10.379   9.642  32.568
  390    H61    A  37           H61        A  37   8.704   4.096  30.434
  391    H62    A  37           H62        A  37  10.050   5.127  30.868
  392    H2     A  37           H2         A  37   4.990   6.279  31.699
  393    H5'    C  38           H5'        C  38   5.429  11.066  37.543
  394   H5''    C  38          H5''        C  38   5.007  10.421  39.141
  395    H4'    C  38           H4'        C  38   3.201   9.957  37.522
  396    H3'    C  38           H3'        C  38   4.901   7.742  38.676
  397    H2'    C  38          H2''        C  38   3.808   6.108  37.428
  398   HO2'    C  38          H2'         C  38   1.739   6.199  36.956
  399    H1'    C  38           H1'        C  38   3.302   7.593  35.122
  400    H41    C  38           H41        C  38   8.093   3.569  33.879
  401    H42    C  38           H42        C  38   9.215   4.623  34.709
  402    H5     C  38           H5         C  38   8.551   6.684  35.751
  403    H6     C  38           H6         C  38   6.656   8.033  36.481
  404    H5'    A  39           H5'        A  39   1.224   6.616  41.625
  405   H5''    A  39          H5''        A  39   2.234   5.561  42.634
  406    H4'    A  39           H4'        A  39   0.365   4.562  40.972
  407    H3'    A  39           H3'        A  39   3.125   3.599  41.777
  408    H2'    A  39          H2''        A  39   3.060   1.819  40.213
  409   HO2'    A  39          H2'         A  39   1.219   0.778  40.473
  410    H1'    A  39           H1'        A  39   1.658   3.056  38.209
  411    H8     A  39           H8         A  39   4.379   5.399  39.352
  412    H61    A  39           H61        A  39   8.408   1.852  36.291
  413    H62    A  39           H62        A  39   8.136   3.416  37.027
  414    H2     A  39           H2         A  39   4.493  -0.324  36.458
  415    H5'    A  40           H5'        A  40  -0.148   0.961  41.978
  416   H5''    A  40          H5''        A  40  -0.525   0.140  43.505
  417    H4'    A  40           H4'        A  40  -1.037  -1.463  41.806
  418    H3'    A  40           H3'        A  40   1.547  -1.758  43.300
  419    H2'    A  40          H2''        A  40   2.446  -3.384  41.914
  420   HO2'    A  40          H2'         A  40   0.209  -4.478  42.012
  421    H1'    A  40           H1'        A  40   1.424  -2.625  39.482
  422    H8     A  40           H8         A  40   2.821   0.193  41.729
  423    H61    A  40           H61        A  40   8.278  -0.961  39.087
  424    H62    A  40           H62        A  40   7.431   0.004  40.274
  425    H2     A  40           H2         A  40   5.381  -4.106  37.725
  426    H5'    A  41           H5'        A  41  -0.086  -5.916  44.021
  427   H5''    A  41          H5''        A  41   0.928  -6.570  45.322
  428    H4'    A  41           H4'        A  41   1.265  -7.347  42.779
  429    H3'    A  41           H3'        A  41   3.182  -6.838  45.047
  430    H2'    A  41          H2''        A  41   5.054  -6.908  43.716
  431   HO2'    A  41          H2'         A  41   4.927  -8.930  42.921
  432    H1'    A  41           H1'        A  41   3.858  -6.276  41.197
  433    H8     A  41           H8         A  41   3.501  -3.418  43.611
  434    H61    A  41           H61        A  41   9.320  -1.871  42.216
  435    H62    A  41           H62        A  41   7.810  -1.318  42.902
  436    H2     A  41           H2         A  41   8.514  -5.934  40.497
  437    H5'    U  42           H5'        U  42   3.936 -11.731  44.433
  438   H5''    U  42          H5''        U  42   4.632 -11.973  46.047
  439    H4'    U  42           H4'        U  42   6.064 -12.527  43.876
  440    H3'    U  42           H3'        U  42   6.720 -11.343  46.543
  441    H2'    U  42          H2''        U  42   8.722 -10.406  45.938
  442   HO2'    U  42          H2'         U  42  10.153 -11.410  44.609
  443    H1'    U  42           H1'        U  42   8.425 -10.283  43.114
  444    H3     U  42           H3         U  42  10.026  -6.218  44.319
  445    H5     U  42           H5         U  42   6.048  -6.225  45.703
  446    H6     U  42           H6         U  42   5.915  -8.576  45.111
  447    H5'    C  43           H5'        C  43   9.292 -14.421  44.687
  448   H5''    C  43          H5''        C  43   9.887 -15.711  45.752
  449    H4'    C  43           H4'        C  43  11.660 -15.100  44.174
  450    H3'    C  43           H3'        C  43  11.843 -14.505  47.102
  451    H2'    C  43          H2''        C  43  13.685 -13.122  46.966
  452   HO2'    C  43          H2'         C  43  14.295 -14.241  44.422
  453    H1'    C  43           H1'        C  43  13.361 -12.046  44.421
  454    H41    C  43           H41        C  43  11.803  -7.393  48.482
  455    H42    C  43           H42        C  43  10.452  -8.318  49.095
  456    H5     C  43           H5         C  43   9.995 -10.580  48.426
  457    H6     C  43           H6         C  43  10.596 -12.375  46.873
  458    H5'    G  44           H5'        G  44  16.001 -16.598  46.844
  459   H5''    G  44          H5''        G  44  16.150 -17.014  48.563
  460    H4'    G  44           H4'        G  44  17.738 -15.173  47.482
  461    H3'    G  44           H3'        G  44  16.348 -15.356  50.146
  462    H2'    G  44          H2''        G  44  16.767 -13.179  50.717
  463   HO2'    G  44          H2'         G  44  18.932 -13.149  50.772
  464    H1'    G  44           H1'        G  44  17.260 -12.100  48.112
  465    H8     G  44           H8         G  44  13.723 -13.348  48.925
  466    H1     G  44           H1         G  44  14.951  -7.332  50.788
  467    H21    G  44           H21        G  44  17.094  -6.892  50.564
  468    H22    G  44           H22        G  44  18.239  -8.072  49.967
  469    H5'    A  45           H5'        A  45  21.221 -14.595  51.108
  470   H5''    A  45          H5''        A  45  21.158 -15.043  52.823
  471    H4'    A  45           H4'        A  45  22.043 -12.641  52.099
  472    H3'    A  45           H3'        A  45  20.390 -13.629  54.393
  473    H2'    A  45          H2''        A  45  19.525 -11.600  54.981
  474   HO2'    A  45          H2'         A  45  20.726  -9.704  54.893
  475    H1'    A  45           H1'        A  45  19.978 -10.106  52.598
  476    H8     A  45           H8         A  45  17.545 -13.059  52.439
  477    H61    A  45           H61        A  45  13.189  -9.033  54.175
  478    H62    A  45           H62        A  45  13.501 -10.629  53.528
  479    H2     A  45           H2         A  45  17.176  -7.007  54.526
  480    H5'    G  46           H5'        G  46  24.217 -10.878  56.714
  481   H5''    G  46          H5''        G  46  23.809 -11.691  58.238
  482    H4'    G  46           H4'        G  46  23.872  -9.032  58.109
  483    H3'    G  46           H3'        G  46  22.132 -10.996  59.543
  484    H2'    G  46          H2''        G  46  20.420  -9.545  60.020
  485   HO2'    G  46          H2'         G  46  22.435  -7.552  59.981
  486    H1'    G  46           H1'        G  46  20.745  -7.614  58.002
  487    H8     G  46           H8         G  46  20.297 -11.177  56.731
  488    H1     G  46           H1         G  46  14.805  -8.251  58.260
  489    H21    G  46           H21        G  46  15.218  -6.402  59.389
  490    H22    G  46           H22        G  46  16.840  -5.784  59.609
  491    H5'    C  47           H5'        C  47  23.350  -7.390  62.702
  492   H5''    C  47          H5''        C  47  22.975  -8.208  64.231
  493    H4'    C  47           H4'        C  47  21.804  -5.910  63.684
  494    H3'    C  47           H3'        C  47  20.696  -8.478  64.806
  495    H2'    C  47          H2''        C  47  18.497  -7.721  64.788
  496   HO2'    C  47          H2'         C  47  17.928  -5.613  64.906
  497    H1'    C  47           H1'        C  47  18.574  -6.192  62.468
  498    H41    C  47           H41        C  47  15.711 -11.691  61.004
  499    H42    C  47           H42        C  47  17.240 -12.533  61.051
  500    H5     C  47           H5         C  47  19.333 -11.438  61.549
  501    H6     C  47           H6         C  47  20.380  -9.342  62.247
  502    H5'    C  48           H5'        C  48  18.639  -5.709  66.884
  503   H5''    C  48          H5''        C  48  18.997  -5.813  68.619
  504    H4'    C  48           H4'        C  48  16.609  -5.790  68.481
  505    H3'    C  48           H3'        C  48  17.915  -8.476  68.846
  506   HO3'    C  48          H3T         C  48  16.103  -7.041  70.508
  507    H2'    C  48          H2''        C  48  15.941  -9.654  68.688
  508   HO2'    C  48          H2'         C  48  14.454  -7.258  69.065
  509    H1'    C  48           H1'        C  48  14.599  -7.987  66.873
  510    H41    C  48           H41        C  48  16.336 -13.153  63.585
  511    H42    C  48           H42        C  48  18.029 -12.755  63.770
  512    H5     C  48           H5         C  48  18.813 -10.909  65.101
  513    H6     C  48           H6         C  48  18.145  -9.026  66.515
  Start of MODEL    3
    1    H5'    G   1           H5'        G   1   7.616 -18.216  60.231
    2   H5''    G   1          H5''        G   1   6.889 -17.559  58.750
    3    H4'    G   1           H4'        G   1   5.866 -16.387  60.601
    4    H3'    G   1           H3'        G   1   7.871 -15.020  58.858
    5    H2'    G   1          H2''        G   1   8.220 -13.185  60.217
    6   HO2'    G   1          H2'         G   1   6.068 -12.571  60.415
    7    H1'    G   1           H1'        G   1   7.851 -14.279  62.727
    8    H8     G   1           H8         G   1  10.086 -16.548  60.668
    9    H1     G   1           H1         G   1  13.126 -11.398  62.972
   10    H21    G   1           H21        G   1  11.666  -9.930  63.736
   11    H22    G   1           H22        G   1   9.956 -10.283  63.847
   12   HO5'    G   1          H5T         G   1   9.259 -17.808  58.826
   13    H5'    G   2           H5'        G   2   4.953 -11.550  58.592
   14   H5''    G   2          H5''        G   2   5.441 -10.924  57.004
   15    H4'    G   2           H4'        G   2   5.986  -9.545  59.209
   16    H3'    G   2           H3'        G   2   7.539 -10.056  56.689
   17    H2'    G   2          H2''        G   2   9.527  -9.258  57.521
   18   HO2'    G   2          H2'         G   2   7.862  -7.544  59.027
   19    H1'    G   2           H1'        G   2   9.001  -9.502  60.319
   20    H8     G   2           H8         G   2   9.154 -12.869  58.621
   21    H1     G   2           H1         G   2  14.930 -10.316  59.731
   22    H21    G   2           H21        G   2  14.720  -8.224  60.402
   23    H22    G   2           H22        G   2  13.184  -7.387  60.385
   24    H5'    C   3           H5'        C   3   7.075  -5.689  58.142
   25   H5''    C   3          H5''        C   3   7.015  -4.563  56.771
   26    H4'    C   3           H4'        C   3   8.506  -3.759  58.633
   27    H3'    C   3           H3'        C   3   9.316  -4.276  55.801
   28    H2'    C   3          H2''        C   3  11.588  -4.197  56.152
   29   HO2'    C   3          H2'         C   3  10.904  -2.448  58.255
   30    H1'    C   3           H1'        C   3  11.764  -4.970  58.832
   31    H41    C   3           H41        C   3  14.096  -9.782  55.364
   32    H42    C   3           H42        C   3  12.507 -10.137  54.726
   33    H5     C   3           H5         C   3  10.534  -8.914  55.359
   34    H6     C   3           H6         C   3   9.680  -6.988  56.601
   35    H5'    U   4           H5'        U   4  11.526  -0.432  56.655
   36   H5''    U   4          H5''        U   4  11.408   0.459  55.124
   37    H4'    U   4           H4'        U   4  13.789  -0.042  55.893
   38    H3'    U   4           H3'        U   4  12.523  -0.743  53.262
   39    H2'    U   4          H2''        U   4  14.209  -2.129  52.570
   40   HO2'    U   4          H2'         U   4  15.765  -0.239  53.861
   41    H1'    U   4           H1'        U   4  15.368  -2.803  55.076
   42    H3     U   4           H3         U   4  14.955  -6.806  53.053
   43    H5     U   4           H5         U   4  10.969  -5.507  53.476
   44    H6     U   4           H6         U   4  11.816  -3.394  54.313
   45    H5'    C   5           H5'        C   5  16.776   1.851  52.221
   46   H5''    C   5          H5''        C   5  16.458   2.020  50.485
   47    H4'    C   5           H4'        C   5  18.697   0.858  51.338
   48    H3'    C   5           H3'        C   5  16.826   0.223  49.061
   49    H2'    C   5          H2''        C   5  17.913  -1.759  48.526
   50   HO2'    C   5          H2'         C   5  19.996  -0.975  48.363
   51    H1'    C   5           H1'        C   5  18.732  -2.540  51.069
   52    H41    C   5           H41        C   5  13.831  -6.203  49.231
   53    H42    C   5           H42        C   5  12.712  -4.985  49.795
   54    H5     C   5           H5         C   5  13.395  -2.751  50.374
   55    H6     C   5           H6         C   5  15.312  -1.314  50.894
   56    H5'    G   6           H5'        G   6  20.385   1.185  45.968
   57   H5''    G   6          H5''        G   6  19.234   1.485  44.651
   58    H4'    G   6           H4'        G   6  20.871  -0.626  44.585
   59    H3'    G   6           H3'        G   6  17.986  -0.265  43.771
   60    H2'    G   6          H2''        G   6  17.691  -2.526  43.319
   61   HO2'    G   6          H2'         G   6  19.237  -3.773  42.529
   62    H1'    G   6           H1'        G   6  19.406  -3.597  45.240
   63    H8     G   6           H8         G   6  17.071  -1.112  46.865
   64    H1     G   6           H1         G   6  14.254  -6.706  45.487
   65    H21    G   6           H21        G   6  15.577  -7.928  44.214
   66    H22    G   6           H22        G   6  17.078  -7.311  43.561
   67    H5'    A   7           H5'        A   7  19.742  -2.160  40.152
   68   H5''    A   7          H5''        A   7  18.565  -1.941  38.842
   69    H4'    A   7           H4'        A   7  18.926  -4.335  39.983
   70    H3'    A   7           H3'        A   7  16.481  -2.901  38.960
   71    H2'    A   7          H2''        A   7  15.002  -4.451  39.831
   72   HO2'    A   7          H2'         A   7  17.144  -6.318  40.000
   73    H1'    A   7           H1'        A   7  16.483  -5.310  42.064
   74    H8     A   7           H8         A   7  16.222  -1.623  42.394
   75    H61    A   7           H61        A   7  10.297  -2.340  43.998
   76    H62    A   7           H62        A   7  11.681  -1.270  44.047
   77    H2     A   7           H2         A   7  11.777  -6.249  42.375
   78    H5'    U   8           H5'        U   8  16.348  -6.653  36.053
   79   H5''    U   8          H5''        U   8  15.328  -5.998  34.757
   80    H4'    U   8           H4'        U   8  14.452  -7.991  36.295
   81    H3'    U   8           H3'        U   8  13.103  -5.563  35.132
   82    H2'    U   8          H2''        U   8  11.156  -5.845  36.342
   83   HO2'    U   8          H2'         U   8  10.623  -7.889  35.703
   84    H1'    U   8           H1'        U   8  12.200  -7.210  38.595
   85    H3     U   8           H3         U   8   9.664  -3.607  39.894
   86    H5     U   8           H5         U   8  13.503  -2.093  39.052
   87    H6     U   8           H6         U   8  14.062  -4.237  38.066
   88    H5'    U   9           H5'        U   9  10.399  -8.234  32.255
   89   H5''    U   9          H5''        U   9  10.288  -6.894  31.099
   90    H4'    U   9           H4'        U   9   8.149  -7.664  32.492
   91    H3'    U   9           H3'        U   9   9.180  -4.958  31.659
   92    H2'    U   9          H2''        U   9   7.716  -3.794  32.993
   93   HO2'    U   9          H2'         U   9   5.771  -4.343  32.311
   94    H1'    U   9           H1'        U   9   7.107  -5.842  34.898
   95    H3     U   9           H3         U   9   7.752  -2.048  37.274
   96    H5     U   9           H5         U   9  11.589  -3.000  35.817
   97    H6     U   9           H6         U   9  10.580  -4.780  34.506
   98    H5'    G  10           H5'        G  10   4.705  -5.440  30.632
   99   H5''    G  10          H5''        G  10   4.465  -4.662  29.054
  100    H4'    G  10           H4'        G  10   2.804  -4.020  30.931
  101    H3'    G  10           H3'        G  10   4.412  -2.237  29.119
  102    H2'    G  10          H2''        G  10   3.941  -0.312  30.265
  103   HO2'    G  10          H2'         G  10   1.508  -1.595  30.964
  104    H1'    G  10           H1'        G  10   3.240  -1.415  32.800
  105    H8     G  10           H8         G  10   6.836  -2.098  31.982
  106    H1     G  10           H1         G  10   5.781   4.001  33.679
  107    H21    G  10           H21        G  10   3.614   4.395  33.772
  108    H22    G  10           H22        G  10   2.428   3.224  33.240
  109    H5'    U  11           H5'        U  11  -0.381  -0.852  28.643
  110   H5''    U  11          H5''        U  11  -0.175   0.146  27.192
  111    H4'    U  11           H4'        U  11  -1.203   1.191  29.417
  112    H3'    U  11           H3'        U  11   0.745   2.290  27.390
  113    H2'    U  11          H2''        U  11   1.108   4.239  28.611
  114   HO2'    U  11          H2'         U  11  -0.352   5.089  30.024
  115    H1'    U  11           H1'        U  11   0.858   3.176  31.192
  116    H3     U  11           H3         U  11   5.003   5.075  30.621
  117    H5     U  11           H5         U  11   5.293   1.177  29.054
  118    H6     U  11           H6         U  11   2.882   0.990  29.247
  119    H5'    A  12           H5'        A  12  -2.122   5.480  25.853
  120   H5''    A  12          H5''        A  12  -1.206   5.692  24.349
  121    H4'    A  12           H4'        A  12  -1.010   7.464  26.347
  122    H3'    A  12           H3'        A  12   1.097   6.310  24.496
  123    H2'    A  12          H2''        A  12   2.750   7.624  25.509
  124   HO2'    A  12          H2'         A  12   0.601   9.129  26.617
  125    H1'    A  12           H1'        A  12   1.809   7.422  28.118
  126    H8     A  12           H8         A  12   1.836   3.939  26.699
  127    H61    A  12           H61        A  12   8.006   4.059  27.020
  128    H62    A  12           H62        A  12   6.594   3.042  26.836
  129    H2     A  12           H2         A  12   6.486   8.171  27.967
  130    H5'    U  13           H5'        U  13   1.536  10.439  24.866
  131   H5''    U  13          H5''        U  13   2.069  11.246  23.378
  132    H4'    U  13           H4'        U  13   3.547  11.595  25.458
  133    H3'    U  13           H3'        U  13   4.397  10.618  22.732
  134    H2'    U  13          H2''        U  13   6.580  10.261  23.395
  135   HO2'    U  13          H2'         U  13   6.090  12.110  25.504
  136    H1'    U  13           H1'        U  13   6.122   9.727  26.139
  137    H3     U  13           H3         U  13   8.705   6.436  24.235
  138    H5     U  13           H5         U  13   4.739   5.563  23.108
  139    H6     U  13           H6         U  13   4.075   7.707  23.998
  140    H5'    U  14           H5'        U  14   7.159  13.461  24.071
  141   H5''    U  14          H5''        U  14   7.176  14.878  23.000
  142    H4'    U  14           H4'        U  14   9.480  14.394  23.478
  143    H3'    U  14           H3'        U  14   8.358  13.631  20.805
  144    H2'    U  14          H2''        U  14  10.119  12.306  20.171
  145   HO2'    U  14          H2'         U  14  11.626  14.055  21.796
  146    H1'    U  14           H1'        U  14  11.191  11.602  22.679
  147    H3     U  14           H3         U  14  10.748   7.614  20.639
  148    H5     U  14           H5         U  14   6.774   8.971  21.000
  149    H6     U  14           H6         U  14   7.638  11.068  21.860
  150    H5'    U  15           H5'        U  15  12.596  15.936  20.280
  151   H5''    U  15          H5''        U  15  12.580  16.400  18.568
  152    H4'    U  15           H4'        U  15  14.568  14.930  19.471
  153    H3'    U  15           H3'        U  15  12.922  14.701  16.960
  154    H2'    U  15          H2''        U  15  13.760  12.645  16.391
  155   HO2'    U  15          H2'         U  15  16.097  13.599  17.634
  156    H1'    U  15           H1'        U  15  14.652  11.774  18.963
  157    H3     U  15           H3         U  15  12.521   8.240  17.054
  158    H5     U  15           H5         U  15   9.436  10.942  18.026
  159    H6     U  15           H6         U  15  11.135  12.576  18.598
  160    H5'    U  16           H5'        U  16  17.480  15.028  15.003
  161   H5''    U  16          H5''        U  16  16.874  15.419  13.382
  162    H4'    U  16           H4'        U  16  18.322  13.220  13.787
  163    H3'    U  16           H3'        U  16  15.916  13.796  12.073
  164    H2'    U  16          H2''        U  16  15.494  11.593  11.591
  165   HO2'    U  16          H2'         U  16  17.092  10.092  11.292
  166    H1'    U  16           H1'        U  16  16.838  10.364  13.792
  167    H3     U  16           H3         U  16  12.845   8.251  13.392
  168    H5     U  16           H5         U  16  11.850  12.092  14.811
  169    H6     U  16           H6         U  16  14.169  12.736  14.500
  170    H5'    U  17           H5'        U  17  19.285  11.442  10.013
  171   H5''    U  17          H5''        U  17  19.403  12.015   8.338
  172    H4'    U  17           H4'        U  17  19.474   9.544   8.411
  173    H3'    U  17           H3'        U  17  17.169  11.056   7.195
  174    H2'    U  17          H2''        U  17  15.873   9.185   6.896
  175   HO2'    U  17          H2'         U  17  18.353   7.847   6.635
  176    H1'    U  17           H1'        U  17  17.065   7.477   8.848
  177    H3     U  17           H3         U  17  12.603   7.002   9.415
  178    H5     U  17           H5         U  17  13.357  10.980  10.584
  179    H6     U  17           H6         U  17  15.640  10.700   9.807
  180    H5'    A  18           H5'        A  18  19.212   8.038   3.662
  181   H5''    A  18          H5''        A  18  18.166   8.497   2.307
  182    H4'    A  18           H4'        A  18  18.336   5.953   3.089
  183    H3'    A  18           H3'        A  18  15.933   7.602   2.261
  184    H2'    A  18          H2''        A  18  14.530   5.738   2.531
  185   HO2'    A  18          H2'         A  18  16.187   4.336   1.448
  186    H1'    A  18           H1'        A  18  15.755   4.707   4.802
  187    H8     A  18           H8         A  18  15.279   8.427   5.283
  188    H61    A  18           H61        A  18   9.239   7.340   6.051
  189    H62    A  18           H62        A  18  10.527   8.509   6.242
  190    H2     A  18           H2         A  18  11.187   3.514   4.751
  191    H5'    A  19           H5'        A  19  16.277   4.375  -0.837
  192   H5''    A  19          H5''        A  19  15.137   4.651  -2.168
  193    H4'    A  19           H4'        A  19  14.697   2.755  -0.313
  194    H3'    A  19           H3'        A  19  12.841   4.642  -1.775
  195    H2'    A  19          H2''        A  19  11.005   3.991  -0.514
  196   HO2'    A  19          H2'         A  19  11.187   1.776  -0.917
  197    H1'    A  19           H1'        A  19  12.382   3.299   1.879
  198    H8     A  19           H8         A  19  13.293   6.789   1.487
  199    H61    A  19           H61        A  19   7.564   8.357   3.190
  200    H62    A  19           H62        A  19   9.178   8.944   2.859
  201    H2     A  19           H2         A  19   7.538   4.021   2.025
  202    H5'    A  20           H5'        A  20  10.734   1.331  -4.346
  203   H5''    A  20          H5''        A  20  10.434   2.550  -5.599
  204    H4'    A  20           H4'        A  20   8.429   1.601  -4.116
  205    H3'    A  20           H3'        A  20   9.065   4.343  -5.188
  206    H2'    A  20          H2''        A  20   7.434   5.402  -3.939
  207   HO2'    A  20          H2'         A  20   5.489   4.610  -3.832
  208    H1'    A  20           H1'        A  20   7.242   3.622  -1.771
  209    H8     A  20           H8         A  20  10.697   5.149  -2.505
  210    H61    A  20           H61        A  20   8.821  10.033   0.778
  211    H62    A  20           H62        A  20  10.159   9.297  -0.074
  212    H2     A  20           H2         A  20   5.298   7.323   0.190
  213    H5'    U  21           H5'        U  21   4.638   4.049  -6.188
  214   H5''    U  21          H5''        U  21   4.490   5.179  -7.548
  215    H4'    U  21           H4'        U  21   3.253   5.801  -5.350
  216    H3'    U  21           H3'        U  21   5.146   7.494  -6.984
  217    H2'    U  21          H2''        U  21   5.027   9.284  -5.483
  218   HO2'    U  21          H2'         U  21   2.783   8.085  -4.216
  219    H1'    U  21           H1'        U  21   4.824   7.825  -3.125
  220    H3     U  21           H3         U  21   8.736  10.038  -2.659
  221    H5     U  21           H5         U  21   9.453   7.469  -5.921
  222    H6     U  21           H6         U  21   7.165   6.695  -5.729
  223    H5'    U  22           H5'        U  22   1.553   8.881  -5.672
  224   H5''    U  22          H5''        U  22   0.256   9.254  -6.824
  225    H4'    U  22           H4'        U  22  -0.138  10.665  -4.928
  226    H3'    U  22           H3'        U  22   0.918  11.819  -7.446
  227    H2'    U  22          H2''        U  22   1.718  13.806  -6.597
  228   HO2'    U  22          H2'         U  22   0.822  14.730  -4.675
  229    H1'    U  22           H1'        U  22   2.251  13.173  -3.966
  230    H3     U  22           H3         U  22   6.337  14.438  -5.366
  231    H5     U  22           H5         U  22   5.481  11.126  -7.822
  232    H6     U  22           H6         U  22   3.311  10.975  -6.749
  233    H5'    A  23           H5'        A  23  -0.276  15.145  -9.179
  234   H5''    A  23          H5''        A  23   0.769  15.068  -7.748
  235    H4'    A  23           H4'        A  23   0.174  17.423  -8.610
  236    H3'    A  23           H3'        A  23   0.116  16.272  -5.875
  237    H2'    A  23          H2''        A  23  -1.346  17.744  -4.893
  238   HO2'    A  23          H2'         A  23  -0.229  19.606  -5.142
  239    H1'    A  23           H1'        A  23  -2.788  18.711  -7.086
  240    H8     A  23           H8         A  23  -3.072  15.014  -7.254
  241    H61    A  23           H61        A  23  -7.279  15.303  -2.739
  242    H62    A  23           H62        A  23  -6.585  14.312  -4.004
  243    H2     A  23           H2         A  23  -5.195  19.258  -2.931
  244    H5'    A  24           H5'        A  24   3.506  18.968  -4.105
  245   H5''    A  24          H5''        A  24   3.391  17.936  -2.669
  246    H4'    A  24           H4'        A  24   1.871  20.281  -3.251
  247    H3'    A  24           H3'        A  24   2.281  18.262  -1.131
  248    H2'    A  24          H2''        A  24   0.116  17.965  -0.504
  249   HO2'    A  24          H2'         A  24  -0.042  20.789  -0.794
  250    H1'    A  24           H1'        A  24  -1.252  19.507  -2.533
  251    H8     A  24           H8         A  24   0.028  16.187  -3.711
  252    H61    A  24           H61        A  24  -5.173  13.693  -1.516
  253    H62    A  24           H62        A  24  -3.669  13.376  -2.352
  254    H2     A  24           H2         A  24  -4.897  17.896   0.016
  255    H5'    U  25           H5'        U  25   1.148  20.905   1.811
  256   H5''    U  25          H5''        U  25   1.752  20.048   3.243
  257    H4'    U  25           H4'        U  25  -0.486  19.318   1.384
  258    H3'    U  25           H3'        U  25  -0.235  20.085   4.010
  259    H2'    U  25          H2''        U  25   0.932  18.329   4.935
  260   HO2'    U  25          H2'         U  25  -0.511  16.643   5.629
  261    H1'    U  25           H1'        U  25  -0.163  16.152   3.250
  262    H3     U  25           H3         U  25   3.387  14.313   5.538
  263    H5     U  25           H5         U  25   5.070  17.021   2.777
  264    H6     U  25           H6         U  25   2.808  17.783   2.256
  265    H5'    U  26           H5'        U  26  -3.474  16.056   1.721
  266   H5''    U  26          H5''        U  26  -2.107  15.804   2.818
  267    H4'    U  26           H4'        U  26  -2.653  14.458   0.349
  268    H3'    U  26           H3'        U  26  -0.525  14.461   2.491
  269    H2'    U  26          H2''        U  26   0.944  13.323   1.129
  270   HO2'    U  26          H2'         U  26  -0.430  11.528   0.877
  271    H1'    U  26           H1'        U  26  -0.302  14.000  -1.384
  272    H3     U  26           H3         U  26   3.942  14.561  -2.615
  273    H5     U  26           H5         U  26   3.632  17.060   0.745
  274    H6     U  26           H6         U  26   1.343  16.296   1.031
  275    H5'    C  27           H5'        C  27  -2.323  10.840   0.874
  276   H5''    C  27          H5''        C  27  -2.847   9.632   2.066
  277    H4'    C  27           H4'        C  27  -2.085   8.311   0.238
  278    H3'    C  27           H3'        C  27   0.021   8.860   2.343
  279    H2'    C  27          H2''        C  27   1.635   7.631   1.189
  280   HO2'    C  27          H2'         C  27  -0.485   6.476  -0.325
  281    H1'    C  27           H1'        C  27   0.744   8.294  -1.402
  282    H41    C  27           H41        C  27   6.022  11.736  -0.518
  283    H42    C  27           H42        C  27   5.242  12.692   0.722
  284    H5     C  27           H5         C  27   3.079  12.138   1.637
  285    H6     C  27           H6         C  27   1.092  10.729   1.373
  286    H5'    U  28           H5'        U  28  -1.317   4.627   2.506
  287   H5''    U  28          H5''        U  28  -1.294   3.722   4.034
  288    H4'    U  28           H4'        U  28   0.196   2.690   2.310
  289    H3'    U  28           H3'        U  28   1.116   3.862   4.923
  290    H2'    U  28          H2''        U  28   3.348   3.829   4.435
  291   HO2'    U  28          H2'         U  28   4.220   2.256   2.928
  292    H1'    U  28           H1'        U  28   3.237   3.759   1.594
  293    H3     U  28           H3         U  28   6.309   6.919   2.705
  294    H5     U  28           H5         U  28   2.609   8.644   3.737
  295    H6     U  28           H6         U  28   1.551   6.522   3.237
  296    H5'    U  29           H5'        U  29   2.852  -0.999   4.850
  297   H5''    U  29          H5''        U  29   3.350  -0.960   6.552
  298    H4'    U  29           H4'        U  29   5.091  -1.626   4.649
  299    H3'    U  29           H3'        U  29   5.388   0.077   7.130
  300    H2'    U  29          H2''        U  29   7.567   0.662   6.596
  301   HO2'    U  29          H2'         U  29   8.923  -0.629   5.442
  302    H1'    U  29           H1'        U  29   7.374   0.513   3.785
  303    H3     U  29           H3         U  29   9.107   4.541   5.301
  304    H5     U  29           H5         U  29   4.930   4.984   5.085
  305    H6     U  29           H6         U  29   4.747   2.579   4.874
  306    H5'    A  30           H5'        A  30   8.766  -2.931   7.000
  307   H5''    A  30          H5''        A  30   9.459  -3.045   8.629
  308    H4'    A  30           H4'        A  30  10.910  -2.100   6.601
  309    H3'    A  30           H3'        A  30  10.687  -1.284   9.493
  310    H2'    A  30          H2''        A  30  11.907   0.643   9.211
  311   HO2'    A  30          H2'         A  30  13.648   0.779   7.912
  312    H1'    A  30           H1'        A  30  11.516   1.023   6.408
  313    H8     A  30           H8         A  30   8.249   1.322   8.233
  314    H61    A  30           H61        A  30   9.998   6.995   9.961
  315    H62    A  30           H62        A  30   8.647   5.896   9.786
  316    H2     A  30           H2         A  30  13.546   4.938   8.149
  317    H5'    A  31           H5'        A  31  14.813  -0.869   8.422
  318   H5''    A  31          H5''        A  31  15.747  -1.896   9.527
  319    H4'    A  31           H4'        A  31  16.877   0.221   9.493
  320    H3'    A  31           H3'        A  31  15.133  -0.378  11.879
  321    H2'    A  31          H2''        A  31  15.329   1.738  12.750
  322   HO2'    A  31          H2'         A  31  17.352   2.194  13.103
  323    H1'    A  31           H1'        A  31  16.032   3.140  10.355
  324    H8     A  31           H8         A  31  12.577   1.450  10.732
  325    H61    A  31           H61        A  31  10.721   6.807  13.186
  326    H62    A  31           H62        A  31  10.205   5.259  12.554
  327    H2     A  31           H2         A  31  15.118   7.103  12.356
  328    H5'    A  32           H5'        A  32  19.699   0.690  13.559
  329   H5''    A  32          H5''        A  32  19.482   0.084  15.213
  330    H4'    A  32           H4'        A  32  20.224   2.587  14.844
  331    H3'    A  32           H3'        A  32  18.168   1.397  16.705
  332    H2'    A  32          H2''        A  32  17.395   3.454  17.393
  333   HO2'    A  32          H2'         A  32  19.997   4.391  16.755
  334    H1'    A  32           H1'        A  32  18.168   4.996  15.122
  335    H8     A  32           H8         A  32  15.648   2.136  14.625
  336    H61    A  32           H61        A  32  11.288   6.231  16.188
  337    H62    A  32           H62        A  32  11.600   4.667  15.471
  338    H2     A  32           H2         A  32  15.288   8.170  16.775
  339    H5'    A  33           H5'        A  33  21.009   4.224  19.095
  340   H5''    A  33          H5''        A  33  20.947   3.615  20.761
  341    H4'    A  33           H4'        A  33  20.344   6.104  20.408
  342    H3'    A  33           H3'        A  33  18.746   3.994  21.861
  343    H2'    A  33          H2''        A  33  16.956   5.399  22.203
  344   HO2'    A  33          H2'         A  33  17.364   7.241  23.098
  345    H1'    A  33           H1'        A  33  17.429   7.226  20.054
  346    H8     A  33           H8         A  33  16.661   3.575  19.164
  347    H61    A  33           H61        A  33  10.694   5.160  19.543
  348    H62    A  33           H62        A  33  11.827   3.953  18.980
  349    H2     A  33           H2         A  33  13.157   8.629  20.974
  350    H5'    A  34           H5'        A  34  19.561   7.715  24.723
  351   H5''    A  34          H5''        A  34  19.280   7.072  26.352
  352    H4'    A  34           H4'        A  34  17.897   9.166  25.517
  353    H3'    A  34           H3'        A  34  17.070   6.710  27.052
  354    H2'    A  34          H2''        A  34  14.817   7.156  26.877
  355   HO2'    A  34          H2'         A  34  14.004   9.274  26.820
  356    H1'    A  34           H1'        A  34  14.879   8.876  24.591
  357    H8     A  34           H8         A  34  15.925   5.330  23.803
  358    H61    A  34           H61        A  34   9.882   4.117  23.218
  359    H62    A  34           H62        A  34  11.503   3.537  22.907
  360    H2     A  34           H2         A  34  10.341   8.170  25.107
  361    H5'    C  35           H5'        C  35  16.348   6.833  31.021
  362   H5''    C  35          H5''        C  35  16.599   5.138  30.562
  363    H4'    C  35           H4'        C  35  14.387   7.009  29.794
  364    H3'    C  35           H3'        C  35  14.723   4.586  31.191
  365    H2'    C  35          H2''        C  35  14.891   3.139  29.460
  366   HO2'    C  35          H2'         C  35  12.791   2.695  30.194
  367    H1'    C  35           H1'        C  35  13.256   4.783  27.559
  368    H41    C  35           H41        C  35  16.335   0.913  23.540
  369    H42    C  35           H42        C  35  17.880   1.374  24.217
  370    H5     C  35           H5         C  35  18.093   2.714  26.211
  371    H6     C  35           H6         C  35  16.889   4.084  27.846
  372    H5'    U  36           H5'        U  36  15.021   8.224  31.286
  373   H5''    U  36          H5''        U  36  14.076   8.667  32.721
  374    H4'    U  36           H4'        U  36  14.742  10.693  31.439
  375    H3'    U  36           H3'        U  36  11.964   9.745  31.933
  376    H2'    U  36          H2''        U  36  10.890  11.078  30.374
  377   HO2'    U  36          H2'         U  36  11.912  13.018  31.154
  378    H1'    U  36           H1'        U  36  12.770  11.214  28.375
  379    H3     U  36           H3         U  36   8.651   8.656  28.069
  380    H5     U  36           H5         U  36  12.033   6.170  27.792
  381    H6     U  36           H6         U  36  13.387   8.010  28.566
  382    H5'    A  37           H5'        A  37  10.242  13.375  34.495
  383   H5''    A  37          H5''        A  37   9.806  12.075  35.622
  384    H4'    A  37           H4'        A  37   7.916  13.436  34.317
  385    H3'    A  37           H3'        A  37   8.183  10.491  34.962
  386    H2'    A  37          H2''        A  37   6.179   9.982  33.862
  387   HO2'    A  37          H2'         A  37   4.596  11.400  33.524
  388    H1'    A  37           H1'        A  37   6.572  11.582  31.658
  389    H8     A  37           H8         A  37   9.956  10.249  32.050
  390    H61    A  37           H61        A  37   7.909   4.724  30.201
  391    H62    A  37           H62        A  37   9.308   5.764  30.345
  392    H2     A  37           H2         A  37   4.346   7.243  31.244
  393    H5'    C  38           H5'        C  38   4.773  12.052  37.111
  394   H5''    C  38          H5''        C  38   4.330  11.360  38.684
  395    H4'    C  38           H4'        C  38   2.565  10.932  36.993
  396    H3'    C  38           H3'        C  38   4.220   8.718  38.208
  397    H2'    C  38          H2''        C  38   3.193   7.078  36.912
  398   HO2'    C  38          H2'         C  38   1.052   7.715  37.409
  399    H1'    C  38           H1'        C  38   2.759   8.568  34.592
  400    H41    C  38           H41        C  38   7.635   4.579  33.523
  401    H42    C  38           H42        C  38   8.718   5.663  34.367
  402    H5     C  38           H5         C  38   7.993   7.711  35.391
  403    H6     C  38           H6         C  38   6.062   9.059  36.022
  404    H5'    A  39           H5'        A  39   0.464   7.469  40.913
  405   H5''    A  39          H5''        A  39   1.453   6.486  42.010
  406    H4'    A  39           H4'        A  39  -0.225   5.362  40.228
  407    H3'    A  39           H3'        A  39   2.518   4.570  41.254
  408    H2'    A  39          H2''        A  39   2.693   2.796  39.715
  409   HO2'    A  39          H2'         A  39   1.040   1.564  39.331
  410    H1'    A  39           H1'        A  39   1.238   3.882  37.625
  411    H8     A  39           H8         A  39   3.865   6.352  38.714
  412    H61    A  39           H61        A  39   8.054   2.841  35.832
  413    H62    A  39           H62        A  39   7.719   4.420  36.505
  414    H2     A  39           H2         A  39   4.206   0.547  36.005
  415    H5'    A  40           H5'        A  40  -0.737   1.743  40.992
  416   H5''    A  40          H5''        A  40  -1.119   0.957  42.539
  417    H4'    A  40           H4'        A  40  -1.616  -0.673  40.845
  418    H3'    A  40           H3'        A  40   0.909  -0.948  42.440
  419    H2'    A  40          H2''        A  40   1.861  -2.599  41.129
  420   HO2'    A  40          H2'         A  40   0.608  -4.210  40.678
  421    H1'    A  40           H1'        A  40   0.904  -1.925  38.644
  422    H8     A  40           H8         A  40   2.264   0.976  40.808
  423    H61    A  40           H61        A  40   7.804  -0.399  38.448
  424    H62    A  40           H62        A  40   6.875   0.782  39.344
  425    H2     A  40           H2         A  40   4.886  -3.506  37.050
  426    H5'    A  41           H5'        A  41  -0.637  -5.140  43.084
  427   H5''    A  41          H5''        A  41   0.334  -5.739  44.443
  428    H4'    A  41           H4'        A  41   0.806  -6.561  41.937
  429    H3'    A  41           H3'        A  41   2.618  -5.942  44.267
  430    H2'    A  41          H2''        A  41   4.535  -6.019  43.005
  431   HO2'    A  41          H2'         A  41   3.121  -7.840  41.349
  432    H1'    A  41           H1'        A  41   3.394  -5.525  40.422
  433    H8     A  41           H8         A  41   3.010  -2.545  42.688
  434    H61    A  41           H61        A  41   8.870  -1.118  41.326
  435    H62    A  41           H62        A  41   7.360  -0.526  41.980
  436    H2     A  41           H2         A  41   8.049  -5.247  39.779
  437    H5'    U  42           H5'        U  42   3.954 -10.653  42.945
  438   H5''    U  42          H5''        U  42   4.650 -10.976  44.544
  439    H4'    U  42           H4'        U  42   6.140 -11.237  42.356
  440    H3'    U  42           H3'        U  42   6.698 -10.205  45.116
  441    H2'    U  42          H2''        U  42   8.674  -9.162  44.589
  442   HO2'    U  42          H2'         U  42   9.016 -11.439  43.185
  443    H1'    U  42           H1'        U  42   8.343  -8.820  41.787
  444    H3     U  42           H3         U  42   9.777  -4.814  43.384
  445    H5     U  42           H5         U  42   5.792  -5.115  44.716
  446    H6     U  42           H6         U  42   5.763  -7.404  43.909
  447    H5'    C  43           H5'        C  43   9.399 -13.917  43.506
  448   H5''    C  43          H5''        C  43  10.343 -14.582  44.854
  449    H4'    C  43           H4'        C  43  11.604 -14.096  42.630
  450    H3'    C  43           H3'        C  43  12.306 -13.419  45.464
  451    H2'    C  43          H2''        C  43  14.014 -11.963  44.950
  452   HO2'    C  43          H2'         C  43  15.441 -12.409  43.458
  453    H1'    C  43           H1'        C  43  13.200 -11.054  42.430
  454    H41    C  43           H41        C  43  12.608  -6.212  46.529
  455    H42    C  43           H42        C  43  11.201  -6.958  47.249
  456    H5     C  43           H5         C  43  10.324  -9.081  46.536
  457    H6     C  43           H6         C  43  10.637 -10.974  45.014
  458    H5'    G  44           H5'        G  44  16.606 -15.631  44.757
  459   H5''    G  44          H5''        G  44  16.634 -16.080  46.473
  460    H4'    G  44           H4'        G  44  18.480 -14.436  45.479
  461    H3'    G  44           H3'        G  44  16.996 -14.528  48.088
  462    H2'    G  44          H2''        G  44  17.561 -12.406  48.741
  463   HO2'    G  44          H2'         G  44  19.706 -12.480  48.863
  464    H1'    G  44           H1'        G  44  18.182 -11.242  46.222
  465    H8     G  44           H8         G  44  14.594 -12.474  46.757
  466    H1     G  44           H1         G  44  15.757  -6.581  49.004
  467    H21    G  44           H21        G  44  17.913  -6.136  48.884
  468    H22    G  44           H22        G  44  19.093  -7.349  48.438
  469    H5'    A  45           H5'        A  45  21.751 -14.303  49.374
  470   H5''    A  45          H5''        A  45  21.597 -14.770  51.078
  471    H4'    A  45           H4'        A  45  22.594 -12.386  50.407
  472    H3'    A  45           H3'        A  45  20.881 -13.370  52.656
  473    H2'    A  45          H2''        A  45  20.017 -11.347  53.253
  474   HO2'    A  45          H2'         A  45  22.606 -10.538  52.711
  475    H1'    A  45           H1'        A  45  20.469  -9.814  50.913
  476    H8     A  45           H8         A  45  18.141 -12.847  50.620
  477    H61    A  45           H61        A  45  13.623  -9.030  52.412
  478    H62    A  45           H62        A  45  13.994 -10.571  51.672
  479    H2     A  45           H2         A  45  17.527  -6.860  52.838
  480    H5'    G  46           H5'        G  46  24.622 -10.768  55.228
  481   H5''    G  46          H5''        G  46  24.118 -11.618  56.702
  482    H4'    G  46           H4'        G  46  24.195  -8.952  56.630
  483    H3'    G  46           H3'        G  46  22.383 -10.942  57.938
  484    H2'    G  46          H2''        G  46  20.659  -9.484  58.382
  485   HO2'    G  46          H2'         G  46  22.693  -7.511  58.423
  486    H1'    G  46           H1'        G  46  21.023  -7.567  56.376
  487    H8     G  46           H8         G  46  20.765 -11.154  55.107
  488    H1     G  46           H1         G  46  15.110  -8.394  56.314
  489    H21    G  46           H21        G  46  15.412  -6.451  57.315
  490    H22    G  46           H22        G  46  16.984  -5.920  57.867
  491    H5'    C  47           H5'        C  47  23.332  -7.395  61.259
  492   H5''    C  47          H5''        C  47  22.815  -8.256  62.721
  493    H4'    C  47           H4'        C  47  21.665  -5.952  62.039
  494    H3'    C  47           H3'        C  47  20.552  -8.518  63.160
  495    H2'    C  47          H2''        C  47  18.342  -7.819  62.985
  496   HO2'    C  47          H2'         C  47  19.336  -5.163  62.705
  497    H1'    C  47           H1'        C  47  18.527  -6.351  60.632
  498    H41    C  47           H41        C  47  15.890 -11.979  59.204
  499    H42    C  47           H42        C  47  17.437 -12.776  59.366
  500    H5     C  47           H5         C  47  19.469 -11.604  59.927
  501    H6     C  47           H6         C  47  20.421  -9.458  60.606
  502    H5'    C  48           H5'        C  48  18.369  -5.418  65.056
  503   H5''    C  48          H5''        C  48  18.671  -5.533  66.801
  504    H4'    C  48           H4'        C  48  16.291  -5.280  66.552
  505    H3'    C  48           H3'        C  48  17.372  -8.022  67.138
  506   HO3'    C  48          H3T         C  48  16.733  -7.500  69.138
  507    H2'    C  48          H2''        C  48  15.340  -9.081  66.941
  508   HO2'    C  48          H2'         C  48  13.384  -8.071  67.254
  509    H1'    C  48           H1'        C  48  14.178  -7.448  64.983
  510    H41    C  48           H41        C  48  15.741 -12.888  62.076
  511    H42    C  48           H42        C  48  17.445 -12.515  62.213
  512    H5     C  48           H5         C  48  18.281 -10.674  63.525
  513    H6     C  48           H6         C  48  17.669  -8.683  64.809
  Start of MODEL    4
    1    H5'    G   1           H5'        G   1   7.412 -18.704  58.995
    2   H5''    G   1          H5''        G   1   6.683 -18.086  57.499
    3    H4'    G   1           H4'        G   1   5.474 -17.077  59.337
    4    H3'    G   1           H3'        G   1   7.382 -15.464  57.695
    5    H2'    G   1          H2''        G   1   7.460 -13.626  59.091
    6   HO2'    G   1          H2'         G   1   5.196 -13.353  59.195
    7    H1'    G   1           H1'        G   1   7.148 -14.810  61.567
    8    H8     G   1           H8         G   1   9.668 -16.729  59.451
    9    H1     G   1           H1         G   1  12.084 -11.463  62.189
   10    H21    G   1           H21        G   1  10.468 -10.253  63.076
   11    H22    G   1           H22        G   1   8.784 -10.715  62.974
   12   HO5'    G   1          H5T         G   1   8.520 -17.253  56.997
   13    H5'    G   2           H5'        G   2   4.113 -12.352  57.435
   14   H5''    G   2          H5''        G   2   4.597 -11.563  55.921
   15    H4'    G   2           H4'        G   2   4.898 -10.304  58.243
   16    H3'    G   2           H3'        G   2   6.596 -10.448  55.770
   17    H2'    G   2          H2''        G   2   8.441  -9.498  56.752
   18   HO2'    G   2          H2'         G   2   6.571  -8.142  58.400
   19    H1'    G   2           H1'        G   2   7.833 -10.014  59.497
   20    H8     G   2           H8         G   2   8.469 -13.202  57.575
   21    H1     G   2           H1         G   2  13.833 -10.029  59.089
   22    H21    G   2           H21        G   2  13.337  -8.037  59.897
   23    H22    G   2           H22        G   2  11.703  -7.413  59.904
   24    H5'    C   3           H5'        C   3   5.726  -6.222  57.555
   25   H5''    C   3          H5''        C   3   5.656  -5.039  56.234
   26    H4'    C   3           H4'        C   3   7.029  -4.278  58.224
   27    H3'    C   3           H3'        C   3   7.905  -4.491  55.376
   28    H2'    C   3          H2''        C   3  10.159  -4.305  55.766
   29   HO2'    C   3          H2'         C   3   9.514  -2.289  57.111
   30    H1'    C   3           H1'        C   3  10.353  -5.220  58.409
   31    H41    C   3           H41        C   3  13.209  -9.551  54.704
   32    H42    C   3           H42        C   3  11.675 -10.011  54.003
   33    H5     C   3           H5         C   3   9.581  -9.030  54.667
   34    H6     C   3           H6         C   3   8.520  -7.272  55.997
   35    H5'    U   4           H5'        U   4   9.676  -0.061  56.359
   36   H5''    U   4          H5''        U   4   9.527   0.504  54.684
   37    H4'    U   4           H4'        U   4  11.913   0.419  55.812
   38    H3'    U   4           H3'        U   4  10.946  -0.332  53.072
   39    H2'    U   4          H2''        U   4  12.835  -1.474  52.467
   40   HO2'    U   4          H2'         U   4  14.711  -0.568  52.702
   41    H1'    U   4           H1'        U   4  13.881  -2.137  55.015
   42    H3     U   4           H3         U   4  14.002  -6.022  52.726
   43    H5     U   4           H5         U   4   9.883  -5.246  53.161
   44    H6     U   4           H6         U   4  10.459  -3.095  54.123
   45    H5'    C   5           H5'        C   5  15.009   2.315  52.705
   46   H5''    C   5          H5''        C   5  14.764   3.050  51.108
   47    H4'    C   5           H4'        C   5  17.007   1.882  51.409
   48    H3'    C   5           H3'        C   5  14.950   1.289  49.285
   49    H2'    C   5          H2''        C   5  16.135  -0.509  48.425
   50   HO2'    C   5          H2'         C   5  18.093   0.473  48.076
   51    H1'    C   5           H1'        C   5  17.375  -1.409  50.766
   52    H41    C   5           H41        C   5  12.835  -5.671  49.471
   53    H42    C   5           H42        C   5  11.582  -4.475  49.707
   54    H5     C   5           H5         C   5  12.038  -2.201  50.340
   55    H6     C   5           H6         C   5  13.794  -0.542  50.751
   56    H5'    G   6           H5'        G   6  18.204   2.688  46.315
   57   H5''    G   6          H5''        G   6  17.200   2.959  44.878
   58    H4'    G   6           H4'        G   6  18.842   0.856  45.023
   59    H3'    G   6           H3'        G   6  16.079   1.225  43.876
   60    H2'    G   6          H2''        G   6  15.707  -1.022  43.597
   61   HO2'    G   6          H2'         G   6  17.473  -1.279  42.182
   62    H1'    G   6           H1'        G   6  17.642  -2.041  45.445
   63    H8     G   6           H8         G   6  14.769  -0.134  47.044
   64    H1     G   6           H1         G   6  13.362  -6.204  45.519
   65    H21    G   6           H21        G   6  14.977  -7.070  44.293
   66    H22    G   6           H22        G   6  16.304  -6.106  43.684
   67    H5'    A   7           H5'        A   7  19.169  -0.409  40.201
   68   H5''    A   7          H5''        A   7  18.034  -0.387  38.837
   69    H4'    A   7           H4'        A   7  19.290  -2.642  39.543
   70    H3'    A   7           H3'        A   7  16.528  -2.054  38.515
   71    H2'    A   7          H2''        A   7  15.699  -4.191  38.932
   72   HO2'    A   7          H2'         A   7  18.384  -5.098  39.207
   73    H1'    A   7           H1'        A   7  17.046  -4.784  41.267
   74    H8     A   7           H8         A   7  15.775  -1.239  41.504
   75    H61    A   7           H61        A   7  10.228  -3.572  42.867
   76    H62    A   7           H62        A   7  11.248  -2.153  42.931
   77    H2     A   7           H2         A   7  12.861  -6.952  41.529
   78    H5'    U   8           H5'        U   8  17.376  -5.024  35.313
   79   H5''    U   8          H5''        U   8  16.254  -4.512  34.036
   80    H4'    U   8           H4'        U   8  15.733  -6.675  35.499
   81    H3'    U   8           H3'        U   8  14.001  -4.474  34.409
   82    H2'    U   8          H2''        U   8  12.150  -5.042  35.653
   83   HO2'    U   8          H2'         U   8  11.776  -7.072  34.984
   84    H1'    U   8           H1'        U   8  13.412  -6.413  37.801
   85    H3     U   8           H3         U   8  10.322  -3.414  39.401
   86    H5     U   8           H5         U   8  13.849  -1.214  38.717
   87    H6     U   8           H6         U   8  14.742  -3.136  37.538
   88    H5'    U   9           H5'        U   9  11.676  -7.637  31.952
   89   H5''    U   9          H5''        U   9  11.416  -6.624  30.518
   90    H4'    U   9           H4'        U   9   9.311  -7.266  31.863
   91    H3'    U   9           H3'        U   9  10.225  -4.545  30.970
   92    H2'    U   9          H2''        U   9   8.705  -3.391  32.238
   93   HO2'    U   9          H2'         U   9   6.634  -4.031  32.488
   94    H1'    U   9           H1'        U   9   8.091  -5.393  34.186
   95    H3     U   9           H3         U   9   8.605  -1.629  36.616
   96    H5     U   9           H5         U   9  12.453  -2.334  35.053
   97    H6     U   9           H6         U   9  11.517  -4.146  33.736
   98    H5'    G  10           H5'        G  10   5.641  -5.499  29.360
   99   H5''    G  10          H5''        G  10   5.556  -4.392  27.976
  100    H4'    G  10           H4'        G  10   3.627  -4.350  29.772
  101    H3'    G  10           H3'        G  10   5.097  -2.147  28.357
  102    H2'    G  10          H2''        G  10   4.281  -0.458  29.684
  103   HO2'    G  10          H2'         G  10   2.206  -0.381  29.892
  104    H1'    G  10           H1'        G  10   3.766  -1.868  32.061
  105    H8     G  10           H8         G  10   7.361  -2.343  31.234
  106    H1     G  10           H1         G  10   6.094   3.651  33.136
  107    H21    G  10           H21        G  10   3.915   3.979  33.204
  108    H22    G  10           H22        G  10   2.773   2.791  32.617
  109    H5'    U  11           H5'        U  11   0.423  -0.908  27.845
  110   H5''    U  11          H5''        U  11   0.623   0.159  26.442
  111    H4'    U  11           H4'        U  11  -0.361   1.107  28.729
  112    H3'    U  11           H3'        U  11   1.591   2.276  26.745
  113    H2'    U  11          H2''        U  11   1.976   4.162  28.059
  114   HO2'    U  11          H2'         U  11  -0.346   3.530  29.577
  115    H1'    U  11           H1'        U  11   1.743   2.969  30.581
  116    H3     U  11           H3         U  11   5.909   4.835  30.084
  117    H5     U  11           H5         U  11   6.128   1.039  28.274
  118    H6     U  11           H6         U  11   3.718   0.875  28.475
  119    H5'    A  12           H5'        A  12  -1.251   5.568  25.354
  120   H5''    A  12          H5''        A  12  -0.320   5.846  23.869
  121    H4'    A  12           H4'        A  12  -0.127   7.512  25.961
  122    H3'    A  12           H3'        A  12   1.981   6.450  24.055
  123    H2'    A  12          H2''        A  12   3.639   7.693  25.145
  124   HO2'    A  12          H2'         A  12   1.493   9.153  26.316
  125    H1'    A  12           H1'        A  12   2.684   7.358  27.736
  126    H8     A  12           H8         A  12   2.698   3.937  26.194
  127    H61    A  12           H61        A  12   8.868   4.030  26.458
  128    H62    A  12           H62        A  12   7.452   3.028  26.235
  129    H2     A  12           H2         A  12   7.370   8.108  27.567
  130    H5'    U  13           H5'        U  13   2.672  10.470  24.697
  131   H5''    U  13          H5''        U  13   3.186  11.321  23.229
  132    H4'    U  13           H4'        U  13   4.797  11.462  25.219
  133    H3'    U  13           H3'        U  13   5.430  10.512  22.425
  134    H2'    U  13          H2''        U  13   7.593   9.933  22.967
  135   HO2'    U  13          H2'         U  13   8.821  11.063  24.325
  136    H1'    U  13           H1'        U  13   7.232   9.408  25.731
  137    H3     U  13           H3         U  13   9.506   5.972  23.702
  138    H5     U  13           H5         U  13   5.461   5.416  22.656
  139    H6     U  13           H6         U  13   4.973   7.572  23.624
  140    H5'    U  14           H5'        U  14   8.510  13.199  24.048
  141   H5''    U  14          H5''        U  14   8.598  14.589  22.948
  142    H4'    U  14           H4'        U  14  10.871  14.022  23.566
  143    H3'    U  14           H3'        U  14   9.833  13.423  20.823
  144    H2'    U  14          H2''        U  14  11.551  12.049  20.193
  145   HO2'    U  14          H2'         U  14  13.577  12.570  20.542
  146    H1'    U  14           H1'        U  14  12.512  11.183  22.690
  147    H3     U  14           H3         U  14  11.937   7.352  20.368
  148    H5     U  14           H5         U  14   8.017   8.820  20.847
  149    H6     U  14           H6         U  14   8.958  10.827  21.834
  150    H5'    U  15           H5'        U  15  14.164  15.672  20.228
  151   H5''    U  15          H5''        U  15  14.061  16.043  18.496
  152    H4'    U  15           H4'        U  15  16.017  14.492  19.433
  153    H3'    U  15           H3'        U  15  14.344  14.373  16.931
  154    H2'    U  15          H2''        U  15  15.054  12.273  16.346
  155   HO2'    U  15          H2'         U  15  17.106  11.819  16.304
  156    H1'    U  15           H1'        U  15  15.905  11.337  18.910
  157    H3     U  15           H3         U  15  13.543   7.964  16.972
  158    H5     U  15           H5         U  15  10.642  10.822  18.056
  159    H6     U  15           H6         U  15  12.446  12.351  18.597
  160    H5'    U  16           H5'        U  16  18.762  13.615  15.709
  161   H5''    U  16          H5''        U  16  18.911  14.578  14.225
  162    H4'    U  16           H4'        U  16  19.739  12.289  13.830
  163    H3'    U  16           H3'        U  16  17.227  13.323  12.529
  164    H2'    U  16          H2''        U  16  16.621  11.287  11.667
  165   HO2'    U  16          H2'         U  16  19.396  10.926  11.478
  166    H1'    U  16           H1'        U  16  18.064   9.578  13.438
  167    H3     U  16           H3         U  16  13.993   7.658  13.338
  168    H5     U  16           H5         U  16  13.228  11.479  14.941
  169    H6     U  16           H6         U  16  15.556  12.041  14.540
  170    H5'    U  17           H5'        U  17  20.096  11.643   8.741
  171   H5''    U  17          H5''        U  17  19.080  12.351   7.472
  172    H4'    U  17           H4'        U  17  19.511   9.724   7.544
  173    H3'    U  17           H3'        U  17  17.032  11.337   6.935
  174    H2'    U  17          H2''        U  17  15.678   9.488   6.886
  175   HO2'    U  17          H2'         U  17  18.010   8.128   6.029
  176    H1'    U  17           H1'        U  17  17.301   7.721   8.456
  177    H3     U  17           H3         U  17  13.016   7.128   9.799
  178    H5     U  17           H5         U  17  13.992  11.002  11.145
  179    H6     U  17           H6         U  17  16.084  10.822   9.924
  180    H5'    A  18           H5'        A  18  18.291   8.410   3.016
  181   H5''    A  18          H5''        A  18  17.027   8.873   1.862
  182    H4'    A  18           H4'        A  18  17.372   6.319   2.564
  183    H3'    A  18           H3'        A  18  14.855   7.935   2.086
  184    H2'    A  18          H2''        A  18  13.503   6.131   2.665
  185   HO2'    A  18          H2'         A  18  13.993   4.274   1.841
  186    H1'    A  18           H1'        A  18  15.182   4.950   4.574
  187    H8     A  18           H8         A  18  14.782   8.464   5.669
  188    H61    A  18           H61        A  18   9.071   7.047   7.559
  189    H62    A  18           H62        A  18  10.328   8.263   7.563
  190    H2     A  18           H2         A  18  10.553   3.696   4.976
  191    H5'    A  19           H5'        A  19  14.812   4.689  -1.113
  192   H5''    A  19          H5''        A  19  13.503   5.010  -2.266
  193    H4'    A  19           H4'        A  19  13.337   3.003  -0.493
  194    H3'    A  19           H3'        A  19  11.275   4.944  -1.558
  195    H2'    A  19          H2''        A  19   9.636   4.153  -0.119
  196   HO2'    A  19          H2'         A  19   9.458   2.093   0.452
  197    H1'    A  19           H1'        A  19  11.322   3.334   2.013
  198    H8     A  19           H8         A  19  12.103   6.881   1.746
  199    H61    A  19           H61        A  19   6.652   8.140   4.352
  200    H62    A  19           H62        A  19   8.176   8.806   3.810
  201    H2     A  19           H2         A  19   6.562   3.884   2.909
  202    H5'    A  20           H5'        A  20   9.043   1.585  -4.027
  203   H5''    A  20          H5''        A  20   8.396   2.807  -5.140
  204    H4'    A  20           H4'        A  20   6.793   1.553  -3.417
  205    H3'    A  20           H3'        A  20   6.914   4.404  -4.388
  206    H2'    A  20          H2''        A  20   5.371   5.164  -2.840
  207   HO2'    A  20          H2'         A  20   3.633   3.935  -3.250
  208    H1'    A  20           H1'        A  20   5.758   3.261  -0.805
  209    H8     A  20           H8         A  20   8.890   5.227  -1.780
  210    H61    A  20           H61        A  20   6.758   9.788   1.798
  211    H62    A  20           H62        A  20   8.149   9.158   0.942
  212    H2     A  20           H2         A  20   3.581   6.633   1.537
  213    H5'    U  21           H5'        U  21   2.565   3.720  -5.215
  214   H5''    U  21          H5''        U  21   2.243   4.859  -6.537
  215    H4'    U  21           H4'        U  21   1.094   5.402  -4.309
  216    H3'    U  21           H3'        U  21   2.937   7.210  -5.877
  217    H2'    U  21          H2''        U  21   2.805   8.908  -4.292
  218   HO2'    U  21          H2'         U  21   0.487   7.595  -3.287
  219    H1'    U  21           H1'        U  21   2.644   7.324  -2.002
  220    H3     U  21           H3         U  21   6.480   9.653  -1.455
  221    H5     U  21           H5         U  21   7.256   7.275  -4.847
  222    H6     U  21           H6         U  21   5.003   6.399  -4.665
  223    H5'    U  22           H5'        U  22  -0.952   9.052  -4.777
  224   H5''    U  22          H5''        U  22  -1.622   9.999  -6.120
  225    H4'    U  22           H4'        U  22  -1.710  11.195  -3.886
  226    H3'    U  22           H3'        U  22  -0.220  12.164  -6.331
  227    H2'    U  22          H2''        U  22   0.850  13.844  -5.228
  228   HO2'    U  22          H2'         U  22  -0.186  15.198  -3.892
  229    H1'    U  22           H1'        U  22   0.342  12.914  -2.527
  230    H3     U  22           H3         U  22   4.461  15.062  -3.274
  231    H5     U  22           H5         U  22   4.992  10.893  -3.413
  232    H6     U  22           H6         U  22   2.577  10.664  -3.679
  233    H5'    A  23           H5'        A  23  -0.321  15.650  -7.834
  234   H5''    A  23          H5''        A  23   0.471  15.453  -6.259
  235    H4'    A  23           H4'        A  23   0.287  17.860  -7.377
  236    H3'    A  23           H3'        A  23   0.295  16.828  -4.619
  237    H2'    A  23          H2''        A  23  -0.994  18.409  -3.588
  238   HO2'    A  23          H2'         A  23   0.405  20.093  -3.876
  239    H1'    A  23           H1'        A  23  -2.342  19.637  -5.739
  240    H8     A  23           H8         A  23  -3.393  16.100  -5.859
  241    H61    A  23           H61        A  23  -7.013  17.145  -0.964
  242    H62    A  23           H62        A  23  -6.553  15.989  -2.196
  243    H2     A  23           H2         A  23  -4.144  20.570  -1.315
  244    H5'    A  24           H5'        A  24   3.943  19.033  -2.972
  245   H5''    A  24          H5''        A  24   3.813  17.854  -1.654
  246    H4'    A  24           H4'        A  24   2.365  20.320  -1.987
  247    H3'    A  24           H3'        A  24   2.704  18.063  -0.027
  248    H2'    A  24          H2''        A  24   0.581  18.124   0.791
  249   HO2'    A  24          H2'         A  24   0.750  20.948   0.462
  250    H1'    A  24           H1'        A  24  -0.628  19.856  -1.199
  251    H8     A  24           H8         A  24  -0.082  16.469  -2.556
  252    H61    A  24           H61        A  24  -5.349  14.787   0.213
  253    H62    A  24           H62        A  24  -4.099  14.300  -0.909
  254    H2     A  24           H2         A  24  -4.023  18.714   1.936
  255    H5'    U  25           H5'        U  25   0.959  19.812   3.633
  256   H5''    U  25          H5''        U  25   2.202  18.912   4.524
  257    H4'    U  25           H4'        U  25  -0.377  17.928   3.365
  258    H3'    U  25           H3'        U  25   0.735  18.264   5.900
  259    H2'    U  25          H2''        U  25   2.391  16.671   5.891
  260   HO2'    U  25          H2'         U  25   1.635  14.665   6.619
  261    H1'    U  25           H1'        U  25   1.048  14.729   4.081
  262    H3     U  25           H3         U  25   5.278  13.018   4.444
  263    H5     U  25           H5         U  25   5.841  16.855   2.789
  264    H6     U  25           H6         U  25   3.454  17.246   3.052
  265    H5'    U  26           H5'        U  26  -0.803  16.292   1.718
  266   H5''    U  26          H5''        U  26  -2.537  16.270   2.067
  267    H4'    U  26           H4'        U  26  -2.773  14.211   1.177
  268    H3'    U  26           H3'        U  26  -0.526  13.602   3.071
  269    H2'    U  26          H2''        U  26   0.144  11.734   1.856
  270   HO2'    U  26          H2'         U  26  -1.281  10.404   1.077
  271    H1'    U  26           H1'        U  26  -0.570  12.621  -0.728
  272    H3     U  26           H3         U  26   3.882  11.802  -0.972
  273    H5     U  26           H5         U  26   3.591  15.052   1.668
  274    H6     U  26           H6         U  26   1.191  14.938   1.485
  275    H5'    C  27           H5'        C  27  -3.829  10.297   3.962
  276   H5''    C  27          H5''        C  27  -3.298   9.438   5.420
  277    H4'    C  27           H4'        C  27  -3.304   8.111   3.173
  278    H3'    C  27           H3'        C  27  -1.003   8.470   5.115
  279    H2'    C  27          H2''        C  27   0.385   7.085   3.841
  280   HO2'    C  27          H2'         C  27  -0.393   5.338   2.993
  281    H1'    C  27           H1'        C  27  -0.627   7.856   1.326
  282    H41    C  27           H41        C  27   5.017  10.749   1.863
  283    H42    C  27           H42        C  27   4.428  11.746   3.173
  284    H5     C  27           H5         C  27   2.289  11.396   4.228
  285    H6     C  27           H6         C  27   0.157  10.195   4.095
  286    H5'    U  28           H5'        U  28  -2.160   4.044   5.872
  287   H5''    U  28          H5''        U  28  -1.369   3.530   7.375
  288    H4'    U  28           H4'        U  28  -0.496   2.575   5.073
  289    H3'    U  28           H3'        U  28   1.033   3.752   7.413
  290    H2'    U  28          H2''        U  28   3.068   3.573   6.338
  291   HO2'    U  28          H2'         U  28   3.584   1.843   5.253
  292    H1'    U  28           H1'        U  28   2.120   3.758   3.671
  293    H3     U  28           H3         U  28   5.507   6.764   4.164
  294    H5     U  28           H5         U  28   2.223   8.511   6.136
  295    H6     U  28           H6         U  28   1.021   6.428   5.839
  296    H5'    U  29           H5'        U  29   2.677  -0.716   6.380
  297   H5''    U  29          H5''        U  29   3.672  -1.090   7.800
  298    H4'    U  29           H4'        U  29   4.746  -1.097   5.361
  299    H3'    U  29           H3'        U  29   5.777  -0.128   8.024
  300    H2'    U  29          H2''        U  29   7.675   0.828   7.107
  301   HO2'    U  29          H2'         U  29   7.273  -0.903   4.886
  302    H1'    U  29           H1'        U  29   6.674   1.515   4.578
  303    H3     U  29           H3         U  29   8.439   5.232   6.566
  304    H5     U  29           H5         U  29   4.799   4.584   8.582
  305    H6     U  29           H6         U  29   4.534   2.534   7.315
  306    H5'    A  30           H5'        A  30   9.059  -2.145   5.954
  307   H5''    A  30          H5''        A  30   9.949  -3.114   7.143
  308    H4'    A  30           H4'        A  30  11.429  -1.542   5.855
  309    H3'    A  30           H3'        A  30  11.030  -1.427   8.845
  310    H2'    A  30          H2''        A  30  12.265   0.494   9.069
  311   HO2'    A  30          H2'         A  30  13.828  -0.769   7.253
  312    H1'    A  30           H1'        A  30  12.032   1.472   6.387
  313    H8     A  30           H8         A  30   8.824   1.317   8.468
  314    H61    A  30           H61        A  30  10.480   6.827  10.729
  315    H62    A  30           H62        A  30   9.165   5.690  10.536
  316    H2     A  30           H2         A  30  13.894   5.237   8.291
  317    H5'    A  31           H5'        A  31  15.954  -1.806   8.195
  318   H5''    A  31          H5''        A  31  16.264  -2.395   9.839
  319    H4'    A  31           H4'        A  31  17.499  -0.230   9.025
  320    H3'    A  31           H3'        A  31  16.050  -0.770  11.620
  321    H2'    A  31          H2''        A  31  16.272   1.399  12.343
  322   HO2'    A  31          H2'         A  31  18.560   1.597  10.658
  323    H1'    A  31           H1'        A  31  16.609   2.667   9.797
  324    H8     A  31           H8         A  31  13.258   0.952  10.522
  325    H61    A  31           H61        A  31  11.597   6.231  13.271
  326    H62    A  31           H62        A  31  11.033   4.700  12.641
  327    H2     A  31           H2         A  31  15.905   6.576  12.077
  328    H5'    A  32           H5'        A  32  20.301   0.997  12.414
  329   H5''    A  32          H5''        A  32  20.826   0.161  13.888
  330    H4'    A  32           H4'        A  32  21.149   2.618  14.078
  331    H3'    A  32           H3'        A  32  19.158   1.126  15.797
  332    H2'    A  32          H2''        A  32  18.414   3.066  16.805
  333   HO2'    A  32          H2'         A  32  21.021   3.988  16.254
  334    H1'    A  32           H1'        A  32  19.041   4.891  14.715
  335    H8     A  32           H8         A  32  16.584   1.963  14.126
  336    H61    A  32           H61        A  32  12.182   5.857  16.043
  337    H62    A  32           H62        A  32  12.505   4.337  15.240
  338    H2     A  32           H2         A  32  16.147   7.893  16.528
  339    H5'    A  33           H5'        A  33  22.101   3.532  18.768
  340   H5''    A  33          H5''        A  33  21.681   2.771  20.314
  341    H4'    A  33           H4'        A  33  21.297   5.382  19.937
  342    H3'    A  33           H3'        A  33  19.622   3.288  21.332
  343    H2'    A  33          H2''        A  33  17.868   4.743  21.660
  344   HO2'    A  33          H2'         A  33  19.915   6.670  21.791
  345    H1'    A  33           H1'        A  33  18.457   6.588  19.550
  346    H8     A  33           H8         A  33  17.532   3.032  18.498
  347    H61    A  33           H61        A  33  11.631   4.816  19.000
  348    H62    A  33           H62        A  33  12.716   3.606  18.353
  349    H2     A  33           H2         A  33  14.225   8.103  20.612
  350    H5'    A  34           H5'        A  34  20.365   7.036  24.024
  351   H5''    A  34          H5''        A  34  20.196   6.476  25.698
  352    H4'    A  34           H4'        A  34  18.742   8.501  24.938
  353    H3'    A  34           H3'        A  34  17.934   6.008  26.426
  354    H2'    A  34          H2''        A  34  15.680   6.463  26.281
  355   HO2'    A  34          H2'         A  34  15.919   8.453  27.421
  356    H1'    A  34           H1'        A  34  15.738   8.256  24.047
  357    H8     A  34           H8         A  34  16.707   4.715  23.145
  358    H61    A  34           H61        A  34  10.637   3.617  22.618
  359    H62    A  34           H62        A  34  12.243   3.037  22.237
  360    H2     A  34           H2         A  34  11.188   7.617  24.590
  361    H5'    C  35           H5'        C  35  17.214   6.186  30.451
  362   H5''    C  35          H5''        C  35  17.408   4.473  30.031
  363    H4'    C  35           H4'        C  35  15.217   6.372  29.308
  364    H3'    C  35           H3'        C  35  15.554   3.927  30.657
  365    H2'    C  35          H2''        C  35  15.710   2.510  28.889
  366   HO2'    C  35          H2'         C  35  12.943   3.153  28.784
  367    H1'    C  35           H1'        C  35  14.021   4.174  27.058
  368    H41    C  35           H41        C  35  17.016   0.459  22.845
  369    H42    C  35           H42        C  35  18.565   0.767  23.598
  370    H5     C  35           H5         C  35  18.824   2.106  25.584
  371    H6     C  35           H6         C  35  17.658   3.447  27.271
  372    H5'    U  36           H5'        U  36  15.891   7.611  30.841
  373   H5''    U  36          H5''        U  36  14.876   8.028  32.237
  374    H4'    U  36           H4'        U  36  15.581  10.065  30.958
  375    H3'    U  36           H3'        U  36  12.799   9.109  31.433
  376    H2'    U  36          H2''        U  36  11.741  10.459  29.877
  377   HO2'    U  36          H2'         U  36  12.367  12.453  29.446
  378    H1'    U  36           H1'        U  36  13.637  10.604  27.895
  379    H3     U  36           H3         U  36   9.505   8.085  27.519
  380    H5     U  36           H5         U  36  12.868   5.580  27.234
  381    H6     U  36           H6         U  36  14.230   7.394  28.055
  382    H5'    A  37           H5'        A  37  11.231  12.859  34.200
  383   H5''    A  37          H5''        A  37  10.767  11.507  35.251
  384    H4'    A  37           H4'        A  37   8.909  13.062  34.130
  385    H3'    A  37           H3'        A  37   9.042  10.086  34.622
  386    H2'    A  37          H2''        A  37   7.033   9.675  33.504
  387   HO2'    A  37          H2'         A  37   5.482  11.162  33.200
  388    H1'    A  37           H1'        A  37   7.409  11.366  31.376
  389    H8     A  37           H8         A  37  10.792  10.023  31.613
  390    H61    A  37           H61        A  37   8.708   4.555  29.641
  391    H62    A  37           H62        A  37  10.107   5.594  29.782
  392    H2     A  37           H2         A  37   5.171   7.021  30.877
  393    H5'    C  38           H5'        C  38   5.520  11.638  36.497
  394   H5''    C  38          H5''        C  38   5.068  11.023  38.100
  395    H4'    C  38           H4'        C  38   3.215  10.691  36.501
  396    H3'    C  38           H3'        C  38   4.764   8.382  37.668
  397    H2'    C  38          H2''        C  38   3.636   6.791  36.396
  398   HO2'    C  38          H2'         C  38   1.587   6.978  35.823
  399    H1'    C  38           H1'        C  38   3.237   8.261  34.074
  400    H41    C  38           H41        C  38   8.023   4.187  32.962
  401    H42    C  38           H42        C  38   9.132   5.236  33.817
  402    H5     C  38           H5         C  38   8.460   7.298  34.839
  403    H6     C  38           H6         C  38   6.560   8.662  35.527
  404    H5'    A  39           H5'        A  39   0.988   7.330  40.460
  405   H5''    A  39          H5''        A  39   1.948   6.265  41.504
  406    H4'    A  39           H4'        A  39   0.147   5.278  39.768
  407    H3'    A  39           H3'        A  39   2.882   4.307  40.644
  408    H2'    A  39          H2''        A  39   2.832   2.523  39.100
  409   HO2'    A  39          H2'         A  39   0.022   2.962  39.025
  410    H1'    A  39           H1'        A  39   1.507   3.781  37.050
  411    H8     A  39           H8         A  39   4.240   6.070  38.285
  412    H61    A  39           H61        A  39   8.293   2.456  35.337
  413    H62    A  39           H62        A  39   8.021   4.037  36.035
  414    H2     A  39           H2         A  39   4.336   0.352  35.378
  415    H5'    A  40           H5'        A  40  -0.317   1.359  40.871
  416   H5''    A  40          H5''        A  40  -0.356   0.402  42.366
  417    H4'    A  40           H4'        A  40  -0.694  -1.092  40.450
  418    H3'    A  40           H3'        A  40   1.804  -1.134  42.108
  419    H2'    A  40          H2''        A  40   3.020  -2.488  40.704
  420   HO2'    A  40          H2'         A  40   1.603  -4.214  40.643
  421    H1'    A  40           H1'        A  40   1.871  -1.884  38.243
  422    H8     A  40           H8         A  40   3.096   1.042  40.449
  423    H61    A  40           H61        A  40   8.634   0.132  37.864
  424    H62    A  40           H62        A  40   7.658   1.219  38.825
  425    H2     A  40           H2         A  40   5.884  -3.114  36.443
  426    H5'    A  41           H5'        A  41   0.209  -5.736  42.445
  427   H5''    A  41          H5''        A  41   1.245  -6.355  43.745
  428    H4'    A  41           H4'        A  41   1.394  -7.358  41.265
  429    H3'    A  41           H3'        A  41   3.437  -6.820  43.405
  430    H2'    A  41          H2''        A  41   5.261  -7.100  42.025
  431   HO2'    A  41          H2'         A  41   5.088  -9.055  41.190
  432    H1'    A  41           H1'        A  41   4.128  -6.391  39.540
  433    H8     A  41           H8         A  41   3.706  -3.632  42.085
  434    H61    A  41           H61        A  41   9.494  -1.932  40.753
  435    H62    A  41           H62        A  41   7.978  -1.436  41.471
  436    H2     A  41           H2         A  41   8.735  -5.905  38.815
  437    H5'    U  42           H5'        U  42   4.699 -11.522  42.295
  438   H5''    U  42          H5''        U  42   5.343 -11.766  43.930
  439    H4'    U  42           H4'        U  42   6.926 -12.036  41.805
  440    H3'    U  42           H3'        U  42   7.330 -10.928  44.559
  441    H2'    U  42          H2''        U  42   9.268  -9.793  44.092
  442   HO2'    U  42          H2'         U  42  10.346 -11.728  43.477
  443    H1'    U  42           H1'        U  42   9.062  -9.551  41.267
  444    H3     U  42           H3         U  42  10.224  -5.411  42.665
  445    H5     U  42           H5         U  42   6.262  -5.882  44.018
  446    H6     U  42           H6         U  42   6.367  -8.201  43.307
  447    H5'    C  43           H5'        C  43  10.481 -13.920  42.852
  448   H5''    C  43          H5''        C  43  11.239 -14.852  44.157
  449    H4'    C  43           H4'        C  43  12.907 -14.034  42.475
  450    H3'    C  43           H3'        C  43  12.881 -13.299  45.385
  451    H2'    C  43          H2''        C  43  14.526 -11.680  45.215
  452   HO2'    C  43          H2'         C  43  16.198 -11.831  43.885
  453    H1'    C  43           H1'        C  43  14.070 -10.754  42.635
  454    H41    C  43           H41        C  43  11.716  -6.264  46.492
  455    H42    C  43           H42        C  43  10.549  -7.382  47.159
  456    H5     C  43           H5         C  43  10.366  -9.672  46.449
  457    H6     C  43           H6         C  43  11.287 -11.402  44.984
  458    H5'    G  44           H5'        G  44  17.166 -14.988  45.471
  459   H5''    G  44          H5''        G  44  17.326 -15.259  47.217
  460    H4'    G  44           H4'        G  44  18.643 -13.268  46.023
  461    H3'    G  44           H3'        G  44  17.250 -13.488  48.686
  462    H2'    G  44          H2''        G  44  17.328 -11.240  49.110
  463   HO2'    G  44          H2'         G  44  19.695 -11.235  47.537
  464    H1'    G  44           H1'        G  44  17.697 -10.279  46.439
  465    H8     G  44           H8         G  44  14.326 -11.909  47.134
  466    H1     G  44           H1         G  44  14.781  -5.833  49.143
  467    H21    G  44           H21        G  44  16.885  -5.184  49.115
  468    H22    G  44           H22        G  44  18.156  -6.168  48.426
  469    H5'    A  45           H5'        A  45  21.948 -11.802  49.164
  470   H5''    A  45          H5''        A  45  22.212 -12.300  50.846
  471    H4'    A  45           H4'        A  45  22.848  -9.876  50.278
  472    H3'    A  45           H3'        A  45  21.099 -10.890  52.498
  473    H2'    A  45          H2''        A  45  20.309  -8.812  53.127
  474   HO2'    A  45          H2'         A  45  22.232  -7.786  53.487
  475    H1'    A  45           H1'        A  45  20.402  -7.451  50.696
  476    H8     A  45           H8         A  45  18.635 -10.825  50.502
  477    H61    A  45           H61        A  45  13.536  -7.844  52.293
  478    H62    A  45           H62        A  45  14.165  -9.291  51.539
  479    H2     A  45           H2         A  45  17.008  -5.036  52.723
  480    H5'    G  46           H5'        G  46  24.149  -9.131  55.434
  481   H5''    G  46          H5''        G  46  23.720 -10.086  56.867
  482    H4'    G  46           H4'        G  46  22.978  -7.529  56.656
  483    H3'    G  46           H3'        G  46  21.619  -9.976  57.766
  484    H2'    G  46          H2''        G  46  19.558  -8.982  57.937
  485   HO2'    G  46          H2'         G  46  19.283  -6.941  58.626
  486    H1'    G  46           H1'        G  46  19.914  -6.850  56.066
  487    H8     G  46           H8         G  46  19.971 -10.308  54.495
  488    H1     G  46           H1         G  46  14.073  -8.116  55.732
  489    H21    G  46           H21        G  46  14.185  -6.276  56.942
  490    H22    G  46           H22        G  46  15.691  -5.688  57.609
  491    H5'    C  47           H5'        C  47  21.646  -6.183  60.703
  492   H5''    C  47          H5''        C  47  21.504  -6.852  62.340
  493    H4'    C  47           H4'        C  47  19.886  -4.948  61.812
  494    H3'    C  47           H3'        C  47  19.159  -7.721  62.741
  495    H2'    C  47          H2''        C  47  16.871  -7.332  62.600
  496   HO2'    C  47          H2'         C  47  17.547  -4.570  62.634
  497    H1'    C  47           H1'        C  47  16.845  -5.691  60.355
  498    H41    C  47           H41        C  47  15.013 -11.497  58.471
  499    H42    C  47           H42        C  47  16.652 -12.088  58.605
  500    H5     C  47           H5         C  47  18.501 -10.696  59.278
  501    H6     C  47           H6         C  47  19.146  -8.504  60.149
  502    H5'    C  48           H5'        C  48  16.594  -5.136  64.769
  503   H5''    C  48          H5''        C  48  16.876  -5.271  66.516
  504    H4'    C  48           H4'        C  48  14.496  -5.360  66.254
  505    H3'    C  48           H3'        C  48  15.927  -7.976  66.650
  506   HO3'    C  48          H3T         C  48  15.144  -7.731  68.681
  507    H2'    C  48          H2''        C  48  14.037  -9.261  66.370
  508   HO2'    C  48          H2'         C  48  12.884  -7.555  67.832
  509    H1'    C  48           H1'        C  48  12.694  -7.644  64.511
  510    H41    C  48           H41        C  48  14.891 -12.636  61.238
  511    H42    C  48           H42        C  48  16.539 -12.087  61.434
  512    H5     C  48           H5         C  48  17.153 -10.260  62.883
  513    H6     C  48           H6         C  48  16.308  -8.454  64.301
  Start of MODEL    5
    1    H5'    G   1           H5'        G   1   7.336 -17.603  61.053
    2   H5''    G   1          H5''        G   1   6.728 -16.838  59.572
    3    H4'    G   1           H4'        G   1   5.651 -15.795  61.517
    4    H3'    G   1           H3'        G   1   7.580 -14.358  59.747
    5    H2'    G   1          H2''        G   1   7.931 -12.543  61.116
    6   HO2'    G   1          H2'         G   1   5.942 -11.767  61.446
    7    H1'    G   1           H1'        G   1   7.546 -13.657  63.632
    8    H8     G   1           H8         G   1   9.935 -15.830  61.673
    9    H1     G   1           H1         G   1  12.655 -10.477  63.918
   10    H21    G   1           H21        G   1  11.112  -9.105  64.692
   11    H22    G   1           H22        G   1   9.402  -9.460  64.588
   12   HO5'    G   1          H5T         G   1   8.650 -16.135  59.152
   13    H5'    G   2           H5'        G   2   4.501 -10.836  59.564
   14   H5''    G   2          H5''        G   2   4.968 -10.329  57.930
   15    H4'    G   2           H4'        G   2   5.449  -8.746  60.012
   16    H3'    G   2           H3'        G   2   7.021  -9.398  57.538
   17    H2'    G   2          H2''        G   2   8.978  -8.460  58.293
   18   HO2'    G   2          H2'         G   2   7.319  -6.734  59.824
   19    H1'    G   2           H1'        G   2   8.470  -8.494  61.104
   20    H8     G   2           H8         G   2   8.733 -11.949  59.545
   21    H1     G   2           H1         G   2  14.402  -9.225  60.780
   22    H21    G   2           H21        G   2  14.119  -7.123  61.389
   23    H22    G   2           H22        G   2  12.564  -6.326  61.302
   24    H5'    C   3           H5'        C   3   6.417  -4.923  58.660
   25   H5''    C   3          H5''        C   3   6.363  -3.923  57.195
   26    H4'    C   3           H4'        C   3   7.805  -2.940  59.016
   27    H3'    C   3           H3'        C   3   8.659  -3.652  56.241
   28    H2'    C   3          H2''        C   3  10.924  -3.503  56.608
   29   HO2'    C   3          H2'         C   3  11.623  -1.739  57.475
   30    H1'    C   3           H1'        C   3  11.080  -4.033  59.352
   31    H41    C   3           H41        C   3  13.632  -9.051  56.371
   32    H42    C   3           H42        C   3  12.088  -9.466  55.663
   33    H5     C   3           H5         C   3  10.067  -8.232  56.099
   34    H6     C   3           H6         C   3   9.121  -6.247  57.171
   35    H5'    U   4           H5'        U   4  10.680   0.572  56.618
   36   H5''    U   4          H5''        U   4  10.654   1.036  54.906
   37    H4'    U   4           H4'        U   4  12.976   0.755  56.100
   38    H3'    U   4           H3'        U   4  11.997  -0.158  53.412
   39    H2'    U   4          H2''        U   4  13.760  -1.559  53.000
   40   HO2'    U   4          H2'         U   4  15.831  -1.103  53.593
   41    H1'    U   4           H1'        U   4  14.661  -2.031  55.652
   42    H3     U   4           H3         U   4  14.509  -6.126  53.744
   43    H5     U   4           H5         U   4  10.463  -4.960  53.950
   44    H6     U   4           H6         U   4  11.200  -2.782  54.723
   45    H5'    C   5           H5'        C   5  16.304   2.005  53.113
   46   H5''    C   5          H5''        C   5  16.287   2.654  51.461
   47    H4'    C   5           H4'        C   5  18.370   1.326  52.024
   48    H3'    C   5           H3'        C   5  16.441   0.690  49.791
   49    H2'    C   5          H2''        C   5  17.583  -1.242  49.182
   50   HO2'    C   5          H2'         C   5  19.643  -0.229  49.077
   51    H1'    C   5           H1'        C   5  18.465  -2.054  51.691
   52    H41    C   5           H41        C   5  13.608  -5.870  50.143
   53    H42    C   5           H42        C   5  12.474  -4.547  50.284
   54    H5     C   5           H5         C   5  13.126  -2.320  50.911
   55    H6     C   5           H6         C   5  15.017  -0.841  51.400
   56    H5'    G   6           H5'        G   6  19.911   1.794  46.765
   57   H5''    G   6          H5''        G   6  18.851   1.969  45.354
   58    H4'    G   6           H4'        G   6  20.537  -0.099  45.566
   59    H3'    G   6           H3'        G   6  17.717   0.123  44.503
   60    H2'    G   6          H2''        G   6  17.532  -2.170  44.181
   61   HO2'    G   6          H2'         G   6  19.857  -2.004  43.206
   62    H1'    G   6           H1'        G   6  19.184  -3.044  46.270
   63    H8     G   6           H8         G   6  16.550  -0.689  47.604
   64    H1     G   6           H1         G   6  14.289  -6.543  46.275
   65    H21    G   6           H21        G   6  15.797  -7.701  45.158
   66    H22    G   6           H22        G   6  17.282  -6.985  44.575
   67    H5'    A   7           H5'        A   7  19.899  -1.921  41.135
   68   H5''    A   7          H5''        A   7  18.827  -1.825  39.725
   69    H4'    A   7           H4'        A   7  19.235  -4.149  40.991
   70    H3'    A   7           H3'        A   7  16.809  -2.914  39.700
   71    H2'    A   7          H2''        A   7  15.349  -4.502  40.521
   72   HO2'    A   7          H2'         A   7  17.512  -6.272  41.034
   73    H1'    A   7           H1'        A   7  16.690  -5.206  42.895
   74    H8     A   7           H8         A   7  16.144  -1.513  42.968
   75    H61    A   7           H61        A   7  10.206  -2.614  44.285
   76    H62    A   7           H62        A   7  11.487  -1.423  44.306
   77    H2     A   7           H2         A   7  12.096  -6.490  43.066
   78    H5'    U   8           H5'        U   8  17.170  -7.023  37.145
   79   H5''    U   8          H5''        U   8  16.199  -6.535  35.742
   80    H4'    U   8           H4'        U   8  15.427  -8.568  37.286
   81    H3'    U   8           H3'        U   8  13.921  -6.364  35.898
   82    H2'    U   8          H2''        U   8  11.919  -6.806  36.957
   83   HO2'    U   8          H2'         U   8  12.840  -9.425  37.578
   84    H1'    U   8           H1'        U   8  12.887  -7.929  39.364
   85    H3     U   8           H3         U   8   9.942  -4.521  40.250
   86    H5     U   8           H5         U   8  13.671  -2.685  39.568
   87    H6     U   8           H6         U   8  14.502  -4.819  38.768
   88    H5'    U   9           H5'        U   9  11.754  -9.487  33.041
   89   H5''    U   9          H5''        U   9  11.596  -8.264  31.765
   90    H4'    U   9           H4'        U   9   9.441  -9.151  33.047
   91    H3'    U   9           H3'        U   9  10.260  -6.417  32.091
   92    H2'    U   9          H2''        U   9   8.593  -5.318  33.224
   93   HO2'    U   9          H2'         U   9   6.783  -6.127  32.412
   94    H1'    U   9           H1'        U   9   8.029  -7.279  35.231
   95    H3     U   9           H3         U   9   8.146  -3.298  37.374
   96    H5     U   9           H5         U   9  12.154  -3.979  36.268
   97    H6     U   9           H6         U   9  11.410  -5.916  35.007
   98    H5'    G  10           H5'        G  10   5.884  -7.474  30.213
   99   H5''    G  10          H5''        G  10   5.930  -6.505  28.727
  100    H4'    G  10           H4'        G  10   3.890  -6.242  30.385
  101    H3'    G  10           H3'        G  10   5.504  -4.232  28.840
  102    H2'    G  10          H2''        G  10   4.637  -2.397  29.919
  103   HO2'    G  10          H2'         G  10   2.361  -4.023  30.168
  104    H1'    G  10           H1'        G  10   3.931  -3.546  32.390
  105    H8     G  10           H8         G  10   7.578  -4.112  31.817
  106    H1     G  10           H1         G  10   6.233   2.017  33.161
  107    H21    G  10           H21        G  10   4.055   2.348  33.086
  108    H22    G  10           H22        G  10   2.943   1.118  32.528
  109    H5'    U  11           H5'        U  11   0.896  -3.056  27.988
  110   H5''    U  11          H5''        U  11   1.120  -2.111  26.504
  111    H4'    U  11           H4'        U  11   0.056  -0.987  28.672
  112    H3'    U  11           H3'        U  11   2.042   0.042  26.643
  113    H2'    U  11          H2''        U  11   2.368   2.035  27.798
  114   HO2'    U  11          H2'         U  11   0.212   2.624  28.025
  115    H1'    U  11           H1'        U  11   2.046   1.072  30.410
  116    H3     U  11           H3         U  11   6.183   3.004  29.925
  117    H5     U  11           H5         U  11   6.576  -0.918  28.439
  118    H6     U  11           H6         U  11   4.164  -1.139  28.569
  119    H5'    A  12           H5'        A  12  -0.903   3.129  24.921
  120   H5''    A  12          H5''        A  12   0.064   3.346  23.450
  121    H4'    A  12           H4'        A  12   0.099   5.173  25.409
  122    H3'    A  12           H3'        A  12   2.335   4.069  23.686
  123    H2'    A  12          H2''        A  12   3.872   5.511  24.721
  124   HO2'    A  12          H2'         A  12   1.567   6.913  25.608
  125    H1'    A  12           H1'        A  12   2.865   5.279  27.291
  126    H8     A  12           H8         A  12   3.061   1.787  25.904
  127    H61    A  12           H61        A  12   9.210   2.134  26.427
  128    H62    A  12           H62        A  12   7.844   1.068  26.187
  129    H2     A  12           H2         A  12   7.514   6.199  27.266
  130    H5'    U  13           H5'        U  13   2.419   8.267  24.048
  131   H5''    U  13          H5''        U  13   2.932   9.117  22.578
  132    H4'    U  13           H4'        U  13   4.241   9.662  24.730
  133    H3'    U  13           H3'        U  13   5.307   8.814  22.046
  134    H2'    U  13          H2''        U  13   7.480   8.609  22.775
  135   HO2'    U  13          H2'         U  13   8.238  10.298  23.741
  136    H1'    U  13           H1'        U  13   7.015   8.054  25.511
  137    H3     U  13           H3         U  13   9.881   4.932  23.749
  138    H5     U  13           H5         U  13   6.040   3.794  22.447
  139    H6     U  13           H6         U  13   5.193   5.889  23.293
  140    H5'    U  14           H5'        U  14   7.391  12.188  23.519
  141   H5''    U  14          H5''        U  14   7.325  13.616  22.465
  142    H4'    U  14           H4'        U  14   9.608  13.436  23.229
  143    H3'    U  14           H3'        U  14   8.887  12.721  20.421
  144    H2'    U  14          H2''        U  14  10.819  11.608  19.904
  145   HO2'    U  14          H2'         U  14  11.974  13.415  21.729
  146    H1'    U  14           H1'        U  14  11.715  10.807  22.432
  147    H3     U  14           H3         U  14  11.641   6.931  20.130
  148    H5     U  14           H5         U  14   7.580   8.029  20.333
  149    H6     U  14           H6         U  14   8.263  10.121  21.353
  150    H5'    U  15           H5'        U  15  12.949  15.491  20.163
  151   H5''    U  15          H5''        U  15  12.902  15.890  18.435
  152    H4'    U  15           H4'        U  15  14.981  14.579  19.456
  153    H3'    U  15           H3'        U  15  13.480  14.317  16.864
  154    H2'    U  15          H2''        U  15  14.451  12.323  16.282
  155   HO2'    U  15          H2'         U  15  16.538  12.152  16.312
  156    H1'    U  15           H1'        U  15  15.250  11.400  18.855
  157    H3     U  15           H3         U  15  13.272   7.866  16.788
  158    H5     U  15           H5         U  15  10.094  10.478  17.697
  159    H6     U  15           H6         U  15  11.734  12.140  18.355
  160    H5'    U  16           H5'        U  16  17.913  13.997  15.800
  161   H5''    U  16          H5''        U  16  18.055  14.985  14.332
  162    H4'    U  16           H4'        U  16  19.015  12.733  13.962
  163    H3'    U  16           H3'        U  16  16.541  13.700  12.545
  164    H2'    U  16          H2''        U  16  16.064  11.664  11.598
  165   HO2'    U  16          H2'         U  16  17.603  10.753  10.519
  166    H1'    U  16           H1'        U  16  17.396   9.957  13.437
  167    H3     U  16           H3         U  16  13.331   8.044  13.163
  168    H5     U  16           H5         U  16  12.496  11.875  14.705
  169    H6     U  16           H6         U  16  14.840  12.433  14.408
  170    H5'    U  17           H5'        U  17  19.566  12.125   8.945
  171   H5''    U  17          H5''        U  17  18.655  12.842   7.603
  172    H4'    U  17           H4'        U  17  19.034  10.209   7.722
  173    H3'    U  17           H3'        U  17  16.646  11.871   6.918
  174    H2'    U  17          H2''        U  17  15.243  10.061   6.808
  175   HO2'    U  17          H2'         U  17  17.583   8.672   6.059
  176    H1'    U  17           H1'        U  17  16.707   8.262   8.490
  177    H3     U  17           H3         U  17  12.348   7.780   9.603
  178    H5     U  17           H5         U  17  13.318  11.668  10.915
  179    H6     U  17           H6         U  17  15.470  11.425   9.816
  180    H5'    A  18           H5'        A  18  18.213   8.856   3.171
  181   H5''    A  18          H5''        A  18  17.043   9.246   1.899
  182    H4'    A  18           H4'        A  18  17.385   6.726   2.724
  183    H3'    A  18           H3'        A  18  14.892   8.265   1.958
  184    H2'    A  18          H2''        A  18  13.519   6.446   2.479
  185   HO2'    A  18          H2'         A  18  14.490   4.798   1.406
  186    H1'    A  18           H1'        A  18  14.945   5.457   4.651
  187    H8     A  18           H8         A  18  14.598   9.049   5.430
  188    H61    A  18           H61        A  18   8.630   8.071   6.698
  189    H62    A  18           H62        A  18   9.932   9.241   6.714
  190    H2     A  18           H2         A  18  10.203   4.463   4.544
  191    H5'    A  19           H5'        A  19  15.094   4.985  -1.270
  192   H5''    A  19          H5''        A  19  13.830   5.354  -2.461
  193    H4'    A  19           H4'        A  19  13.547   3.351  -0.693
  194    H3'    A  19           H3'        A  19  11.595   5.343  -1.854
  195    H2'    A  19          H2''        A  19   9.864   4.648  -0.461
  196   HO2'    A  19          H2'         A  19  11.353   2.265   0.004
  197    H1'    A  19           H1'        A  19  11.390   3.968   1.802
  198    H8     A  19           H8         A  19  12.518   7.382   1.254
  199    H61    A  19           H61        A  19   7.035   9.377   3.277
  200    H62    A  19           H62        A  19   8.656   9.845   2.818
  201    H2     A  19           H2         A  19   6.642   5.025   2.228
  202    H5'    A  20           H5'        A  20   9.186   2.092  -4.195
  203   H5''    A  20          H5''        A  20   8.670   3.291  -5.397
  204    H4'    A  20           H4'        A  20   6.935   2.312  -3.623
  205    H3'    A  20           H3'        A  20   7.336   5.053  -4.799
  206    H2'    A  20          H2''        A  20   5.864   6.091  -3.338
  207   HO2'    A  20          H2'         A  20   4.698   3.526  -2.937
  208    H1'    A  20           H1'        A  20   6.139   4.441  -1.105
  209    H8     A  20           H8         A  20   9.483   5.733  -2.397
  210    H61    A  20           H61        A  20   8.228  11.035   0.512
  211    H62    A  20           H62        A  20   9.476  10.064  -0.236
  212    H2     A  20           H2         A  20   4.548   8.475   0.648
  213    H5'    U  21           H5'        U  21   2.883   4.872  -5.487
  214   H5''    U  21          H5''        U  21   2.732   5.898  -6.927
  215    H4'    U  21           H4'        U  21   1.643   6.817  -4.795
  216    H3'    U  21           H3'        U  21   3.723   8.199  -6.500
  217    H2'    U  21          H2''        U  21   3.784  10.068  -5.093
  218   HO2'    U  21          H2'         U  21   1.372  10.094  -5.027
  219    H1'    U  21           H1'        U  21   3.441   8.773  -2.674
  220    H3     U  21           H3         U  21   7.560  10.640  -2.419
  221    H5     U  21           H5         U  21   7.972   7.787  -5.491
  222    H6     U  21           H6         U  21   5.627   7.245  -5.212
  223    H5'    U  22           H5'        U  22  -0.515   9.750  -6.743
  224   H5''    U  22          H5''        U  22  -1.119  10.499  -8.236
  225    H4'    U  22           H4'        U  22  -1.525  11.880  -6.136
  226    H3'    U  22           H3'        U  22  -0.021  12.714  -8.605
  227    H2'    U  22          H2''        U  22   0.926  14.585  -7.700
  228   HO2'    U  22          H2'         U  22  -1.436  14.720  -6.137
  229    H1'    U  22           H1'        U  22   0.639  13.992  -4.933
  230    H3     U  22           H3         U  22   4.746  15.776  -6.466
  231    H5     U  22           H5         U  22   5.123  11.633  -5.826
  232    H6     U  22           H6         U  22   2.694  11.486  -5.805
  233    H5'    A  23           H5'        A  23  -0.325  16.076 -10.436
  234   H5''    A  23          H5''        A  23   0.430  16.111  -8.831
  235    H4'    A  23           H4'        A  23   0.127  18.365 -10.167
  236    H3'    A  23           H3'        A  23   0.115  17.620  -7.357
  237    H2'    A  23          H2''        A  23  -1.498  18.995  -6.519
  238   HO2'    A  23          H2'         A  23  -1.179  21.066  -6.664
  239    H1'    A  23           H1'        A  23  -2.758  20.043  -8.821
  240    H8     A  23           H8         A  23  -3.497  16.423  -8.796
  241    H61    A  23           H61        A  23  -7.638  17.449  -4.331
  242    H62    A  23           H62        A  23  -6.972  16.264  -5.433
  243    H2     A  23           H2         A  23  -5.046  21.088  -4.673
  244    H5'    A  24           H5'        A  24   3.513  20.374  -5.854
  245   H5''    A  24          H5''        A  24   3.406  19.310  -4.440
  246    H4'    A  24           H4'        A  24   1.851  21.659  -5.013
  247    H3'    A  24           H3'        A  24   2.285  19.637  -2.860
  248    H2'    A  24          H2''        A  24   0.126  19.538  -2.140
  249   HO2'    A  24          H2'         A  24  -1.128  21.579  -2.073
  250    H1'    A  24           H1'        A  24  -1.160  21.066  -4.258
  251    H8     A  24           H8         A  24  -0.202  17.572  -5.185
  252    H61    A  24           H61        A  24  -5.566  15.719  -2.762
  253    H62    A  24           H62        A  24  -4.114  15.209  -3.594
  254    H2     A  24           H2         A  24  -4.883  19.972  -1.528
  255    H5'    U  25           H5'        U  25   1.395  22.531  -0.063
  256   H5''    U  25          H5''        U  25   1.951  21.780   1.445
  257    H4'    U  25           H4'        U  25  -0.364  21.046  -0.311
  258    H3'    U  25           H3'        U  25  -0.004  22.029   2.228
  259    H2'    U  25          H2''        U  25   1.037  20.282   3.304
  260   HO2'    U  25          H2'         U  25  -0.510  18.787   4.170
  261    H1'    U  25           H1'        U  25  -0.231  18.042   1.841
  262    H3     U  25           H3         U  25   3.258  16.228   4.262
  263    H5     U  25           H5         U  25   5.026  18.485   1.170
  264    H6     U  25           H6         U  25   2.806  19.344   0.623
  265    H5'    U  26           H5'        U  26  -3.575  18.087   0.295
  266   H5''    U  26          H5''        U  26  -2.215  17.813   1.397
  267    H4'    U  26           H4'        U  26  -2.890  16.345  -0.973
  268    H3'    U  26           H3'        U  26  -0.732  16.340   1.147
  269    H2'    U  26          H2''        U  26   0.611  14.979  -0.136
  270   HO2'    U  26          H2'         U  26  -0.788  13.254  -0.282
  271    H1'    U  26           H1'        U  26  -0.607  15.588  -2.681
  272    H3     U  26           H3         U  26   3.642  15.728  -3.997
  273    H5     U  26           H5         U  26   3.598  18.433  -0.786
  274    H6     U  26           H6         U  26   1.261  17.877  -0.422
  275    H5'    C  27           H5'        C  27  -3.392  12.492   1.439
  276   H5''    C  27          H5''        C  27  -3.182  11.594   2.957
  277    H4'    C  27           H4'        C  27  -2.516  10.293   0.873
  278    H3'    C  27           H3'        C  27  -0.589  11.072   3.087
  279    H2'    C  27          H2''        C  27   1.169   9.946   2.056
  280   HO2'    C  27          H2'         C  27  -0.857   8.463   0.723
  281    H1'    C  27           H1'        C  27   0.275  10.375  -0.616
  282    H41    C  27           H41        C  27   5.453  14.008   0.044
  283    H42    C  27           H42        C  27   4.637  15.027   1.209
  284    H5     C  27           H5         C  27   2.499  14.458   2.171
  285    H6     C  27           H6         C  27   0.533  13.008   1.969
  286    H5'    U  28           H5'        U  28  -2.205   6.686   3.694
  287   H5''    U  28          H5''        U  28  -1.942   6.000   5.311
  288    H4'    U  28           H4'        U  28  -0.865   4.687   3.408
  289    H3'    U  28           H3'        U  28   0.549   5.907   5.782
  290    H2'    U  28          H2''        U  28   2.658   5.345   5.025
  291   HO2'    U  28          H2'         U  28   1.303   3.267   3.669
  292    H1'    U  28           H1'        U  28   2.148   5.360   2.254
  293    H3     U  28           H3         U  28   5.747   8.035   3.061
  294    H5     U  28           H5         U  28   2.428  10.304   4.307
  295    H6     U  28           H6         U  28   1.044   8.349   3.964
  296    H5'    U  29           H5'        U  29   1.663   1.196   5.419
  297   H5''    U  29          H5''        U  29   2.411   0.855   6.992
  298    H4'    U  29           H4'        U  29   3.779   0.471   4.740
  299    H3'    U  29           H3'        U  29   4.553   1.552   7.439
  300    H2'    U  29          H2''        U  29   6.625   2.297   6.756
  301   HO2'    U  29          H2'         U  29   6.426   0.289   4.764
  302    H1'    U  29           H1'        U  29   6.108   2.752   4.023
  303    H3     U  29           H3         U  29   7.968   6.534   5.743
  304    H5     U  29           H5         U  29   4.138   6.392   7.485
  305    H6     U  29           H6         U  29   3.777   4.270   6.369
  306    H5'    A  30           H5'        A  30   7.825  -1.594   6.151
  307   H5''    A  30          H5''        A  30   8.523  -2.100   7.701
  308    H4'    A  30           H4'        A  30  10.081  -1.014   5.861
  309    H3'    A  30           H3'        A  30   9.930  -0.615   8.843
  310    H2'    A  30          H2''        A  30  11.351   1.187   8.845
  311   HO2'    A  30          H2'         A  30  13.189   1.112   7.818
  312    H1'    A  30           H1'        A  30  11.041   2.024   6.132
  313    H8     A  30           H8         A  30   7.873   2.277   8.210
  314    H61    A  30           H61        A  30  10.075   7.653  10.324
  315    H62    A  30           H62        A  30   8.647   6.661  10.133
  316    H2     A  30           H2         A  30  13.336   5.629   8.000
  317    H5'    A  31           H5'        A  31  14.258  -0.900   7.718
  318   H5''    A  31          H5''        A  31  14.987  -2.000   8.904
  319    H4'    A  31           H4'        A  31  16.331   0.052   8.751
  320    H3'    A  31           H3'        A  31  14.722  -0.593  11.214
  321    H2'    A  31          H2''        A  31  15.099   1.443  12.205
  322   HO2'    A  31          H2'         A  31  17.107   1.965  12.432
  323    H1'    A  31           H1'        A  31  15.726   2.979   9.875
  324    H8     A  31           H8         A  31  12.254   1.356  10.485
  325    H61    A  31           H61        A  31  10.742   6.749  13.099
  326    H62    A  31           H62        A  31  10.133   5.224  12.495
  327    H2     A  31           H2         A  31  15.070   6.928  11.937
  328    H5'    A  32           H5'        A  32  19.520  -0.152  12.728
  329   H5''    A  32          H5''        A  32  19.255  -0.766  14.371
  330    H4'    A  32           H4'        A  32  20.292   1.657  13.987
  331    H3'    A  32           H3'        A  32  18.288   0.600  15.975
  332    H2'    A  32          H2''        A  32  17.729   2.684  16.767
  333   HO2'    A  32          H2'         A  32  19.348   3.819  17.440
  334    H1'    A  32           H1'        A  32  18.463   4.251  14.506
  335    H8     A  32           H8         A  32  15.705   1.594  14.110
  336    H61    A  32           H61        A  32  11.793   5.975  16.045
  337    H62    A  32           H62        A  32  11.932   4.413  15.269
  338    H2     A  32           H2         A  32  15.961   7.600  16.353
  339    H5'    A  33           H5'        A  33  21.702   2.928  18.592
  340   H5''    A  33          H5''        A  33  21.297   2.275  20.191
  341    H4'    A  33           H4'        A  33  21.192   4.896  19.739
  342    H3'    A  33           H3'        A  33  19.398   3.041  21.302
  343    H2'    A  33          H2''        A  33  17.799   4.661  21.675
  344   HO2'    A  33          H2'         A  33  18.499   6.452  22.490
  345    H1'    A  33           H1'        A  33  18.300   6.320  19.422
  346    H8     A  33           H8         A  33  17.346   2.701  18.638
  347    H61    A  33           H61        A  33  11.468   4.546  19.159
  348    H62    A  33           H62        A  33  12.533   3.286  18.578
  349    H2     A  33           H2         A  33  14.109   7.917  20.496
  350    H5'    A  34           H5'        A  34  20.663   6.304  24.324
  351   H5''    A  34          H5''        A  34  20.304   5.645  25.932
  352    H4'    A  34           H4'        A  34  18.979   7.767  25.010
  353    H3'    A  34           H3'        A  34  18.134   5.370  26.620
  354    H2'    A  34          H2''        A  34  15.880   5.772  26.384
  355   HO2'    A  34          H2'         A  34  15.018   7.826  26.336
  356    H1'    A  34           H1'        A  34  15.941   7.396  24.034
  357    H8     A  34           H8         A  34  17.115   3.858  23.408
  358    H61    A  34           H61        A  34  11.120   2.428  22.791
  359    H62    A  34           H62        A  34  12.761   1.906  22.483
  360    H2     A  34           H2         A  34  11.426   6.568  24.518
  361    H5'    C  35           H5'        C  35  17.329   5.636  30.538
  362   H5''    C  35          H5''        C  35  17.658   3.929  30.180
  363    H4'    C  35           H4'        C  35  15.396   5.663  29.270
  364    H3'    C  35           H3'        C  35  15.809   3.287  30.728
  365    H2'    C  35          H2''        C  35  16.092   1.814  29.048
  366   HO2'    C  35          H2'         C  35  14.008   1.261  29.699
  367    H1'    C  35           H1'        C  35  14.457   3.330  27.040
  368    H41    C  35           H41        C  35  17.904  -0.512  23.294
  369    H42    C  35           H42        C  35  19.393   0.108  23.971
  370    H5     C  35           H5         C  35  19.457   1.551  25.901
  371    H6     C  35           H6         C  35  18.113   2.898  27.447
  372    H5'    U  36           H5'        U  36  15.854   6.891  30.765
  373   H5''    U  36          H5''        U  36  14.933   7.300  32.225
  374    H4'    U  36           H4'        U  36  15.443   9.359  30.963
  375    H3'    U  36           H3'        U  36  12.724   8.232  31.397
  376    H2'    U  36          H2''        U  36  11.595   9.482  29.812
  377   HO2'    U  36          H2'         U  36  13.788  11.300  29.855
  378    H1'    U  36           H1'        U  36  13.502   9.750  27.853
  379    H3     U  36           H3         U  36   9.584   6.909  27.457
  380    H5     U  36           H5         U  36  13.138   4.665  27.267
  381    H6     U  36           H6         U  36  14.340   6.596  28.070
  382    H5'    A  37           H5'        A  37  10.707  11.710  33.870
  383   H5''    A  37          H5''        A  37  10.288  10.405  34.995
  384    H4'    A  37           H4'        A  37   8.397  11.632  33.564
  385    H3'    A  37           H3'        A  37   8.788   8.719  34.292
  386    H2'    A  37          H2''        A  37   6.871   8.083  33.110
  387   HO2'    A  37          H2'         A  37   5.252   9.438  32.592
  388    H1'    A  37           H1'        A  37   7.284   9.666  30.892
  389    H8     A  37           H8         A  37  10.704   8.501  31.444
  390    H61    A  37           H61        A  37   8.983   2.862  29.594
  391    H62    A  37           H62        A  37  10.332   3.946  29.850
  392    H2     A  37           H2         A  37   5.275   5.217  30.504
  393    H5'    C  38           H5'        C  38   5.184  10.212  35.943
  394   H5''    C  38          H5''        C  38   4.599   9.738  37.551
  395    H4'    C  38           H4'        C  38   2.915   9.148  35.867
  396    H3'    C  38           H3'        C  38   4.507   7.010  37.284
  397    H2'    C  38          H2''        C  38   3.513   5.291  36.064
  398   HO2'    C  38          H2'         C  38   1.370   5.823  36.365
  399    H1'    C  38           H1'        C  38   3.192   6.611  33.631
  400    H41    C  38           H41        C  38   8.119   2.590  33.045
  401    H42    C  38           H42        C  38   9.158   3.720  33.883
  402    H5     C  38           H5         C  38   8.386   5.827  34.734
  403    H6     C  38           H6         C  38   6.423   7.194  35.211
  404    H5'    A  39           H5'        A  39   0.649   5.987  39.958
  405   H5''    A  39          H5''        A  39   1.594   5.047  41.130
  406    H4'    A  39           H4'        A  39  -0.062   3.860  39.368
  407    H3'    A  39           H3'        A  39   2.639   3.076  40.501
  408    H2'    A  39          H2''        A  39   2.807   1.208  39.067
  409   HO2'    A  39          H2'         A  39   1.121   0.038  38.552
  410    H1'    A  39           H1'        A  39   1.481   2.221  36.873
  411    H8     A  39           H8         A  39   4.083   4.710  37.989
  412    H61    A  39           H61        A  39   8.366   1.018  35.501
  413    H62    A  39           H62        A  39   8.016   2.638  36.060
  414    H2     A  39           H2         A  39   4.480  -1.215  35.562
  415    H5'    A  40           H5'        A  40  -0.581   0.304  40.456
  416   H5''    A  40          H5''        A  40  -1.051  -0.410  42.012
  417    H4'    A  40           H4'        A  40  -1.429  -2.136  40.395
  418    H3'    A  40           H3'        A  40   1.036  -2.287  42.100
  419    H2'    A  40          H2''        A  40   2.063  -3.984  40.906
  420   HO2'    A  40          H2'         A  40  -0.520  -4.592  39.883
  421    H1'    A  40           H1'        A  40   1.208  -3.432  38.355
  422    H8     A  40           H8         A  40   2.401  -0.413  40.448
  423    H61    A  40           H61        A  40   8.070  -1.721  38.387
  424    H62    A  40           H62        A  40   7.067  -0.529  39.184
  425    H2     A  40           H2         A  40   5.304  -4.973  37.006
  426    H5'    A  41           H5'        A  41  -0.398  -6.431  43.029
  427   H5''    A  41          H5''        A  41   0.571  -6.878  44.446
  428    H4'    A  41           H4'        A  41   1.167  -7.808  42.001
  429    H3'    A  41           H3'        A  41   2.869  -6.946  44.338
  430    H2'    A  41          H2''        A  41   4.825  -6.995  43.129
  431   HO2'    A  41          H2'         A  41   3.536  -9.035  41.655
  432    H1'    A  41           H1'        A  41   3.728  -6.686  40.499
  433    H8     A  41           H8         A  41   3.085  -3.614  42.548
  434    H61    A  41           H61        A  41   8.939  -1.966  41.440
  435    H62    A  41           H62        A  41   7.359  -1.407  41.937
  436    H2     A  41           H2         A  41   8.416  -6.218  40.112
  437    H5'    U  42           H5'        U  42   4.607 -11.561  43.418
  438   H5''    U  42          H5''        U  42   5.242 -11.738  45.065
  439    H4'    U  42           H4'        U  42   6.866 -11.956  42.967
  440    H3'    U  42           H3'        U  42   7.182 -10.736  45.691
  441    H2'    U  42          H2''        U  42   9.090  -9.560  45.195
  442   HO2'    U  42          H2'         U  42  10.584 -10.316  43.604
  443    H1'    U  42           H1'        U  42   8.868  -9.419  42.361
  444    H3     U  42           H3         U  42   9.947  -5.228  43.755
  445    H5     U  42           H5         U  42   5.921  -5.721  44.889
  446    H6     U  42           H6         U  42   6.096  -8.058  44.263
  447    H5'    C  43           H5'        C  43  10.115 -13.783  44.002
  448   H5''    C  43          H5''        C  43  10.864 -14.845  45.211
  449    H4'    C  43           H4'        C  43  12.492 -14.214  43.446
  450    H3'    C  43           H3'        C  43  12.747 -13.441  46.330
  451    H2'    C  43          H2''        C  43  14.479 -11.949  46.026
  452   HO2'    C  43          H2'         C  43  15.952 -13.257  45.054
  453    H1'    C  43           H1'        C  43  13.998 -11.109  43.403
  454    H41    C  43           H41        C  43  12.549  -6.193  47.179
  455    H42    C  43           H42        C  43  11.180  -7.055  47.845
  456    H5     C  43           H5         C  43  10.585  -9.287  47.184
  457    H6     C  43           H6         C  43  11.181 -11.190  45.760
  458    H5'    G  44           H5'        G  44  16.958 -15.582  46.359
  459   H5''    G  44          H5''        G  44  16.928 -15.901  48.104
  460    H4'    G  44           H4'        G  44  18.661 -14.156  47.080
  461    H3'    G  44           H3'        G  44  17.037 -14.185  49.610
  462    H2'    G  44          H2''        G  44  17.419 -11.984  50.112
  463   HO2'    G  44          H2'         G  44  19.416 -11.391  50.248
  464    H1'    G  44           H1'        G  44  18.143 -11.018  47.524
  465    H8     G  44           H8         G  44  14.554 -12.261  47.969
  466    H1     G  44           H1         G  44  15.539  -6.218  49.880
  467    H21    G  44           H21        G  44  17.694  -5.757  49.853
  468    H22    G  44           H22        G  44  18.907  -6.980  49.543
  469    H5'    A  45           H5'        A  45  21.846 -13.459  50.954
  470   H5''    A  45          H5''        A  45  21.626 -13.796  52.682
  471    H4'    A  45           H4'        A  45  22.650 -11.470  51.882
  472    H3'    A  45           H3'        A  45  20.813 -12.275  54.104
  473    H2'    A  45          H2''        A  45  19.951 -10.201  54.515
  474   HO2'    A  45          H2'         A  45  21.814  -9.200  55.123
  475    H1'    A  45           H1'        A  45  20.479  -8.867  52.080
  476    H8     A  45           H8         A  45  18.231 -11.957  51.892
  477    H61    A  45           H61        A  45  13.547  -8.153  53.217
  478    H62    A  45           H62        A  45  13.989  -9.724  52.588
  479    H2     A  45           H2         A  45  17.374  -5.863  53.700
  480    H5'    G  46           H5'        G  46  24.263  -9.622  56.742
  481   H5''    G  46          H5''        G  46  23.770 -10.423  58.246
  482    H4'    G  46           H4'        G  46  23.643  -7.767  58.019
  483    H3'    G  46           H3'        G  46  21.939  -9.821  59.372
  484    H2'    G  46          H2''        G  46  20.084  -8.495  59.643
  485   HO2'    G  46          H2'         G  46  20.386  -6.663  60.597
  486    H1'    G  46           H1'        G  46  20.452  -6.607  57.590
  487    H8     G  46           H8         G  46  20.346 -10.255  56.458
  488    H1     G  46           H1         G  46  14.577  -7.590  57.299
  489    H21    G  46           H21        G  46  14.788  -5.600  58.230
  490    H22    G  46           H22        G  46  16.322  -5.007  58.824
  491    H5'    C  47           H5'        C  47  22.625  -6.030  62.579
  492   H5''    C  47          H5''        C  47  22.064  -6.852  64.048
  493    H4'    C  47           H4'        C  47  20.898  -4.598  63.242
  494    H3'    C  47           H3'        C  47  19.795  -7.148  64.405
  495    H2'    C  47          H2''        C  47  17.578  -6.518  64.102
  496   HO2'    C  47          H2'         C  47  16.903  -4.423  63.962
  497    H1'    C  47           H1'        C  47  17.826  -5.129  61.713
  498    H41    C  47           H41        C  47  15.429 -10.877  60.349
  499    H42    C  47           H42        C  47  16.992 -11.619  60.602
  500    H5     C  47           H5         C  47  18.960 -10.366  61.214
  501    H6     C  47           H6         C  47  19.813  -8.173  61.874
  502    H5'    C  48           H5'        C  48  17.398  -4.058  66.078
  503   H5''    C  48          H5''        C  48  17.644  -4.107  67.835
  504    H4'    C  48           H4'        C  48  15.264  -3.966  67.499
  505    H3'    C  48           H3'        C  48  16.442  -6.640  68.204
  506   HO3'    C  48          H3T         C  48  15.411  -6.166  70.156
  507    H2'    C  48          H2''        C  48  14.461  -7.792  67.977
  508   HO2'    C  48          H2'         C  48  13.047  -5.322  68.082
  509    H1'    C  48           H1'        C  48  13.307  -6.282  65.920
  510    H41    C  48           H41        C  48  15.261 -11.717  63.246
  511    H42    C  48           H42        C  48  16.936 -11.249  63.432
  512    H5     C  48           H5         C  48  17.625  -9.329  64.717
  513    H6     C  48           H6         C  48  16.860  -7.343  65.924
  Start of MODEL    6
    1    H5'    G   1           H5'        G   1   9.215 -18.895  60.947
    2   H5''    G   1          H5''        G   1   8.543 -17.887  59.649
    3    H4'    G   1           H4'        G   1   7.817 -17.098  61.908
    4    H3'    G   1           H3'        G   1   9.434 -15.527  59.943
    5    H2'    G   1          H2''        G   1  10.153 -13.928  61.387
    6   HO2'    G   1          H2'         G   1   8.857 -13.063  62.985
    7    H1'    G   1           H1'        G   1   9.707 -15.224  63.893
    8    H8     G   1           H8         G   1  12.383 -17.029  62.010
    9    H1     G   1           H1         G   1  14.402 -11.447  64.442
   10    H21    G   1           H21        G   1  12.671 -10.225  65.066
   11    H22    G   1           H22        G   1  11.038 -10.851  65.061
   12   HO5'    G   1          H5T         G   1  10.967 -17.018  60.598
   13    H5'    G   2           H5'        G   2   5.241 -12.220  60.633
   14   H5''    G   2          H5''        G   2   5.775 -11.598  59.060
   15    H4'    G   2           H4'        G   2   5.444  -9.942  61.122
   16    H3'    G   2           H3'        G   2   7.401 -10.079  58.866
   17    H2'    G   2          H2''        G   2   8.973  -8.671  59.783
   18   HO2'    G   2          H2'         G   2   8.362  -6.828  60.570
   19    H1'    G   2           H1'        G   2   8.477  -8.986  62.520
   20    H8     G   2           H8         G   2   9.086 -12.326  60.879
   21    H1     G   2           H1         G   2  14.466  -8.990  61.874
   22    H21    G   2           H21        G   2  13.975  -6.942  62.536
   23    H22    G   2           H22        G   2  12.335  -6.332  62.553
   24    H5'    C   3           H5'        C   3   6.134  -5.690  59.838
   25   H5''    C   3          H5''        C   3   6.172  -4.804  58.302
   26    H4'    C   3           H4'        C   3   7.489  -3.764  60.266
   27    H3'    C   3           H3'        C   3   8.337  -4.299  57.448
   28    H2'    C   3          H2''        C   3  10.587  -4.006  57.789
   29   HO2'    C   3          H2'         C   3   9.871  -2.321  59.963
   30    H1'    C   3           H1'        C   3  10.805  -4.561  60.539
   31    H41    C   3           H41        C   3  13.906  -9.178  57.429
   32    H42    C   3           H42        C   3  12.412  -9.768  56.739
   33    H5     C   3           H5         C   3  10.264  -8.798  57.231
   34    H6     C   3           H6         C   3   9.103  -6.950  58.339
   35    H5'    U   4           H5'        U   4   9.966   0.129  58.087
   36   H5''    U   4          H5''        U   4   9.789   0.708  56.420
   37    H4'    U   4           H4'        U   4  12.176   0.743  57.461
   38    H3'    U   4           H3'        U   4  11.224  -0.263  54.797
   39    H2'    U   4          H2''        U   4  13.161  -1.366  54.269
   40   HO2'    U   4          H2'         U   4  14.478   0.528  55.929
   41    H1'    U   4           H1'        U   4  14.250  -1.754  56.862
   42    H3     U   4           H3         U   4  14.603  -5.818  54.940
   43    H5     U   4           H5         U   4  10.443  -5.221  55.247
   44    H6     U   4           H6         U   4  10.890  -2.969  56.030
   45    H5'    C   5           H5'        C   5  15.171   2.147  54.445
   46   H5''    C   5          H5''        C   5  15.001   3.102  52.958
   47    H4'    C   5           H4'        C   5  17.192   1.979  52.980
   48    H3'    C   5           H3'        C   5  15.033   1.165  51.038
   49    H2'    C   5          H2''        C   5  16.268  -0.595  50.176
   50   HO2'    C   5          H2'         C   5  18.120   0.658  49.713
   51    H1'    C   5           H1'        C   5  17.737  -1.289  52.460
   52    H41    C   5           H41        C   5  13.460  -5.914  51.548
   53    H42    C   5           H42        C   5  12.153  -4.839  51.978
   54    H5     C   5           H5         C   5  12.447  -2.461  52.234
   55    H6     C   5           H6         C   5  14.089  -0.663  52.488
   56    H5'    G   6           H5'        G   6  18.148   2.475  47.859
   57   H5''    G   6          H5''        G   6  17.103   2.593  46.431
   58    H4'    G   6           H4'        G   6  18.889   0.618  46.667
   59    H3'    G   6           H3'        G   6  16.089   0.722  45.552
   60    H2'    G   6          H2''        G   6  15.887  -1.563  45.396
   61   HO2'    G   6          H2'         G   6  17.654  -1.758  43.974
   62    H1'    G   6           H1'        G   6  17.918  -2.320  47.272
   63    H8     G   6           H8         G   6  14.897  -0.543  48.767
   64    H1     G   6           H1         G   6  14.034  -6.816  47.736
   65    H21    G   6           H21        G   6  15.719  -7.629  46.566
   66    H22    G   6           H22        G   6  16.958  -6.604  45.880
   67    H5'    A   7           H5'        A   7  19.298  -0.649  41.955
   68   H5''    A   7          H5''        A   7  18.247  -0.835  40.538
   69    H4'    A   7           H4'        A   7  19.710  -2.885  41.444
   70    H3'    A   7           H3'        A   7  16.967  -2.679  40.236
   71    H2'    A   7          H2''        A   7  16.348  -4.866  40.750
   72   HO2'    A   7          H2'         A   7  19.089  -5.459  41.250
   73    H1'    A   7           H1'        A   7  17.598  -5.159  43.196
   74    H8     A   7           H8         A   7  15.952  -1.758  43.091
   75    H61    A   7           H61        A   7  10.583  -4.591  44.205
   76    H62    A   7           H62        A   7  11.435  -3.064  44.225
   77    H2     A   7           H2         A   7  13.665  -7.743  43.372
   78    H5'    U   8           H5'        U   8  18.544  -5.559  37.203
   79   H5''    U   8          H5''        U   8  17.482  -5.321  35.801
   80    H4'    U   8           H4'        U   8  17.174  -7.440  37.387
   81    H3'    U   8           H3'        U   8  15.236  -5.637  35.965
   82    H2'    U   8          H2''        U   8  13.378  -6.403  37.088
   83   HO2'    U   8          H2'         U   8  13.671  -8.563  36.435
   84    H1'    U   8           H1'        U   8  14.605  -7.371  39.463
   85    H3     U   8           H3         U   8  10.954  -4.735  40.418
   86    H5     U   8           H5         U   8  14.228  -2.123  39.955
   87    H6     U   8           H6         U   8  15.501  -3.982  39.058
   88    H5'    U   9           H5'        U   9  13.689  -9.101  33.071
   89   H5''    U   9          H5''        U   9  13.371  -7.870  31.833
   90    H4'    U   9           H4'        U   9  11.355  -9.132  33.036
   91    H3'    U   9           H3'        U   9  11.755  -6.285  32.150
   92    H2'    U   9          H2''        U   9   9.934  -5.468  33.282
   93   HO2'    U   9          H2'         U   9   8.392  -6.682  32.241
   94    H1'    U   9           H1'        U   9   9.636  -7.529  35.243
   95    H3     U   9           H3         U   9   9.171  -3.618  37.465
   96    H5     U   9           H5         U   9  13.239  -3.692  36.376
   97    H6     U   9           H6         U   9  12.789  -5.695  35.080
   98    H5'    G  10           H5'        G  10   7.644  -8.092  30.093
   99   H5''    G  10          H5''        G  10   7.527  -7.040  28.669
  100    H4'    G  10           H4'        G  10   5.443  -7.317  30.290
  101    H3'    G  10           H3'        G  10   6.604  -4.958  28.836
  102    H2'    G  10          H2''        G  10   5.338  -3.378  29.945
  103   HO2'    G  10          H2'         G  10   3.427  -5.087  29.584
  104    H1'    G  10           H1'        G  10   4.990  -4.634  32.411
  105    H8     G  10           H8         G  10   8.645  -4.642  31.719
  106    H1     G  10           H1         G  10   6.435   1.240  33.027
  107    H21    G  10           H21        G  10   4.233   1.244  32.984
  108    H22    G  10           H22        G  10   3.304  -0.150  32.482
  109    H5'    U  11           H5'        U  11   2.022  -4.548  28.105
  110   H5''    U  11          H5''        U  11   1.978  -3.610  26.600
  111    H4'    U  11           H4'        U  11   0.950  -2.605  28.837
  112    H3'    U  11           H3'        U  11   2.575  -1.368  26.620
  113    H2'    U  11          H2''        U  11   2.828   0.653  27.722
  114   HO2'    U  11          H2'         U  11   0.752   1.193  28.141
  115    H1'    U  11           H1'        U  11   2.760  -0.253  30.378
  116    H3     U  11           H3         U  11   6.582   2.174  29.622
  117    H5     U  11           H5         U  11   7.393  -1.698  28.177
  118    H6     U  11           H6         U  11   5.043  -2.224  28.453
  119    H5'    A  12           H5'        A  12  -1.075   1.328  25.189
  120   H5''    A  12          H5''        A  12  -0.266   1.611  23.636
  121    H4'    A  12           H4'        A  12  -0.465   3.563  25.453
  122    H3'    A  12           H3'        A  12   1.805   2.752  23.625
  123    H2'    A  12          H2''        A  12   3.167   4.471  24.458
  124   HO2'    A  12          H2'         A  12   0.777   5.544  25.569
  125    H1'    A  12           H1'        A  12   2.451   4.245  27.111
  126    H8     A  12           H8         A  12   2.959   0.772  25.647
  127    H61    A  12           H61        A  12   9.038   1.832  25.975
  128    H62    A  12           H62        A  12   7.800   0.617  25.752
  129    H2     A  12           H2         A  12   6.906   5.634  27.025
  130    H5'    U  13           H5'        U  13   1.141   7.077  23.620
  131   H5''    U  13          H5''        U  13   1.641   7.806  22.082
  132    H4'    U  13           H4'        U  13   2.784   8.621  24.306
  133    H3'    U  13           H3'        U  13   3.952   7.923  21.621
  134    H2'    U  13          H2''        U  13   6.138   8.055  22.337
  135   HO2'    U  13          H2'         U  13   5.140   9.832  24.308
  136    H1'    U  13           H1'        U  13   5.785   7.429  25.072
  137    H3     U  13           H3         U  13   9.035   4.750  23.247
  138    H5     U  13           H5         U  13   5.369   3.059  22.044
  139    H6     U  13           H6         U  13   4.250   5.021  22.898
  140    H5'    U  14           H5'        U  14   5.587  11.676  22.909
  141   H5''    U  14          H5''        U  14   5.337  12.975  21.725
  142    H4'    U  14           H4'        U  14   7.663  13.056  22.457
  143    H3'    U  14           H3'        U  14   6.888  12.199  19.704
  144    H2'    U  14          H2''        U  14   8.890  11.253  19.122
  145   HO2'    U  14          H2'         U  14   9.854  13.383  20.563
  146    H1'    U  14           H1'        U  14   9.982  10.628  21.625
  147    H3     U  14           H3         U  14  10.197   6.679  19.468
  148    H5     U  14           H5         U  14   6.058   7.392  19.792
  149    H6     U  14           H6         U  14   6.574   9.578  20.706
  150    H5'    U  15           H5'        U  15  10.619  15.399  19.229
  151   H5''    U  15          H5''        U  15  10.480  15.747  17.495
  152    H4'    U  15           H4'        U  15  12.723  14.706  18.488
  153    H3'    U  15           H3'        U  15  11.203  14.246  15.938
  154    H2'    U  15          H2''        U  15  12.340  12.342  15.361
  155   HO2'    U  15          H2'         U  15  14.424  13.818  16.164
  156    H1'    U  15           H1'        U  15  13.308  11.545  17.917
  157    H3     U  15           H3         U  15  11.622   7.807  15.956
  158    H5     U  15           H5         U  15   8.233  10.096  16.962
  159    H6     U  15           H6         U  15   9.718  11.919  17.552
  160    H5'    U  16           H5'        U  16  15.821  14.678  14.649
  161   H5''    U  16          H5''        U  16  15.589  15.437  13.062
  162    H4'    U  16           H4'        U  16  16.999  13.295  13.068
  163    H3'    U  16           H3'        U  16  14.580  13.933  11.408
  164    H2'    U  16          H2''        U  16  14.278  11.802  10.627
  165   HO2'    U  16          H2'         U  16  17.083  11.498  10.963
  166    H1'    U  16           H1'        U  16  15.635  10.323  12.635
  167    H3     U  16           H3         U  16  11.716   8.131  12.225
  168    H5     U  16           H5         U  16  10.592  11.901  13.730
  169    H6     U  16           H6         U  16  12.894  12.620  13.465
  170    H5'    U  17           H5'        U  17  17.946  12.380   8.048
  171   H5''    U  17          H5''        U  17  17.052  13.012   6.653
  172    H4'    U  17           H4'        U  17  17.578  10.407   6.849
  173    H3'    U  17           H3'        U  17  15.161  11.931   5.895
  174    H2'    U  17          H2''        U  17  13.804  10.092   5.827
  175   HO2'    U  17          H2'         U  17  16.189   8.655   5.284
  176    H1'    U  17           H1'        U  17  15.228   8.380   7.618
  177    H3     U  17           H3         U  17  10.854   7.950   8.675
  178    H5     U  17           H5         U  17  11.789  11.905   9.794
  179    H6     U  17           H6         U  17  13.963  11.608   8.752
  180    H5'    A  18           H5'        A  18  16.794   8.818   2.200
  181   H5''    A  18          H5''        A  18  15.606   9.236   0.952
  182    H4'    A  18           H4'        A  18  15.914   6.707   1.771
  183    H3'    A  18           H3'        A  18  13.456   8.300   1.012
  184    H2'    A  18          H2''        A  18  12.021   6.557   1.602
  185   HO2'    A  18          H2'         A  18  12.554   4.641   0.964
  186    H1'    A  18           H1'        A  18  13.446   5.523   3.755
  187    H8     A  18           H8         A  18  13.240   9.182   4.375
  188    H61    A  18           H61        A  18   7.380   8.352   6.130
  189    H62    A  18           H62        A  18   8.693   9.500   5.994
  190    H2     A  18           H2         A  18   8.744   4.620   4.045
  191    H5'    A  19           H5'        A  19  13.374   4.930  -2.105
  192   H5''    A  19          H5''        A  19  12.084   5.354  -3.248
  193    H4'    A  19           H4'        A  19  11.753   3.434  -1.388
  194    H3'    A  19           H3'        A  19   9.877   5.499  -2.554
  195    H2'    A  19          H2''        A  19   8.172   4.969  -1.061
  196   HO2'    A  19          H2'         A  19   8.133   2.748  -1.417
  197    H1'    A  19           H1'        A  19   9.766   4.267   1.160
  198    H8     A  19           H8         A  19  11.029   7.598   0.410
  199    H61    A  19           H61        A  19   5.778   9.937   2.668
  200    H62    A  19           H62        A  19   7.465  10.252   2.334
  201    H2     A  19           H2         A  19   5.153   5.545   1.915
  202    H5'    A  20           H5'        A  20   7.170   2.267  -4.584
  203   H5''    A  20          H5''        A  20   6.708   3.395  -5.874
  204    H4'    A  20           H4'        A  20   4.938   2.664  -4.024
  205    H3'    A  20           H3'        A  20   5.498   5.260  -5.425
  206    H2'    A  20          H2''        A  20   4.225   6.554  -3.999
  207   HO2'    A  20          H2'         A  20   2.716   4.196  -3.497
  208    H1'    A  20           H1'        A  20   4.247   4.940  -1.689
  209    H8     A  20           H8         A  20   7.659   6.098  -3.011
  210    H61    A  20           H61        A  20   6.683  11.350   0.090
  211    H62    A  20           H62        A  20   7.850  10.391  -0.793
  212    H2     A  20           H2         A  20   2.924   8.911   0.288
  213    H5'    U  21           H5'        U  21   1.167   5.848  -6.449
  214   H5''    U  21          H5''        U  21   1.498   6.876  -7.858
  215    H4'    U  21           H4'        U  21   0.566   7.990  -5.667
  216    H3'    U  21           H3'        U  21   2.792   8.821  -7.516
  217    H2'    U  21          H2''        U  21   3.493  10.583  -6.159
  218   HO2'    U  21          H2'         U  21   0.890  10.426  -5.033
  219    H1'    U  21           H1'        U  21   2.983   9.490  -3.676
  220    H3     U  21           H3         U  21   7.475  10.167  -3.896
  221    H5     U  21           H5         U  21   6.784   7.153  -6.759
  222    H6     U  21           H6         U  21   4.433   7.235  -6.172
  223    H5'    U  22           H5'        U  22  -0.405  11.934  -6.522
  224   H5''    U  22          H5''        U  22  -0.781  12.957  -7.924
  225    H4'    U  22           H4'        U  22  -0.492  14.204  -5.703
  226    H3'    U  22           H3'        U  22   0.552  14.734  -8.377
  227    H2'    U  22          H2''        U  22   2.674  15.377  -7.895
  228   HO2'    U  22          H2'         U  22   1.213  17.154  -6.301
  229    H1'    U  22           H1'        U  22   2.570  15.356  -4.975
  230    H3     U  22           H3         U  22   6.931  14.349  -5.187
  231    H5     U  22           H5         U  22   5.230  11.691  -7.982
  232    H6     U  22           H6         U  22   3.072  12.695  -7.526
  233    H5'    A  23           H5'        A  23   0.896  17.164 -10.644
  234   H5''    A  23          H5''        A  23   1.933  16.311  -9.485
  235    H4'    A  23           H4'        A  23   3.174  17.880 -11.051
  236    H3'    A  23           H3'        A  23   3.301  17.653  -8.128
  237    H2'    A  23          H2''        A  23   3.836  19.794  -7.550
  238   HO2'    A  23          H2'         A  23   5.491  20.825  -8.474
  239    H1'    A  23           H1'        A  23   3.288  21.255  -9.921
  240    H8     A  23           H8         A  23   0.116  19.743  -8.727
  241    H61    A  23           H61        A  23  -0.234  24.268  -4.521
  242    H62    A  23           H62        A  23  -1.126  23.033  -5.382
  243    H2     A  23           H2         A  23   3.833  24.423  -6.401
  244    H5'    A  24           H5'        A  24   6.978  19.231  -7.520
  245   H5''    A  24          H5''        A  24   7.766  17.920  -6.623
  246    H4'    A  24           H4'        A  24   7.425  19.844  -5.115
  247    H3'    A  24           H3'        A  24   6.502  17.175  -4.692
  248    H2'    A  24          H2''        A  24   4.290  17.815  -4.599
  249   HO2'    A  24          H2'         A  24   5.196  17.362  -2.290
  250    H1'    A  24           H1'        A  24   4.920  20.606  -3.634
  251    H8     A  24           H8         A  24   2.758  18.423  -6.048
  252    H61    A  24           H61        A  24  -2.034  21.426  -3.578
  253    H62    A  24           H62        A  24  -1.541  20.107  -4.616
  254    H2     A  24           H2         A  24   1.727  23.271  -1.997
  255    H5'    U  25           H5'        U  25   7.915  16.587   0.138
  256   H5''    U  25          H5''        U  25   6.759  17.033  -1.125
  257    H4'    U  25           H4'        U  25   7.229  18.316   1.445
  258    H3'    U  25           H3'        U  25   5.174  17.798  -0.447
  259    H2'    U  25          H2''        U  25   5.310  19.740  -1.692
  260   HO2'    U  25          H2'         U  25   4.240  20.804   0.725
  261    H1'    U  25           H1'        U  25   6.392  21.350   0.582
  262    H3     U  25           H3         U  25   6.884  24.753  -2.296
  263    H5     U  25           H5         U  25   8.493  21.481  -4.408
  264    H6     U  25           H6         U  25   7.812  20.048  -2.571
  265    H5'    U  26           H5'        U  26   2.898  18.613  -1.750
  266   H5''    U  26          H5''        U  26   1.887  19.305  -0.467
  267    H4'    U  26           H4'        U  26   0.206  18.231  -1.630
  268    H3'    U  26           H3'        U  26   1.467  16.497   0.408
  269    H2'    U  26          H2''        U  26   0.993  14.444  -0.486
  270   HO2'    U  26          H2'         U  26  -1.205  14.578  -0.479
  271    H1'    U  26           H1'        U  26   0.691  14.964  -3.177
  272    H3     U  26           H3         U  26   4.000  11.913  -3.094
  273    H5     U  26           H5         U  26   5.773  15.325  -1.384
  274    H6     U  26           H6         U  26   3.611  16.419  -1.479
  275    H5'    C  27           H5'        C  27  -2.885  15.426   2.291
  276   H5''    C  27          H5''        C  27  -2.102  14.781   3.747
  277    H4'    C  27           H4'        C  27  -3.253  13.150   1.940
  278    H3'    C  27           H3'        C  27  -0.675  12.930   3.507
  279    H2'    C  27          H2''        C  27  -0.197  10.833   2.553
  280   HO2'    C  27          H2'         C  27  -2.151   9.792   2.751
  281    H1'    C  27           H1'        C  27  -1.090  11.471  -0.019
  282    H41    C  27           H41        C  27   5.241  12.128  -0.165
  283    H42    C  27           H42        C  27   5.177  13.461   0.967
  284    H5     C  27           H5         C  27   3.149  14.162   2.055
  285    H6     C  27           H6         C  27   0.746  13.756   2.278
  286    H5'    U  28           H5'        U  28  -3.262   9.180   4.793
  287   H5''    U  28          H5''        U  28  -2.616   8.731   6.384
  288    H4'    U  28           H4'        U  28  -2.544   6.935   4.494
  289    H3'    U  28           H3'        U  28  -0.389   7.857   6.386
  290    H2'    U  28          H2''        U  28   1.298   6.641   5.365
  291   HO2'    U  28          H2'         U  28   0.987   4.706   4.516
  292    H1'    U  28           H1'        U  28   0.379   6.673   2.734
  293    H3     U  28           H3         U  28   4.504   8.582   2.720
  294    H5     U  28           H5         U  28   1.999  11.511   4.411
  295    H6     U  28           H6         U  28   0.216   9.875   4.434
  296    H5'    U  29           H5'        U  29  -0.594   3.011   6.337
  297   H5''    U  29          H5''        U  29   0.340   2.579   7.783
  298    H4'    U  29           H4'        U  29   1.103   1.724   5.375
  299    H3'    U  29           H3'        U  29   2.636   2.705   7.772
  300    H2'    U  29          H2''        U  29   4.664   2.790   6.661
  301   HO2'    U  29          H2'         U  29   5.257   1.279   5.314
  302    H1'    U  29           H1'        U  29   3.780   3.355   4.071
  303    H3     U  29           H3         U  29   6.709   6.626   5.289
  304    H5     U  29           H5         U  29   3.271   7.411   7.588
  305    H6     U  29           H6         U  29   2.279   5.395   6.681
  306    H5'    A  30           H5'        A  30   5.035  -1.077   6.569
  307   H5''    A  30          H5''        A  30   5.841  -1.463   8.102
  308    H4'    A  30           H4'        A  30   7.266  -0.719   5.976
  309    H3'    A  30           H3'        A  30   7.514  -0.090   8.913
  310    H2'    A  30          H2''        A  30   9.083   1.552   8.603
  311   HO2'    A  30          H2'         A  30   9.859   0.010   6.363
  312    H1'    A  30           H1'        A  30   8.546   2.199   5.871
  313    H8     A  30           H8         A  30   5.673   3.016   8.202
  314    H61    A  30           H61        A  30   8.712   8.209   9.609
  315    H62    A  30           H62        A  30   7.159   7.405   9.628
  316    H2     A  30           H2         A  30  11.471   5.581   7.240
  317    H5'    A  31           H5'        A  31  11.865  -1.204   7.376
  318   H5''    A  31          H5''        A  31  12.431  -2.155   8.763
  319    H4'    A  31           H4'        A  31  14.046  -0.349   8.103
  320    H3'    A  31           H3'        A  31  12.678  -0.564  10.770
  321    H2'    A  31          H2''        A  31  13.347   1.502  11.517
  322   HO2'    A  31          H2'         A  31  15.590   1.080   9.843
  323    H1'    A  31           H1'        A  31  13.793   2.811   9.039
  324    H8     A  31           H8         A  31  10.332   1.371  10.011
  325    H61    A  31           H61        A  31   9.200   6.951  12.406
  326    H62    A  31           H62        A  31   8.499   5.419  11.935
  327    H2     A  31           H2         A  31  13.432   6.911  10.934
  328    H5'    A  32           H5'        A  32  17.583  -0.347  11.841
  329   H5''    A  32          H5''        A  32  17.405  -0.861  13.530
  330    H4'    A  32           H4'        A  32  18.528   1.484  12.942
  331    H3'    A  32           H3'        A  32  16.627   0.631  15.122
  332    H2'    A  32          H2''        A  32  16.244   2.779  15.854
  333   HO2'    A  32          H2'         A  32  17.919   3.960  16.257
  334    H1'    A  32           H1'        A  32  16.779   4.196  13.461
  335    H8     A  32           H8         A  32  14.010   1.525  13.408
  336    H61    A  32           H61        A  32  10.244   5.984  15.440
  337    H62    A  32           H62        A  32  10.332   4.380  14.749
  338    H2     A  32           H2         A  32  14.416   7.624  15.363
  339    H5'    A  33           H5'        A  33  20.250   2.927  17.360
  340   H5''    A  33          H5''        A  33  19.977   2.360  19.018
  341    H4'    A  33           H4'        A  33  19.853   4.958  18.441
  342    H3'    A  33           H3'        A  33  18.207   3.202  20.256
  343    H2'    A  33          H2''        A  33  16.623   4.825  20.662
  344   HO2'    A  33          H2'         A  33  18.022   6.366  21.485
  345    H1'    A  33           H1'        A  33  16.930   6.378  18.302
  346    H8     A  33           H8         A  33  15.936   2.735  17.735
  347    H61    A  33           H61        A  33  10.114   4.565  18.726
  348    H62    A  33           H62        A  33  11.131   3.300  18.073
  349    H2     A  33           H2         A  33  12.840   7.989  19.719
  350    H5'    A  34           H5'        A  34  19.747   6.591  23.073
  351   H5''    A  34          H5''        A  34  19.513   5.956  24.714
  352    H4'    A  34           H4'        A  34  18.124   8.070  23.863
  353    H3'    A  34           H3'        A  34  17.439   5.717  25.602
  354    H2'    A  34          H2''        A  34  15.155   6.030  25.487
  355   HO2'    A  34          H2'         A  34  14.243   7.982  25.687
  356    H1'    A  34           H1'        A  34  14.982   7.601  23.117
  357    H8     A  34           H8         A  34  16.280   4.102  22.523
  358    H61    A  34           H61        A  34  10.325   2.430  22.209
  359    H62    A  34           H62        A  34  11.978   1.913  21.966
  360    H2     A  34           H2         A  34  10.543   6.587  23.905
  361    H5'    C  35           H5'        C  35  16.874   6.262  29.556
  362   H5''    C  35          H5''        C  35  17.211   4.533  29.341
  363    H4'    C  35           H4'        C  35  14.879   6.143  28.423
  364    H3'    C  35           H3'        C  35  15.422   3.866  29.989
  365    H2'    C  35          H2''        C  35  15.643   2.298  28.377
  366   HO2'    C  35          H2'         C  35  12.847   2.780  28.233
  367    H1'    C  35           H1'        C  35  13.880   3.669  26.379
  368    H41    C  35           H41        C  35  17.191  -0.279  22.637
  369    H42    C  35           H42        C  35  18.706   0.327  23.267
  370    H5     C  35           H5         C  35  18.844   1.877  25.106
  371    H6     C  35           H6         C  35  17.561   3.291  26.641
  372    H5'    U  36           H5'        U  36  14.981   7.208  30.048
  373   H5''    U  36          H5''        U  36  14.493   7.651  31.695
  374    H4'    U  36           H4'        U  36  14.469   9.730  30.517
  375    H3'    U  36           H3'        U  36  11.904   8.313  31.029
  376    H2'    U  36          H2''        U  36  10.583   9.481  29.533
  377   HO2'    U  36          H2'         U  36  10.994  11.552  30.160
  378    H1'    U  36           H1'        U  36  12.370  10.003  27.510
  379    H3     U  36           H3         U  36   8.759   6.760  27.175
  380    H5     U  36           H5         U  36  12.532   4.957  26.708
  381    H6     U  36           H6         U  36  13.540   6.972  27.560
  382    H5'    A  37           H5'        A  37   9.572  11.467  33.615
  383   H5''    A  37          H5''        A  37   9.354  10.105  34.730
  384    H4'    A  37           H4'        A  37   7.282  11.102  33.372
  385    H3'    A  37           H3'        A  37   8.063   8.255  34.040
  386    H2'    A  37          H2''        A  37   6.222   7.385  32.887
  387   HO2'    A  37          H2'         A  37   5.214  10.051  32.783
  388    H1'    A  37           H1'        A  37   6.369   9.030  30.686
  389    H8     A  37           H8         A  37   9.929   8.344  31.179
  390    H61    A  37           H61        A  37   8.988   2.544  29.278
  391    H62    A  37           H62        A  37  10.177   3.802  29.536
  392    H2     A  37           H2         A  37   4.998   4.347  30.251
  393    H5'    C  38           H5'        C  38   4.303   9.199  35.827
  394   H5''    C  38          H5''        C  38   3.868   8.579  37.431
  395    H4'    C  38           H4'        C  38   2.226   7.816  35.757
  396    H3'    C  38           H3'        C  38   4.130   5.897  37.101
  397    H2'    C  38          H2''        C  38   3.368   4.077  35.865
  398   HO2'    C  38          H2'         C  38   1.359   3.927  35.024
  399    H1'    C  38           H1'        C  38   2.824   5.367  33.463
  400    H41    C  38           H41        C  38   8.273   2.093  32.815
  401    H42    C  38           H42        C  38   9.148   3.368  33.631
  402    H5     C  38           H5         C  38   8.092   5.342  34.492
  403    H6     C  38           H6         C  38   5.959   6.415  34.991
  404    H5'    A  39           H5'        A  39   0.433   4.375  39.838
  405   H5''    A  39          H5''        A  39   1.495   3.511  40.968
  406    H4'    A  39           H4'        A  39  -0.087   2.197  39.229
  407    H3'    A  39           H3'        A  39   2.713   1.659  40.261
  408    H2'    A  39          H2''        A  39   2.984  -0.191  38.805
  409   HO2'    A  39          H2'         A  39   1.326  -1.484  38.825
  410    H1'    A  39           H1'        A  39   1.611   0.776  36.640
  411    H8     A  39           H8         A  39   3.876   3.531  37.822
  412    H61    A  39           H61        A  39   8.618   0.407  35.390
  413    H62    A  39           H62        A  39   8.062   1.966  35.954
  414    H2     A  39           H2         A  39   5.037  -2.292  35.396
  415    H5'    A  40           H5'        A  40  -0.118  -1.457  40.495
  416   H5''    A  40          H5''        A  40  -0.418  -2.264  42.047
  417    H4'    A  40           H4'        A  40  -0.495  -3.997  40.382
  418    H3'    A  40           H3'        A  40   1.941  -3.744  42.116
  419    H2'    A  40          H2''        A  40   3.250  -5.230  40.916
  420   HO2'    A  40          H2'         A  40   1.851  -6.968  40.888
  421    H1'    A  40           H1'        A  40   2.328  -4.800  38.362
  422    H8     A  40           H8         A  40   3.010  -1.649  40.487
  423    H61    A  40           H61        A  40   8.844  -2.056  38.509
  424    H62    A  40           H62        A  40   7.660  -1.038  39.299
  425    H2     A  40           H2         A  40   6.627  -5.674  37.052
  426    H5'    A  41           H5'        A  41   0.942  -8.108  43.044
  427   H5''    A  41          H5''        A  41   1.937  -8.478  44.465
  428    H4'    A  41           H4'        A  41   2.606  -9.381  42.031
  429    H3'    A  41           H3'        A  41   4.223  -8.385  44.371
  430    H2'    A  41          H2''        A  41   6.192  -8.267  43.183
  431   HO2'    A  41          H2'         A  41   5.079 -10.329  41.585
  432    H1'    A  41           H1'        A  41   5.128  -7.973  40.552
  433    H8     A  41           H8         A  41   4.076  -5.105  42.741
  434    H61    A  41           H61        A  41   9.651  -2.639  41.716
  435    H62    A  41           H62        A  41   8.012  -2.323  42.238
  436    H2     A  41           H2         A  41   9.698  -6.860  40.196
  437    H5'    U  42           H5'        U  42   5.863 -13.094  44.402
  438   H5''    U  42          H5''        U  42   6.417 -13.002  46.085
  439    H4'    U  42           H4'        U  42   8.147 -13.491  44.119
  440    H3'    U  42           H3'        U  42   8.291 -11.917  46.662
  441    H2'    U  42          H2''        U  42  10.149 -10.695  46.108
  442   HO2'    U  42          H2'         U  42  10.883 -12.979  44.594
  443    H1'    U  42           H1'        U  42  10.116 -10.939  43.274
  444    H3     U  42           H3         U  42  10.853  -6.541  44.085
  445    H5     U  42           H5         U  42   6.829  -7.139  45.177
  446    H6     U  42           H6         U  42   7.164  -9.521  44.857
  447    H5'    C  43           H5'        C  43  11.619 -14.786  45.572
  448   H5''    C  43          H5''        C  43  12.376 -15.616  46.947
  449    H4'    C  43           H4'        C  43  14.073 -14.851  45.286
  450    H3'    C  43           H3'        C  43  13.903 -13.889  48.120
  451    H2'    C  43          H2''        C  43  15.461 -12.195  47.881
  452   HO2'    C  43          H2'         C  43  16.411 -13.546  45.563
  453    H1'    C  43           H1'        C  43  15.060 -11.492  45.225
  454    H41    C  43           H41        C  43  12.327  -6.901  48.697
  455    H42    C  43           H42        C  43  11.215  -8.042  49.419
  456    H5     C  43           H5         C  43  11.177 -10.376  48.855
  457    H6     C  43           H6         C  43  12.223 -12.138  47.515
  458    H5'    G  44           H5'        G  44  18.317 -15.261  48.389
  459   H5''    G  44          H5''        G  44  18.453 -15.409  50.153
  460    H4'    G  44           H4'        G  44  19.711 -13.447  48.855
  461    H3'    G  44           H3'        G  44  18.271 -13.556  51.499
  462    H2'    G  44          H2''        G  44  18.238 -11.284  51.777
  463   HO2'    G  44          H2'         G  44  20.693 -11.374  50.384
  464    H1'    G  44           H1'        G  44  18.626 -10.477  49.059
  465    H8     G  44           H8         G  44  15.325 -12.229  49.816
  466    H1     G  44           H1         G  44  15.420  -5.998  51.341
  467    H21    G  44           H21        G  44  17.489  -5.241  51.297
  468    H22    G  44           H22        G  44  18.823  -6.205  50.703
  469    H5'    A  45           H5'        A  45  23.000 -11.723  52.252
  470   H5''    A  45          H5''        A  45  22.975 -11.990  54.006
  471    H4'    A  45           H4'        A  45  23.603  -9.606  53.093
  472    H3'    A  45           H3'        A  45  21.838 -10.475  55.360
  473    H2'    A  45          H2''        A  45  20.893  -8.400  55.715
  474   HO2'    A  45          H2'         A  45  22.806  -7.276  56.024
  475    H1'    A  45           H1'        A  45  21.043  -7.303  53.149
  476    H8     A  45           H8         A  45  19.391 -10.731  53.235
  477    H61    A  45           H61        A  45  14.149  -7.775  54.622
  478    H62    A  45           H62        A  45  14.843  -9.264  54.020
  479    H2     A  45           H2         A  45  17.518  -4.826  54.881
  480    H5'    G  46           H5'        G  46  24.786  -8.244  58.189
  481   H5''    G  46          H5''        G  46  24.369  -9.095  59.690
  482    H4'    G  46           H4'        G  46  23.575  -6.577  59.283
  483    H3'    G  46           H3'        G  46  22.275  -8.963  60.577
  484    H2'    G  46          H2''        G  46  20.180  -8.029  60.651
  485   HO2'    G  46          H2'         G  46  21.587  -5.588  60.905
  486    H1'    G  46           H1'        G  46  20.472  -6.044  58.620
  487    H8     G  46           H8         G  46  20.700  -9.616  57.345
  488    H1     G  46           H1         G  46  14.693  -7.581  58.303
  489    H21    G  46           H21        G  46  14.707  -5.639  59.349
  490    H22    G  46           H22        G  46  16.174  -4.933  59.987
  491    H5'    C  47           H5'        C  47  22.199  -4.916  63.183
  492   H5''    C  47          H5''        C  47  22.032  -5.443  64.870
  493    H4'    C  47           H4'        C  47  20.411  -3.603  64.139
  494    H3'    C  47           H3'        C  47  19.703  -6.277  65.332
  495    H2'    C  47          H2''        C  47  17.411  -5.939  65.123
  496   HO2'    C  47          H2'         C  47  16.464  -3.966  65.072
  497    H1'    C  47           H1'        C  47  17.390  -4.528  62.726
  498    H41    C  47           H41        C  47  15.666 -10.516  61.409
  499    H42    C  47           H42        C  47  17.317 -11.059  61.586
  500    H5     C  47           H5         C  47  19.140  -9.576  62.134
  501    H6     C  47           H6         C  47  19.742  -7.297  62.784
  502    H5'    C  48           H5'        C  48  17.039  -3.832  67.139
  503   H5''    C  48          H5''        C  48  17.279  -3.818  68.898
  504    H4'    C  48           H4'        C  48  14.941  -4.230  68.586
  505    H3'    C  48           H3'        C  48  16.674  -6.619  69.175
  506   HO3'    C  48          H3T         C  48  15.551  -6.448  71.160
  507    H2'    C  48          H2''        C  48  14.952  -8.135  68.959
  508   HO2'    C  48          H2'         C  48  13.127  -5.960  69.213
  509    H1'    C  48           H1'        C  48  13.496  -6.822  66.953
  510    H41    C  48           H41        C  48  16.402 -11.645  63.999
  511    H42    C  48           H42        C  48  17.980 -11.059  64.480
  512    H5     C  48           H5         C  48  18.301  -8.991  65.673
  513    H6     C  48           H6         C  48  17.188  -7.210  66.930
  Start of MODEL    7
    1    H5'    G   1           H5'        G   1  10.761 -14.978  62.230
    2   H5''    G   1          H5''        G   1   9.754 -14.421  60.880
    3    H4'    G   1           H4'        G   1   8.434 -14.613  62.986
    4    H3'    G   1           H3'        G   1   8.979 -12.002  61.603
    5    H2'    G   1          H2''        G   1   7.915 -10.728  63.155
    6   HO2'    G   1          H2'         G   1   6.011 -11.642  63.562
    7    H1'    G   1           H1'        G   1   8.686 -12.129  65.422
    8    H8     G   1           H8         G   1   8.808  -9.244  64.783
    9    H1     G   1           H1         G   1  14.978 -10.491  63.678
   10    H21    G   1           H21        G   1  15.278 -12.653  63.350
   11    H22    G   1           H22        G   1  13.963 -13.805  63.401
   12   HO5'    G   1          H5T         G   1  11.010 -12.781  60.691
   13    H5'    G   2           H5'        G   2   5.807  -9.590  61.453
   14   H5''    G   2          H5''        G   2   6.053  -9.269  59.726
   15    H4'    G   2           H4'        G   2   6.830  -7.494  61.562
   16    H3'    G   2           H3'        G   2   8.020  -8.387  58.951
   17    H2'    G   2          H2''        G   2  10.058  -7.366  59.302
   18   HO2'    G   2          H2'         G   2   8.560  -5.560  60.884
   19    H1'    G   2           H1'        G   2  10.094  -7.273  62.127
   20    H8     G   2           H8         G   2   9.737 -10.748  60.685
   21    H1     G   2           H1         G   2  15.779  -8.637  60.725
   22    H21    G   2           H21        G   2  15.832  -6.497  61.268
   23    H22    G   2           H22        G   2  14.379  -5.539  61.440
   24    H5'    C   3           H5'        C   3   7.799  -3.491  59.356
   25   H5''    C   3          H5''        C   3   8.094  -2.952  57.693
   26    H4'    C   3           H4'        C   3   9.649  -2.095  59.673
   27    H3'    C   3           H3'        C   3  10.198  -2.893  56.835
   28    H2'    C   3          H2''        C   3  12.496  -2.970  57.064
   29   HO2'    C   3          H2'         C   3  12.159  -1.236  59.292
   30    H1'    C   3           H1'        C   3  12.729  -3.664  59.755
   31    H41    C   3           H41        C   3  14.356  -8.761  56.276
   32    H42    C   3           H42        C   3  12.689  -9.010  55.809
   33    H5     C   3           H5         C   3  10.889  -7.604  56.563
   34    H6     C   3           H6         C   3  10.308  -5.582  57.812
   35    H5'    U   4           H5'        U   4  12.888   0.204  57.507
   36   H5''    U   4          H5''        U   4  12.911   1.345  56.149
   37    H4'    U   4           H4'        U   4  15.171   0.390  56.570
   38    H3'    U   4           H3'        U   4  13.599  -0.084  54.048
   39    H2'    U   4          H2''        U   4  15.021  -1.680  53.236
   40   HO2'    U   4          H2'         U   4  17.236  -1.618  53.546
   41    H1'    U   4           H1'        U   4  16.292  -2.469  55.671
   42    H3     U   4           H3         U   4  15.429  -6.389  53.619
   43    H5     U   4           H5         U   4  11.597  -4.771  54.285
   44    H6     U   4           H6         U   4  12.663  -2.760  55.128
   45    H5'    C   5           H5'        C   5  17.970   0.918  52.977
   46   H5''    C   5          H5''        C   5  17.818   2.047  51.616
   47    H4'    C   5           H4'        C   5  19.438   0.299  51.035
   48    H3'    C   5           H3'        C   5  16.744   0.426  49.694
   49    H2'    C   5          H2''        C   5  16.992  -1.583  48.619
   50   HO2'    C   5          H2'         C   5  18.691  -1.450  47.366
   51    H1'    C   5           H1'        C   5  18.977  -2.769  50.297
   52    H41    C   5           H41        C   5  13.972  -6.661  50.433
   53    H42    C   5           H42        C   5  12.969  -5.426  51.152
   54    H5     C   5           H5         C   5  13.824  -3.259  51.797
   55    H6     C   5           H6         C   5  15.693  -1.689  51.535
   56    H5'    G   6           H5'        G   6  20.130   0.788  45.926
   57   H5''    G   6          H5''        G   6  18.930   1.089  44.654
   58    H4'    G   6           H4'        G   6  20.574  -1.013  44.514
   59    H3'    G   6           H3'        G   6  17.663  -0.655  43.799
   60    H2'    G   6          H2''        G   6  17.358  -2.919  43.336
   61   HO2'    G   6          H2'         G   6  18.966  -4.251  42.686
   62    H1'    G   6           H1'        G   6  19.056  -4.005  45.241
   63    H8     G   6           H8         G   6  16.794  -1.305  46.696
   64    H1     G   6           H1         G   6  13.919  -6.992  45.985
   65    H21    G   6           H21        G   6  15.227  -8.363  44.852
   66    H22    G   6           H22        G   6  16.718  -7.832  44.108
   67    H5'    A   7           H5'        A   7  19.414  -2.724  40.292
   68   H5''    A   7          H5''        A   7  18.260  -2.598  38.951
   69    H4'    A   7           H4'        A   7  18.656  -4.925  40.213
   70    H3'    A   7           H3'        A   7  16.193  -3.605  39.081
   71    H2'    A   7          H2''        A   7  14.747  -5.172  39.985
   72   HO2'    A   7          H2'         A   7  16.983  -6.873  39.820
   73    H1'    A   7           H1'        A   7  16.204  -5.877  42.284
   74    H8     A   7           H8         A   7  15.800  -2.179  42.400
   75    H61    A   7           H61        A   7   9.882  -3.045  43.957
   76    H62    A   7           H62        A   7  11.216  -1.913  43.946
   77    H2     A   7           H2         A   7  11.553  -6.982  42.611
   78    H5'    U   8           H5'        U   8  16.113  -7.714  36.979
   79   H5''    U   8          H5''        U   8  15.257  -7.382  35.461
   80    H4'    U   8           H4'        U   8  14.189  -9.077  37.147
   81    H3'    U   8           H3'        U   8  12.955  -6.788  35.627
   82    H2'    U   8          H2''        U   8  10.934  -6.923  36.725
   83   HO2'    U   8          H2'         U   8  10.230  -8.915  36.390
   84    H1'    U   8           H1'        U   8  11.811  -8.106  39.159
   85    H3     U   8           H3         U   8   9.168  -4.489  40.096
   86    H5     U   8           H5         U   8  12.974  -2.920  39.204
   87    H6     U   8           H6         U   8  13.626  -5.121  38.422
   88    H5'    U   9           H5'        U   9  10.444  -9.750  32.910
   89   H5''    U   9          H5''        U   9  10.355  -8.538  31.617
   90    H4'    U   9           H4'        U   9   8.181  -9.189  33.011
   91    H3'    U   9           H3'        U   9   9.209  -6.547  31.978
   92    H2'    U   9          H2''        U   9   7.635  -5.318  33.117
   93   HO2'    U   9          H2'         U   9   5.738  -5.978  32.418
   94    H1'    U   9           H1'        U   9   6.996  -7.228  35.161
   95    H3     U   9           H3         U   9   7.315  -3.268  37.297
   96    H5     U   9           H5         U   9  11.262  -4.055  36.046
   97    H6     U   9           H6         U   9  10.424  -5.979  34.823
   98    H5'    G  10           H5'        G  10   4.859  -7.388  30.623
   99   H5''    G  10          H5''        G  10   4.665  -6.700  28.998
  100    H4'    G  10           H4'        G  10   2.847  -6.100  30.735
  101    H3'    G  10           H3'        G  10   4.447  -4.271  28.958
  102    H2'    G  10          H2''        G  10   3.740  -2.348  29.983
  103   HO2'    G  10          H2'         G  10   1.374  -3.813  30.412
  104    H1'    G  10           H1'        G  10   2.969  -3.406  32.515
  105    H8     G  10           H8         G  10   6.651  -3.832  31.939
  106    H1     G  10           H1         G  10   5.025   2.222  33.317
  107    H21    G  10           H21        G  10   2.834   2.448  33.255
  108    H22    G  10           H22        G  10   1.779   1.169  32.699
  109    H5'    U  11           H5'        U  11  -0.337  -3.241  28.117
  110   H5''    U  11          H5''        U  11  -0.126  -2.286  26.637
  111    H4'    U  11           H4'        U  11  -1.313  -1.226  28.776
  112    H3'    U  11           H3'        U  11   0.654  -0.081  26.791
  113    H2'    U  11          H2''        U  11   0.828   1.934  27.947
  114   HO2'    U  11          H2'         U  11  -1.435   2.277  28.107
  115    H1'    U  11           H1'        U  11   0.530   0.949  30.556
  116    H3     U  11           H3         U  11   4.563   3.106  30.104
  117    H5     U  11           H5         U  11   5.183  -0.807  28.676
  118    H6     U  11           H6         U  11   2.785  -1.153  28.772
  119    H5'    A  12           H5'        A  12  -2.356   2.848  25.024
  120   H5''    A  12          H5''        A  12  -1.387   3.095  23.559
  121    H4'    A  12           H4'        A  12  -1.414   4.918  25.520
  122    H3'    A  12           H3'        A  12   0.865   3.882  23.807
  123    H2'    A  12          H2''        A  12   2.351   5.363  24.857
  124   HO2'    A  12          H2'         A  12   0.009   6.703  25.754
  125    H1'    A  12           H1'        A  12   1.304   5.129  27.419
  126    H8     A  12           H8         A  12   1.675   1.631  26.091
  127    H61    A  12           H61        A  12   7.794   2.249  26.698
  128    H62    A  12           H62        A  12   6.479   1.122  26.456
  129    H2     A  12           H2         A  12   5.914   6.250  27.453
  130    H5'    U  13           H5'        U  13   0.900   8.023  24.156
  131   H5''    U  13          H5''        U  13   1.395   8.894  22.692
  132    H4'    U  13           H4'        U  13   2.731   9.422  24.823
  133    H3'    U  13           H3'        U  13   3.797   8.542  22.144
  134    H2'    U  13          H2''        U  13   5.973   8.383  22.891
  135   HO2'    U  13          H2'         U  13   5.270  10.161  25.001
  136    H1'    U  13           H1'        U  13   5.478   7.848  25.628
  137    H3     U  13           H3         U  13   8.434   4.779  23.913
  138    H5     U  13           H5         U  13   4.629   3.540  22.593
  139    H6     U  13           H6         U  13   3.727   5.619  23.420
  140    H5'    U  14           H5'        U  14   6.005  11.769  23.773
  141   H5''    U  14          H5''        U  14   5.958  13.203  22.727
  142    H4'    U  14           H4'        U  14   8.222  13.018  23.558
  143    H3'    U  14           H3'        U  14   7.579  12.352  20.716
  144    H2'    U  14          H2''        U  14   9.551  11.291  20.231
  145   HO2'    U  14          H2'         U  14  11.358  12.239  20.706
  146    H1'    U  14           H1'        U  14  10.381  10.452  22.771
  147    H3     U  14           H3         U  14  10.482   6.639  20.363
  148    H5     U  14           H5         U  14   6.387   7.626  20.474
  149    H6     U  14           H6         U  14   6.985   9.709  21.565
  150    H5'    U  15           H5'        U  15  11.552  15.045  20.907
  151   H5''    U  15          H5''        U  15  11.674  15.710  19.267
  152    H4'    U  15           H4'        U  15  13.693  14.326  20.208
  153    H3'    U  15           H3'        U  15  12.317  14.225  17.536
  154    H2'    U  15          H2''        U  15  13.365  12.304  16.857
  155   HO2'    U  15          H2'         U  15  15.449  12.456  16.853
  156    H1'    U  15           H1'        U  15  14.100  11.234  19.402
  157    H3     U  15           H3         U  15  12.394   7.747  17.046
  158    H5     U  15           H5         U  15   9.053  10.149  17.951
  159    H6     U  15           H6         U  15  10.577  11.845  18.777
  160    H5'    U  16           H5'        U  16  16.864  14.315  16.632
  161   H5''    U  16          H5''        U  16  16.954  15.350  15.194
  162    H4'    U  16           H4'        U  16  18.086  13.151  14.835
  163    H3'    U  16           H3'        U  16  15.685  14.100  13.293
  164    H2'    U  16          H2''        U  16  15.300  12.091  12.262
  165   HO2'    U  16          H2'         U  16  17.032  11.621  11.134
  166    H1'    U  16           H1'        U  16  16.641  10.349  14.079
  167    H3     U  16           H3         U  16  12.741   8.194  13.533
  168    H5     U  16           H5         U  16  11.569  11.908  15.140
  169    H6     U  16           H6         U  16  13.882  12.628  14.992
  170    H5'    U  17           H5'        U  17  19.151  12.939   9.804
  171   H5''    U  17          H5''        U  17  18.243  13.626   8.445
  172    H4'    U  17           H4'        U  17  18.922  11.048   8.451
  173    H3'    U  17           H3'        U  17  16.417  12.481   7.573
  174    H2'    U  17          H2''        U  17  15.221  10.548   7.293
  175   HO2'    U  17          H2'         U  17  17.726   9.492   6.576
  176    H1'    U  17           H1'        U  17  16.748   8.817   8.981
  177    H3     U  17           H3         U  17  12.397   7.900   9.814
  178    H5     U  17           H5         U  17  12.929  11.798  11.327
  179    H6     U  17           H6         U  17  15.156  11.794  10.355
  180    H5'    A  18           H5'        A  18  18.472   9.858   3.761
  181   H5''    A  18          H5''        A  18  17.320  10.204   2.457
  182    H4'    A  18           H4'        A  18  17.879   7.687   3.171
  183    H3'    A  18           H3'        A  18  15.289   9.017   2.346
  184    H2'    A  18          H2''        A  18  14.066   7.062   2.723
  185   HO2'    A  18          H2'         A  18  16.559   5.687   2.677
  186    H1'    A  18           H1'        A  18  15.477   6.097   4.916
  187    H8     A  18           H8         A  18  14.767   9.621   5.797
  188    H61    A  18           H61        A  18   8.904   8.008   6.877
  189    H62    A  18           H62        A  18  10.084   9.297   6.971
  190    H2     A  18           H2         A  18  10.876   4.653   4.643
  191    H5'    A  19           H5'        A  19  15.895   5.821  -0.855
  192   H5''    A  19          H5''        A  19  14.660   6.069  -2.105
  193    H4'    A  19           H4'        A  19  14.473   4.059  -0.332
  194    H3'    A  19           H3'        A  19  12.405   5.864  -1.598
  195    H2'    A  19          H2''        A  19  10.685   5.022  -0.276
  196   HO2'    A  19          H2'         A  19  12.355   2.773   0.239
  197    H1'    A  19           H1'        A  19  12.175   4.469   2.053
  198    H8     A  19           H8         A  19  12.986   7.979   1.519
  199    H61    A  19           H61        A  19   7.269   9.460   3.318
  200    H62    A  19           H62        A  19   8.916  10.025   3.149
  201    H2     A  19           H2         A  19   7.349   5.064   2.399
  202    H5'    A  20           H5'        A  20  10.480   2.361  -4.078
  203   H5''    A  20          H5''        A  20   9.900   3.510  -5.300
  204    H4'    A  20           H4'        A  20   8.189   2.311  -3.644
  205    H3'    A  20           H3'        A  20   8.340   5.108  -4.753
  206    H2'    A  20          H2''        A  20   6.655   5.922  -3.380
  207   HO2'    A  20          H2'         A  20   4.946   4.685  -3.662
  208    H1'    A  20           H1'        A  20   6.980   4.243  -1.171
  209    H8     A  20           H8         A  20  10.195   6.028  -2.191
  210    H61    A  20           H61        A  20   8.017  11.000   0.756
  211    H62    A  20           H62        A  20   9.436  10.240   0.070
  212    H2     A  20           H2         A  20   4.749   7.932   0.615
  213    H5'    U  21           H5'        U  21   4.206   4.457  -5.676
  214   H5''    U  21          H5''        U  21   3.872   5.418  -7.129
  215    H4'    U  21           H4'        U  21   2.743   6.304  -5.047
  216    H3'    U  21           H3'        U  21   4.760   7.831  -6.699
  217    H2'    U  21          H2''        U  21   4.682   9.686  -5.281
  218   HO2'    U  21          H2'         U  21   2.967  10.185  -4.023
  219    H1'    U  21           H1'        U  21   4.375   8.354  -2.871
  220    H3     U  21           H3         U  21   8.369  10.455  -2.519
  221    H5     U  21           H5         U  21   9.006   7.654  -5.602
  222    H6     U  21           H6         U  21   6.692   6.971  -5.369
  223    H5'    U  22           H5'        U  22   0.440   9.162  -7.084
  224   H5''    U  22          H5''        U  22  -0.109   9.984  -8.558
  225    H4'    U  22           H4'        U  22  -0.589  11.240  -6.379
  226    H3'    U  22           H3'        U  22   0.988  12.248  -8.751
  227    H2'    U  22          H2''        U  22   1.793  14.086  -7.678
  228   HO2'    U  22          H2'         U  22  -0.020  15.223  -7.378
  229    H1'    U  22           H1'        U  22   1.161  13.279  -4.966
  230    H3     U  22           H3         U  22   5.101  15.774  -5.545
  231    H5     U  22           H5         U  22   6.042  11.675  -5.405
  232    H6     U  22           H6         U  22   3.685  11.194  -5.827
  233    H5'    A  23           H5'        A  23   0.751  15.195 -10.856
  234   H5''    A  23          H5''        A  23   1.645  15.126  -9.326
  235    H4'    A  23           H4'        A  23   1.609  17.388 -10.636
  236    H3'    A  23           H3'        A  23   1.477  16.708  -7.784
  237    H2'    A  23          H2''        A  23   0.242  18.460  -6.994
  238   HO2'    A  23          H2'         A  23   1.364  20.062  -9.061
  239    H1'    A  23           H1'        A  23  -0.940  19.531  -9.316
  240    H8     A  23           H8         A  23  -2.267  16.101  -9.104
  241    H61    A  23           H61        A  23  -5.845  17.886  -4.394
  242    H62    A  23           H62        A  23  -5.489  16.603  -5.528
  243    H2     A  23           H2         A  23  -2.738  21.050  -5.047
  244    H5'    A  24           H5'        A  24   5.187  19.105  -6.368
  245   H5''    A  24          H5''        A  24   5.030  18.157  -4.876
  246    H4'    A  24           H4'        A  24   3.728  20.619  -5.521
  247    H3'    A  24           H3'        A  24   3.935  18.630  -3.305
  248    H2'    A  24          H2''        A  24   1.791  18.802  -2.580
  249   HO2'    A  24          H2'         A  24   0.762  20.916  -2.493
  250    H1'    A  24           H1'        A  24   0.673  20.406  -4.745
  251    H8     A  24           H8         A  24   1.144  16.845  -5.637
  252    H61    A  24           H61        A  24  -4.154  15.613  -2.690
  253    H62    A  24           H62        A  24  -2.879  14.951  -3.688
  254    H2     A  24           H2         A  24  -2.872  19.775  -1.601
  255    H5'    U  25           H5'        U  25   6.668  20.416   0.480
  256   H5''    U  25          H5''        U  25   5.545  19.296  -0.311
  257    H4'    U  25           H4'        U  25   4.960  20.565   2.022
  258    H3'    U  25           H3'        U  25   3.618  19.033   0.062
  259    H2'    U  25          H2''        U  25   2.412  20.696  -1.002
  260   HO2'    U  25          H2'         U  25   0.441  20.841  -0.149
  261    H1'    U  25           H1'        U  25   2.290  22.500   1.372
  262    H3     U  25           H3         U  25   1.438  26.200  -0.994
  263    H5     U  25           H5         U  25   3.117  23.635  -3.884
  264    H6     U  25           H6         U  25   3.426  21.975  -2.145
  265    H5'    U  26           H5'        U  26   0.613  18.689  -0.863
  266   H5''    U  26          H5''        U  26  -0.227  18.196   0.620
  267    H4'    U  26           H4'        U  26  -1.070  16.736  -1.078
  268    H3'    U  26           H3'        U  26   0.949  15.696   0.850
  269    H2'    U  26          H2''        U  26   1.526  13.796  -0.310
  270   HO2'    U  26          H2'         U  26  -0.378  12.783  -0.534
  271    H1'    U  26           H1'        U  26   1.037  14.563  -2.938
  272    H3     U  26           H3         U  26   5.436  13.512  -2.892
  273    H5     U  26           H5         U  26   5.215  16.951  -0.476
  274    H6     U  26           H6         U  26   2.811  16.918  -0.754
  275    H5'    C  27           H5'        C  27  -2.555  12.585   1.891
  276   H5''    C  27          H5''        C  27  -1.917  11.957   3.423
  277    H4'    C  27           H4'        C  27  -1.955  10.401   1.268
  278    H3'    C  27           H3'        C  27   0.250  10.902   3.285
  279    H2'    C  27          H2''        C  27   1.668   9.381   2.219
  280   HO2'    C  27          H2'         C  27   0.847   7.556   1.611
  281    H1'    C  27           H1'        C  27   0.768   9.912  -0.407
  282    H41    C  27           H41        C  27   6.499  12.641   0.033
  283    H42    C  27           H42        C  27   5.908  13.788   1.214
  284    H5     C  27           H5         C  27   3.724  13.622   2.224
  285    H6     C  27           H6         C  27   1.550  12.494   2.131
  286    H5'    U  28           H5'        U  28  -1.729   6.786   4.180
  287   H5''    U  28          H5''        U  28  -1.398   6.144   5.800
  288    H4'    U  28           H4'        U  28  -0.507   4.722   3.873
  289    H3'    U  28           H3'        U  28   1.081   5.912   6.148
  290    H2'    U  28          H2''        U  28   3.127   5.239   5.312
  291   HO2'    U  28          H2'         U  28   3.417   3.363   4.343
  292    H1'    U  28           H1'        U  28   2.528   5.268   2.570
  293    H3     U  28           H3         U  28   6.179   7.909   3.231
  294    H5     U  28           H5         U  28   2.935  10.209   4.608
  295    H6     U  28           H6         U  28   1.520   8.265   4.323
  296    H5'    U  29           H5'        U  29   2.034   1.163   5.769
  297   H5''    U  29          H5''        U  29   2.845   0.823   7.309
  298    H4'    U  29           H4'        U  29   4.094   0.372   5.001
  299    H3'    U  29           H3'        U  29   5.036   1.484   7.637
  300    H2'    U  29          H2''        U  29   7.113   2.097   6.828
  301   HO2'    U  29          H2'         U  29   8.208   0.887   5.476
  302    H1'    U  29           H1'        U  29   6.454   2.600   4.147
  303    H3     U  29           H3         U  29   8.488   6.315   5.837
  304    H5     U  29           H5         U  29   4.713   6.264   7.702
  305    H6     U  29           H6         U  29   4.266   4.151   6.602
  306    H5'    A  30           H5'        A  30   8.230  -1.626   6.410
  307   H5''    A  30          H5''        A  30   8.977  -2.072   7.956
  308    H4'    A  30           H4'        A  30  10.434  -0.906   6.073
  309    H3'    A  30           H3'        A  30  10.324  -0.522   9.059
  310    H2'    A  30          H2''        A  30  11.639   1.359   9.036
  311   HO2'    A  30          H2'         A  30  13.464   1.367   7.993
  312    H1'    A  30           H1'        A  30  11.233   2.176   6.330
  313    H8     A  30           H8         A  30   8.082   2.283   8.435
  314    H61    A  30           H61        A  30  10.055   7.738  10.562
  315    H62    A  30           H62        A  30   8.671   6.686  10.371
  316    H2     A  30           H2         A  30  13.398   5.864   8.230
  317    H5'    A  31           H5'        A  31  14.655  -0.524   7.900
  318   H5''    A  31          H5''        A  31  15.436  -1.621   9.055
  319    H4'    A  31           H4'        A  31  16.686   0.485   8.985
  320    H3'    A  31           H3'        A  31  15.057  -0.273  11.402
  321    H2'    A  31          H2''        A  31  15.313   1.761  12.437
  322   HO2'    A  31          H2'         A  31  17.756   1.975  10.995
  323    H1'    A  31           H1'        A  31  15.903   3.372  10.154
  324    H8     A  31           H8         A  31  12.528   1.526  10.656
  325    H61    A  31           H61        A  31  10.616   6.768  13.310
  326    H62    A  31           H62        A  31  10.121   5.217  12.670
  327    H2     A  31           H2         A  31  14.948   7.243  12.249
  328    H5'    A  32           H5'        A  32  19.685   0.529  13.206
  329   H5''    A  32          H5''        A  32  19.339  -0.196  14.788
  330    H4'    A  32           H4'        A  32  20.148   2.335  14.613
  331    H3'    A  32           H3'        A  32  18.063   1.007  16.348
  332    H2'    A  32          H2''        A  32  17.331   3.015  17.224
  333   HO2'    A  32          H2'         A  32  18.676   4.551  17.796
  334    H1'    A  32           H1'        A  32  18.039   4.717  15.064
  335    H8     A  32           H8         A  32  15.609   1.786  14.443
  336    H61    A  32           H61        A  32  11.134   5.704  16.135
  337    H62    A  32           H62        A  32  11.488   4.177  15.357
  338    H2     A  32           H2         A  32  15.075   7.760  16.721
  339    H5'    A  33           H5'        A  33  20.926   3.487  19.269
  340   H5''    A  33          H5''        A  33  20.513   2.762  20.833
  341    H4'    A  33           H4'        A  33  20.096   5.353  20.399
  342    H3'    A  33           H3'        A  33  18.449   3.260  21.820
  343    H2'    A  33          H2''        A  33  16.651   4.672  22.104
  344   HO2'    A  33          H2'         A  33  17.024   6.543  22.954
  345    H1'    A  33           H1'        A  33  17.151   6.458  19.935
  346    H8     A  33           H8         A  33  16.527   2.806  19.001
  347    H61    A  33           H61        A  33  10.500   4.176  19.210
  348    H62    A  33           H62        A  33  11.693   3.010  18.682
  349    H2     A  33           H2         A  33  12.786   7.698  20.788
  350    H5'    A  34           H5'        A  34  19.144   6.807  24.778
  351   H5''    A  34          H5''        A  34  18.803   6.159  26.394
  352    H4'    A  34           H4'        A  34  17.358   8.170  25.427
  353    H3'    A  34           H3'        A  34  16.623   5.725  27.022
  354    H2'    A  34          H2''        A  34  14.356   6.004  26.740
  355   HO2'    A  34          H2'         A  34  14.882   8.790  26.461
  356    H1'    A  34           H1'        A  34  14.392   7.642  24.394
  357    H8     A  34           H8         A  34  15.722   4.160  23.766
  358    H61    A  34           H61        A  34   9.807   2.499  22.985
  359    H62    A  34           H62        A  34  11.476   2.018  22.778
  360    H2     A  34           H2         A  34   9.903   6.625  24.768
  361    H5'    C  35           H5'        C  35  15.725   5.984  30.949
  362   H5''    C  35          H5''        C  35  16.112   4.288  30.601
  363    H4'    C  35           H4'        C  35  13.800   5.940  29.669
  364    H3'    C  35           H3'        C  35  14.281   3.591  31.144
  365    H2'    C  35          H2''        C  35  14.644   2.120  29.471
  366   HO2'    C  35          H2'         C  35  12.749   1.223  29.886
  367    H1'    C  35           H1'        C  35  12.962   3.557  27.445
  368    H41    C  35           H41        C  35  16.579  -0.119  23.703
  369    H42    C  35           H42        C  35  18.040   0.502  24.438
  370    H5     C  35           H5         C  35  18.034   1.970  26.349
  371    H6     C  35           H6         C  35  16.628   3.264  27.885
  372    H5'    U  36           H5'        U  36  14.258   7.232  31.141
  373   H5''    U  36          H5''        U  36  13.232   7.624  32.535
  374    H4'    U  36           H4'        U  36  13.761   9.672  31.233
  375    H3'    U  36           H3'        U  36  11.060   8.491  31.636
  376    H2'    U  36          H2''        U  36   9.938   9.690  30.006
  377   HO2'    U  36          H2'         U  36  12.094  11.549  30.081
  378    H1'    U  36           H1'        U  36  11.880   9.953  28.080
  379    H3     U  36           H3         U  36   8.018   7.038  27.667
  380    H5     U  36           H5         U  36  11.611   4.853  27.585
  381    H6     U  36           H6         U  36  12.767   6.818  28.373
  382    H5'    A  37           H5'        A  37   8.890  11.963  33.994
  383   H5''    A  37          H5''        A  37   8.503  10.663  35.138
  384    H4'    A  37           H4'        A  37   6.590  11.798  33.663
  385    H3'    A  37           H3'        A  37   7.073   8.906  34.426
  386    H2'    A  37          H2''        A  37   5.178   8.206  33.242
  387   HO2'    A  37          H2'         A  37   4.463  10.958  33.026
  388    H1'    A  37           H1'        A  37   5.562   9.782  31.016
  389    H8     A  37           H8         A  37   9.007   8.703  31.580
  390    H61    A  37           H61        A  37   7.424   3.029  29.713
  391    H62    A  37           H62        A  37   8.751   4.099  30.103
  392    H2     A  37           H2         A  37   3.662   5.277  30.664
  393    H5'    C  38           H5'        C  38   3.461  10.330  36.210
  394   H5''    C  38          H5''        C  38   2.910   9.789  37.808
  395    H4'    C  38           H4'        C  38   1.265   9.138  36.097
  396    H3'    C  38           H3'        C  38   2.959   7.075  37.510
  397    H2'    C  38          H2''        C  38   2.070   5.317  36.265
  398   HO2'    C  38          H2'         C  38  -0.079   7.071  35.637
  399    H1'    C  38           H1'        C  38   1.684   6.646  33.843
  400    H41    C  38           H41        C  38   6.816   2.894  33.213
  401    H42    C  38           H42        C  38   7.794   4.072  34.058
  402    H5     C  38           H5         C  38   6.909   6.121  34.940
  403    H6     C  38           H6         C  38   4.879   7.382  35.421
  404    H5'    A  39           H5'        A  39  -0.840   5.796  40.121
  405   H5''    A  39          H5''        A  39   0.147   4.912  41.301
  406    H4'    A  39           H4'        A  39  -1.392   3.630  39.501
  407    H3'    A  39           H3'        A  39   1.343   3.023  40.664
  408    H2'    A  39          H2''        A  39   1.651   1.185  39.217
  409   HO2'    A  39          H2'         A  39  -1.176   1.219  38.862
  410    H1'    A  39           H1'        A  39   0.263   2.125  37.021
  411    H8     A  39           H8         A  39   2.717   4.754  38.150
  412    H61    A  39           H61        A  39   7.206   1.323  35.644
  413    H62    A  39           H62        A  39   6.765   2.914  36.226
  414    H2     A  39           H2         A  39   3.453  -1.128  35.697
  415    H5'    A  40           H5'        A  40  -1.681  -0.014  40.511
  416   H5''    A  40          H5''        A  40  -2.047  -0.789  42.065
  417    H4'    A  40           H4'        A  40  -2.294  -2.502  40.391
  418    H3'    A  40           H3'        A  40   0.151  -2.488  42.135
  419    H2'    A  40          H2''        A  40   1.313  -4.090  40.937
  420   HO2'    A  40          H2'         A  40  -0.337  -5.647  40.951
  421    H1'    A  40           H1'        A  40   0.424  -3.590  38.381
  422    H8     A  40           H8         A  40   1.449  -0.512  40.481
  423    H61    A  40           H61        A  40   7.160  -1.470  38.328
  424    H62    A  40           H62        A  40   6.149  -0.446  39.323
  425    H2     A  40           H2         A  40   4.587  -4.908  37.031
  426    H5'    A  41           H5'        A  41  -1.082  -6.734  43.033
  427   H5''    A  41          H5''        A  41  -0.105  -7.143  44.456
  428    H4'    A  41           H4'        A  41   0.545  -8.045  42.014
  429    H3'    A  41           H3'        A  41   2.206  -7.106  44.354
  430    H2'    A  41          H2''        A  41   4.163  -7.106  43.147
  431   HO2'    A  41          H2'         A  41   2.945  -9.131  41.571
  432    H1'    A  41           H1'        A  41   3.046  -6.848  40.515
  433    H8     A  41           H8         A  41   2.343  -3.786  42.570
  434    H61    A  41           H61        A  41   8.123  -1.972  41.333
  435    H62    A  41           H62        A  41   6.539  -1.460  41.871
  436    H2     A  41           H2         A  41   7.695  -6.242  40.025
  437    H5'    U  42           H5'        U  42   3.934 -11.395  42.983
  438   H5''    U  42          H5''        U  42   4.450 -12.012  44.564
  439    H4'    U  42           H4'        U  42   6.225 -12.086  42.717
  440    H3'    U  42           H3'        U  42   6.435 -10.869  45.454
  441    H2'    U  42          H2''        U  42   8.392  -9.743  45.052
  442   HO2'    U  42          H2'         U  42   8.944 -11.821  43.195
  443    H1'    U  42           H1'        U  42   8.315  -9.610  42.207
  444    H3     U  42           H3         U  42   9.409  -5.415  43.528
  445    H5     U  42           H5         U  42   5.402  -5.868  44.750
  446    H6     U  42           H6         U  42   5.537  -8.204  44.100
  447    H5'    C  43           H5'        C  43   9.212 -14.199  44.059
  448   H5''    C  43          H5''        C  43   9.958 -15.217  45.308
  449    H4'    C  43           H4'        C  43  11.563 -14.615  43.478
  450    H3'    C  43           H3'        C  43  11.865 -13.916  46.375
  451    H2'    C  43          H2''        C  43  13.584 -12.424  46.093
  452   HO2'    C  43          H2'         C  43  14.258 -14.095  43.930
  453    H1'    C  43           H1'        C  43  13.185 -11.660  43.401
  454    H41    C  43           H41        C  43  12.259  -6.487  46.982
  455    H42    C  43           H42        C  43  10.855  -7.203  47.736
  456    H5     C  43           H5         C  43  10.038  -9.401  47.179
  457    H6     C  43           H6         C  43  10.427 -11.406  45.825
  458    H5'    G  44           H5'        G  44  16.216 -16.058  45.516
  459   H5''    G  44          H5''        G  44  16.560 -16.382  47.226
  460    H4'    G  44           H4'        G  44  18.173 -14.810  45.819
  461    H3'    G  44           H3'        G  44  17.130 -14.652  48.636
  462    H2'    G  44          H2''        G  44  17.912 -12.514  49.006
  463   HO2'    G  44          H2'         G  44  20.064 -12.942  48.507
  464    H1'    G  44           H1'        G  44  17.874 -11.515  46.377
  465    H8     G  44           H8         G  44  14.611 -12.996  47.794
  466    H1     G  44           H1         G  44  15.649  -6.858  49.332
  467    H21    G  44           H21        G  44  17.642  -6.228  48.626
  468    H22    G  44           H22        G  44  18.794  -7.358  47.952
  469    H5'    A  45           H5'        A  45  21.743 -14.299  49.577
  470   H5''    A  45          H5''        A  45  21.701 -14.752  51.291
  471    H4'    A  45           H4'        A  45  22.378 -12.279  50.557
  472    H3'    A  45           H3'        A  45  20.765 -13.365  52.856
  473    H2'    A  45          H2''        A  45  19.893 -11.337  53.456
  474   HO2'    A  45          H2'         A  45  21.077  -9.379  53.151
  475    H1'    A  45           H1'        A  45  20.307  -9.895  51.017
  476    H8     A  45           H8         A  45  17.792 -12.777  50.931
  477    H61    A  45           H61        A  45  13.619  -8.672  52.922
  478    H62    A  45           H62        A  45  13.854 -10.242  52.186
  479    H2     A  45           H2         A  45  17.657  -6.724  53.054
  480    H5'    G  46           H5'        G  46  24.726 -10.605  55.004
  481   H5''    G  46          H5''        G  46  24.340 -11.309  56.586
  482    H4'    G  46           H4'        G  46  24.547  -8.669  56.303
  483    H3'    G  46           H3'        G  46  22.763 -10.444  57.920
  484    H2'    G  46          H2''        G  46  21.164  -8.862  58.390
  485   HO2'    G  46          H2'         G  46  21.775  -7.015  59.161
  486    H1'    G  46           H1'        G  46  21.516  -7.069  56.249
  487    H8     G  46           H8         G  46  20.781 -10.549  55.014
  488    H1     G  46           H1         G  46  15.572  -7.434  57.070
  489    H21    G  46           H21        G  46  16.157  -5.557  58.069
  490    H22    G  46           H22        G  46  17.826  -5.168  58.420
  491    H5'    C  47           H5'        C  47  24.544  -6.831  60.859
  492   H5''    C  47          H5''        C  47  24.062  -7.460  62.446
  493    H4'    C  47           H4'        C  47  23.229  -5.060  61.635
  494    H3'    C  47           H3'        C  47  21.840  -7.287  63.120
  495    H2'    C  47          H2''        C  47  19.781  -6.177  63.124
  496   HO2'    C  47          H2'         C  47  20.704  -4.128  63.767
  497    H1'    C  47           H1'        C  47  19.890  -5.124  60.566
  498    H41    C  47           H41        C  47  16.458 -10.487  60.279
  499    H42    C  47           H42        C  47  17.912 -11.450  60.366
  500    H5     C  47           H5         C  47  20.118 -10.494  60.584
  501    H6     C  47           H6         C  47  21.388  -8.418  60.772
  502    H5'    C  48           H5'        C  48  21.385  -4.039  65.776
  503   H5''    C  48          H5''        C  48  21.510  -4.455  67.496
  504    H4'    C  48           H4'        C  48  19.221  -3.647  66.867
  505    H3'    C  48           H3'        C  48  19.793  -6.443  67.842
  506   HO3'    C  48          H3T         C  48  18.516  -4.139  68.945
  507    H2'    C  48          H2''        C  48  17.611  -7.114  67.633
  508   HO2'    C  48          H2'         C  48  16.074  -5.894  68.353
  509    H1'    C  48           H1'        C  48  16.864  -5.331  65.526
  510    H41    C  48           H41        C  48  16.467 -11.245  63.204
  511    H42    C  48           H42        C  48  18.184 -11.222  62.870
  512    H5     C  48           H5         C  48  19.645  -9.450  63.598
  513    H6     C  48           H6         C  48  19.801  -7.445  65.017
  Start of MODEL    8
    1    H5'    G   1           H5'        G   1   8.368 -15.311  61.861
    2   H5''    G   1          H5''        G   1   7.484 -14.435  60.594
    3    H4'    G   1           H4'        G   1   6.870 -13.425  62.705
    4    H3'    G   1           H3'        G   1   8.659 -12.002  60.782
    5    H2'    G   1          H2''        G   1   9.412 -10.370  62.244
    6   HO2'    G   1          H2'         G   1   8.194  -9.535  63.840
    7    H1'    G   1           H1'        G   1   9.349 -11.701  64.660
    8    H8     G   1           H8         G   1  11.044 -13.974  62.197
    9    H1     G   1           H1         G   1  14.690  -8.924  63.717
   10    H21    G   1           H21        G   1  13.530  -7.480  64.915
   11    H22    G   1           H22        G   1  11.810  -7.657  65.181
   12   HO5'    G   1          H5T         G   1   9.793 -14.852  60.234
   13    H5'    G   2           H5'        G   2   4.914  -8.800  60.525
   14   H5''    G   2          H5''        G   2   5.265  -8.311  58.856
   15    H4'    G   2           H4'        G   2   5.430  -6.546  60.846
   16    H3'    G   2           H3'        G   2   6.976  -7.009  58.331
   17    H2'    G   2          H2''        G   2   8.847  -5.803  58.907
   18   HO2'    G   2          H2'         G   2   7.117  -4.317  60.604
   19    H1'    G   2           H1'        G   2   8.761  -5.929  61.703
   20    H8     G   2           H8         G   2   8.667  -9.420  60.344
   21    H1     G   2           H1         G   2  14.469  -6.735  59.884
   22    H21    G   2           H21        G   2  14.341  -4.577  60.324
   23    H22    G   2           H22        G   2  12.809  -3.759  60.541
   24    H5'    C   3           H5'        C   3   6.705  -2.586  59.096
   25   H5''    C   3          H5''        C   3   6.491  -1.754  57.544
   26    H4'    C   3           H4'        C   3   8.453  -0.937  58.983
   27    H3'    C   3           H3'        C   3   8.456  -1.811  56.116
   28    H2'    C   3          H2''        C   3  10.739  -1.924  55.902
   29   HO2'    C   3          H2'         C   3  10.826   0.038  57.956
   30    H1'    C   3           H1'        C   3  11.498  -2.315  58.597
   31    H41    C   3           H41        C   3  13.122  -7.585  55.417
   32    H42    C   3           H42        C   3  11.455  -7.903  54.997
   33    H5     C   3           H5         C   3   9.625  -6.486  55.691
   34    H6     C   3           H6         C   3   9.013  -4.461  56.920
   35    H5'    U   4           H5'        U   4  10.782   2.367  55.633
   36   H5''    U   4          H5''        U   4  10.356   2.620  53.930
   37    H4'    U   4           H4'        U   4  12.895   2.331  54.605
   38    H3'    U   4           H3'        U   4  11.286   1.238  52.311
   39    H2'    U   4          H2''        U   4  12.890  -0.255  51.637
   40   HO2'    U   4          H2'         U   4  14.907   0.336  51.412
   41    H1'    U   4           H1'        U   4  14.363  -0.509  54.063
   42    H3     U   4           H3         U   4  13.815  -4.788  52.750
   43    H5     U   4           H5         U   4   9.871  -3.444  53.373
   44    H6     U   4           H6         U   4  10.762  -1.240  53.844
   45    H5'    C   5           H5'        C   5  15.255   3.543  50.251
   46   H5''    C   5          H5''        C   5  14.691   3.458  48.571
   47    H4'    C   5           H4'        C   5  17.006   2.342  49.277
   48    H3'    C   5           H3'        C   5  14.820   1.493  47.393
   49    H2'    C   5          H2''        C   5  15.621  -0.642  47.114
   50   HO2'    C   5          H2'         C   5  18.169   0.460  47.722
   51    H1'    C   5           H1'        C   5  17.091  -0.930  49.522
   52    H41    C   5           H41        C   5  12.415  -5.251  49.471
   53    H42    C   5           H42        C   5  11.202  -3.999  49.599
   54    H5     C   5           H5         C   5  11.743  -1.653  49.750
   55    H6     C   5           H6         C   5  13.553  -0.001  49.675
   56    H5'    G   6           H5'        G   6  19.162   1.075  45.435
   57   H5''    G   6          H5''        G   6  18.849   1.250  43.698
   58    H4'    G   6           H4'        G   6  20.224  -0.803  44.360
   59    H3'    G   6           H3'        G   6  17.647  -0.794  42.786
   60    H2'    G   6          H2''        G   6  17.584  -3.116  42.648
   61   HO2'    G   6          H2'         G   6  19.329  -4.299  42.445
   62    H1'    G   6           H1'        G   6  18.712  -3.730  45.122
   63    H8     G   6           H8         G   6  15.904  -1.111  45.198
   64    H1     G   6           H1         G   6  13.830  -7.169  44.871
   65    H21    G   6           H21        G   6  15.538  -8.544  44.637
   66    H22    G   6           H22        G   6  17.169  -7.970  44.370
   67    H5'    A   7           H5'        A   7  20.210  -2.768  39.551
   68   H5''    A   7          H5''        A   7  19.140  -2.597  38.146
   69    H4'    A   7           H4'        A   7  19.519  -4.977  39.311
   70    H3'    A   7           H3'        A   7  17.047  -3.679  38.140
   71    H2'    A   7          H2''        A   7  15.701  -5.452  38.788
   72   HO2'    A   7          H2'         A   7  18.055  -7.034  39.033
   73    H1'    A   7           H1'        A   7  17.121  -6.224  41.102
   74    H8     A   7           H8         A   7  16.194  -2.594  41.380
   75    H61    A   7           H61        A   7  10.407  -4.384  42.610
   76    H62    A   7           H62        A   7  11.556  -3.070  42.711
   77    H2     A   7           H2         A   7  12.726  -7.992  41.298
   78    H5'    U   8           H5'        U   8  17.274  -7.481  35.435
   79   H5''    U   8          H5''        U   8  16.272  -6.973  34.061
   80    H4'    U   8           H4'        U   8  15.491  -8.961  35.668
   81    H3'    U   8           H3'        U   8  13.965  -6.718  34.337
   82    H2'    U   8          H2''        U   8  12.001  -7.229  35.439
   83   HO2'    U   8          H2'         U   8  11.985  -9.405  34.696
   84    H1'    U   8           H1'        U   8  13.130  -8.471  37.753
   85    H3     U   8           H3         U   8   9.909  -5.407  38.929
   86    H5     U   8           H5         U   8  13.476  -3.231  38.390
   87    H6     U   8           H6         U   8  14.455  -5.210  37.389
   88    H5'    U   9           H5'        U   9  11.752  -9.744  31.337
   89   H5''    U   9          H5''        U   9  11.521  -8.404  30.198
   90    H4'    U   9           H4'        U   9   9.437  -9.499  31.453
   91    H3'    U   9           H3'        U   9  10.108  -6.644  30.742
   92    H2'    U   9          H2''        U   9   8.377  -5.770  31.977
   93   HO2'    U   9          H2'         U   9   6.651  -6.679  31.028
   94    H1'    U   9           H1'        U   9   7.987  -7.955  33.791
   95    H3     U   9           H3         U   9   7.795  -4.210  36.310
   96    H5     U   9           H5         U   9  11.816  -4.378  35.058
   97    H6     U   9           H6         U   9  11.233  -6.273  33.656
   98    H5'    G  10           H5'        G  10   5.793  -7.994  29.137
   99   H5''    G  10          H5''        G  10   5.656  -7.111  27.604
  100    H4'    G  10           H4'        G  10   3.597  -7.031  29.148
  101    H3'    G  10           H3'        G  10   5.085  -4.731  27.898
  102    H2'    G  10          H2''        G  10   3.906  -3.111  29.044
  103   HO2'    G  10          H2'         G  10   1.820  -3.240  29.279
  104    H1'    G  10           H1'        G  10   3.290  -4.515  31.386
  105    H8     G  10           H8         G  10   6.989  -4.660  30.792
  106    H1     G  10           H1         G  10   5.013   1.133  32.723
  107    H21    G  10           H21        G  10   2.810   1.230  32.679
  108    H22    G  10           H22        G  10   1.834  -0.049  31.994
  109    H5'    U  11           H5'        U  11   0.532  -3.954  26.673
  110   H5''    U  11          H5''        U  11   0.752  -2.788  25.355
  111    H4'    U  11           H4'        U  11  -0.541  -2.099  27.590
  112    H3'    U  11           H3'        U  11   1.430  -0.589  25.862
  113    H2'    U  11          H2''        U  11   1.403   1.259  27.296
  114   HO2'    U  11          H2'         U  11  -0.314   1.848  28.402
  115    H1'    U  11           H1'        U  11   1.172  -0.123  29.715
  116    H3     U  11           H3         U  11   5.059   2.329  29.563
  117    H5     U  11           H5         U  11   5.927  -1.347  27.699
  118    H6     U  11           H6         U  11   3.553  -1.840  27.710
  119    H5'    A  12           H5'        A  12  -1.679   2.381  24.270
  120   H5''    A  12          H5''        A  12  -0.629   2.848  22.919
  121    H4'    A  12           H4'        A  12  -0.917   4.423  25.076
  122    H3'    A  12           H3'        A  12   1.529   3.761  23.404
  123    H2'    A  12          H2''        A  12   2.833   5.200  24.717
  124   HO2'    A  12          H2'         A  12   0.358   6.250  25.651
  125    H1'    A  12           H1'        A  12   1.663   4.584  27.159
  126    H8     A  12           H8         A  12   2.377   1.271  25.580
  127    H61    A  12           H61        A  12   8.416   2.378  26.280
  128    H62    A  12           H62        A  12   7.206   1.158  25.952
  129    H2     A  12           H2         A  12   6.185   6.121  27.345
  130    H5'    U  13           H5'        U  13   1.566   7.755  24.282
  131   H5''    U  13          H5''        U  13   1.968   8.766  22.882
  132    H4'    U  13           H4'        U  13   3.417   9.171  24.933
  133    H3'    U  13           H3'        U  13   4.437   8.333  22.211
  134    H2'    U  13          H2''        U  13   6.630   8.269  22.949
  135   HO2'    U  13          H2'         U  13   5.756  10.088  24.940
  136    H1'    U  13           H1'        U  13   6.139   7.608  25.655
  137    H3     U  13           H3         U  13   9.204   4.766  23.710
  138    H5     U  13           H5         U  13   5.407   3.343  22.558
  139    H6     U  13           H6         U  13   4.435   5.343  23.503
  140    H5'    U  14           H5'        U  14   6.879  11.376  23.726
  141   H5''    U  14          H5''        U  14   6.931  12.756  22.612
  142    H4'    U  14           H4'        U  14   9.213  12.281  23.309
  143    H3'    U  14           H3'        U  14   8.284  11.643  20.528
  144    H2'    U  14          H2''        U  14  10.103  10.378  19.961
  145   HO2'    U  14          H2'         U  14  12.171  10.818  20.726
  146    H1'    U  14           H1'        U  14  11.067   9.669  22.536
  147    H3     U  14           H3         U  14  11.125   5.725  20.352
  148    H5     U  14           H5         U  14   7.037   6.746  20.434
  149    H6     U  14           H6         U  14   7.662   8.890  21.387
  150    H5'    U  15           H5'        U  15  12.417  14.429  20.445
  151   H5''    U  15          H5''        U  15  12.545  14.814  18.719
  152    H4'    U  15           H4'        U  15  14.555  13.605  19.974
  153    H3'    U  15           H3'        U  15  13.357  13.269  17.239
  154    H2'    U  15          H2''        U  15  14.443  11.301  16.784
  155   HO2'    U  15          H2'         U  15  16.465  12.273  18.517
  156    H1'    U  15           H1'        U  15  14.993  10.411  19.428
  157    H3     U  15           H3         U  15  13.336   6.900  17.005
  158    H5     U  15           H5         U  15   9.982   9.242  18.006
  159    H6     U  15           H6         U  15  11.498  10.954  18.813
  160    H5'    U  16           H5'        U  16  17.785  13.123  16.377
  161   H5''    U  16          H5''        U  16  17.954  14.165  14.951
  162    H4'    U  16           H4'        U  16  18.908  11.920  14.515
  163    H3'    U  16           H3'        U  16  16.489  12.992  13.089
  164    H2'    U  16          H2''        U  16  15.939  11.005  12.092
  165   HO2'    U  16          H2'         U  16  17.396   9.789  11.129
  166    H1'    U  16           H1'        U  16  17.274   9.194  13.843
  167    H3     U  16           H3         U  16  13.237   7.259  13.522
  168    H5     U  16           H5         U  16  12.370  11.028  15.196
  169    H6     U  16           H6         U  16  14.703  11.622  14.898
  170    H5'    U  17           H5'        U  17  19.703  11.583   9.434
  171   H5''    U  17          H5''        U  17  18.766  12.332   8.128
  172    H4'    U  17           H4'        U  17  19.282   9.722   8.083
  173    H3'    U  17           H3'        U  17  16.816  11.306   7.372
  174    H2'    U  17          H2''        U  17  15.497   9.447   7.156
  175   HO2'    U  17          H2'         U  17  16.402   7.393   6.546
  176    H1'    U  17           H1'        U  17  17.031   7.614   8.731
  177    H3     U  17           H3         U  17  12.701   6.908   9.834
  178    H5     U  17           H5         U  17  13.534  10.751  11.354
  179    H6     U  17           H6         U  17  15.686  10.649  10.235
  180    H5'    A  18           H5'        A  18  18.418   8.586   3.384
  181   H5''    A  18          H5''        A  18  17.195   9.071   2.193
  182    H4'    A  18           H4'        A  18  17.593   6.494   2.780
  183    H3'    A  18           H3'        A  18  15.059   8.061   2.241
  184    H2'    A  18          H2''        A  18  13.717   6.199   2.670
  185   HO2'    A  18          H2'         A  18  15.094   4.833   1.293
  186    H1'    A  18           H1'        A  18  15.251   5.027   4.677
  187    H8     A  18           H8         A  18  14.872   8.575   5.699
  188    H61    A  18           H61        A  18   9.111   7.242   7.479
  189    H62    A  18           H62        A  18  10.359   8.468   7.443
  190    H2     A  18           H2         A  18  10.598   3.854   4.944
  191    H5'    A  19           H5'        A  19  14.968   4.922  -0.981
  192   H5''    A  19          H5''        A  19  13.640   5.324  -2.085
  193    H4'    A  19           H4'        A  19  13.417   3.342  -0.280
  194    H3'    A  19           H3'        A  19  11.438   5.387  -1.311
  195    H2'    A  19          H2''        A  19   9.798   4.699   0.184
  196   HO2'    A  19          H2'         A  19  11.240   2.261   0.475
  197    H1'    A  19           H1'        A  19  11.503   3.868   2.295
  198    H8     A  19           H8         A  19  12.492   7.343   1.893
  199    H61    A  19           H61        A  19   7.195   9.003   4.594
  200    H62    A  19           H62        A  19   8.745   9.559   4.003
  201    H2     A  19           H2         A  19   6.804   4.728   3.258
  202    H5'    A  20           H5'        A  20   8.910   2.169  -3.600
  203   H5''    A  20          H5''        A  20   8.300   3.395  -4.728
  204    H4'    A  20           H4'        A  20   6.695   2.332  -2.888
  205    H3'    A  20           H3'        A  20   6.990   5.136  -3.955
  206    H2'    A  20          H2''        A  20   5.564   6.053  -2.376
  207   HO2'    A  20          H2'         A  20   3.719   4.992  -2.535
  208    H1'    A  20           H1'        A  20   5.948   4.229  -0.278
  209    H8     A  20           H8         A  20   9.148   5.878  -1.574
  210    H61    A  20           H61        A  20   7.674  10.741   1.938
  211    H62    A  20           H62        A  20   8.933   9.971   0.999
  212    H2     A  20           H2         A  20   4.228   7.874   2.032
  213    H5'    U  21           H5'        U  21   2.590   4.808  -4.530
  214   H5''    U  21          H5''        U  21   2.287   5.926  -5.874
  215    H4'    U  21           H4'        U  21   1.320   6.644  -3.615
  216    H3'    U  21           H3'        U  21   3.223   8.230  -5.345
  217    H2'    U  21          H2''        U  21   3.327   9.992  -3.810
  218   HO2'    U  21          H2'         U  21   1.684  10.555  -2.595
  219    H1'    U  21           H1'        U  21   3.211   8.508  -1.472
  220    H3     U  21           H3         U  21   7.297  10.455  -1.357
  221    H5     U  21           H5         U  21   7.547   7.854  -4.664
  222    H6     U  21           H6         U  21   5.244   7.218  -4.252
  223    H5'    U  22           H5'        U  22  -0.211  10.287  -3.864
  224   H5''    U  22          H5''        U  22  -1.148  11.156  -5.096
  225    H4'    U  22           H4'        U  22  -0.971  12.513  -3.029
  226    H3'    U  22           H3'        U  22   0.433  13.295  -5.591
  227    H2'    U  22          H2''        U  22   1.632  14.975  -4.633
  228   HO2'    U  22          H2'         U  22   0.466  15.827  -2.493
  229    H1'    U  22           H1'        U  22   1.283  14.184  -1.870
  230    H3     U  22           H3         U  22   5.449  16.017  -3.146
  231    H5     U  22           H5         U  22   5.713  11.822  -2.956
  232    H6     U  22           H6         U  22   3.277  11.737  -2.993
  233    H5'    A  23           H5'        A  23   0.401  16.394  -7.585
  234   H5''    A  23          H5''        A  23   1.428  16.195  -6.154
  235    H4'    A  23           H4'        A  23   1.501  18.477  -7.434
  236    H3'    A  23           H3'        A  23   1.626  17.737  -4.603
  237    H2'    A  23          H2''        A  23   0.643  19.556  -3.636
  238   HO2'    A  23          H2'         A  23   1.454  21.465  -3.997
  239    H1'    A  23           H1'        A  23  -0.654  20.835  -5.786
  240    H8     A  23           H8         A  23  -2.312  17.559  -5.539
  241    H61    A  23           H61        A  23  -5.165  19.504  -0.415
  242    H62    A  23           H62        A  23  -5.044  18.217  -1.595
  243    H2     A  23           H2         A  23  -1.819  22.352  -1.303
  244    H5'    A  24           H5'        A  24   5.599  19.737  -3.424
  245   H5''    A  24          H5''        A  24   5.467  18.713  -1.981
  246    H4'    A  24           H4'        A  24   4.343  21.318  -2.395
  247    H3'    A  24           H3'        A  24   4.561  19.203  -0.294
  248    H2'    A  24          H2''        A  24   2.523  19.552   0.645
  249   HO2'    A  24          H2'         A  24   1.765  21.642   1.083
  250    H1'    A  24           H1'        A  24   1.372  21.333  -1.354
  251    H8     A  24           H8         A  24   1.402  17.806  -2.437
  252    H61    A  24           H61        A  24  -3.638  16.888   1.033
  253    H62    A  24           H62        A  24  -2.541  16.165  -0.122
  254    H2     A  24           H2         A  24  -1.851  20.848   2.164
  255    H5'    U  25           H5'        U  25   7.851  20.572   3.233
  256   H5''    U  25          H5''        U  25   6.543  19.606   2.528
  257    H4'    U  25           H4'        U  25   6.325  20.845   4.940
  258    H3'    U  25           H3'        U  25   4.652  19.524   3.088
  259    H2'    U  25          H2''        U  25   3.532  21.333   2.181
  260   HO2'    U  25          H2'         U  25   1.687  21.739   3.271
  261    H1'    U  25           H1'        U  25   3.817  23.062   4.595
  262    H3     U  25           H3         U  25   3.185  26.919   2.414
  263    H5     U  25           H5         U  25   4.228  24.270  -0.691
  264    H6     U  25           H6         U  25   4.521  22.531   0.969
  265    H5'    U  26           H5'        U  26   1.582  19.511   2.461
  266   H5''    U  26          H5''        U  26   0.842  19.025   3.998
  267    H4'    U  26           H4'        U  26  -0.294  17.721   2.345
  268    H3'    U  26           H3'        U  26   1.806  16.431   4.013
  269    H2'    U  26          H2''        U  26   2.159  14.578   2.711
  270   HO2'    U  26          H2'         U  26   0.147  13.717   2.710
  271    H1'    U  26           H1'        U  26   1.399  15.485   0.184
  272    H3     U  26           H3         U  26   5.663  14.118  -0.416
  273    H5     U  26           H5         U  26   6.040  17.412   2.179
  274    H6     U  26           H6         U  26   3.625  17.566   2.236
  275    H5'    C  27           H5'        C  27  -2.079  13.454   4.525
  276   H5''    C  27          H5''        C  27  -1.591  12.604   6.005
  277    H4'    C  27           H4'        C  27  -2.036  11.138   3.914
  278    H3'    C  27           H3'        C  27   0.503  11.234   5.563
  279    H2'    C  27          H2''        C  27   1.478   9.536   4.283
  280   HO2'    C  27          H2'         C  27  -0.116   8.001   4.277
  281    H1'    C  27           H1'        C  27   0.320  10.297   1.827
  282    H41    C  27           H41        C  27   6.406  12.131   1.520
  283    H42    C  27           H42        C  27   6.164  13.299   2.800
  284    H5     C  27           H5         C  27   4.132  13.428   4.091
  285    H6     C  27           H6         C  27   1.824  12.627   4.289
  286    H5'    U  28           H5'        U  28  -1.741   7.280   6.601
  287   H5''    U  28          H5''        U  28  -1.178   6.566   8.126
  288    H4'    U  28           H4'        U  28  -0.844   5.117   6.034
  289    H3'    U  28           H3'        U  28   1.251   6.015   8.013
  290    H2'    U  28          H2''        U  28   3.019   5.114   6.822
  291   HO2'    U  28          H2'         U  28   1.070   3.437   5.604
  292    H1'    U  28           H1'        U  28   2.009   5.393   4.233
  293    H3     U  28           H3         U  28   5.980   7.614   4.440
  294    H5     U  28           H5         U  28   3.255  10.116   6.447
  295    H6     U  28           H6         U  28   1.612   8.347   6.283
  296    H5'    U  29           H5'        U  29   1.510   1.213   7.319
  297   H5''    U  29          H5''        U  29   2.519   0.692   8.681
  298    H4'    U  29           H4'        U  29   3.285   0.205   6.180
  299    H3'    U  29           H3'        U  29   4.812   1.067   8.632
  300    H2'    U  29          H2''        U  29   6.788   1.404   7.469
  301   HO2'    U  29          H2'         U  29   7.423   0.044   6.002
  302    H1'    U  29           H1'        U  29   5.746   2.171   4.989
  303    H3     U  29           H3         U  29   8.509   5.493   6.456
  304    H5     U  29           H5         U  29   5.097   5.819   8.901
  305    H6     U  29           H6         U  29   4.219   3.826   7.838
  306    H5'    A  30           H5'        A  30   7.452  -2.288   6.988
  307   H5''    A  30          H5''        A  30   8.341  -2.792   8.438
  308    H4'    A  30           H4'        A  30   9.637  -1.677   6.409
  309    H3'    A  30           H3'        A  30   9.891  -1.321   9.393
  310    H2'    A  30          H2''        A  30  11.316   0.467   9.214
  311   HO2'    A  30          H2'         A  30  12.134  -0.726   6.774
  312    H1'    A  30           H1'        A  30  10.648   1.311   6.563
  313    H8     A  30           H8         A  30   7.783   1.699   9.004
  314    H61    A  30           H61        A  30  10.444   6.973  10.819
  315    H62    A  30           H62        A  30   8.959   6.048  10.790
  316    H2     A  30           H2         A  30  13.347   4.785   8.192
  317    H5'    A  31           H5'        A  31  14.079  -1.523   7.793
  318   H5''    A  31          H5''        A  31  14.871  -2.721   8.835
  319    H4'    A  31           H4'        A  31  16.288  -0.745   8.753
  320    H3'    A  31           H3'        A  31  14.733  -1.368  11.257
  321    H2'    A  31          H2''        A  31  15.265   0.615  12.287
  322   HO2'    A  31          H2'         A  31  17.625   0.521  10.715
  323    H1'    A  31           H1'        A  31  15.844   2.192   9.982
  324    H8     A  31           H8         A  31  12.365   0.626  10.713
  325    H61    A  31           H61        A  31  11.072   5.990  13.489
  326    H62    A  31           H62        A  31  10.412   4.483  12.896
  327    H2     A  31           H2         A  31  15.328   6.140  12.097
  328    H5'    A  32           H5'        A  32  19.510  -0.990  12.783
  329   H5''    A  32          H5''        A  32  19.193  -1.667  14.391
  330    H4'    A  32           H4'        A  32  20.211   0.779  14.137
  331    H3'    A  32           H3'        A  32  18.115  -0.339  16.002
  332    H2'    A  32          H2''        A  32  17.619   1.735  16.892
  333   HO2'    A  32          H2'         A  32  20.246   2.455  16.087
  334    H1'    A  32           H1'        A  32  18.321   3.345  14.669
  335    H8     A  32           H8         A  32  15.657   0.594  14.222
  336    H61    A  32           H61        A  32  11.570   4.828  16.109
  337    H62    A  32           H62        A  32  11.774   3.272  15.336
  338    H2     A  32           H2         A  32  15.670   6.603  16.473
  339    H5'    A  33           H5'        A  33  21.318   1.862  18.717
  340   H5''    A  33          H5''        A  33  20.942   1.216  20.326
  341    H4'    A  33           H4'        A  33  20.702   3.821  19.827
  342    H3'    A  33           H3'        A  33  19.001   1.907  21.423
  343    H2'    A  33          H2''        A  33  17.317   3.442  21.736
  344   HO2'    A  33          H2'         A  33  17.719   5.450  22.292
  345    H1'    A  33           H1'        A  33  17.858   5.151  19.510
  346    H8     A  33           H8         A  33  16.821   1.568  18.693
  347    H61    A  33           H61        A  33  10.980   3.504  19.295
  348    H62    A  33           H62        A  33  12.017   2.246  18.661
  349    H2     A  33           H2         A  33  13.691   6.813  20.646
  350    H5'    A  34           H5'        A  34  19.960   5.771  23.533
  351   H5''    A  34          H5''        A  34  20.124   5.497  25.279
  352    H4'    A  34           H4'        A  34  18.587   7.426  24.643
  353    H3'    A  34           H3'        A  34  17.901   5.044  26.348
  354    H2'    A  34          H2''        A  34  15.622   5.473  26.326
  355   HO2'    A  34          H2'         A  34  16.288   8.236  26.086
  356    H1'    A  34           H1'        A  34  15.494   7.224  24.058
  357    H8     A  34           H8         A  34  16.309   3.601  23.281
  358    H61    A  34           H61        A  34  10.184   2.799  22.923
  359    H62    A  34           H62        A  34  11.751   2.073  22.644
  360    H2     A  34           H2         A  34  10.971   6.820  24.766
  361    H5'    C  35           H5'        C  35  17.782   6.697  30.529
  362   H5''    C  35          H5''        C  35  17.578   4.970  30.879
  363    H4'    C  35           H4'        C  35  15.586   6.900  30.000
  364    H3'    C  35           H3'        C  35  15.819   4.635  31.625
  365    H2'    C  35          H2''        C  35  15.562   2.946  30.097
  366   HO2'    C  35          H2'         C  35  12.889   3.918  30.034
  367    H1'    C  35           H1'        C  35  13.867   4.459  28.180
  368    H41    C  35           H41        C  35  16.393   0.006  24.401
  369    H42    C  35           H42        C  35  18.000   0.327  25.011
  370    H5     C  35           H5         C  35  18.431   1.811  26.861
  371    H6     C  35           H6         C  35  17.447   3.453  28.388
  372    H5'    U  36           H5'        U  36  14.240   8.493  30.163
  373   H5''    U  36          H5''        U  36  13.847   9.702  31.401
  374    H4'    U  36           H4'        U  36  12.372  10.456  29.780
  375    H3'    U  36           H3'        U  36  11.134   8.151  31.279
  376    H2'    U  36          H2''        U  36   9.421   7.888  29.782
  377   HO2'    U  36          H2'         U  36   9.734  10.648  29.166
  378    H1'    U  36           H1'        U  36  10.631   9.131  27.505
  379    H3     U  36           H3         U  36   8.346   5.001  26.967
  380    H5     U  36           H5         U  36  12.502   4.352  27.000
  381    H6     U  36           H6         U  36  12.786   6.588  27.897
  382    H5'    A  37           H5'        A  37   8.187  11.326  34.054
  383   H5''    A  37          H5''        A  37   8.057   9.863  35.051
  384    H4'    A  37           H4'        A  37   5.886  11.004  33.961
  385    H3'    A  37           H3'        A  37   6.672   8.114  34.389
  386    H2'    A  37          H2''        A  37   4.737   7.326  33.321
  387   HO2'    A  37          H2'         A  37   3.763  10.007  33.343
  388    H1'    A  37           H1'        A  37   4.786   9.049  31.188
  389    H8     A  37           H8         A  37   8.387   8.364  31.643
  390    H61    A  37           H61        A  37   7.474   2.686  29.397
  391    H62    A  37           H62        A  37   8.650   3.953  29.673
  392    H2     A  37           H2         A  37   3.471   4.434  30.409
  393    H5'    C  38           H5'        C  38   2.999   8.904  36.054
  394   H5''    C  38          H5''        C  38   2.501   8.325  37.656
  395    H4'    C  38           H4'        C  38   0.846   7.588  36.021
  396    H3'    C  38           H3'        C  38   2.759   5.579  37.221
  397    H2'    C  38          H2''        C  38   1.875   3.829  35.952
  398   HO2'    C  38          H2'         C  38  -0.154   3.898  35.008
  399    H1'    C  38           H1'        C  38   1.350   5.230  33.615
  400    H41    C  38           H41        C  38   6.730   1.927  32.664
  401    H42    C  38           H42        C  38   7.636   3.102  33.592
  402    H5     C  38           H5         C  38   6.628   5.036  34.596
  403    H6     C  38           H6         C  38   4.519   6.089  35.227
  404    H5'    A  39           H5'        A  39  -0.789   3.922  39.983
  405   H5''    A  39          H5''        A  39   0.317   2.970  40.994
  406    H4'    A  39           H4'        A  39  -1.313   1.805  39.192
  407    H3'    A  39           H3'        A  39   1.526   1.190  40.076
  408    H2'    A  39          H2''        A  39   1.721  -0.537  38.455
  409   HO2'    A  39          H2'         A  39  -1.112  -0.410  38.193
  410    H1'    A  39           H1'        A  39   0.299   0.639  36.438
  411    H8     A  39           H8         A  39   2.634   3.254  37.802
  412    H61    A  39           H61        A  39   7.282   0.282  35.018
  413    H62    A  39           H62        A  39   6.764   1.795  35.727
  414    H2     A  39           H2         A  39   3.656  -2.346  34.843
  415    H5'    A  40           H5'        A  40  -1.240  -1.891  39.692
  416   H5''    A  40          H5''        A  40  -1.643  -2.783  41.173
  417    H4'    A  40           H4'        A  40  -1.821  -4.415  39.450
  418    H3'    A  40           H3'        A  40   0.700  -4.392  41.073
  419    H2'    A  40          H2''        A  40   1.866  -5.877  39.724
  420   HO2'    A  40          H2'         A  40  -0.642  -6.642  38.614
  421    H1'    A  40           H1'        A  40   0.909  -5.185  37.251
  422    H8     A  40           H8         A  40   1.760  -2.252  39.618
  423    H61    A  40           H61        A  40   7.522  -2.684  37.441
  424    H62    A  40           H62        A  40   6.396  -1.698  38.345
  425    H2     A  40           H2         A  40   5.144  -6.103  35.771
  426    H5'    A  41           H5'        A  41  -0.201  -8.705  41.354
  427   H5''    A  41          H5''        A  41   0.785  -9.313  42.698
  428    H4'    A  41           H4'        A  41   1.484  -9.795  40.166
  429    H3'    A  41           H3'        A  41   3.085  -9.137  42.634
  430    H2'    A  41          H2''        A  41   5.037  -8.796  41.475
  431   HO2'    A  41          H2'         A  41   4.002 -10.667  39.606
  432    H1'    A  41           H1'        A  41   3.925  -8.270  38.878
  433    H8     A  41           H8         A  41   3.007  -5.540  41.273
  434    H61    A  41           H61        A  41   8.650  -3.191  40.350
  435    H62    A  41           H62        A  41   7.023  -2.851  40.893
  436    H2     A  41           H2         A  41   8.550  -7.309  38.572
  437    H5'    U  42           H5'        U  42   5.169 -12.369  40.394
  438   H5''    U  42          H5''        U  42   5.321 -13.710  41.547
  439    H4'    U  42           H4'        U  42   7.468 -13.537  40.499
  440    H3'    U  42           H3'        U  42   7.146 -12.397  43.258
  441    H2'    U  42          H2''        U  42   9.138 -11.273  43.271
  442   HO2'    U  42          H2'         U  42  10.020 -13.348  41.556
  443    H1'    U  42           H1'        U  42   9.600 -11.038  40.473
  444    H3     U  42           H3         U  42  10.362  -6.837  41.913
  445    H5     U  42           H5         U  42   6.315  -7.482  42.886
  446    H6     U  42           H6         U  42   6.569  -9.778  42.147
  447    H5'    C  43           H5'        C  43  10.953 -15.900  43.567
  448   H5''    C  43          H5''        C  43  11.127 -15.730  45.323
  449    H4'    C  43           H4'        C  43  13.225 -15.394  43.708
  450    H3'    C  43           H3'        C  43  12.342 -13.942  46.203
  451    H2'    C  43          H2''        C  43  13.984 -12.325  46.003
  452   HO2'    C  43          H2'         C  43  15.969 -12.756  45.311
  453    H1'    C  43           H1'        C  43  14.321 -12.381  43.194
  454    H41    C  43           H41        C  43  11.941  -6.680  44.765
  455    H42    C  43           H42        C  43  10.330  -7.360  44.776
  456    H5     C  43           H5         C  43   9.891  -9.663  44.215
  457    H6     C  43           H6         C  43  10.888 -11.896  44.007
  458    H5'    G  44           H5'        G  44  16.690 -15.142  46.933
  459   H5''    G  44          H5''        G  44  16.988 -14.973  48.674
  460    H4'    G  44           H4'        G  44  18.188 -13.353  46.920
  461    H3'    G  44           H3'        G  44  17.037 -12.917  49.666
  462    H2'    G  44          H2''        G  44  17.076 -10.630  49.533
  463   HO2'    G  44          H2'         G  44  18.709  -9.505  48.576
  464    H1'    G  44           H1'        G  44  17.185 -10.319  46.693
  465    H8     G  44           H8         G  44  13.924 -11.820  47.866
  466    H1     G  44           H1         G  44  14.327  -5.495  48.850
  467    H21    G  44           H21        G  44  16.385  -4.801  48.461
  468    H22    G  44           H22        G  44  17.700  -5.911  48.151
  469    H5'    A  45           H5'        A  45  20.896 -10.703  48.815
  470   H5''    A  45          H5''        A  45  22.019 -11.243  50.078
  471    H4'    A  45           H4'        A  45  22.468  -8.907  49.790
  472    H3'    A  45           H3'        A  45  20.828  -9.743  52.165
  473    H2'    A  45          H2''        A  45  20.293  -7.574  52.807
  474   HO2'    A  45          H2'         A  45  22.350  -6.705  52.834
  475    H1'    A  45           H1'        A  45  20.114  -6.359  50.328
  476    H8     A  45           H8         A  45  18.388  -9.784  50.685
  477    H61    A  45           H61        A  45  13.407  -6.622  52.512
  478    H62    A  45           H62        A  45  13.998  -8.161  51.928
  479    H2     A  45           H2         A  45  16.823  -3.737  52.143
  480    H5'    G  46           H5'        G  46  24.196  -7.769  54.443
  481   H5''    G  46          H5''        G  46  23.974  -8.348  56.106
  482    H4'    G  46           H4'        G  46  23.248  -5.875  55.418
  483    H3'    G  46           H3'        G  46  22.021  -7.934  57.242
  484    H2'    G  46          H2''        G  46  20.027  -6.816  57.455
  485   HO2'    G  46          H2'         G  46  21.407  -4.395  56.876
  486    H1'    G  46           H1'        G  46  20.166  -5.179  55.113
  487    H8     G  46           H8         G  46  19.862  -8.855  54.300
  488    H1     G  46           H1         G  46  14.320  -6.126  56.029
  489    H21    G  46           H21        G  46  14.693  -4.111  56.844
  490    H22    G  46           H22        G  46  16.309  -3.514  57.149
  491    H5'    C  47           H5'        C  47  22.298  -3.671  58.528
  492   H5''    C  47          H5''        C  47  22.915  -3.530  60.186
  493    H4'    C  47           H4'        C  47  21.208  -1.843  59.960
  494    H3'    C  47           H3'        C  47  20.428  -4.379  61.407
  495    H2'    C  47          H2''        C  47  18.263  -3.542  61.829
  496   HO2'    C  47          H2'         C  47  18.987  -1.397  62.399
  497    H1'    C  47           H1'        C  47  17.830  -2.480  59.337
  498    H41    C  47           H41        C  47  15.396  -8.388  59.374
  499    H42    C  47           H42        C  47  17.000  -9.078  59.267
  500    H5     C  47           H5         C  47  18.997  -7.740  59.135
  501    H6     C  47           H6         C  47  19.907  -5.474  59.261
  502    H5'    C  48           H5'        C  48  20.121  -1.667  64.861
  503   H5''    C  48          H5''        C  48  20.492  -2.619  66.313
  504    H4'    C  48           H4'        C  48  18.025  -1.835  65.948
  505    H3'    C  48           H3'        C  48  19.065  -4.589  66.616
  506   HO3'    C  48          H3T         C  48  17.609  -2.603  68.062
  507    H2'    C  48          H2''        C  48  16.957  -5.522  66.579
  508   HO2'    C  48          H2'         C  48  15.867  -2.906  66.886
  509    H1'    C  48           H1'        C  48  15.790  -3.787  64.679
  510    H41    C  48           H41        C  48  16.521  -9.934  62.812
  511    H42    C  48           H42        C  48  17.936  -9.428  61.917
  512    H5     C  48           H5         C  48  18.952  -7.277  62.192
  513    H6     C  48           H6         C  48  18.548  -4.993  62.926
  Start of MODEL    9
    1    H5'    G   1           H5'        G   1   5.642 -18.567  59.605
    2   H5''    G   1          H5''        G   1   5.138 -17.366  58.400
    3    H4'    G   1           H4'        G   1   4.660 -16.624  60.751
    4    H3'    G   1           H3'        G   1   6.419 -15.233  58.773
    5    H2'    G   1          H2''        G   1   7.474 -13.864  60.252
    6   HO2'    G   1          H2'         G   1   5.025 -13.923  61.682
    7    H1'    G   1           H1'        G   1   6.959 -15.225  62.707
    8    H8     G   1           H8         G   1   9.155 -17.300  60.476
    9    H1     G   1           H1         G   1  12.275 -12.424  63.239
   10    H21    G   1           H21        G   1  10.831 -11.004  64.118
   11    H22    G   1           H22        G   1   9.115 -11.335  64.178
   12   HO5'    G   1          H5T         G   1   7.149 -17.028  57.870
   13    H5'    G   2           H5'        G   2   2.866 -11.328  59.919
   14   H5''    G   2          H5''        G   2   3.435 -10.690  58.364
   15    H4'    G   2           H4'        G   2   3.455  -9.153  60.542
   16    H3'    G   2           H3'        G   2   5.283  -9.444  58.193
   17    H2'    G   2          H2''        G   2   7.092  -8.370  59.122
   18   HO2'    G   2          H2'         G   2   6.891  -6.576  60.246
   19    H1'    G   2           H1'        G   2   6.642  -8.785  61.854
   20    H8     G   2           H8         G   2   6.666 -12.062  59.992
   21    H1     G   2           H1         G   2  12.530  -9.661  60.937
   22    H21    G   2           H21        G   2  12.390  -7.612  61.743
   23    H22    G   2           H22        G   2  10.867  -6.761  61.875
   24    H5'    C   3           H5'        C   3   4.940  -5.083  59.515
   25   H5''    C   3          H5''        C   3   4.923  -4.082  58.050
   26    H4'    C   3           H4'        C   3   6.611  -3.346  59.798
   27    H3'    C   3           H3'        C   3   7.144  -4.059  56.937
   28    H2'    C   3          H2''        C   3   9.434  -4.116  57.130
   29   HO2'    C   3          H2'         C   3  10.309  -2.400  57.931
   30    H1'    C   3           H1'        C   3   9.719  -4.692  59.873
   31    H41    C   3           H41        C   3  11.864  -9.764  56.675
   32    H42    C   3           H42        C   3  10.284 -10.056  55.988
   33    H5     C   3           H5         C   3   8.353  -8.704  56.505
   34    H6     C   3           H6         C   3   7.555  -6.718  57.688
   35    H5'    U   4           H5'        U   4   9.552  -0.269  57.572
   36   H5''    U   4          H5''        U   4   9.375   0.623  56.048
   37    H4'    U   4           H4'        U   4  11.781   0.145  56.698
   38    H3'    U   4           H3'        U   4  10.412  -0.659  54.146
   39    H2'    U   4          H2''        U   4  12.098  -2.039  53.432
   40   HO2'    U   4          H2'         U   4  13.824  -0.336  54.911
   41    H1'    U   4           H1'        U   4  13.376  -2.577  55.925
   42    H3     U   4           H3         U   4  13.069  -6.682  54.116
   43    H5     U   4           H5         U   4   9.045  -5.512  54.571
   44    H6     U   4           H6         U   4   9.829  -3.334  55.292
   45    H5'    C   5           H5'        C   5  14.558   1.860  52.874
   46   H5''    C   5          H5''        C   5  14.165   2.079  51.158
   47    H4'    C   5           H4'        C   5  16.404   0.834  51.867
   48    H3'    C   5           H3'        C   5  14.398   0.332  49.684
   49    H2'    C   5          H2''        C   5  15.209  -1.744  49.140
   50   HO2'    C   5          H2'         C   5  17.665  -0.603  49.880
   51    H1'    C   5           H1'        C   5  16.517  -2.412  51.580
   52    H41    C   5           H41        C   5  11.990  -6.752  50.537
   53    H42    C   5           H42        C   5  10.735  -5.559  50.774
   54    H5     C   5           H5         C   5  11.198  -3.261  51.348
   55    H6     C   5           H6         C   5  12.957  -1.573  51.605
   56    H5'    G   6           H5'        G   6  18.803   0.830  47.276
   57   H5''    G   6          H5''        G   6  18.128   0.826  45.635
   58    H4'    G   6           H4'        G   6  19.907  -1.019  46.378
   59    H3'    G   6           H3'        G   6  17.426  -1.158  44.666
   60    H2'    G   6          H2''        G   6  17.546  -3.483  44.446
   61   HO2'    G   6          H2'         G   6  20.216  -3.293  45.416
   62    H1'    G   6           H1'        G   6  18.365  -4.124  46.987
   63    H8     G   6           H8         G   6  15.702  -1.403  47.088
   64    H1     G   6           H1         G   6  13.336  -7.231  45.851
   65    H21    G   6           H21        G   6  14.984  -8.675  45.578
   66    H22    G   6           H22        G   6  16.659  -8.176  45.503
   67    H5'    A   7           H5'        A   7  20.444  -2.039  41.105
   68   H5''    A   7          H5''        A   7  19.320  -1.812  39.752
   69    H4'    A   7           H4'        A   7  20.163  -4.258  40.481
   70    H3'    A   7           H3'        A   7  17.518  -3.222  39.451
   71    H2'    A   7          H2''        A   7  16.446  -5.270  39.772
   72   HO2'    A   7          H2'         A   7  17.814  -6.673  38.786
   73    H1'    A   7           H1'        A   7  17.758  -6.077  42.098
   74    H8     A   7           H8         A   7  16.753  -2.600  42.847
   75    H61    A   7           H61        A   7  10.893  -4.505  43.288
   76    H62    A   7           H62        A   7  12.032  -3.246  43.709
   77    H2     A   7           H2         A   7  13.281  -7.798  41.402
   78    H5'    U   8           H5'        U   8  18.281  -5.949  35.928
   79   H5''    U   8          H5''        U   8  17.219  -5.278  34.675
   80    H4'    U   8           H4'        U   8  16.557  -7.513  35.990
   81    H3'    U   8           H3'        U   8  14.943  -5.167  34.999
   82    H2'    U   8          H2''        U   8  13.007  -5.838  36.077
   83   HO2'    U   8          H2'         U   8  12.980  -7.926  35.163
   84    H1'    U   8           H1'        U   8  14.166  -7.201  38.275
   85    H3     U   8           H3         U   8  11.099  -3.975  39.539
   86    H5     U   8           H5         U   8  14.880  -2.121  39.390
   87    H6     U   8           H6         U   8  15.726  -4.086  38.246
   88    H5'    U   9           H5'        U   9  12.756  -7.871  31.695
   89   H5''    U   9          H5''        U   9  12.537  -6.441  30.668
   90    H4'    U   9           H4'        U   9  10.440  -7.622  31.818
   91    H3'    U   9           H3'        U   9  11.146  -4.736  31.317
   92    H2'    U   9          H2''        U   9   9.467  -3.903  32.645
   93   HO2'    U   9          H2'         U   9   7.790  -4.869  31.483
   94    H1'    U   9           H1'        U   9   9.044  -6.172  34.331
   95    H3     U   9           H3         U   9   9.122  -2.482  36.972
   96    H5     U   9           H5         U   9  13.124  -2.962  35.742
   97    H6     U   9           H6         U   9  12.389  -4.748  34.270
   98    H5'    G  10           H5'        G  10   6.738  -5.512  29.156
   99   H5''    G  10          H5''        G  10   6.900  -4.281  27.888
  100    H4'    G  10           H4'        G  10   4.761  -4.308  29.473
  101    H3'    G  10           H3'        G  10   6.436  -2.070  28.354
  102    H2'    G  10          H2''        G  10   5.404  -0.432  29.621
  103   HO2'    G  10          H2'         G  10   3.236  -2.229  30.043
  104    H1'    G  10           H1'        G  10   4.763  -1.913  31.898
  105    H8     G  10           H8         G  10   8.391  -2.440  31.197
  106    H1     G  10           H1         G  10   7.151   3.485  33.332
  107    H21    G  10           H21        G  10   4.979   3.852  33.319
  108    H22    G  10           H22        G  10   3.840   2.701  32.659
  109    H5'    U  11           H5'        U  11   2.084  -0.695  27.157
  110   H5''    U  11          H5''        U  11   2.461   0.476  25.879
  111    H4'    U  11           H4'        U  11   1.313   1.269  28.153
  112    H3'    U  11           H3'        U  11   3.479   2.515  26.451
  113    H2'    U  11          H2''        U  11   3.777   4.283  27.953
  114   HO2'    U  11          H2'         U  11   1.863   5.076  28.461
  115    H1'    U  11           H1'        U  11   3.416   2.873  30.316
  116    H3     U  11           H3         U  11   7.666   4.619  29.962
  117    H5     U  11           H5         U  11   7.774   0.907  27.973
  118    H6     U  11           H6         U  11   5.358   0.814  28.155
  119    H5'    A  12           H5'        A  12   0.770   6.011  25.076
  120   H5''    A  12          H5''        A  12   1.844   6.402  23.719
  121    H4'    A  12           H4'        A  12   1.793   7.908  25.943
  122    H3'    A  12           H3'        A  12   4.109   7.021  24.193
  123    H2'    A  12          H2''        A  12   5.601   8.250  25.524
  124   HO2'    A  12          H2'         A  12   3.274   9.527  26.548
  125    H1'    A  12           H1'        A  12   4.450   7.628  27.965
  126    H8     A  12           H8         A  12   4.636   4.343  26.207
  127    H61    A  12           H61        A  12  10.801   4.626  26.514
  128    H62    A  12           H62        A  12   9.422   3.589  26.227
  129    H2     A  12           H2         A  12   9.159   8.564  27.898
  130    H5'    U  13           H5'        U  13   4.646  10.984  25.250
  131   H5''    U  13          H5''        U  13   5.055  11.988  23.845
  132    H4'    U  13           H4'        U  13   6.636  12.226  25.831
  133    H3'    U  13           H3'        U  13   7.423  11.413  23.028
  134    H2'    U  13          H2''        U  13   9.645  11.135  23.618
  135   HO2'    U  13          H2'         U  13  10.524  12.128  25.520
  136    H1'    U  13           H1'        U  13   9.279  10.381  26.312
  137    H3     U  13           H3         U  13  11.883   7.347  24.022
  138    H5     U  13           H5         U  13   7.886   6.349  23.139
  139    H6     U  13           H6         U  13   7.200   8.420  24.174
  140    H5'    U  14           H5'        U  14  10.478  13.900  24.239
  141   H5''    U  14          H5''        U  14  10.442  15.350  23.216
  142    H4'    U  14           H4'        U  14  12.737  14.680  23.253
  143    H3'    U  14           H3'        U  14  11.117  13.996  20.820
  144    H2'    U  14          H2''        U  14  12.668  12.570  19.913
  145   HO2'    U  14          H2'         U  14  14.801  12.959  19.968
  146    H1'    U  14           H1'        U  14  14.120  11.850  22.234
  147    H3     U  14           H3         U  14  13.278   7.828  20.412
  148    H5     U  14           H5         U  14   9.430   9.347  21.213
  149    H6     U  14           H6         U  14  10.466  11.432  21.896
  150    H5'    U  15           H5'        U  15  15.290  16.258  19.390
  151   H5''    U  15          H5''        U  15  14.918  16.541  17.679
  152    H4'    U  15           H4'        U  15  17.049  15.103  18.373
  153    H3'    U  15           H3'        U  15  15.027  14.815  16.166
  154    H2'    U  15          H2''        U  15  15.682  12.697  15.582
  155   HO2'    U  15          H2'         U  15  17.706  12.337  15.190
  156    H1'    U  15           H1'        U  15  16.932  11.889  18.015
  157    H3     U  15           H3         U  15  14.326   8.416  16.681
  158    H5     U  15           H5         U  15  11.588  11.364  17.936
  159    H6     U  15           H6         U  15  13.449  12.905  18.157
  160    H5'    U  16           H5'        U  16  19.311  14.281  14.234
  161   H5''    U  16          H5''        U  16  19.066  14.973  12.617
  162    H4'    U  16           H4'        U  16  20.019  12.611  12.627
  163    H3'    U  16           H3'        U  16  17.514  13.551  11.253
  164    H2'    U  16          H2''        U  16  16.782  11.447  10.715
  165   HO2'    U  16          H2'         U  16  18.339  10.672   9.454
  166    H1'    U  16           H1'        U  16  18.230   9.924  12.646
  167    H3     U  16           H3         U  16  14.047   8.226  12.822
  168    H5     U  16           H5         U  16  13.600  12.160  14.267
  169    H6     U  16           H6         U  16  15.917  12.571  13.675
  170    H5'    U  17           H5'        U  17  20.423  11.138   8.201
  171   H5''    U  17          H5''        U  17  19.897  11.753   6.622
  172    H4'    U  17           H4'        U  17  19.951   9.199   6.856
  173    H3'    U  17           H3'        U  17  17.632  10.917   5.991
  174    H2'    U  17          H2''        U  17  16.124   9.193   6.010
  175   HO2'    U  17          H2'         U  17  18.296   7.803   5.042
  176    H1'    U  17           H1'        U  17  17.472   7.411   7.788
  177    H3     U  17           H3         U  17  13.128   7.408   9.049
  178    H5     U  17           H5         U  17  14.479  11.275  10.041
  179    H6     U  17           H6         U  17  16.565  10.759   8.911
  180    H5'    A  18           H5'        A  18  18.675   7.550   2.308
  181   H5''    A  18          H5''        A  18  17.479   8.132   1.135
  182    H4'    A  18           H4'        A  18  17.467   5.588   1.936
  183    H3'    A  18           H3'        A  18  15.174   7.518   1.491
  184    H2'    A  18          H2''        A  18  13.629   5.845   2.045
  185   HO2'    A  18          H2'         A  18  14.423   4.177   0.769
  186    H1'    A  18           H1'        A  18  15.130   4.619   4.046
  187    H8     A  18           H8         A  18  15.155   8.292   4.748
  188    H61    A  18           H61        A  18   9.394   7.689   6.898
  189    H62    A  18           H62        A  18  10.738   8.786   6.675
  190    H2     A  18           H2         A  18  10.467   3.917   4.720
  191    H5'    A  19           H5'        A  19  14.855   4.293  -1.850
  192   H5''    A  19          H5''        A  19  13.536   4.715  -2.958
  193    H4'    A  19           H4'        A  19  13.314   2.644  -1.276
  194    H3'    A  19           H3'        A  19  11.350   4.720  -2.241
  195    H2'    A  19          H2''        A  19   9.696   4.078  -0.749
  196   HO2'    A  19          H2'         A  19   9.692   1.887  -1.346
  197    H1'    A  19           H1'        A  19  11.320   3.143   1.359
  198    H8     A  19           H8         A  19  12.478   6.597   0.835
  199    H61    A  19           H61        A  19   7.364   8.544   3.681
  200    H62    A  19           H62        A  19   8.902   9.021   2.995
  201    H2     A  19           H2         A  19   6.777   4.232   2.551
  202    H5'    A  20           H5'        A  20   8.729   1.662  -4.712
  203   H5''    A  20          H5''        A  20   8.220   2.999  -5.761
  204    H4'    A  20           H4'        A  20   6.513   1.904  -4.030
  205    H3'    A  20           H3'        A  20   6.981   4.733  -4.942
  206    H2'    A  20          H2''        A  20   5.623   5.678  -3.317
  207   HO2'    A  20          H2'         A  20   4.331   3.152  -3.276
  208    H1'    A  20           H1'        A  20   5.911   3.813  -1.273
  209    H8     A  20           H8         A  20   9.196   5.169  -2.727
  210    H61    A  20           H61        A  20   8.422  10.038   0.991
  211    H62    A  20           H62        A  20   9.440   9.308  -0.232
  212    H2     A  20           H2         A  20   4.725   7.508   1.238
  213    H5'    U  21           H5'        U  21   2.529   4.530  -5.407
  214   H5''    U  21          H5''        U  21   2.169   5.671  -6.717
  215    H4'    U  21           H4'        U  21   1.227   6.323  -4.433
  216    H3'    U  21           H3'        U  21   3.105   7.984  -6.122
  217    H2'    U  21          H2''        U  21   3.190   9.695  -4.532
  218   HO2'    U  21          H2'         U  21   0.771   9.540  -4.299
  219    H1'    U  21           H1'        U  21   3.076   8.120  -2.240
  220    H3     U  21           H3         U  21   7.127  10.104  -1.966
  221    H5     U  21           H5         U  21   7.460   7.678  -5.396
  222    H6     U  21           H6         U  21   5.153   7.015  -5.070
  223    H5'    U  22           H5'        U  22  -1.400   9.017  -6.307
  224   H5''    U  22          H5''        U  22  -2.057   9.833  -7.741
  225    H4'    U  22           H4'        U  22  -2.516  10.984  -5.479
  226    H3'    U  22           H3'        U  22  -1.291  12.131  -7.977
  227    H2'    U  22          H2''        U  22  -0.537  14.071  -7.016
  228   HO2'    U  22          H2'         U  22  -2.591  13.758  -5.076
  229    H1'    U  22           H1'        U  22  -0.357  13.246  -4.306
  230    H3     U  22           H3         U  22   3.380  15.369  -6.329
  231    H5     U  22           H5         U  22   4.072  11.227  -5.992
  232    H6     U  22           H6         U  22   1.703  10.933  -5.559
  233    H5'    A  23           H5'        A  23  -2.860  15.860  -9.689
  234   H5''    A  23          H5''        A  23  -1.699  15.964  -8.351
  235    H4'    A  23           H4'        A  23  -2.814  18.170  -8.959
  236    H3'    A  23           H3'        A  23  -2.456  16.879  -6.358
  237    H2'    A  23          H2''        A  23  -4.276  17.660  -5.225
  238   HO2'    A  23          H2'         A  23  -3.382  19.807  -5.407
  239    H1'    A  23           H1'        A  23  -5.951  18.653  -7.248
  240    H8     A  23           H8         A  23  -5.456  14.987  -7.805
  241    H61    A  23           H61        A  23  -9.525  13.952  -3.280
  242    H62    A  23           H62        A  23  -8.707  13.267  -4.665
  243    H2     A  23           H2         A  23  -8.387  18.279  -3.141
  244    H5'    A  24           H5'        A  24  -0.441  20.246  -3.990
  245   H5''    A  24          H5''        A  24  -0.164  18.973  -2.788
  246    H4'    A  24           H4'        A  24  -2.458  20.668  -3.052
  247    H3'    A  24           H3'        A  24  -1.280  18.646  -1.260
  248    H2'    A  24          H2''        A  24  -3.112  17.368  -0.883
  249   HO2'    A  24          H2'         A  24  -4.429  19.870  -0.656
  250    H1'    A  24           H1'        A  24  -5.031  18.633  -2.652
  251    H8     A  24           H8         A  24  -2.586  16.293  -4.328
  252    H61    A  24           H61        A  24  -6.373  11.677  -2.731
  253    H62    A  24           H62        A  24  -4.878  12.095  -3.537
  254    H2     A  24           H2         A  24  -7.796  15.415  -0.694
  255    H5'    U  25           H5'        U  25  -1.795  18.741   3.268
  256   H5''    U  25          H5''        U  25  -1.463  17.743   1.845
  257    H4'    U  25           H4'        U  25  -3.006  16.874   3.864
  258    H3'    U  25           H3'        U  25  -2.536  16.222   1.114
  259    H2'    U  25          H2''        U  25  -4.658  16.669   0.314
  260   HO2'    U  25          H2'         U  25  -4.944  14.536   0.164
  261    H1'    U  25           H1'        U  25  -5.888  16.192   3.015
  262    H3     U  25           H3         U  25  -9.871  17.382   1.314
  263    H5     U  25           H5         U  25  -7.264  20.313  -0.227
  264    H6     U  25           H6         U  25  -5.418  19.118   0.806
  265    H5'    U  26           H5'        U  26  -2.762  15.259  -0.972
  266   H5''    U  26          H5''        U  26  -3.411  13.643  -0.635
  267    H4'    U  26           H4'        U  26  -2.228  13.040  -2.517
  268    H3'    U  26           H3'        U  26  -0.553  12.920  -0.117
  269    H2'    U  26          H2''        U  26   1.499  13.346  -1.005
  270   HO2'    U  26          H2'         U  26   0.486  11.780  -3.048
  271    H1'    U  26           H1'        U  26   0.905  14.673  -3.402
  272    H3     U  26           H3         U  26   3.614  17.651  -1.394
  273    H5     U  26           H5         U  26   0.263  17.511   1.156
  274    H6     U  26           H6         U  26  -0.624  15.723  -0.212
  275    H5'    C  27           H5'        C  27  -2.787   8.711   0.632
  276   H5''    C  27          H5''        C  27  -3.202   9.896   1.888
  277    H4'    C  27           H4'        C  27  -1.738   7.846   2.573
  278    H3'    C  27           H3'        C  27  -1.571  10.733   3.282
  279    H2'    C  27          H2''        C  27   0.630  10.834   3.710
  280   HO2'    C  27          H2'         C  27   0.739   9.832   5.555
  281    H1'    C  27           H1'        C  27   1.453   8.234   2.870
  282    H41    C  27           H41        C  27   5.859  11.824   0.157
  283    H42    C  27           H42        C  27   4.803  13.218   0.141
  284    H5     C  27           H5         C  27   2.493  13.121   0.810
  285    H6     C  27           H6         C  27   0.673  11.670   1.534
  286    H5'    U  28           H5'        U  28  -2.076   6.877   5.973
  287   H5''    U  28          H5''        U  28  -1.292   6.543   7.526
  288    H4'    U  28           H4'        U  28  -0.725   5.128   5.309
  289    H3'    U  28           H3'        U  28   1.034   6.054   7.615
  290    H2'    U  28          H2''        U  28   2.970   5.429   6.536
  291   HO2'    U  28          H2'         U  28   3.155   3.521   5.595
  292    H1'    U  28           H1'        U  28   1.939   5.308   3.856
  293    H3     U  28           H3         U  28   6.100   7.205   3.602
  294    H5     U  28           H5         U  28   3.464  10.229   4.911
  295    H6     U  28           H6         U  28   1.836   8.528   5.307
  296    H5'    U  29           H5'        U  29   1.688   1.201   7.004
  297   H5''    U  29          H5''        U  29   2.639   0.862   8.462
  298    H4'    U  29           H4'        U  29   3.640   0.347   6.049
  299    H3'    U  29           H3'        U  29   4.902   1.511   8.533
  300    H2'    U  29          H2''        U  29   6.905   1.940   7.458
  301   HO2'    U  29          H2'         U  29   6.430  -0.411   6.357
  302    H1'    U  29           H1'        U  29   5.928   2.324   4.837
  303    H3     U  29           H3         U  29   8.531   5.901   5.944
  304    H5     U  29           H5         U  29   5.146   6.286   8.419
  305    H6     U  29           H6         U  29   4.289   4.236   7.465
  306    H5'    A  30           H5'        A  30   7.707  -1.799   7.088
  307   H5''    A  30          H5''        A  30   8.529  -2.355   8.557
  308    H4'    A  30           H4'        A  30  10.007  -1.418   6.632
  309    H3'    A  30           H3'        A  30  10.043  -0.730   9.569
  310    H2'    A  30          H2''        A  30  11.550   0.985   9.301
  311   HO2'    A  30          H2'         A  30  12.468  -0.426   7.010
  312    H1'    A  30           H1'        A  30  11.083   1.554   6.536
  313    H8     A  30           H8         A  30   8.119   2.187   8.843
  314    H61    A  30           H61        A  30  10.712   7.655  10.093
  315    H62    A  30           H62        A  30   9.233   6.722  10.148
  316    H2     A  30           H2         A  30  13.651   5.228   7.729
  317    H5'    A  31           H5'        A  31  14.292  -1.365   8.254
  318   H5''    A  31          H5''        A  31  15.052  -2.311   9.548
  319    H4'    A  31           H4'        A  31  16.423  -0.327   9.032
  320    H3'    A  31           H3'        A  31  14.963  -0.605  11.657
  321    H2'    A  31          H2''        A  31  15.473   1.526  12.344
  322   HO2'    A  31          H2'         A  31  17.422   2.377  12.110
  323    H1'    A  31           H1'        A  31  15.996   2.704   9.786
  324    H8     A  31           H8         A  31  12.534   1.367  10.964
  325    H61    A  31           H61        A  31  11.506   7.151  12.876
  326    H62    A  31           H62        A  31  10.766   5.610  12.505
  327    H2     A  31           H2         A  31  15.737   6.904  11.411
  328    H5'    A  32           H5'        A  32  19.568   0.322  12.004
  329   H5''    A  32          H5''        A  32  20.110  -0.453  13.505
  330    H4'    A  32           H4'        A  32  20.953   1.892  13.297
  331    H3'    A  32           H3'        A  32  19.076   0.973  15.472
  332    H2'    A  32          H2''        A  32  18.796   3.095  16.333
  333   HO2'    A  32          H2'         A  32  21.331   3.677  15.184
  334    H1'    A  32           H1'        A  32  19.337   4.608  13.994
  335    H8     A  32           H8         A  32  16.442   2.064  13.959
  336    H61    A  32           H61        A  32  12.943   6.658  16.171
  337    H62    A  32           H62        A  32  12.935   5.065  15.447
  338    H2     A  32           H2         A  32  17.194   8.080  16.050
  339    H5'    A  33           H5'        A  33  22.841   3.111  17.577
  340   H5''    A  33          H5''        A  33  22.669   2.529  19.244
  341    H4'    A  33           H4'        A  33  22.593   5.134  18.726
  342    H3'    A  33           H3'        A  33  20.970   3.407  20.590
  343    H2'    A  33          H2''        A  33  19.486   5.084  21.097
  344   HO2'    A  33          H2'         A  33  20.353   6.836  21.829
  345    H1'    A  33           H1'        A  33  19.850   6.721  18.781
  346    H8     A  33           H8         A  33  18.413   3.219  18.228
  347    H61    A  33           H61        A  33  12.899   5.693  19.545
  348    H62    A  33           H62        A  33  13.727   4.322  18.840
  349    H2     A  33           H2         A  33  16.052   8.772  20.396
  350    H5'    A  34           H5'        A  34  22.725   7.131  22.867
  351   H5''    A  34          H5''        A  34  22.817   6.626  24.566
  352    H4'    A  34           H4'        A  34  21.525   8.813  24.051
  353    H3'    A  34           H3'        A  34  20.663   6.443  25.703
  354    H2'    A  34          H2''        A  34  18.463   7.181  25.865
  355   HO2'    A  34          H2'         A  34  19.543   9.816  25.706
  356    H1'    A  34           H1'        A  34  18.418   8.992  23.645
  357    H8     A  34           H8         A  34  18.741   5.314  22.787
  358    H61    A  34           H61        A  34  12.559   5.171  22.984
  359    H62    A  34           H62        A  34  13.995   4.366  22.396
  360    H2     A  34           H2         A  34  13.929   9.094  24.695
  361    H5'    C  35           H5'        C  35  20.975   8.517  29.721
  362   H5''    C  35          H5''        C  35  20.697   6.952  30.507
  363    H4'    C  35           H4'        C  35  18.722   8.744  29.568
  364    H3'    C  35           H3'        C  35  18.968   6.439  31.160
  365    H2'    C  35          H2''        C  35  18.480   4.784  29.651
  366   HO2'    C  35          H2'         C  35  15.885   5.937  29.685
  367    H1'    C  35           H1'        C  35  16.817   6.417  27.816
  368    H41    C  35           H41        C  35  18.917   1.903  23.872
  369    H42    C  35           H42        C  35  20.527   1.973  24.554
  370    H5     C  35           H5         C  35  21.095   3.348  26.450
  371    H6     C  35           H6         C  35  20.281   5.047  28.015
  372    H5'    U  36           H5'        U  36  17.223  10.497  30.103
  373   H5''    U  36          H5''        U  36  16.907  11.599  31.460
  374    H4'    U  36           H4'        U  36  15.206  12.350  30.093
  375    H3'    U  36           H3'        U  36  14.291   9.853  31.514
  376    H2'    U  36          H2''        U  36  12.443   9.580  30.186
  377   HO2'    U  36          H2'         U  36  11.147  11.197  29.720
  378    H1'    U  36           H1'        U  36  13.312  11.111  27.918
  379    H3     U  36           H3         U  36  11.174   6.972  27.131
  380    H5     U  36           H5         U  36  15.337   6.476  26.806
  381    H6     U  36           H6         U  36  15.624   8.626  27.892
  382    H5'    A  37           H5'        A  37  11.721  12.988  34.750
  383   H5''    A  37          H5''        A  37  11.395  11.527  35.703
  384    H4'    A  37           H4'        A  37   9.392  13.018  34.733
  385    H3'    A  37           H3'        A  37   9.756  10.032  35.025
  386    H2'    A  37          H2''        A  37   7.726   9.560  33.957
  387   HO2'    A  37          H2'         A  37   6.367  11.037  34.926
  388    H1'    A  37           H1'        A  37   7.951  11.364  31.909
  389    H8     A  37           H8         A  37  11.438  10.208  32.149
  390    H61    A  37           H61        A  37   9.683   4.837  29.656
  391    H62    A  37           H62        A  37  11.044   5.820  30.148
  392    H2     A  37           H2         A  37   6.004   6.977  31.071
  393    H5'    C  38           H5'        C  38   6.273  11.296  36.921
  394   H5''    C  38          H5''        C  38   5.782  10.718  38.525
  395    H4'    C  38           H4'        C  38   3.958  10.291  36.962
  396    H3'    C  38           H3'        C  38   5.627   7.995  37.990
  397    H2'    C  38          H2''        C  38   4.486   6.427  36.691
  398   HO2'    C  38          H2'         C  38   2.386   6.936  37.173
  399    H1'    C  38           H1'        C  38   4.051   7.966  34.431
  400    H41    C  38           H41        C  38   8.968   4.080  33.200
  401    H42    C  38           H42        C  38  10.038   5.116  34.118
  402    H5     C  38           H5         C  38   9.301   7.126  35.205
  403    H6     C  38           H6         C  38   7.355   8.407  35.930
  404    H5'    A  39           H5'        A  39   1.964   6.708  40.825
  405   H5''    A  39          H5''        A  39   2.960   5.583  41.770
  406    H4'    A  39           H4'        A  39   1.126   4.706  40.004
  407    H3'    A  39           H3'        A  39   3.884   3.691  40.757
  408    H2'    A  39          H2''        A  39   3.788   1.998  39.093
  409   HO2'    A  39          H2'         A  39   0.994   2.519  38.910
  410    H1'    A  39           H1'        A  39   2.482   3.416  37.156
  411    H8     A  39           H8         A  39   5.165   5.676  38.492
  412    H61    A  39           H61        A  39   9.313   2.226  35.483
  413    H62    A  39           H62        A  39   9.006   3.775  36.235
  414    H2     A  39           H2         A  39   5.389   0.060  35.402
  415    H5'    A  40           H5'        A  40   0.665   1.067  40.360
  416   H5''    A  40          H5''        A  40   0.151   0.252  41.851
  417    H4'    A  40           H4'        A  40  -0.384  -1.320  40.155
  418    H3'    A  40           H3'        A  40   2.181  -1.744  41.640
  419    H2'    A  40          H2''        A  40   3.009  -3.396  40.229
  420   HO2'    A  40          H2'         A  40   1.764  -4.810  39.246
  421    H1'    A  40           H1'        A  40   2.133  -2.491  37.813
  422    H8     A  40           H8         A  40   3.446   0.215  40.240
  423    H61    A  40           H61        A  40   9.034  -0.938  37.892
  424    H62    A  40           H62        A  40   8.126   0.004  39.053
  425    H2     A  40           H2         A  40   6.180  -3.992  36.253
  426    H5'    A  41           H5'        A  41   0.516  -5.863  41.542
  427   H5''    A  41          H5''        A  41   1.338  -6.779  42.820
  428    H4'    A  41           H4'        A  41   1.874  -7.263  40.256
  429    H3'    A  41           H3'        A  41   3.588  -7.161  42.724
  430    H2'    A  41          H2''        A  41   5.577  -7.142  41.581
  431   HO2'    A  41          H2'         A  41   5.921  -8.673  40.203
  432    H1'    A  41           H1'        A  41   4.656  -6.219  39.034
  433    H8     A  41           H8         A  41   4.244  -3.568  41.669
  434    H61    A  41           H61        A  41  10.227  -2.245  40.885
  435    H62    A  41           H62        A  41   8.689  -1.652  41.472
  436    H2     A  41           H2         A  41   9.374  -6.104  38.771
  437    H5'    U  42           H5'        U  42   4.843 -10.863  40.247
  438   H5''    U  42          H5''        U  42   4.767 -12.164  41.452
  439    H4'    U  42           H4'        U  42   6.868 -12.364  40.211
  440    H3'    U  42           H3'        U  42   6.777 -11.562  43.091
  441    H2'    U  42          H2''        U  42   8.922 -10.794  43.227
  442   HO2'    U  42          H2'         U  42   9.922 -12.722  42.739
  443    H1'    U  42           H1'        U  42   9.492 -10.265  40.504
  444    H3     U  42           H3         U  42  10.781  -6.416  42.439
  445    H5     U  42           H5         U  42   6.681  -6.630  43.372
  446    H6     U  42           H6         U  42   6.627  -8.826  42.339
  447    H5'    C  43           H5'        C  43  10.157 -15.418  42.961
  448   H5''    C  43          H5''        C  43  10.092 -15.631  44.720
  449    H4'    C  43           H4'        C  43  12.414 -15.159  43.506
  450    H3'    C  43           H3'        C  43  11.243 -14.225  46.112
  451    H2'    C  43          H2''        C  43  12.812 -12.586  46.461
  452   HO2'    C  43          H2'         C  43  14.504 -14.421  45.178
  453    H1'    C  43           H1'        C  43  13.733 -12.219  43.784
  454    H41    C  43           H41        C  43  11.447  -6.615  45.728
  455    H42    C  43           H42        C  43   9.811  -7.218  45.624
  456    H5     C  43           H5         C  43   9.288  -9.439  44.836
  457    H6     C  43           H6         C  43  10.204 -11.672  44.393
  458    H5'    G  44           H5'        G  44  15.689 -16.187  47.055
  459   H5''    G  44          H5''        G  44  15.599 -16.327  48.823
  460    H4'    G  44           H4'        G  44  17.525 -14.883  47.682
  461    H3'    G  44           H3'        G  44  15.889 -14.555  50.167
  462    H2'    G  44          H2''        G  44  16.368 -12.337  50.502
  463   HO2'    G  44          H2'         G  44  18.419 -11.949  50.632
  464    H1'    G  44           H1'        G  44  17.025 -11.519  47.890
  465    H8     G  44           H8         G  44  13.541 -13.041  48.339
  466    H1     G  44           H1         G  44  13.961  -6.878  50.063
  467    H21    G  44           H21        G  44  16.063  -6.214  49.990
  468    H22    G  44           H22        G  44  17.384  -7.326  49.711
  469    H5'    A  45           H5'        A  45  20.487 -13.518  50.997
  470   H5''    A  45          H5''        A  45  20.689 -13.907  52.717
  471    H4'    A  45           H4'        A  45  21.456 -11.560  51.976
  472    H3'    A  45           H3'        A  45  19.634 -12.327  54.240
  473    H2'    A  45          H2''        A  45  18.980 -10.164  54.720
  474   HO2'    A  45          H2'         A  45  21.389  -9.346  53.453
  475    H1'    A  45           H1'        A  45  19.201  -8.985  52.195
  476    H8     A  45           H8         A  45  17.139 -12.214  52.310
  477    H61    A  45           H61        A  45  12.328  -8.615  53.753
  478    H62    A  45           H62        A  45  12.838 -10.222  53.285
  479    H2     A  45           H2         A  45  16.035  -6.096  53.889
  480    H5'    G  46           H5'        G  46  22.848 -10.560  57.046
  481   H5''    G  46          H5''        G  46  22.373 -11.371  58.550
  482    H4'    G  46           H4'        G  46  21.860  -8.778  58.178
  483    H3'    G  46           H3'        G  46  20.289 -11.005  59.467
  484    H2'    G  46          H2''        G  46  18.362  -9.771  59.632
  485   HO2'    G  46          H2'         G  46  18.361  -7.558  60.001
  486    H1'    G  46           H1'        G  46  18.909  -7.813  57.617
  487    H8     G  46           H8         G  46  18.465 -11.317  56.231
  488    H1     G  46           H1         G  46  12.940  -8.352  57.582
  489    H21    G  46           H21        G  46  13.327  -6.492  58.699
  490    H22    G  46           H22        G  46  14.928  -6.038  59.237
  491    H5'    C  47           H5'        C  47  20.776  -7.044  61.866
  492   H5''    C  47          H5''        C  47  20.874  -7.453  63.590
  493    H4'    C  47           H4'        C  47  19.375  -5.506  63.217
  494    H3'    C  47           H3'        C  47  18.374  -8.165  64.225
  495    H2'    C  47          H2''        C  47  16.152  -7.483  64.260
  496   HO2'    C  47          H2'         C  47  17.119  -4.806  64.121
  497    H1'    C  47           H1'        C  47  16.169  -5.844  62.009
  498    H41    C  47           H41        C  47  13.426 -11.322  60.290
  499    H42    C  47           H42        C  47  14.969 -12.143  60.325
  500    H5     C  47           H5         C  47  17.037 -11.032  60.867
  501    H6     C  47           H6         C  47  18.043  -8.955  61.682
  502    H5'    C  48           H5'        C  48  16.279  -5.633  66.442
  503   H5''    C  48          H5''        C  48  16.609  -5.799  68.177
  504    H4'    C  48           H4'        C  48  14.229  -5.890  68.002
  505    H3'    C  48           H3'        C  48  15.643  -8.540  68.216
  506   HO3'    C  48          H3T         C  48  14.840  -8.413  70.298
  507    H2'    C  48          H2''        C  48  13.707  -9.771  67.994
  508   HO2'    C  48          H2'         C  48  12.460  -8.768  69.554
  509    H1'    C  48           H1'        C  48  12.330  -8.045  66.256
  510    H41    C  48           H41        C  48  14.211 -12.916  62.627
  511    H42    C  48           H42        C  48  15.891 -12.631  63.022
  512    H5     C  48           H5         C  48  16.624 -10.773  64.370
  513    H6     C  48           H6         C  48  15.903  -8.983  65.876
  Start of MODEL   10
    1    H5'    G   1           H5'        G   1   7.355 -16.565  60.434
    2   H5''    G   1          H5''        G   1   7.030 -15.197  59.351
    3    H4'    G   1           H4'        G   1   6.717 -14.525  61.714
    4    H3'    G   1           H3'        G   1   8.789 -13.404  59.885
    5    H2'    G   1          H2''        G   1  10.094 -12.390  61.491
    6   HO2'    G   1          H2'         G   1   7.908 -11.474  62.345
    7    H1'    G   1           H1'        G   1   9.624 -13.989  63.710
    8    H8     G   1           H8         G   1  10.595 -16.508  61.249
    9    H1     G   1           H1         G   1  15.508 -12.580  62.491
   10    H21    G   1           H21        G   1  14.814 -10.831  63.644
   11    H22    G   1           H22        G   1  13.121 -10.534  63.966
   12   HO5'    G   1          H5T         G   1   8.896 -15.981  58.618
   13    H5'    G   2           H5'        G   2   6.798  -9.705  61.754
   14   H5''    G   2          H5''        G   2   6.439  -8.624  60.392
   15    H4'    G   2           H4'        G   2   7.660  -7.391  62.140
   16    H3'    G   2           H3'        G   2   8.770  -7.914  59.427
   17    H2'    G   2          H2''        G   2  10.921  -7.207  59.909
   18   HO2'    G   2          H2'         G   2  11.352  -5.594  61.244
   19    H1'    G   2           H1'        G   2  11.152  -7.952  62.558
   20    H8     G   2           H8         G   2   9.702 -10.709  60.329
   21    H1     G   2           H1         G   2  16.057 -10.009  59.780
   22    H21    G   2           H21        G   2  16.727  -8.296  61.008
   23    H22    G   2           H22        G   2  15.603  -7.210  61.791
   24    H5'    C   3           H5'        C   3   9.293  -3.902  61.280
   25   H5''    C   3          H5''        C   3   8.916  -2.575  60.163
   26    H4'    C   3           H4'        C   3  10.906  -2.017  61.519
   27    H3'    C   3           H3'        C   3  10.963  -2.419  58.557
   28    H2'    C   3          H2''        C   3  13.255  -2.515  58.342
   29   HO2'    C   3          H2'         C   3  13.454  -1.112  60.811
   30    H1'    C   3           H1'        C   3  14.002  -3.483  60.855
   31    H41    C   3           H41        C   3  14.950  -8.214  56.688
   32    H42    C   3           H42        C   3  13.227  -8.388  56.439
   33    H5     C   3           H5         C   3  11.596  -7.003  57.531
   34    H6     C   3           H6         C   3  11.254  -5.162  59.110
   35    H5'    U   4           H5'        U   4  13.547   0.791  58.718
   36   H5''    U   4          H5''        U   4  13.043   2.039  57.560
   37    H4'    U   4           H4'        U   4  15.328   1.273  57.033
   38    H3'    U   4           H3'        U   4  12.983   0.733  55.229
   39    H2'    U   4          H2''        U   4  14.110  -0.724  53.863
   40   HO2'    U   4          H2'         U   4  16.173  -0.411  53.239
   41    H1'    U   4           H1'        U   4  16.224  -1.492  55.620
   42    H3     U   4           H3         U   4  14.837  -5.407  53.862
   43    H5     U   4           H5         U   4  11.540  -4.112  56.148
   44    H6     U   4           H6         U   4  12.701  -2.014  56.510
   45    H5'    C   5           H5'        C   5  16.586   2.957  52.605
   46   H5''    C   5          H5''        C   5  15.657   3.378  51.154
   47    H4'    C   5           H4'        C   5  17.841   1.914  50.912
   48    H3'    C   5           H3'        C   5  15.129   1.687  49.625
   49    H2'    C   5          H2''        C   5  15.520  -0.391  48.738
   50   HO2'    C   5          H2'         C   5  17.230  -0.648  47.563
   51    H1'    C   5           H1'        C   5  17.626  -1.257  50.463
   52    H41    C   5           H41        C   5  12.859  -5.437  50.936
   53    H42    C   5           H42        C   5  11.860  -4.261  51.756
   54    H5     C   5           H5         C   5  12.621  -2.027  52.283
   55    H6     C   5           H6         C   5  14.405  -0.382  51.929
   56    H5'    G   6           H5'        G   6  18.528   1.960  45.932
   57   H5''    G   6          H5''        G   6  17.396   2.194  44.587
   58    H4'    G   6           H4'        G   6  19.102   0.147  44.575
   59    H3'    G   6           H3'        G   6  16.227   0.415  43.718
   60    H2'    G   6          H2''        G   6  15.933  -1.861  43.377
   61   HO2'    G   6          H2'         G   6  17.483  -3.149  42.640
   62    H1'    G   6           H1'        G   6  17.673  -2.868  45.311
   63    H8     G   6           H8         G   6  15.324  -0.299  46.806
   64    H1     G   6           H1         G   6  12.605  -6.035  45.896
   65    H21    G   6           H21        G   6  13.944  -7.326  44.705
   66    H22    G   6           H22        G   6  15.419  -6.726  43.980
   67    H5'    A   7           H5'        A   7  18.151  -1.709  40.309
   68   H5''    A   7          H5''        A   7  17.076  -1.545  38.906
   69    H4'    A   7           H4'        A   7  17.375  -3.902  40.123
   70    H3'    A   7           H3'        A   7  15.011  -2.514  38.889
   71    H2'    A   7          H2''        A   7  13.454  -3.961  39.759
   72   HO2'    A   7          H2'         A   7  15.543  -5.887  39.793
   73    H1'    A   7           H1'        A   7  14.882  -4.920  42.020
   74    H8     A   7           H8         A   7  14.414  -1.208  42.292
   75    H61    A   7           H61        A   7   8.583  -2.309  44.025
   76    H62    A   7           H62        A   7   9.874  -1.129  43.985
   77    H2     A   7           H2         A   7  10.330  -6.150  42.509
   78    H5'    U   8           H5'        U   8  15.006  -6.894  36.682
   79   H5''    U   8          H5''        U   8  14.126  -6.393  35.225
   80    H4'    U   8           H4'        U   8  13.152  -8.327  36.751
   81    H3'    U   8           H3'        U   8  11.861  -6.026  35.318
   82    H2'    U   8          H2''        U   8   9.831  -6.225  36.375
   83   HO2'    U   8          H2'         U   8   8.927  -8.102  36.284
   84    H1'    U   8           H1'        U   8  10.638  -7.552  38.757
   85    H3     U   8           H3         U   8   7.982  -4.049  39.963
   86    H5     U   8           H5         U   8  11.708  -2.331  39.018
   87    H6     U   8           H6         U   8  12.402  -4.481  38.134
   88    H5'    U   9           H5'        U   9   9.195  -9.324  34.044
   89   H5''    U   9          H5''        U   9   8.983  -9.122  32.292
   90    H4'    U   9           H4'        U   9   6.782  -9.095  33.362
   91    H3'    U   9           H3'        U   9   7.968  -6.602  32.169
   92    H2'    U   9          H2''        U   9   6.374  -5.190  33.026
   93   HO2'    U   9          H2'         U   9   4.616  -7.430  33.014
   94    H1'    U   9           H1'        U   9   5.456  -6.775  35.210
   95    H3     U   9           H3         U   9   6.121  -2.930  37.384
   96    H5     U   9           H5         U   9   9.812  -3.541  35.436
   97    H6     U   9           H6         U   9   8.895  -5.567  34.479
   98    H5'    G  10           H5'        G  10   3.564  -7.333  30.031
   99   H5''    G  10          H5''        G  10   3.783  -6.301  28.605
  100    H4'    G  10           H4'        G  10   1.722  -5.912  30.243
  101    H3'    G  10           H3'        G  10   3.560  -3.983  28.822
  102    H2'    G  10          H2''        G  10   2.634  -2.130  29.863
  103   HO2'    G  10          H2'         G  10   0.404  -3.275  29.387
  104    H1'    G  10           H1'        G  10   1.927  -3.296  32.311
  105    H8     G  10           H8         G  10   5.541  -4.024  31.649
  106    H1     G  10           H1         G  10   4.511   2.109  33.232
  107    H21    G  10           H21        G  10   2.351   2.545  33.203
  108    H22    G  10           H22        G  10   1.170   1.385  32.637
  109    H5'    U  11           H5'        U  11  -0.665  -2.464  27.852
  110   H5''    U  11          H5''        U  11  -0.423  -1.456  26.413
  111    H4'    U  11           H4'        U  11  -1.242  -0.368  28.700
  112    H3'    U  11           H3'        U  11   0.762   0.588  26.646
  113    H2'    U  11          H2''        U  11   1.277   2.476  27.904
  114   HO2'    U  11          H2'         U  11  -1.114   2.065  29.392
  115    H1'    U  11           H1'        U  11   0.884   1.364  30.466
  116    H3     U  11           H3         U  11   5.101   3.165  30.076
  117    H5     U  11           H5         U  11   5.336  -0.696  28.406
  118    H6     U  11           H6         U  11   2.918  -0.824  28.522
  119    H5'    A  12           H5'        A  12  -2.000   3.966  25.177
  120   H5''    A  12          H5''        A  12  -1.063   4.210  23.692
  121    H4'    A  12           H4'        A  12  -0.853   5.904  25.759
  122    H3'    A  12           H3'        A  12   1.257   4.785  23.887
  123    H2'    A  12          H2''        A  12   2.910   6.046  24.965
  124   HO2'    A  12          H2'         A  12   0.742   7.552  26.025
  125    H1'    A  12           H1'        A  12   1.913   5.778  27.551
  126    H8     A  12           H8         A  12   1.993   2.335  26.024
  127    H61    A  12           H61        A  12   8.147   2.462  26.561
  128    H62    A  12           H62        A  12   6.747   1.448  26.295
  129    H2     A  12           H2         A  12   6.582   6.537  27.586
  130    H5'    U  13           H5'        U  13   1.650   8.956  24.497
  131   H5''    U  13          H5''        U  13   2.223   9.826  23.061
  132    H4'    U  13           H4'        U  13   3.600  10.118  25.230
  133    H3'    U  13           H3'        U  13   4.573   9.337  22.482
  134    H2'    U  13          H2''        U  13   6.740   9.003  23.195
  135   HO2'    U  13          H2'         U  13   7.703  10.287  24.587
  136    H1'    U  13           H1'        U  13   6.219   8.328  25.900
  137    H3     U  13           H3         U  13   9.002   5.226  23.958
  138    H5     U  13           H5         U  13   5.123   4.267  22.620
  139    H6     U  13           H6         U  13   4.342   6.339  23.575
  140    H5'    U  14           H5'        U  14   7.091  12.240  24.279
  141   H5''    U  14          H5''        U  14   7.044  13.750  23.345
  142    H4'    U  14           H4'        U  14   9.337  13.460  24.012
  143    H3'    U  14           H3'        U  14   8.528  12.917  21.188
  144    H2'    U  14          H2''        U  14  10.426  11.802  20.563
  145   HO2'    U  14          H2'         U  14  12.312  12.624  20.990
  146    H1'    U  14           H1'        U  14  11.359  10.848  23.025
  147    H3     U  14           H3         U  14  11.192   7.116  20.504
  148    H5     U  14           H5         U  14   7.150   8.263  20.824
  149    H6     U  14           H6         U  14   7.877  10.274  21.968
  150    H5'    U  15           H5'        U  15  12.621  15.595  20.951
  151   H5''    U  15          H5''        U  15  12.532  16.096  19.252
  152    H4'    U  15           H4'        U  15  14.603  14.673  20.116
  153    H3'    U  15           H3'        U  15  12.991  14.569  17.576
  154    H2'    U  15          H2''        U  15  13.907  12.593  16.864
  155   HO2'    U  15          H2'         U  15  16.007  13.152  16.696
  156    H1'    U  15           H1'        U  15  14.807  11.559  19.373
  157    H3     U  15           H3         U  15  12.795   8.086  17.261
  158    H5     U  15           H5         U  15   9.627  10.659  18.311
  159    H6     U  15           H6         U  15  11.275  12.309  18.977
  160    H5'    U  16           H5'        U  16  17.527  15.208  15.639
  161   H5''    U  16          H5''        U  16  16.879  15.700  14.061
  162    H4'    U  16           H4'        U  16  18.406  13.530  14.273
  163    H3'    U  16           H3'        U  16  15.941  14.139  12.653
  164    H2'    U  16          H2''        U  16  15.609  11.963  12.003
  165   HO2'    U  16          H2'         U  16  18.424  11.742  12.229
  166    H1'    U  16           H1'        U  16  17.043  10.633  14.085
  167    H3     U  16           H3         U  16  13.153   8.357  13.628
  168    H5     U  16           H5         U  16  11.989  12.067  15.253
  169    H6     U  16           H6         U  16  14.272  12.837  14.962
  170    H5'    U  17           H5'        U  17  19.391  12.158  10.233
  171   H5''    U  17          H5''        U  17  19.302  12.805   8.583
  172    H4'    U  17           H4'        U  17  19.517  10.303   8.632
  173    H3'    U  17           H3'        U  17  17.175  11.800   7.473
  174    H2'    U  17          H2''        U  17  15.916   9.913   7.125
  175   HO2'    U  17          H2'         U  17  18.422   8.632   6.824
  176    H1'    U  17           H1'        U  17  17.140   8.176   9.025
  177    H3     U  17           H3         U  17  12.676   7.642   9.572
  178    H5     U  17           H5         U  17  13.392  11.595  10.847
  179    H6     U  17           H6         U  17  15.681  11.354  10.078
  180    H5'    A  18           H5'        A  18  19.271   8.888   3.907
  181   H5''    A  18          H5''        A  18  18.243   9.353   2.538
  182    H4'    A  18           H4'        A  18  18.440   6.800   3.278
  183    H3'    A  18           H3'        A  18  16.027   8.426   2.436
  184    H2'    A  18          H2''        A  18  14.640   6.550   2.663
  185   HO2'    A  18          H2'         A  18  15.353   4.679   2.056
  186    H1'    A  18           H1'        A  18  15.859   5.477   4.924
  187    H8     A  18           H8         A  18  15.320   9.164   5.517
  188    H61    A  18           H61        A  18   9.283   7.982   6.132
  189    H62    A  18           H62        A  18  10.555   9.149   6.413
  190    H2     A  18           H2         A  18  11.300   4.225   4.740
  191    H5'    A  19           H5'        A  19  16.453   5.254  -0.662
  192   H5''    A  19          H5''        A  19  15.364   5.534  -2.034
  193    H4'    A  19           H4'        A  19  14.858   3.626  -0.214
  194    H3'    A  19           H3'        A  19  13.048   5.528  -1.716
  195    H2'    A  19          H2''        A  19  11.176   4.849  -0.526
  196   HO2'    A  19          H2'         A  19  11.490   2.619  -1.022
  197    H1'    A  19           H1'        A  19  12.495   4.078   1.887
  198    H8     A  19           H8         A  19  13.332   7.599   1.675
  199    H61    A  19           H61        A  19   7.522   8.962   3.279
  200    H62    A  19           H62        A  19   9.131   9.600   3.024
  201    H2     A  19           H2         A  19   7.629   4.685   1.915
  202    H5'    A  20           H5'        A  20  11.069   2.284  -4.455
  203   H5''    A  20          H5''        A  20  10.777   3.551  -5.663
  204    H4'    A  20           H4'        A  20   8.759   2.522  -4.250
  205    H3'    A  20           H3'        A  20   9.378   5.318  -5.193
  206    H2'    A  20          H2''        A  20   7.680   6.283  -3.955
  207   HO2'    A  20          H2'         A  20   5.759   5.428  -3.924
  208    H1'    A  20           H1'        A  20   7.502   4.423  -1.854
  209    H8     A  20           H8         A  20  10.931   6.060  -2.477
  210    H61    A  20           H61        A  20   8.884  10.755   0.975
  211    H62    A  20           H62        A  20  10.233  10.125   0.057
  212    H2     A  20           H2         A  20   5.439   7.983   0.218
  213    H5'    U  21           H5'        U  21   4.906   4.933  -6.278
  214   H5''    U  21          H5''        U  21   4.786   6.126  -7.586
  215    H4'    U  21           H4'        U  21   3.423   6.578  -5.410
  216    H3'    U  21           H3'        U  21   5.299   8.440  -6.881
  217    H2'    U  21          H2''        U  21   4.976  10.151  -5.320
  218   HO2'    U  21          H2'         U  21   2.638   8.722  -4.547
  219    H1'    U  21           H1'        U  21   4.742   8.567  -3.040
  220    H3     U  21           H3         U  21   8.434  11.051  -2.248
  221    H5     U  21           H5         U  21   9.542   8.680  -5.553
  222    H6     U  21           H6         U  21   7.312   7.732  -5.537
  223    H5'    U  22           H5'        U  22   1.277   9.483  -6.045
  224   H5''    U  22          H5''        U  22   0.230  10.107  -7.336
  225    H4'    U  22           H4'        U  22  -0.346  11.209  -5.219
  226    H3'    U  22           H3'        U  22   0.733  12.566  -7.595
  227    H2'    U  22          H2''        U  22   1.839  14.290  -6.619
  228   HO2'    U  22          H2'         U  22  -0.397  14.396  -4.873
  229    H1'    U  22           H1'        U  22   1.662  13.615  -3.835
  230    H3     U  22           H3         U  22   5.902  15.083  -3.829
  231    H5     U  22           H5         U  22   5.898  12.251  -6.949
  232    H6     U  22           H6         U  22   3.528  11.922  -6.564
  233    H5'    A  23           H5'        A  23  -0.052  15.491  -9.507
  234   H5''    A  23          H5''        A  23   1.062  15.191  -8.160
  235    H4'    A  23           H4'        A  23   1.140  17.555  -9.126
  236    H3'    A  23           H3'        A  23   0.884  16.658  -6.320
  237    H2'    A  23          H2''        A  23  -0.071  18.534  -5.407
  238   HO2'    A  23          H2'         A  23   1.536  19.969  -5.830
  239    H1'    A  23           H1'        A  23  -1.288  19.745  -7.616
  240    H8     A  23           H8         A  23  -2.668  16.326  -7.608
  241    H61    A  23           H61        A  23  -6.183  17.875  -2.769
  242    H62    A  23           H62        A  23  -5.827  16.635  -3.951
  243    H2     A  23           H2         A  23  -3.015  21.009  -3.236
  244    H5'    A  24           H5'        A  24   4.584  18.590  -4.489
  245   H5''    A  24          H5''        A  24   4.234  17.552  -3.094
  246    H4'    A  24           H4'        A  24   3.184  20.162  -3.658
  247    H3'    A  24           H3'        A  24   3.167  18.059  -1.550
  248    H2'    A  24          H2''        A  24   0.995  18.261  -0.915
  249   HO2'    A  24          H2'         A  24   0.182  20.164  -0.301
  250    H1'    A  24           H1'        A  24  -0.023  19.983  -2.997
  251    H8     A  24           H8         A  24   0.551  16.541  -4.219
  252    H61    A  24           H61        A  24  -4.720  14.854  -1.454
  253    H62    A  24           H62        A  24  -3.471  14.377  -2.583
  254    H2     A  24           H2         A  24  -3.614  18.947   0.011
  255    H5'    U  25           H5'        U  25   5.759  18.666   2.178
  256   H5''    U  25          H5''        U  25   4.534  17.874   1.169
  257    H4'    U  25           H4'        U  25   4.190  18.344   3.836
  258    H3'    U  25           H3'        U  25   2.674  17.403   1.692
  259    H2'    U  25          H2''        U  25   1.569  19.360   1.075
  260   HO2'    U  25          H2'         U  25   0.159  18.704   3.461
  261    H1'    U  25           H1'        U  25   1.453  20.470   3.843
  262    H3     U  25           H3         U  25   0.755  24.693   2.539
  263    H5     U  25           H5         U  25   2.441  22.939  -0.900
  264    H6     U  25           H6         U  25   2.653  20.864   0.333
  265    H5'    U  26           H5'        U  26   0.048  17.061   0.480
  266   H5''    U  26          H5''        U  26  -0.994  16.531   1.815
  267    H4'    U  26           H4'        U  26  -1.739  15.163   0.045
  268    H3'    U  26           H3'        U  26   0.246  13.957   1.901
  269    H2'    U  26          H2''        U  26   0.914  12.211   0.571
  270   HO2'    U  26          H2'         U  26  -1.682  12.089   0.051
  271    H1'    U  26           H1'        U  26   0.508  13.215  -1.973
  272    H3     U  26           H3         U  26   4.941  12.324  -1.839
  273    H5     U  26           H5         U  26   4.488  15.491   0.901
  274    H6     U  26           H6         U  26   2.099  15.397   0.521
  275    H5'    C  27           H5'        C  27  -3.114  10.635   0.967
  276   H5''    C  27          H5''        C  27  -3.084   9.671   2.457
  277    H4'    C  27           H4'        C  27  -2.791   8.279   0.372
  278    H3'    C  27           H3'        C  27  -0.625   8.594   2.464
  279    H2'    C  27          H2''        C  27   0.753   7.057   1.338
  280   HO2'    C  27          H2'         C  27   0.007   5.457   0.136
  281    H1'    C  27           H1'        C  27   0.026   7.865  -1.259
  282    H41    C  27           H41        C  27   5.724  10.503  -0.218
  283    H42    C  27           H42        C  27   5.099  11.438   1.122
  284    H5     C  27           H5         C  27   2.836  11.259   1.912
  285    H6     C  27           H6         C  27   0.684  10.134   1.607
  286    H5'    U  28           H5'        U  28  -1.186   4.599   2.049
  287   H5''    U  28          H5''        U  28  -1.154   3.594   3.512
  288    H4'    U  28           H4'        U  28   0.592   2.898   1.866
  289    H3'    U  28           H3'        U  28   1.184   4.023   4.599
  290    H2'    U  28          H2''        U  28   3.440   4.216   4.251
  291   HO2'    U  28          H2'         U  28   3.144   2.036   2.453
  292    H1'    U  28           H1'        U  28   3.458   4.259   1.393
  293    H3     U  28           H3         U  28   6.292   7.553   2.681
  294    H5     U  28           H5         U  28   2.483   8.985   3.773
  295    H6     U  28           H6         U  28   1.567   6.822   3.169
  296    H5'    U  29           H5'        U  29   3.365  -0.633   4.235
  297   H5''    U  29          H5''        U  29   3.768  -0.738   5.958
  298    H4'    U  29           H4'        U  29   5.657  -1.112   4.142
  299    H3'    U  29           H3'        U  29   5.684   0.439   6.736
  300    H2'    U  29          H2''        U  29   7.826   1.240   6.367
  301   HO2'    U  29          H2'         U  29   8.126  -1.045   4.712
  302    H1'    U  29           H1'        U  29   7.809   1.227   3.540
  303    H3     U  29           H3         U  29   9.159   5.293   5.300
  304    H5     U  29           H5         U  29   4.972   5.430   4.925
  305    H6     U  29           H6         U  29   4.983   3.028   4.617
  306    H5'    A  30           H5'        A  30   9.309  -2.322   6.565
  307   H5''    A  30          H5''        A  30   9.912  -2.509   8.222
  308    H4'    A  30           H4'        A  30  11.432  -1.373   6.354
  309    H3'    A  30           H3'        A  30  10.986  -0.738   9.267
  310    H2'    A  30          H2''        A  30  12.115   1.258   9.167
  311   HO2'    A  30          H2'         A  30  13.596   0.131   7.015
  312    H1'    A  30           H1'        A  30  11.914   1.751   6.355
  313    H8     A  30           H8         A  30   8.532   1.874   7.996
  314    H61    A  30           H61        A  30   9.983   7.553   9.969
  315    H62    A  30           H62        A  30   8.695   6.390   9.753
  316    H2     A  30           H2         A  30  13.695   5.668   8.306
  317    H5'    A  31           H5'        A  31  15.296  -0.462   8.287
  318   H5''    A  31          H5''        A  31  16.156  -1.487   9.454
  319    H4'    A  31           H4'        A  31  17.359   0.620   9.282
  320    H3'    A  31           H3'        A  31  15.753  -0.014  11.745
  321    H2'    A  31          H2''        A  31  15.938   2.087  12.648
  322   HO2'    A  31          H2'         A  31  18.399   2.212  11.244
  323    H1'    A  31           H1'        A  31  16.470   3.586  10.287
  324    H8     A  31           H8         A  31  13.143   1.677  10.656
  325    H61    A  31           H61        A  31  11.007   6.789  13.397
  326    H62    A  31           H62        A  31  10.575   5.241  12.703
  327    H2     A  31           H2         A  31  15.369   7.380  12.545
  328    H5'    A  32           H5'        A  32  19.986   1.527  12.806
  329   H5''    A  32          H5''        A  32  20.480   0.624  14.252
  330    H4'    A  32           H4'        A  32  20.843   3.063  14.550
  331    H3'    A  32           H3'        A  32  18.802   1.533  16.169
  332    H2'    A  32          H2''        A  32  18.049   3.435  17.241
  333   HO2'    A  32          H2'         A  32  19.355   5.005  17.874
  334    H1'    A  32           H1'        A  32  18.687   5.340  15.241
  335    H8     A  32           H8         A  32  16.314   2.371  14.488
  336    H61    A  32           H61        A  32  11.772   6.127  16.353
  337    H62    A  32           H62        A  32  12.153   4.636  15.519
  338    H2     A  32           H2         A  32  15.678   8.234  17.008
  339    H5'    A  33           H5'        A  33  21.613   3.858  19.263
  340   H5''    A  33          H5''        A  33  21.200   3.022  20.772
  341    H4'    A  33           H4'        A  33  20.735   5.626  20.511
  342    H3'    A  33           H3'        A  33  19.090   3.418  21.755
  343    H2'    A  33          H2''        A  33  17.286   4.804  22.120
  344   HO2'    A  33          H2'         A  33  17.601   6.645  23.064
  345    H1'    A  33           H1'        A  33  17.840   6.754  20.099
  346    H8     A  33           H8         A  33  17.126   3.177  18.930
  347    H61    A  33           H61        A  33  11.139   4.699  19.200
  348    H62    A  33           H62        A  33  12.304   3.554  18.572
  349    H2     A  33           H2         A  33  13.516   8.073  20.965
  350    H5'    A  34           H5'        A  34  19.777   6.823  24.956
  351   H5''    A  34          H5''        A  34  19.398   6.062  26.513
  352    H4'    A  34           H4'        A  34  18.028   8.188  25.694
  353    H3'    A  34           H3'        A  34  17.194   5.651  27.085
  354    H2'    A  34          H2''        A  34  14.942   6.038  26.820
  355   HO2'    A  34          H2'         A  34  15.007   8.007  27.982
  356    H1'    A  34           H1'        A  34  15.056   7.840  24.601
  357    H8     A  34           H8         A  34  16.279   4.372  23.731
  358    H61    A  34           H61        A  34  10.320   2.928  22.861
  359    H62    A  34           H62        A  34  11.973   2.466  22.525
  360    H2     A  34           H2         A  34  10.533   6.943  24.875
  361    H5'    C  35           H5'        C  35  16.303   5.531  30.987
  362   H5''    C  35          H5''        C  35  16.658   3.878  30.451
  363    H4'    C  35           H4'        C  35  14.404   5.692  29.661
  364    H3'    C  35           H3'        C  35  14.782   3.220  30.961
  365    H2'    C  35          H2''        C  35  15.084   1.866  29.185
  366   HO2'    C  35          H2'         C  35  13.058   1.168  29.691
  367    H1'    C  35           H1'        C  35  13.477   3.537  27.277
  368    H41    C  35           H41        C  35  16.906  -0.013  23.244
  369    H42    C  35           H42        C  35  18.397   0.501  24.002
  370    H5     C  35           H5         C  35  18.460   1.770  26.049
  371    H6     C  35           H6         C  35  17.121   3.002  27.690
  372    H5'    U  36           H5'        U  36  14.944   6.876  31.209
  373   H5''    U  36          H5''        U  36  13.923   7.190  32.626
  374    H4'    U  36           H4'        U  36  14.540   9.313  31.472
  375    H3'    U  36           H3'        U  36  11.802   8.212  31.840
  376    H2'    U  36          H2''        U  36  10.700   9.561  30.318
  377   HO2'    U  36          H2'         U  36  11.615  11.505  31.232
  378    H1'    U  36           H1'        U  36  12.624   9.900  28.382
  379    H3     U  36           H3         U  36   8.654   7.169  27.803
  380    H5     U  36           H5         U  36  12.160   4.860  27.525
  381    H6     U  36           H6         U  36  13.397   6.716  28.443
  382    H5'    A  37           H5'        A  37   9.853  11.589  34.465
  383   H5''    A  37          H5''        A  37   9.383  10.250  35.529
  384    H4'    A  37           H4'        A  37   7.548  11.589  34.125
  385    H3'    A  37           H3'        A  37   7.846   8.631  34.714
  386    H2'    A  37          H2''        A  37   5.907   8.130  33.500
  387   HO2'    A  37          H2'         A  37   5.367  10.929  33.431
  388    H1'    A  37           H1'        A  37   6.387   9.825  31.374
  389    H8     A  37           H8         A  37   9.744   8.470  31.779
  390    H61    A  37           H61        A  37   7.713   3.012  29.708
  391    H62    A  37           H62        A  37   9.122   3.994  30.046
  392    H2     A  37           H2         A  37   4.145   5.478  30.859
  393    H5'    C  38           H5'        C  38   4.280  10.229  36.244
  394   H5''    C  38          H5''        C  38   3.636   9.825  37.848
  395    H4'    C  38           H4'        C  38   1.891   9.422  36.187
  396    H3'    C  38           H3'        C  38   3.272   7.104  37.537
  397    H2'    C  38          H2''        C  38   2.128   5.515  36.276
  398   HO2'    C  38          H2'         C  38   0.042   6.192  36.586
  399    H1'    C  38           H1'        C  38   1.915   6.918  33.878
  400    H41    C  38           H41        C  38   6.482   2.538  33.092
  401    H42    C  38           H42        C  38   7.618   3.549  33.955
  402    H5     C  38           H5         C  38   7.030   5.676  34.891
  403    H6     C  38           H6         C  38   5.190   7.165  35.470
  404    H5'    A  39           H5'        A  39  -0.656   6.368  40.202
  405   H5''    A  39          H5''        A  39   0.209   5.319  41.341
  406    H4'    A  39           H4'        A  39  -1.554   4.319  39.574
  407    H3'    A  39           H3'        A  39   1.088   3.287  40.638
  408    H2'    A  39          H2''        A  39   1.074   1.449  39.156
  409   HO2'    A  39          H2'         A  39  -0.936   0.621  39.574
  410    H1'    A  39           H1'        A  39  -0.168   2.633  37.005
  411    H8     A  39           H8         A  39   2.642   4.842  38.245
  412    H61    A  39           H61        A  39   6.589   0.946  35.525
  413    H62    A  39           H62        A  39   6.375   2.559  36.166
  414    H2     A  39           H2         A  39   2.532  -0.958  35.509
  415    H5'    A  40           H5'        A  40  -2.458   0.839  41.245
  416   H5''    A  40          H5''        A  40  -2.721  -0.011  42.780
  417    H4'    A  40           H4'        A  40  -3.245  -1.561  40.986
  418    H3'    A  40           H3'        A  40  -0.742  -1.889  42.616
  419    H2'    A  40          H2''        A  40   0.216  -3.504  41.266
  420   HO2'    A  40          H2'         A  40  -2.413  -4.021  40.312
  421    H1'    A  40           H1'        A  40  -0.774  -2.788  38.789
  422    H8     A  40           H8         A  40   0.692   0.062  40.932
  423    H61    A  40           H61        A  40   6.090  -1.256  38.245
  424    H62    A  40           H62        A  40   5.270  -0.230  39.400
  425    H2     A  40           H2         A  40   3.141  -4.431  37.075
  426    H5'    A  41           H5'        A  41  -2.166  -6.067  43.337
  427   H5''    A  41          H5''        A  41  -1.135  -6.570  44.689
  428    H4'    A  41           H4'        A  41  -0.630  -7.365  42.174
  429    H3'    A  41           H3'        A  41   1.170  -6.593  44.474
  430    H2'    A  41          H2''        A  41   3.065  -6.596  43.171
  431   HO2'    A  41          H2'         A  41   1.703  -8.498  41.560
  432    H1'    A  41           H1'        A  41   1.831  -6.167  40.616
  433    H8     A  41           H8         A  41   1.326  -3.177  42.816
  434    H61    A  41           H61        A  41   7.116  -1.517  41.420
  435    H62    A  41           H62        A  41   5.572  -0.971  42.036
  436    H2     A  41           H2         A  41   6.487  -5.717  39.977
  437    H5'    U  42           H5'        U  42   2.902 -11.027  43.054
  438   H5''    U  42          H5''        U  42   3.475 -11.450  44.679
  439    H4'    U  42           H4'        U  42   5.197 -11.545  42.727
  440    H3'    U  42           H3'        U  42   5.417 -10.312  45.457
  441    H2'    U  42          H2''        U  42   7.346  -9.149  45.019
  442   HO2'    U  42          H2'         U  42   7.888 -11.330  43.319
  443    H1'    U  42           H1'        U  42   7.208  -9.009  42.179
  444    H3     U  42           H3         U  42   8.219  -4.800  43.526
  445    H5     U  42           H5         U  42   4.248  -5.370  44.819
  446    H6     U  42           H6         U  42   4.422  -7.686  44.106
  447    H5'    C  43           H5'        C  43   8.376 -13.626  44.086
  448   H5''    C  43          H5''        C  43   9.228 -14.454  45.404
  449    H4'    C  43           H4'        C  43  10.709 -13.828  43.441
  450    H3'    C  43           H3'        C  43  11.070 -13.038  46.312
  451    H2'    C  43          H2''        C  43  12.731 -11.493  45.920
  452   HO2'    C  43          H2'         C  43  14.359 -12.124  44.777
  453    H1'    C  43           H1'        C  43  12.136 -10.753  43.271
  454    H41    C  43           H41        C  43  10.978  -5.689  46.957
  455    H42    C  43           H42        C  43   9.618  -6.494  47.704
  456    H5     C  43           H5         C  43   8.920  -8.722  47.112
  457    H6     C  43           H6         C  43   9.423 -10.688  45.740
  458    H5'    G  44           H5'        G  44  15.325 -14.537  45.178
  459   H5''    G  44          H5''        G  44  16.009 -14.912  46.770
  460    H4'    G  44           H4'        G  44  17.033 -12.944  45.306
  461    H3'    G  44           H3'        G  44  16.488 -13.220  48.252
  462    H2'    G  44          H2''        G  44  16.823 -11.001  48.717
  463   HO2'    G  44          H2'         G  44  18.681 -11.149  46.598
  464    H1'    G  44           H1'        G  44  16.409  -9.902  46.112
  465    H8     G  44           H8         G  44  13.407 -11.579  47.792
  466    H1     G  44           H1         G  44  14.435  -5.528  49.662
  467    H21    G  44           H21        G  44  16.334  -4.791  48.816
  468    H22    G  44           H22        G  44  17.443  -5.836  47.957
  469    H5'    A  45           H5'        A  45  20.655 -11.380  47.515
  470   H5''    A  45          H5''        A  45  21.720 -12.200  48.674
  471    H4'    A  45           H4'        A  45  22.068  -9.745  48.743
  472    H3'    A  45           H3'        A  45  20.958 -11.334  51.035
  473    H2'    A  45          H2''        A  45  20.319  -9.512  52.279
  474   HO2'    A  45          H2'         A  45  22.502  -8.244  51.010
  475    H1'    A  45           H1'        A  45  20.073  -7.561  50.232
  476    H8     A  45           H8         A  45  17.942 -10.796  50.260
  477    H61    A  45           H61        A  45  13.820  -7.494  53.472
  478    H62    A  45           H62        A  45  14.088  -8.965  52.565
  479    H2     A  45           H2         A  45  17.482  -4.969  52.897
  480    H5'    G  46           H5'        G  46  24.878  -8.961  52.678
  481   H5''    G  46          H5''        G  46  25.212  -9.789  54.213
  482    H4'    G  46           H4'        G  46  24.688  -7.173  54.170
  483    H3'    G  46           H3'        G  46  24.013  -9.393  56.064
  484    H2'    G  46          H2''        G  46  22.318  -8.290  57.153
  485   HO2'    G  46          H2'         G  46  22.369  -5.927  57.295
  486    H1'    G  46           H1'        G  46  21.719  -6.266  55.241
  487    H8     G  46           H8         G  46  21.002  -9.860  54.162
  488    H1     G  46           H1         G  46  16.300  -7.054  57.489
  489    H21    G  46           H21        G  46  17.051  -5.239  58.483
  490    H22    G  46           H22        G  46  18.653  -4.606  58.182
  491    H5'    C  47           H5'        C  47  23.534  -6.333  58.831
  492   H5''    C  47          H5''        C  47  24.929  -6.526  59.910
  493    H4'    C  47           H4'        C  47  23.243  -6.626  61.495
  494    H3'    C  47           H3'        C  47  24.103  -9.281  60.479
  495    H2'    C  47          H2''        C  47  22.081 -10.326  60.577
  496   HO2'    C  47          H2'         C  47  21.632  -9.096  63.074
  497    H1'    C  47           H1'        C  47  20.535  -8.201  61.686
  498    H41    C  47           H41        C  47  16.296 -11.002  57.963
  499    H42    C  47           H42        C  47  17.553 -11.910  57.161
  500    H5     C  47           H5         C  47  19.914 -11.473  57.488
  501    H6     C  47           H6         C  47  21.545 -10.034  58.622
  502    H5'    C  48           H5'        C  48  23.240  -7.865  64.761
  503   H5''    C  48          H5''        C  48  23.168  -8.852  66.231
  504    H4'    C  48           H4'        C  48  21.083  -7.381  65.579
  505    H3'    C  48           H3'        C  48  21.168 -10.268  66.453
  506   HO3'    C  48          H3T         C  48  20.242  -7.859  67.669
  507    H2'    C  48          H2''        C  48  18.898 -10.527  66.210
  508   HO2'    C  48          H2'         C  48  18.034  -9.008  67.459
  509    H1'    C  48           H1'        C  48  18.514  -8.477  64.209
  510    H41    C  48           H41        C  48  16.756 -13.811  61.282
  511    H42    C  48           H42        C  48  18.435 -14.213  61.007
  512    H5     C  48           H5         C  48  20.241 -12.790  61.706
  513    H6     C  48           H6         C  48  20.878 -11.039  63.307