*HEADER    RNA                                     01-MAR-10   2KUU              
*TITLE     SOLUTION STRUCTURE OF K10 TLS RNA (GC MUTANT IN UPPER HELIX)          
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: K10 TLS RNA;                                               
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 ENGINEERED: YES;                                                     
*COMPND   5 MUTATION: YES;                                                       
*COMPND   6 OTHER_DETAILS: THE WILD-TYPE SEQUENCE OF K10 TLS RNA IS              
*COMPND   7 'GGCUUGAUUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAAUUAAGCC'. THE MUTATION IN  
*COMPND   8 THE GC MUTANT IN UPPER HELIX RNA ARE: U14G, U16G, A31C, A33C.        
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES;                                                      
*SOURCE   3 ORGANISM_SCIENTIFIC: DROSOPHILA MELANOGASTER;                        
*SOURCE   4 ORGANISM_COMMON: FRUIT FLY;                                          
*SOURCE   5 ORGANISM_TAXID: 7227;                                                
*SOURCE   6 OTHER_DETAILS: PREPARED BY IN VITRO TRANSCRIPTION USING T7 RNA       
*SOURCE   7 POLYMERASE                                                           
*KEYWDS    RNA TRANSPORT, RNA HAIRPIN, RNA                                       
*EXPDTA    SOLUTION NMR                                                          
*NUMMDL    12                                                                    
*AUTHOR    S.L.BULLOCK, I.RINGEL, D.ISH-HOROWICZ, P.J.LUKAVSKY                   
*REVDAT   1   19-MAY-10 2KUU    0                                                


{NOE-D2O}
assign (residue 1 and name h2'') (residue 2 and name h8) 1.8 0.4 1.2
assign (residue 2 and name h2'') (residue 3 and name h6) 1.8 0.4 1.2
assign (residue 3 and name h2'') (residue 4 and name h6) 1.8 0.4 1.2
assign (residue 4 and name h2'') (residue 5 and name h6) 1.8 0.4 1.2
assign (residue 5 and name h2'') (residue 6 and name h8) 1.8 0.4 1.2
assign (residue 7 and name h2'') (residue 8 and name h6) 1.8 0.4 1.2
assign (residue 8 and name h2'') (residue 9 and name h6) 1.8 0.4 1.2
assign (residue 9 and name h2'') (residue 10 and name h8) 1.8 0.4 1.2
assign (residue 18 and name h2'') (residue 19 and name h8) 1.8 0.4 1.2
assign (residue 19 and name h2'') (residue 20 and name h8) 1.8 0.4 1.2
assign (residue 20 and name h2'') (residue 21 and name h6) 1.8 0.4 1.2
assign (residue 21 and name h2'') (residue 22 and name h6) 1.8 0.4 1.2
assign (residue 26 and name h2'') (residue 27 and name h6) 1.8 0.4 1.2
assign (residue 29 and name h2'') (residue 30 and name h8) 1.8 0.4 1.2
assign (residue 30 and name h1') (residue 18 and name h2) 1.8 0.4 1.2
assign (residue 38 and name h2'') (residue 39 and name h8) 1.8 0.4 1.2
assign (residue 40 and name h2'') (residue 41 and name h8) 1.8 0.4 1.2
assign (residue 41 and name h2'') (residue 42 and name h6) 1.8 0.4 1.2
assign (residue 42 and name h2'') (residue 43 and name h6) 1.8 0.4 1.2
assign (residue 42 and name h3') (residue 42 and name h6) 1.8 0.4 1.2
assign (residue 43 and name h2'') (residue 44 and name h8) 1.8 0.4 1.2
assign (residue 46 and name h2'') (residue 47 and name h6) 1.8 0.4 1.2
assign (residue 47 and name h2'') (residue 48 and name h6) 1.8 0.4 1.2
assign (residue 1 and name h3') (residue 1 and name h8) 1.8 0 2.2
assign (residue 2 and name h3') (residue 2 and name h8) 1.8 0 2.2
assign (residue 2 and name h3') (residue 3 and name h6) 1.8 0 2.2
assign (residue 4 and name h3') (residue 4 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 5 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 6 and name h8) 1.8 0 2.2
assign (residue 6 and name h1') (residue 44 and name h2) 1.8 0 2.2
assign (residue 6 and name h2'') (residue 7 and name h8) 1.8 0 2.2
assign (residue 6 and name h3') (residue 6 and name h8) 1.8 0 2.2
assign (residue 6 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 7 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 7 and name h3') (residue 8 and name h6) 1.8 0 2.2
assign (residue 8 and name h3') (residue 8 and name h6) 1.8 0 2.2
assign (residue 8 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 9 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 18 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 18 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 18 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 19 and name h1') (residue 18 and name h2) 1.8 0 2.2
assign (residue 19 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 20 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 21 and name h1') (residue 20 and name h2) 1.8 0 2.2
assign (residue 21 and name h2'') (residue 21 and name h6) 1.8 0 2.2
assign (residue 21 and name h3') (residue 21 and name h6) 1.8 0 2.2
assign (residue 22 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 22 and name h3') (residue 22 and name h6) 1.8 0 2.2
assign (residue 23 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 23 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 25 and name h2'') (residue 25 and name h6) 1.8 0 2.2
assign (residue 25 and name h3') (residue 25 and name h6) 1.8 0 2.2
assign (residue 26 and name h2'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h3') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h5'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 27 and name h3') (residue 27 and name h6) 1.8 0 2.2
assign (residue 28 and name h2'') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 29 and name h3') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 38 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 39 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 39 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 41 and name h8) 1.8 0 2.2
assign (residue 41 and name h3') (residue 41 and name h8) 1.8 0 2.2
assign (residue 41 and name h3') (residue 42 and name h6) 1.8 0 2.2
assign (residue 42 and name h3') (residue 43 and name h6) 1.8 0 2.2
assign (residue 43 and name h1') (residue 7 and name h2) 1.8 0 2.2
assign (residue 43 and name h3') (residue 43 and name h6) 1.8 0 2.2
assign (residue 44 and name h2'') (residue 45 and name h8) 1.8 0 2.2
assign (residue 44 and name h3') (residue 44 and name h8) 1.8 0 2.2
assign (residue 45 and name h1') (residue 44 and name h2) 1.8 0 2.2
assign (residue 45 and name h2'') (residue 46 and name h8) 1.8 0 2.2
assign (residue 45 and name h3') (residue 45 and name h8) 1.8 0 2.2
assign (residue 46 and name h3') (residue 46 and name h8) 1.8 0 2.2
assign (residue 46 and name h3') (residue 47 and name h6) 1.8 0 2.2
assign (residue 48 and name h3') (residue 48 and name h6) 1.8 0 2.2
assign (residue 1 and name h1') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 1 and name h2'') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h3') (residue 2 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 3 and name h6) 1.8 0 3.2
assign (residue 2 and name h2'') (residue 3 and name h1') 1.8 0 3.2
assign (residue 2 and name h2'') (residue 3 and name h5) 1.8 0 3.2
assign (residue 2 and name h3') (residue 3 and name h5) 1.8 0 3.2
assign (residue 3 and name h1') (residue 3 and name h6) 1.8 0 3.2
assign (residue 3 and name h1') (residue 4 and name h6) 1.8 0 3.2
assign (residue 3 and name h3') (residue 4 and name h5) 1.8 0 3.2
assign (residue 3 and name h5) (residue 4 and name h5) 1.8 0 3.2
assign (residue 3 and name h6) (residue 4 and name h6) 1.8 0 3.2
assign (residue 4 and name h1') (residue 4 and name h6) 1.8 0 3.2
assign (residue 4 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 4 and name h5) (residue 5 and name h5) 1.8 0 3.2
assign (residue 5 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h1') (residue 6 and name h8) 1.8 0 3.2
assign (residue 5 and name h1') (residue 45 and name h2) 1.8 0 3.2
assign (residue 5 and name h2'') (residue 6 and name h1') 1.8 0 3.2
assign (residue 5 and name h5) (residue 4 and name h6) 1.8 0 3.2
assign (residue 6 and name h1') (residue 6 and name h8) 1.8 0 3.2
assign (residue 6 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 6 and name h8) (residue 5 and name h6) 1.8 0 3.2
assign (residue 7 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h1') (residue 8 and name h6) 1.8 0 3.2
assign (residue 7 and name h2'') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h2'') (residue 8 and name h1') 1.8 0 3.2
assign (residue 7 and name h2'') (residue 8 and name h5) 1.8 0 3.2
assign (residue 7 and name h3') (residue 8 and name h5) 1.8 0 3.2
assign (residue 7 and name h5'') (residue 7 and name h8) 1.8 0 3.2
assign (residue 8 and name h1') (residue 7 and name h2) 1.8 0 3.2
assign (residue 8 and name h1') (residue 8 and name h6) 1.8 0 3.2
assign (residue 8 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 8 and name h6) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 9 and name h5) 1.8 0 3.2
assign (residue 8 and name h5) (residue 9 and name h5) 1.8 0 3.2
assign (residue 9 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 9 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 9 and name h1') (residue 41 and name h2) 1.8 0 3.2
assign (residue 18 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 18 and name h2) (residue 19 and name h2) 1.8 0 3.2
assign (residue 18 and name h4') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h5'') (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 20 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h1') 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h5) 1.8 0 3.2
assign (residue 20 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h1') 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h5) (residue 20 and name h8) 1.8 0 3.2
assign (residue 21 and name h5') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h5'') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h6) (residue 20 and name h8) 1.8 0 3.2
assign (residue 22 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 22 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h4') (residue 22 and name h6) 1.8 0 3.2
assign (residue 23 and name h1') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h2) (residue 24 and name h2) 1.8 0 3.2
assign (residue 23 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h5'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 24 and name h1') (residue 23 and name h2) 1.8 0 3.2
assign (residue 24 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h5'') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h8) (residue 23 and name h8) 1.8 0 3.2
assign (residue 25 and name h1') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 26 and name h5) 1.8 0 3.2
assign (residue 25 and name h5') (residue 24 and name h3') 1.8 0 3.2
assign (residue 25 and name h5') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5'') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5'') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h1') (residue 22 and name h1') 1.8 0 3.2
assign (residue 26 and name h1') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 26 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 26 and name h4') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 26 and name h5') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5'') (residue 25 and name h1') 1.8 0 3.2
assign (residue 27 and name h1') (residue 27 and name h6) 1.8 0 3.2
assign (residue 27 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 27 and name h3') (residue 28 and name h5) 1.8 0 3.2
assign (residue 28 and name h1') (residue 20 and name h2) 1.8 0 3.2
assign (residue 28 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 28 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 28 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h6) 1.8 0 3.2
assign (residue 28 and name h6) (residue 20 and name h2) 1.8 0 3.2
assign (residue 29 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 29 and name h5) (residue 28 and name h6) 1.8 0 3.2
assign (residue 29 and name h5'') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h6) (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h2) (residue 18 and name h2) 1.8 0 3.2
assign (residue 38 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 38 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 38 and name h2'') (residue 38 and name h6) 1.8 0 3.2
assign (residue 39 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 39 and name h5'') (residue 39 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 39 and name h2) 1.8 0 3.2
assign (residue 40 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 41 and name h8) 1.8 0 3.2
assign (residue 40 and name h2'') (residue 41 and name h1') 1.8 0 3.2
assign (residue 40 and name h8) (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 41 and name h1') (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 41 and name h2'') (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h2'') (residue 42 and name h5) 1.8 0 3.2
assign (residue 42 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 42 and name h1') (residue 43 and name h6) 1.8 0 3.2
assign (residue 42 and name h2'') (residue 42 and name h6) 1.8 0 3.2
assign (residue 42 and name h3') (residue 42 and name h5) 1.8 0 3.2
assign (residue 42 and name h3') (residue 43 and name h5) 1.8 0 3.2
assign (residue 42 and name h5) (residue 41 and name h1') 1.8 0 3.2
assign (residue 42 and name h5) (residue 43 and name h5) 1.8 0 3.2
assign (residue 43 and name h1') (residue 43 and name h6) 1.8 0 3.2
assign (residue 43 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 43 and name h2'') (residue 43 and name h6) 1.8 0 3.2
assign (residue 43 and name h3') (residue 44 and name h8) 1.8 0 3.2
assign (residue 43 and name h5) (residue 42 and name h6) 1.8 0 3.2
assign (residue 43 and name h5') (residue 43 and name h6) 1.8 0 3.2
assign (residue 43 and name h5'') (residue 43 and name h6) 1.8 0 3.2
assign (residue 44 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h1') (residue 45 and name h8) 1.8 0 3.2
assign (residue 44 and name h2) (residue 45 and name h2) 1.8 0 3.2
assign (residue 44 and name h2'') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h3') (residue 45 and name h8) 1.8 0 3.2
assign (residue 44 and name h4') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h5') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h5'') (residue 44 and name h8) 1.8 0 3.2
assign (residue 45 and name h1') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h1') (residue 46 and name h8) 1.8 0 3.2
assign (residue 45 and name h2) (residue 5 and name h6) 1.8 0 3.2
assign (residue 45 and name h2'') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h3') (residue 46 and name h8) 1.8 0 3.2
assign (residue 45 and name h4') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h5') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h5'') (residue 45 and name h8) 1.8 0 3.2
assign (residue 46 and name h1') (residue 45 and name h2) 1.8 0 3.2
assign (residue 46 and name h1') (residue 46 and name h8) 1.8 0 3.2
assign (residue 46 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 46 and name h2'') (residue 47 and name h5) 1.8 0 3.2
assign (residue 46 and name h5') (residue 46 and name h8) 1.8 0 3.2
assign (residue 46 and name h5'') (residue 46 and name h8) 1.8 0 3.2
assign (residue 47 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 47 and name h4') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h5) (residue 48 and name h5) 1.8 0 3.2
assign (residue 47 and name h5'') (residue 47 and name h6) 1.8 0 3.2
assign (residue 48 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 48 and name h2'') (residue 48 and name h6) 1.8 0 3.2
assign (residue 1 and name h1') (residue 2 and name h1') 1.8 0 4.7
assign (residue 1 and name h2'') (residue 2 and name h1') 1.8 0 4.7
assign (residue 1 and name h4') (residue 1 and name h8) 1.8 0 4.7
assign (residue 1 and name h5') (residue 1 and name h8) 1.8 0 4.7
assign (residue 1 and name h5'') (residue 1 and name h8) 1.8 0 4.7
assign (residue 2 and name h8) (residue 1 and name h8) 1.8 0 4.7
assign (residue 2 and name h8) (residue 3 and name h6) 1.8 0 4.7
assign (residue 3 and name h1') (residue 2 and name h1') 1.8 0 4.7
assign (residue 3 and name h2'') (residue 4 and name h5) 1.8 0 4.7
assign (residue 3 and name h3') (residue 3 and name h5) 1.8 0 4.7
assign (residue 3 and name h5) (residue 2 and name h1') 1.8 0 4.7
assign (residue 3 and name h5) (residue 2 and name h8) 1.8 0 4.7
assign (residue 3 and name h5) (residue 3 and name h1') 1.8 0 4.7
assign (residue 3 and name h5) (residue 4 and name h6) 1.8 0 4.7
assign (residue 4 and name h5) (residue 3 and name h1') 1.8 0 4.7
assign (residue 4 and name h5) (residue 3 and name h6) 1.8 0 4.7
assign (residue 4 and name h5) (residue 4 and name h1') 1.8 0 4.7
assign (residue 5 and name h1') (residue 44 and name h2) 1.8 0 4.7
assign (residue 5 and name h5) (residue 5 and name h1') 1.8 0 4.7
assign (residue 6 and name h1') (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h5) 1.8 0 4.7
assign (residue 8 and name h2'') (residue 8 and name h5) 1.8 0 4.7
assign (residue 8 and name h3') (residue 8 and name h5) 1.8 0 4.7
assign (residue 8 and name h5) (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h5) (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h5) (residue 8 and name h1') 1.8 0 4.7
assign (residue 8 and name h5) (residue 9 and name h6) 1.8 0 4.7
assign (residue 8 and name h6) (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h6) (residue 9 and name h6) 1.8 0 4.7
assign (residue 9 and name h5) (residue 8 and name h6) 1.8 0 4.7
assign (residue 9 and name h5) (residue 9 and name h1') 1.8 0 4.7
assign (residue 10 and name h8) (residue 9 and name h6) 1.8 0 4.7
assign (residue 18 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 18 and name h2) (residue 19 and name h8) 1.8 0 4.7
assign (residue 19 and name h1') (residue 19 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h8) 1.8 0 4.7
assign (residue 19 and name h2) (residue 29 and name h6) 1.8 0 4.7
assign (residue 21 and name h1') (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h2'') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h4') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h5) (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 21 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h6) (residue 22 and name h6) 1.8 0 4.7
assign (residue 22 and name h1') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h3') (residue 22 and name h5) 1.8 0 4.7
assign (residue 22 and name h4') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h5) (residue 21 and name h6) 1.8 0 4.7
assign (residue 23 and name h1') (residue 23 and name h2) 1.8 0 4.7
assign (residue 23 and name h1') (residue 24 and name h1') 1.8 0 4.7
assign (residue 23 and name h3') (residue 24 and name h1') 1.8 0 4.7
assign (residue 24 and name h1') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h2'') (residue 25 and name h1') 1.8 0 4.7
assign (residue 24 and name h3') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h5) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h4') (residue 24 and name h8) 1.8 0 4.7
assign (residue 24 and name h4') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h1') (residue 24 and name h2) 1.8 0 4.7
assign (residue 25 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h4') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 25 and name h5'') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h5) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h6) 1.8 0 4.7
assign (residue 26 and name h2'') (residue 26 and name h5) 1.8 0 4.7
assign (residue 26 and name h5) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h5') (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 27 and name h1') (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h5) (residue 28 and name h6) 1.8 0 4.7
assign (residue 27 and name h6) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h1') (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h1') (residue 28 and name h5) 1.8 0 4.7
assign (residue 28 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h5) (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h5) (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 29 and name h1') (residue 28 and name h1') 1.8 0 4.7
assign (residue 29 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 29 and name h5) (residue 28 and name h5) 1.8 0 4.7
assign (residue 29 and name h5) (residue 30 and name h8) 1.8 0 4.7
assign (residue 38 and name h1') (residue 39 and name h1') 1.8 0 4.7
assign (residue 38 and name h2'') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h3') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h4') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h5) (residue 39 and name h8) 1.8 0 4.7
assign (residue 38 and name h5'') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h6) (residue 39 and name h8) 1.8 0 4.7
assign (residue 39 and name h2) (residue 40 and name h2) 1.8 0 4.7
assign (residue 40 and name h1') (residue 40 and name h2) 1.8 0 4.7
assign (residue 40 and name h1') (residue 41 and name h1') 1.8 0 4.7
assign (residue 42 and name h1') (residue 41 and name h1') 1.8 0 4.7
assign (residue 42 and name h1') (residue 43 and name h5) 1.8 0 4.7
assign (residue 42 and name h5) (residue 7 and name h2) 1.8 0 4.7
assign (residue 42 and name h5) (residue 41 and name h8) 1.8 0 4.7
assign (residue 42 and name h5) (residue 42 and name h1') 1.8 0 4.7
assign (residue 42 and name h5) (residue 43 and name h6) 1.8 0 4.7
assign (residue 42 and name h6) (residue 7 and name h2) 1.8 0 4.7
assign (residue 42 and name h6) (residue 41 and name h8) 1.8 0 4.7
assign (residue 42 and name h6) (residue 43 and name h6) 1.8 0 4.7
assign (residue 44 and name h2) (residue 6 and name h8) 1.8 0 4.7
assign (residue 44 and name h2) (residue 45 and name h8) 1.8 0 4.7
assign (residue 45 and name h1') (residue 45 and name h2) 1.8 0 4.7
assign (residue 45 and name h8) (residue 44 and name h8) 1.8 0 4.7
assign (residue 46 and name h8) (residue 45 and name h2) 1.8 0 4.7
assign (residue 46 and name h8) (residue 45 and name h8) 1.8 0 4.7
assign (residue 46 and name h8) (residue 47 and name h6) 1.8 0 4.7
assign (residue 47 and name h1') (residue 48 and name h1') 1.8 0 4.7
assign (residue 47 and name h2'') (residue 47 and name h5) 1.8 0 4.7
assign (residue 47 and name h5) (residue 46 and name h1') 1.8 0 4.7
assign (residue 47 and name h5) (residue 46 and name h8) 1.8 0 4.7
assign (residue 10 and name h2'') (residue 11 and name h6) 1.8 0.4 1.2
assign (residue 11 and name h2'') (residue 12 and name h8) 1.8 0.4 1.2
assign (residue 12 and name h2'') (residue 13 and name h6) 1.8 0.4 1.2
assign (residue 13 and name h1') (residue 12 and name h2) 1.8 0.4 1.2
assign (residue 13 and name h2'') (residue 14 and name h8) 1.8 0.4 1.2
assign (residue 14 and name h2'') (residue 15 and name h6) 1.8 0.4 1.2
assign (residue 15 and name h2'') (residue 16 and name h8) 1.8 0.4 1.2
assign (residue 16 and name h2'') (residue 17 and name h6) 1.8 0.4 1.2
assign (residue 17 and name h2'') (residue 18 and name h8) 1.8 0.4 1.2
assign (residue 30 and name h2'') (residue 31 and name h6) 1.8 0.4 1.2
assign (residue 31 and name h2'') (residue 32 and name h8) 1.8 0.4 1.2
assign (residue 32 and name h2'') (residue 33 and name h6) 1.8 0.4 1.2
assign (residue 33 and name h2'') (residue 34 and name h8) 1.8 0.4 1.2
assign (residue 36 and name h2'') (residue 37 and name h8) 1.8 0.4 1.2
assign (residue 37 and name h2'') (residue 38 and name h6) 1.8 0.4 1.2
assign (residue 10 and name h1') (residue 39 and name h2) 1.8 0 2.2
assign (residue 10 and name h3') (residue 10 and name h8) 1.8 0 2.2
assign (residue 11 and name h3') (residue 11 and name h6) 1.8 0 2.2
assign (residue 11 and name h3') (residue 12 and name h8) 1.8 0 2.2
assign (residue 12 and name h1') (residue 37 and name h2) 1.8 0 2.2
assign (residue 12 and name h3') (residue 12 and name h8) 1.8 0 2.2
assign (residue 13 and name h3') (residue 13 and name h6) 1.8 0 2.2
assign (residue 14 and name h1') (residue 34 and name h2) 1.8 0 2.2
assign (residue 14 and name h3') (residue 14 and name h8) 1.8 0 2.2
assign (residue 14 and name h3') (residue 15 and name h6) 1.8 0 2.2
assign (residue 15 and name h3') (residue 15 and name h6) 1.8 0 2.2
assign (residue 16 and name h1') (residue 32 and name h2) 1.8 0 2.2
assign (residue 17 and name h3') (residue 17 and name h6) 1.8 0 2.2
assign (residue 17 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 31 and name h6) 1.8 0 2.2
assign (residue 31 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 31 and name h3') (residue 31 and name h6) 1.8 0 2.2
assign (residue 32 and name h3') (residue 32 and name h8) 1.8 0 2.2
assign (residue 32 and name h3') (residue 33 and name h6) 1.8 0 2.2
assign (residue 33 and name h1') (residue 32 and name h2) 1.8 0 2.2
assign (residue 33 and name h3') (residue 33 and name h6) 1.8 0 2.2
assign (residue 35 and name h2'') (residue 35 and name h6) 1.8 0 2.2
assign (residue 36 and name h5) (residue 35 and name h1') 1.8 0 2.2
assign (residue 37 and name h3') (residue 37 and name h8) 1.8 0 2.2
assign (residue 37 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 38 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 38 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 10 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 10 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h5) 1.8 0 3.2
assign (residue 11 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 11 and name h2'') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h5) (residue 10 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 12 and name h2) (residue 37 and name h2) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 13 and name h5) 1.8 0 3.2
assign (residue 13 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h1') (residue 14 and name h8) 1.8 0 3.2
assign (residue 13 and name h2'') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h3') (residue 14 and name h8) 1.8 0 3.2
assign (residue 13 and name h5) (residue 12 and name h8) 1.8 0 3.2
assign (residue 14 and name h1') (residue 14 and name h8) 1.8 0 3.2
assign (residue 14 and name h1') (residue 15 and name h6) 1.8 0 3.2
assign (residue 14 and name h3') (residue 15 and name h5) 1.8 0 3.2
assign (residue 15 and name h1') (residue 15 and name h6) 1.8 0 3.2
assign (residue 15 and name h1') (residue 16 and name h8) 1.8 0 3.2
assign (residue 15 and name h3') (residue 16 and name h8) 1.8 0 3.2
assign (residue 16 and name h1') (residue 16 and name h8) 1.8 0 3.2
assign (residue 16 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 16 and name h2'') (residue 16 and name h8) 1.8 0 3.2
assign (residue 16 and name h2'') (residue 17 and name h5) 1.8 0 3.2
assign (residue 16 and name h8) (residue 17 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 17 and name h2'') (residue 17 and name h5) 1.8 0 3.2
assign (residue 17 and name h5) (residue 16 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 31 and name h6) 1.8 0 3.2
assign (residue 30 and name h2'') (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h3') (residue 31 and name h5) 1.8 0 3.2
assign (residue 31 and name h1') (residue 31 and name h6) 1.8 0 3.2
assign (residue 31 and name h1') (residue 32 and name h8) 1.8 0 3.2
assign (residue 31 and name h2'') (residue 31 and name h6) 1.8 0 3.2
assign (residue 31 and name h3') (residue 31 and name h5) 1.8 0 3.2
assign (residue 32 and name h1') (residue 32 and name h8) 1.8 0 3.2
assign (residue 32 and name h1') (residue 33 and name h6) 1.8 0 3.2
assign (residue 32 and name h2'') (residue 33 and name h5) 1.8 0 3.2
assign (residue 33 and name h1') (residue 33 and name h6) 1.8 0 3.2
assign (residue 33 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 33 and name h2'') (residue 33 and name h6) 1.8 0 3.2
assign (residue 33 and name h3') (residue 33 and name h5) 1.8 0 3.2
assign (residue 33 and name h3') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h1') (residue 35 and name h6) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 35 and name h6) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 36 and name h5) 1.8 0 3.2
assign (residue 35 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 35 and name h1') (residue 35 and name h6) 1.8 0 3.2
assign (residue 36 and name h1') (residue 36 and name h6) 1.8 0 3.2
assign (residue 36 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h1') (residue 12 and name h2) 1.8 0 3.2
assign (residue 37 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 38 and name h5) 1.8 0 3.2
assign (residue 37 and name h3') (residue 38 and name h5) 1.8 0 3.2
assign (residue 38 and name h1') (residue 37 and name h2) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h1') 1.8 0 4.7
assign (residue 10 and name h3') (residue 11 and name h5) 1.8 0 4.7
assign (residue 10 and name h5'') (residue 10 and name h8) 1.8 0 4.7
assign (residue 11 and name h1') (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 11 and name h2'') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h2'') (residue 12 and name h1') 1.8 0 4.7
assign (residue 11 and name h3') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h5) (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 11 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 12 and name h8) 1.8 0 4.7
assign (residue 11 and name h6) (residue 10 and name h8) 1.8 0 4.7
assign (residue 11 and name h6) (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h1') (residue 12 and name h2) 1.8 0 4.7
assign (residue 12 and name h2'') (residue 13 and name h1') 1.8 0 4.7
assign (residue 12 and name h8) (residue 13 and name h6) 1.8 0 4.7
assign (residue 13 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 13 and name h2'') (residue 14 and name h1') 1.8 0 4.7
assign (residue 13 and name h5) (residue 14 and name h1') 1.8 0 4.7
assign (residue 13 and name h6) (residue 14 and name h8) 1.8 0 4.7
assign (residue 15 and name h1') (residue 16 and name h1') 1.8 0 4.7
assign (residue 15 and name h1') (residue 32 and name h2) 1.8 0 4.7
assign (residue 15 and name h2'') (residue 16 and name h1') 1.8 0 4.7
assign (residue 15 and name h5) (residue 14 and name h1') 1.8 0 4.7
assign (residue 15 and name h5) (residue 15 and name h1') 1.8 0 4.7
assign (residue 16 and name h2'') (residue 17 and name h1') 1.8 0 4.7
assign (residue 17 and name h1') (residue 18 and name h1') 1.8 0 4.7
assign (residue 17 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 17 and name h5) (residue 17 and name h1') 1.8 0 4.7
assign (residue 17 and name h5) (residue 18 and name h8) 1.8 0 4.7
assign (residue 17 and name h6) (residue 18 and name h8) 1.8 0 4.7
assign (residue 30 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 31 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 31 and name h1') (residue 32 and name h1') 1.8 0 4.7
assign (residue 31 and name h2'') (residue 31 and name h5) 1.8 0 4.7
assign (residue 31 and name h5) (residue 30 and name h1') 1.8 0 4.7
assign (residue 31 and name h5) (residue 30 and name h8) 1.8 0 4.7
assign (residue 31 and name h5) (residue 31 and name h1') 1.8 0 4.7
assign (residue 31 and name h6) (residue 30 and name h8) 1.8 0 4.7
assign (residue 32 and name h1') (residue 32 and name h2) 1.8 0 4.7
assign (residue 33 and name h1') (residue 32 and name h1') 1.8 0 4.7
assign (residue 33 and name h2'') (residue 33 and name h5) 1.8 0 4.7
assign (residue 33 and name h2'') (residue 34 and name h1') 1.8 0 4.7
assign (residue 33 and name h5) (residue 32 and name h1') 1.8 0 4.7
assign (residue 33 and name h5) (residue 32 and name h8) 1.8 0 4.7
assign (residue 33 and name h5) (residue 33 and name h1') 1.8 0 4.7
assign (residue 33 and name h6) (residue 32 and name h8) 1.8 0 4.7
assign (residue 34 and name h1') (residue 34 and name h2) 1.8 0 4.7
assign (residue 34 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 34 and name h2'') (residue 35 and name h5) 1.8 0 4.7
assign (residue 34 and name h2'') (residue 36 and name h6) 1.8 0 4.7
assign (residue 35 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 35 and name h2'') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h2'') (residue 36 and name h6) 1.8 0 4.7
assign (residue 35 and name h5) (residue 34 and name h8) 1.8 0 4.7
assign (residue 36 and name h5) (residue 34 and name h1') 1.8 0 4.7
assign (residue 36 and name h5) (residue 35 and name h5) 1.8 0 4.7
assign (residue 36 and name h5) (residue 35 and name h6) 1.8 0 4.7
assign (residue 36 and name h5) (residue 37 and name h8) 1.8 0 4.7
assign (residue 36 and name h6) (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h1') (residue 37 and name h2) 1.8 0 4.7
assign (residue 37 and name h2'') (residue 38 and name h1') 1.8 0 4.7
assign (residue 38 and name h1') (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h2) 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h8) 1.8 0 4.7
assign (residue 2 and name h2'') (residue 3 and name h6) 1.8 0.4 1.2
assign (residue 27 and name h2'') (residue 28 and name h6) 1.8 0.4 1.2
assign (residue 39 and name h2'') (residue 40 and name h8) 1.8 0.4 1.2
assign (residue 3 and name h3') (residue 3 and name h6) 1.8 0 2.2
assign (residue 3 and name h3') (residue 4 and name h6) 1.8 0 2.2
assign (residue 20 and name h2'') (residue 20 and name h8) 1.8 0 2.2
assign (residue 20 and name h3') (residue 20 and name h8) 1.8 0 2.2
assign (residue 20 and name h3') (residue 21 and name h6) 1.8 0 2.2
assign (residue 25 and name h4') (residue 26 and name h6) 1.8 0 2.2
assign (residue 27 and name h2'') (residue 27 and name h6) 1.8 0 2.2
assign (residue 28 and name h3') (residue 28 and name h6) 1.8 0 2.2
assign (residue 28 and name h3') (residue 29 and name h6) 1.8 0 2.2
assign (residue 38 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 47 and name h3') (residue 47 and name h6) 1.8 0 2.2
assign (residue 2 and name h4') (residue 2 and name h8) 1.8 0 3.2
assign (residue 3 and name h4') (residue 3 and name h6) 1.8 0 3.2
assign (residue 4 and name h4') (residue 4 and name h6) 1.8 0 3.2
assign (residue 5 and name h3') (residue 5 and name h5) 1.8 0 3.2
assign (residue 5 and name h2'') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h4') (residue 5 and name h6) 1.8 0 3.2
assign (residue 22 and name h5') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h5'') (residue 22 and name h6) 1.8 0 3.2
assign (residue 25 and name h3') (residue 26 and name h6) 1.8 0 3.2
assign (residue 27 and name h4') (residue 27 and name h6) 1.8 0 3.2
assign (residue 28 and name h4') (residue 28 and name h6) 1.8 0 3.2
assign (residue 38 and name h4') (residue 38 and name h6) 1.8 0 3.2
assign (residue 39 and name h4') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h5') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h4') (residue 40 and name h8) 1.8 0 3.2
assign (residue 40 and name h4') (residue 40 and name h8) 1.8 0 3.2
assign (residue 41 and name h4') (residue 41 and name h8) 1.8 0 3.2
assign (residue 43 and name h4') (residue 43 and name h6) 1.8 0 3.2
assign (residue 46 and name h4') (residue 46 and name h8) 1.8 0 3.2
assign (residue 47 and name h4') (residue 47 and name h6) 1.8 0 3.2
assign (residue 48 and name h4') (residue 48 and name h6) 1.8 0 3.2
assign (residue 2 and name h5') (residue 2 and name h8) 1.8 0 4.7
assign (residue 2 and name h5'') (residue 2 and name h8) 1.8 0 4.7
assign (residue 4 and name h4') (residue 5 and name h6) 1.8 0 4.7
assign (residue 6 and name h4') (residue 6 and name h8) 1.8 0 4.7
assign (residue 6 and name h5') (residue 6 and name h8) 1.8 0 4.7
assign (residue 6 and name h5'') (residue 6 and name h8) 1.8 0 4.7
assign (residue 6 and name h4') (residue 7 and name h8) 1.8 0 4.7
assign (residue 7 and name h4') (residue 7 and name h8) 1.8 0 4.7
assign (residue 7 and name h5') (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h4') (residue 8 and name h6) 1.8 0 4.7
assign (residue 8 and name h4') (residue 9 and name h6) 1.8 0 4.7
assign (residue 9 and name h4') (residue 9 and name h6) 1.8 0 4.7
assign (residue 18 and name h4') (residue 18 and name h8) 1.8 0 4.7
assign (residue 18 and name h5') (residue 18 and name h8) 1.8 0 4.7
assign (residue 19 and name h4') (residue 19 and name h8) 1.8 0 4.7
assign (residue 20 and name h4') (residue 21 and name h6) 1.8 0 4.7
assign (residue 21 and name h4') (residue 21 and name h6) 1.8 0 4.7
assign (residue 21 and name h3') (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h4') (residue 22 and name h6) 1.8 0 4.7
assign (residue 23 and name h5') (residue 23 and name h8) 1.8 0 4.7
assign (residue 25 and name h2'') (residue 24 and name h3') 1.8 0 4.7
assign (residue 24 and name h5') (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h4') (residue 25 and name h3') 1.8 0 4.7
assign (residue 24 and name h2'') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h4') (residue 25 and name h6) 1.8 0 4.7
assign (residue 25 and name h3') (residue 26 and name h4') 1.8 0 4.7
assign (residue 25 and name h3') (residue 26 and name h5) 1.8 0 4.7
assign (residue 25 and name h5') (residue 26 and name h5) 1.8 0 4.7
assign (residue 25 and name h5'') (residue 26 and name h5) 1.8 0 4.7
assign (residue 24 and name h2'') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h5') (residue 26 and name h6) 1.8 0 4.7
assign (residue 27 and name h3') (residue 27 and name h5) 1.8 0 4.7
assign (residue 26 and name h4') (residue 27 and name h6) 1.8 0 4.7
assign (residue 27 and name h5') (residue 27 and name h6) 1.8 0 4.7
assign (residue 27 and name h5'') (residue 27 and name h6) 1.8 0 4.7
assign (residue 28 and name h3') (residue 28 and name h5) 1.8 0 4.7
assign (residue 28 and name h4') (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h4') (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h5') (residue 29 and name h6) 1.8 0 4.7
assign (residue 38 and name h5') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h4') (residue 39 and name h8) 1.8 0 4.7
assign (residue 40 and name h5') (residue 40 and name h8) 1.8 0 4.7
assign (residue 40 and name h5'') (residue 40 and name h8) 1.8 0 4.7
assign (residue 41 and name h3') (residue 42 and name h5) 1.8 0 4.7
assign (residue 42 and name h2'') (residue 42 and name h5) 1.8 0 4.7
assign (residue 41 and name h4') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h4') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h5') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h5'') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h4') (residue 43 and name h6) 1.8 0 4.7
assign (residue 43 and name h4') (residue 44 and name h8) 1.8 0 4.7
assign (residue 44 and name h4') (residue 45 and name h8) 1.8 0 4.7
assign (residue 45 and name h4') (residue 46 and name h8) 1.8 0 4.7
assign (residue 46 and name h2'') (residue 46 and name h8) 1.8 0 4.7
assign (residue 46 and name h3') (residue 47 and name h5) 1.8 0 4.7
assign (residue 47 and name h3') (residue 47 and name h5) 1.8 0 4.7
assign (residue 47 and name h5') (residue 47 and name h6) 1.8 0 4.7
assign (residue 47 and name h5'') (residue 47 and name h6) 1.8 0 4.7
assign (residue 48 and name h2'') (residue 48 and name h5) 1.8 0 4.7
assign (residue 47 and name h4') (residue 48 and name h6) 1.8 0 4.7
assign (residue 48 and name h5') (residue 48 and name h6) 1.8 0 4.7
assign (residue 48 and name h5'') (residue 48 and name h6) 1.8 0 4.7
{NOE-H2O}
assign (residue 3 and name h41) (residue 46 and name h1) 1.8 0 1.7
assign (residue 3 and name h42) (residue 46 and name h1) 1.8 0 1.7
assign (residue 18 and name h2) (residue 29 and name h3) 1.8 0 1.7
assign (residue 40 and name h2) (residue 9 and name h3) 1.8 0 1.7
assign (residue 41 and name h2) (residue 8 and name h3) 1.8 0 1.7
assign (residue 44 and name h2) (residue 5 and name h3) 1.8 0 1.7
assign (residue 45 and name h2) (residue 4 and name h3) 1.8 0 1.7
assign (residue 47 and name h41) (residue 2 and name h1) 1.8 0 1.7
assign (residue 47 and name h42) (residue 2 and name h1) 1.8 0 1.7
assign (residue 7 and name h2) (residue 42 and name h3) 1.8 0 2.7
assign (residue 19 and name h2) (residue 28 and name h3) 1.8 0 2.7
assign (residue 45 and name h2) (residue 5 and name h3) 1.8 0 2.7
assign (residue 2 and name h1) (residue 46 and name h1) 1.8 0 4.2
assign (residue 3 and name h5) (residue 46 and name h1) 1.8 0 4.2
assign (residue 4 and name h1') (residue 46 and name h1) 1.8 0 4.2
assign (residue 5 and name h1') (residue 4 and name h3) 1.8 0 4.2
assign (residue 5 and name h3) (residue 4 and name h3) 1.8 0 4.2
assign (residue 6 and name h1') (residue 5 and name h3) 1.8 0 4.2
assign (residue 6 and name h22) (residue 43 and name h3) 1.8 0 4.2
assign (residue 6 and name h8) (residue 5 and name h3) 1.8 0 4.2
assign (residue 7 and name h2) (residue 6 and name h1) 1.8 0 4.2
assign (residue 8 and name h1') (residue 42 and name h3) 1.8 0 4.2
assign (residue 9 and name h1') (residue 8 and name h3) 1.8 0 4.2
assign (residue 19 and name h1') (residue 29 and name h3) 1.8 0 4.2
assign (residue 44 and name h8) (residue 6 and name h1) 1.8 0 4.2
assign (residue 46 and name h1) (residue 4 and name h3) 1.8 0 4.2
assign (residue 47 and name h1') (residue 46 and name h1) 1.8 0 4.2
assign (residue 47 and name h5) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h1') (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h41) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h5) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h5) (residue 47 and name h41) 1.8 0 4.2
assign (residue 48 and name h6) (residue 2 and name h1) 1.8 0 4.2
assign (residue 3 and name h41) (residue 4 and name h3) 3.5 0 3.0
assign (residue 3 and name h42) (residue 4 and name h3) 3.5 0 3.0
assign (residue 3 and name h5) (residue 2 and name h1) 3.5 0 3.0
assign (residue 4 and name h5) (residue 3 and name h41) 3.5 0 3.0
assign (residue 4 and name h6) (residue 46 and name h1) 3.5 0 3.0
assign (residue 5 and name h1') (residue 5 and name h3) 3.5 0 3.0
assign (residue 6 and name h22) (residue 42 and name h3) 3.5 0 3.0
assign (residue 7 and name h8) (residue 6 and name h1) 3.5 0 3.0
assign (residue 39 and name h2) (residue 9 and name h3) 3.5 0 3.0
assign (residue 43 and name h1') (residue 6 and name h1) 3.5 0 3.0
assign (residue 44 and name h2) (residue 4 and name h3) 3.5 0 3.0
assign (residue 44 and name h2) (residue 6 and name h1) 3.5 0 3.0
assign (residue 45 and name h1') (residue 5 and name h3) 3.5 0 3.0
assign (residue 45 and name h2) (residue 46 and name h1) 3.5 0 3.0
assign (residue 47 and name h5) (residue 46 and name h1) 3.5 0 3.0
assign (residue 47 and name h6) (residue 2 and name h1) 3.5 0 3.0
assign (residue 30 and name h2) (residue 17 and name h3) 1.8 0 1.7
assign (residue 31 and name h41) (residue 16 and name h1) 1.8 0 1.7
assign (residue 31 and name h42) (residue 16 and name h1) 1.8 0 1.7
assign (residue 32 and name h2) (residue 15 and name h3) 1.8 0 1.7
assign (residue 33 and name h41) (residue 14 and name h1) 1.8 0 1.7
assign (residue 33 and name h42) (residue 14 and name h1) 1.8 0 1.7
assign (residue 34 and name h2) (residue 13 and name h3) 1.8 0 1.7
assign (residue 37 and name h2) (residue 11 and name h3) 1.8 0 1.7
assign (residue 38 and name h41) (residue 10 and name h1) 1.8 0 1.7
assign (residue 38 and name h42) (residue 10 and name h1) 1.8 0 1.7
assign (residue 12 and name h2) (residue 36 and name h3) 1.8 0 2.7
assign (residue 11 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 14 and name h1) (residue 15 and name h3) 1.8 0 4.2
assign (residue 14 and name h1') (residue 13 and name h3) 1.8 0 4.2
assign (residue 15 and name h1') (residue 14 and name h1) 1.8 0 4.2
assign (residue 16 and name h1) (residue 15 and name h3) 1.8 0 4.2
assign (residue 16 and name h1) (residue 17 and name h3) 1.8 0 4.2
assign (residue 16 and name h1') (residue 15 and name h3) 1.8 0 4.2
assign (residue 17 and name h1') (residue 16 and name h1) 1.8 0 4.2
assign (residue 18 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 18 and name h2) (residue 17 and name h3) 1.8 0 4.2
assign (residue 18 and name h8) (residue 17 and name h3) 1.8 0 4.2
assign (residue 30 and name h2) (residue 16 and name h1) 1.8 0 4.2
assign (residue 31 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 31 and name h41) (residue 15 and name h3) 1.8 0 4.2
assign (residue 31 and name h41) (residue 17 and name h3) 1.8 0 4.2
assign (residue 31 and name h42) (residue 15 and name h3) 1.8 0 4.2
assign (residue 31 and name h42) (residue 17 and name h3) 1.8 0 4.2
assign (residue 31 and name h5) (residue 16 and name h1) 1.8 0 4.2
assign (residue 32 and name h1') (residue 16 and name h1) 1.8 0 4.2
assign (residue 32 and name h2) (residue 16 and name h1) 1.8 0 4.2
assign (residue 33 and name h1') (residue 15 and name h3) 1.8 0 4.2
assign (residue 33 and name h41) (residue 13 and name h3) 1.8 0 4.2
assign (residue 33 and name h42) (residue 13 and name h3) 1.8 0 4.2
assign (residue 33 and name h5) (residue 14 and name h1) 1.8 0 4.2
assign (residue 34 and name h1') (residue 14 and name h1) 1.8 0 4.2
assign (residue 34 and name h2) (residue 14 and name h1) 1.8 0 4.2
assign (residue 39 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h2) (residue 10 and name h1) 1.8 0 4.2
assign (residue 17 and name h5) (residue 16 and name h1) 3.5 0 3.0
assign (residue 31 and name h1') (residue 16 and name h1) 3.5 0 3.0
assign (residue 31 and name h5) (residue 17 and name h3) 3.5 0 3.0
assign (residue 32 and name h1') (residue 15 and name h3) 3.5 0 3.0
assign (residue 33 and name h1') (residue 14 and name h1) 3.5 0 3.0
assign (residue 34 and name h1') (residue 13 and name h3) 3.5 0 3.0
assign (residue 35 and name h1') (residue 13 and name h3) 3.5 0 3.0
assign (residue 37 and name h2) (residue 10 and name h1) 3.5 0 3.0
{hydrogen bonds}
assign (residue 1 and name n1) (residue 48 and name n3) 2.8 0.2 0.2
assign (residue 2 and name n1) (residue 47 and name n3) 2.8 0.2 0.2
assign (residue 46 and name n1) (residue 3 and name n3) 2.8 0.2 0.2
assign (residue 4 and name n3) (residue 45 and name n1) 2.8 0.2 0.2
assign (residue 5 and name n3) (residue 44 and name n1) 2.8 0.2 0.2
assign (residue 42 and name n3) (residue 7 and name n1) 2.8 0.2 0.2
assign (residue 8 and name n3) (residue 41 and name n1) 2.8 0.2 0.2
assign (residue 9 and name n3) (residue 40 and name n1) 2.8 0.2 0.2
assign (residue 10 and name n1) (residue 38 and name n3) 2.8 0.2 0.2
assign (residue 11 and name n3) (residue 37 and name n1) 2.8 0.2 0.2
assign (residue 13 and name n3) (residue 34 and name n1) 2.8 0.2 0.2
assign (residue 14 and name n1) (residue 33 and name n3) 2.8 0.2 0.2
assign (residue 15 and name n3) (residue 32 and name n1) 2.8 0.2 0.2
assign (residue 16 and name n1) (residue 31 and name n3) 2.8 0.2 0.2
assign (residue 17 and name n3) (residue 30 and name n1) 2.8 0.2 0.2
assign (residue 29 and name n3) (residue 18 and name n1) 2.8 0.2 0.2
assign (residue 28 and name n3) (residue 19 and name n1) 2.8 0.2 0.2
{torsion angles}
assign (residue 1 and name c4') (residue 1 and name o4')
       (residue 1 and name c1') (residue 1 and name c2') 2 0 15 2
assign (residue 1 and name o4') (residue 1 and name c1')
       (residue 1 and name c2') (residue 1 and name c3') 2 -22 15 2
assign (residue 1 and name c1') (residue 1 and name c2')
       (residue 1 and name c3') (residue 1 and name c4') 2 36 15 2
assign (residue 1 and name c2') (residue 1 and name c3')
       (residue 1 and name c4') (residue 1 and name o4') 2 -36 15 2
assign (residue 2 and name c4') (residue 2 and name o4')
       (residue 2 and name c1') (residue 2 and name c2') 2 0 15 2
assign (residue 2 and name o4') (residue 2 and name c1') 
       (residue 2 and name c2') (residue 2 and name c3') 2 -22 15 2
assign (residue 2 and name c1') (residue 2 and name c2') 
       (residue 2 and name c3') (residue 2 and name c4') 2 36 15 2
assign (residue 2 and name c2') (residue 2 and name c3') 
       (residue 2 and name c4') (residue 2 and name o4') 2 -36 15 2
assign (residue 3 and name c4') (residue 3 and name o4') 
       (residue 3 and name c1') (residue 3 and name c2') 2 0 15 2
assign (residue 3 and name o4') (residue 3 and name c1') 
       (residue 3 and name c2') (residue 3 and name c3') 2 -22 15 2
assign (residue 3 and name c1') (residue 3 and name c2') 
       (residue 3 and name c3') (residue 3 and name c4') 2 36 15 2
assign (residue 3 and name c2') (residue 3 and name c3') 
       (residue 3 and name c4') (residue 3 and name o4') 2 -36 15 2
assign (residue 4 and name c4') (residue 4 and name o4') 
       (residue 4 and name c1') (residue 4 and name c2') 2 0 15 2
assign (residue 4 and name o4') (residue 4 and name c1') 
       (residue 4 and name c2') (residue 4 and name c3') 2 -22 15 2
assign (residue 4 and name c1') (residue 4 and name c2') 
       (residue 4 and name c3') (residue 4 and name c4') 2 36 15 2
assign (residue 4 and name c2') (residue 4 and name c3') 
       (residue 4 and name c4') (residue 4 and name o4') 2 -36 15 2
assign (residue 5 and name c4') (residue 5 and name o4') 
       (residue 5 and name c1') (residue 5 and name c2') 2 0 15 2
assign (residue 5 and name o4') (residue 5 and name c1') 
       (residue 5 and name c2') (residue 5 and name c3') 2 -22 15 2
assign (residue 5 and name c1') (residue 5 and name c2') 
       (residue 5 and name c3') (residue 5 and name c4') 2 36 15 2
assign (residue 5 and name c2') (residue 5 and name c3') 
       (residue 5 and name c4') (residue 5 and name o4') 2 -36 15 2
assign (residue 6 and name c4') (residue 6 and name o4')
       (residue 6 and name c1') (residue 6 and name c2') 2 0 15 2
assign (residue 6 and name o4') (residue 6 and name c1')
       (residue 6 and name c2') (residue 6 and name c3') 2 -22 15 2
assign (residue 6 and name c1') (residue 6 and name c2')
       (residue 6 and name c3') (residue 6 and name c4') 2 36 15 2
assign (residue 6 and name c2') (residue 6 and name c3')
       (residue 6 and name c4') (residue 6 and name o4') 2 -36 15 2
assign (residue 7 and name c4') (residue 7 and name o4')
       (residue 7 and name c1') (residue 7 and name c2') 2 0 15 2
assign (residue 7 and name o4') (residue 7 and name c1')
       (residue 7 and name c2') (residue 7 and name c3') 2 -22 15 2
assign (residue 7 and name c1') (residue 7 and name c2')
       (residue 7 and name c3') (residue 7 and name c4') 2 36 15 2
assign (residue 7 and name c2') (residue 7 and name c3')
       (residue 7 and name c4') (residue 7 and name o4') 2 -36 15 2
assign (residue 8 and name c4') (residue 8 and name o4')
       (residue 8 and name c1') (residue 8 and name c2') 2 0 15 2
assign (residue 8 and name o4') (residue 8 and name c1') 
       (residue 8 and name c2') (residue 8 and name c3') 2 -22 15 2
assign (residue 8 and name c1') (residue 8 and name c2') 
       (residue 8 and name c3') (residue 8 and name c4') 2 36 15 2
assign (residue 8 and name c2') (residue 8 and name c3') 
       (residue 8 and name c4') (residue 8 and name o4') 2 -36 15 2
assign (residue 9 and name c4') (residue 9 and name o4')
       (residue 9 and name c1') (residue 9 and name c2') 2 0 15 2
assign (residue 9 and name o4') (residue 9 and name c1') 
       (residue 9 and name c2') (residue 9 and name c3') 2 -22 15 2
assign (residue 9 and name c1') (residue 9 and name c2') 
       (residue 9 and name c3') (residue 9 and name c4') 2 36 15 2
assign (residue 9 and name c2') (residue 9 and name c3') 
       (residue 9 and name c4') (residue 9 and name o4') 2 -36 15 2
assign (residue 10 and name c4') (residue 10 and name o4') 
       (residue 10 and name c1') (residue 10 and name c2') 2 0 15 2 
assign (residue 10 and name o4') (residue 10 and name c1') 
       (residue 10 and name c2') (residue 10 and name c3')  2 -22 15 2
assign (residue 10 and name c1') (residue 10 and name c2') 
       (residue 10 and name c3') (residue 10 and name c4') 2 36 15 2
assign (residue 10 and name c2') (residue 10 and name c3') 
       (residue 10 and name c4') (residue 10 and name o4') 2 -36 15 2
assign (residue 11 and name c4') (residue 11 and name o4')
       (residue 11 and name c1') (residue 11 and name c2') 2 0 15 2
assign (residue 11 and name o4') (residue 11 and name c1')
       (residue 11 and name c2') (residue 11 and name c3')  2 -22 15 2
assign (residue 11 and name c1') (residue 11 and name c2')
       (residue 11 and name c3') (residue 11 and name c4') 2 36 15 2
assign (residue 11 and name c2') (residue 11 and name c3')
       (residue 11 and name c4') (residue 11 and name o4') 2 -36 15 2
assign (residue 12 and name c4') (residue 12 and name o4') 
       (residue 12 and name c1') (residue 12 and name c2') 2 0 15 2 
assign (residue 12 and name o4') (residue 12 and name c1') 
       (residue 12 and name c2') (residue 12 and name c3')  2 -22 15 2
assign (residue 12 and name c1') (residue 12 and name c2') 
       (residue 12 and name c3') (residue 12 and name c4') 2 36 15 2
assign (residue 12 and name c2') (residue 12 and name c3') 
       (residue 12 and name c4') (residue 12 and name o4') 2 -36 15 2
assign (residue 13 and name c4') (residue 13 and name o4')
       (residue 13 and name c1') (residue 13 and name c2') 2 0 15 2
assign (residue 13 and name o4') (residue 13 and name c1')
       (residue 13 and name c2') (residue 13 and name c3') 2 -22 15 2
assign (residue 13 and name c1') (residue 13 and name c2')
       (residue 13 and name c3') (residue 13 and name c4') 2 36 15 2
assign (residue 13 and name c2') (residue 13 and name c3')
       (residue 13 and name c4') (residue 13 and name o4') 2 -36 15 2
assign (residue 14 and name c4') (residue 14 and name o4')
       (residue 14 and name c1') (residue 14 and name c2') 2 0 15 2
assign (residue 14 and name o4') (residue 14 and name c1')
       (residue 14 and name c2') (residue 14 and name c3') 2 -22 15 2
assign (residue 14 and name c1') (residue 14 and name c2')
       (residue 14 and name c3') (residue 14 and name c4') 2 36 15 2
assign (residue 14 and name c2') (residue 14 and name c3')
       (residue 14 and name c4') (residue 14 and name o4') 2 -36 15 2
assign (residue 15 and name c4') (residue 15 and name o4')
       (residue 15 and name c1') (residue 15 and name c2') 2 0 15 2
assign (residue 15 and name o4') (residue 15 and name c1')
       (residue 15 and name c2') (residue 15 and name c3') 2 -22 15 2
assign (residue 15 and name c1') (residue 15 and name c2')
       (residue 15 and name c3') (residue 15 and name c4') 2 36 15 2
assign (residue 15 and name c2') (residue 15 and name c3')
       (residue 15 and name c4') (residue 15 and name o4') 2 -36 15 2
assign (residue 16 and name c4') (residue 16 and name o4')
       (residue 16 and name c1') (residue 16 and name c2') 2 0 15 2
assign (residue 16 and name o4') (residue 16 and name c1')
       (residue 16 and name c2') (residue 16 and name c3') 2 -22 15 2
assign (residue 16 and name c1') (residue 16 and name c2')
       (residue 16 and name c3') (residue 16 and name c4') 2 36 15 2
assign (residue 16 and name c2') (residue 16 and name c3')
       (residue 16 and name c4') (residue 16 and name o4') 2 -36 15 2
assign (residue 17 and name c4') (residue 17 and name o4')
       (residue 17 and name c1') (residue 17 and name c2') 2 0 15 2
assign (residue 17 and name o4') (residue 17 and name c1')
       (residue 17 and name c2') (residue 17 and name c3') 2 -22 15 2
assign (residue 17 and name c1') (residue 17 and name c2')
       (residue 17 and name c3') (residue 17 and name c4') 2 36 15 2
assign (residue 17 and name c2') (residue 17 and name c3')
       (residue 17 and name c4') (residue 17 and name o4') 2 -36 15 2
assign (residue 18 and name c4') (residue 18 and name o4')
       (residue 18 and name c1') (residue 18 and name c2') 2 0 15 2
assign (residue 18 and name o4') (residue 18 and name c1')
       (residue 18 and name c2') (residue 18 and name c3') 2 -22 15 2
assign (residue 18 and name c1') (residue 18 and name c2')
       (residue 18 and name c3') (residue 18 and name c4') 2 36 15 2
assign (residue 18 and name c2') (residue 18 and name c3')
       (residue 18 and name c4') (residue 18 and name o4') 2 -36 15 2
assign (residue 19 and name c4') (residue 19 and name o4')
       (residue 19 and name c1') (residue 19 and name c2') 2 0 15 2
assign (residue 19 and name o4') (residue 19 and name c1')
       (residue 19 and name c2') (residue 19 and name c3') 2 -22 15 2
assign (residue 19 and name c1') (residue 19 and name c2')
       (residue 19 and name c3') (residue 19 and name c4') 2 36 15 2
assign (residue 19 and name c2') (residue 19 and name c3')
       (residue 19 and name c4') (residue 19 and name o4') 2 -36 15 2
assign (residue 20 and name c4') (residue 20 and name o4')
       (residue 20 and name c1') (residue 20 and name c2') 2 0 15 2
assign (residue 20 and name o4') (residue 20 and name c1')
       (residue 20 and name c2') (residue 20 and name c3') 2 -22 15 2
assign (residue 20 and name c1') (residue 20 and name c2')
       (residue 20 and name c3') (residue 20 and name c4') 2 36 15 2
assign (residue 20 and name c2') (residue 20 and name c3')
       (residue 20 and name c4') (residue 20 and name o4') 2 -36 15 2
assign (residue 21 and name c4') (residue 21 and name o4')
       (residue 21 and name c1') (residue 21 and name c2') 2 0 15 2
assign (residue 21 and name o4') (residue 21 and name c1')
       (residue 21 and name c2') (residue 21 and name c3') 2 -22 15 2
assign (residue 21 and name c1') (residue 21 and name c2')
       (residue 21 and name c3') (residue 21 and name c4') 2 36 15 2
assign (residue 21 and name c2') (residue 21 and name c3')
       (residue 21 and name c4') (residue 21 and name o4') 2 -36 15 2
assign (residue 26 and name c4') (residue 26 and name o4') 
       (residue 26 and name c1') (residue 26 and name c2') 2 0 15 2
assign (residue 26 and name o4') (residue 26 and name c1') 
       (residue 26 and name c2') (residue 26 and name c3') 2 -22 15 2
assign (residue 26 and name c1') (residue 26 and name c2') 
       (residue 26 and name c3') (residue 26 and name c4') 2 36 15 2
assign (residue 26 and name c2') (residue 26 and name c3') 
       (residue 26 and name c4') (residue 26 and name o4') 2 -36 15 2
assign (residue 27 and name c4') (residue 27 and name o4')
       (residue 27 and name c1') (residue 27 and name c2') 2 0 15 2
assign (residue 27 and name o4') (residue 27 and name c1')
       (residue 27 and name c2') (residue 27 and name c3') 2 -22 15 2
assign (residue 27 and name c1') (residue 27 and name c2')
       (residue 27 and name c3') (residue 27 and name c4') 2 36 15 2
assign (residue 27 and name c2') (residue 27 and name c3')
       (residue 27 and name c4') (residue 27 and name o4') 2 -36 15 2
assign (residue 28 and name c4') (residue 28 and name o4') 
       (residue 28 and name c1') (residue 28 and name c2') 2 0 15 2
assign (residue 28 and name o4') (residue 28 and name c1') 
       (residue 28 and name c2') (residue 28 and name c3') 2 -22 15 2
assign (residue 28 and name c1') (residue 28 and name c2') 
       (residue 28 and name c3') (residue 28 and name c4') 2 36 15 2
assign (residue 28 and name c2') (residue 28 and name c3') 
       (residue 28 and name c4') (residue 28 and name o4') 2 -36 15 2
assign (residue 29 and name c4') (residue 29 and name o4')
       (residue 29 and name c1') (residue 29 and name c2') 2 0 15 2
assign (residue 29 and name o4') (residue 29 and name c1')
       (residue 29 and name c2') (residue 29 and name c3') 2 -22 15 2
assign (residue 29 and name c1') (residue 29 and name c2')
       (residue 29 and name c3') (residue 29 and name c4') 2 36 15 2
assign (residue 29 and name c2') (residue 29 and name c3')
       (residue 29 and name c4') (residue 29 and name o4') 2 -36 15 2
assign (residue 30 and name c4') (residue 30 and name o4')
       (residue 30 and name c1') (residue 30 and name c2') 2 0 15 2
assign (residue 30 and name o4') (residue 30 and name c1')
       (residue 30 and name c2') (residue 30 and name c3') 2 -22 15 2
assign (residue 30 and name c1') (residue 30 and name c2')
       (residue 30 and name c3') (residue 30 and name c4') 2 36 15 2
assign (residue 30 and name c2') (residue 30 and name c3')
       (residue 30 and name c4') (residue 30 and name o4') 2 -36 15 2
assign (residue 31 and name c4') (residue 31 and name o4')
       (residue 31 and name c1') (residue 31 and name c2') 2 0 15 2
assign (residue 31 and name o4') (residue 31 and name c1')
       (residue 31 and name c2') (residue 31 and name c3') 2 -22 15 2
assign (residue 31 and name c1') (residue 31 and name c2')
       (residue 31 and name c3') (residue 31 and name c4') 2 36 15 2
assign (residue 31 and name c2') (residue 31 and name c3')
       (residue 31 and name c4') (residue 31 and name o4') 2 -36 15 2
assign (residue 32 and name c4') (residue 32 and name o4')
       (residue 32 and name c1') (residue 32 and name c2') 2 0 15 2
assign (residue 32 and name o4') (residue 32 and name c1')
       (residue 32 and name c2') (residue 32 and name c3') 2 -22 15 2
assign (residue 32 and name c1') (residue 32 and name c2')
       (residue 32 and name c3') (residue 32 and name c4') 2 36 15 2
assign (residue 32 and name c2') (residue 32 and name c3')
       (residue 32 and name c4') (residue 32 and name o4') 2 -36 15 2
assign (residue 33 and name c4') (residue 33 and name o4')
       (residue 33 and name c1') (residue 33 and name c2') 2 0 15 2
assign (residue 33 and name o4') (residue 33 and name c1')
       (residue 33 and name c2') (residue 33 and name c3') 2 -22 15 2
assign (residue 33 and name c1') (residue 33 and name c2')
       (residue 33 and name c3') (residue 33 and name c4') 2 36 15 2
assign (residue 33 and name c2') (residue 33 and name c3')
       (residue 33 and name c4') (residue 33 and name o4') 2 -36 15 2
assign (residue 34 and name c4') (residue 34 and name o4')
       (residue 34 and name c1') (residue 34 and name c2') 2 0 15 2
assign (residue 34 and name o4') (residue 34 and name c1')
       (residue 34 and name c2') (residue 34 and name c3') 2 -22 15 2
assign (residue 34 and name c1') (residue 34 and name c2')
       (residue 34 and name c3') (residue 34 and name c4') 2 36 15 2
assign (residue 34 and name c2') (residue 34 and name c3')
       (residue 34 and name c4') (residue 34 and name o4') 2 -36 15 2
assign (residue 36 and name c4') (residue 36 and name o4')
       (residue 36 and name c1') (residue 36 and name c2') 2 0 15 2
assign (residue 36 and name o4') (residue 36 and name c1')
       (residue 36 and name c2') (residue 36 and name c3') 2 -22 15 2
assign (residue 36 and name c1') (residue 36 and name c2')
       (residue 36 and name c3') (residue 36 and name c4') 2 36 15 2
assign (residue 36 and name c2') (residue 36 and name c3')
       (residue 36 and name c4') (residue 36 and name o4') 2 -36 15 2
assign (residue 37 and name c4') (residue 37 and name o4')
       (residue 37 and name c1') (residue 37 and name c2') 2 0 15 2
assign (residue 37 and name o4') (residue 37 and name c1')
       (residue 37 and name c2') (residue 37 and name c3') 2 -22 15 2
assign (residue 37 and name c1') (residue 37 and name c2')
       (residue 37 and name c3') (residue 37 and name c4') 2 36 15 2
assign (residue 37 and name c2') (residue 37 and name c3')
       (residue 37 and name c4') (residue 37 and name o4') 2 -36 15 2
assign (residue 38 and name c4') (residue 38 and name o4')
       (residue 38 and name c1') (residue 38 and name c2') 2 0 15 2
assign (residue 38 and name o4') (residue 38 and name c1')
       (residue 38 and name c2') (residue 38 and name c3') 2 -22 15 2
assign (residue 38 and name c1') (residue 38 and name c2')
       (residue 38 and name c3') (residue 38 and name c4') 2 36 15 2
assign (residue 38 and name c2') (residue 38 and name c3')
       (residue 38 and name c4') (residue 38 and name o4') 2 -36 15 2
assign (residue 39 and name c4') (residue 39 and name o4')
       (residue 39 and name c1') (residue 39 and name c2') 2 0 15 2
assign (residue 39 and name o4') (residue 39 and name c1')
       (residue 39 and name c2') (residue 39 and name c3') 2 -22 15 2
assign (residue 39 and name c1') (residue 39 and name c2')
       (residue 39 and name c3') (residue 39 and name c4') 2 36 15 2
assign (residue 39 and name c2') (residue 39 and name c3')
       (residue 39 and name c4') (residue 39 and name o4') 2 -36 15 2
assign (residue 40 and name c4') (residue 40 and name o4')
       (residue 40 and name c1') (residue 40 and name c2') 2 0 15 2
assign (residue 40 and name o4') (residue 40 and name c1')
       (residue 40 and name c2') (residue 40 and name c3') 2 -22 15 2
assign (residue 40 and name c1') (residue 40 and name c2')
       (residue 40 and name c3') (residue 40 and name c4') 2 36 15 2
assign (residue 40 and name c2') (residue 40 and name c3')
       (residue 40 and name c4') (residue 40 and name o4') 2 -36 15 2
assign (residue 41 and name c4') (residue 41 and name o4')
       (residue 41 and name c1') (residue 41 and name c2') 2 0 15 2
assign (residue 41 and name o4') (residue 41 and name c1')
       (residue 41 and name c2') (residue 41 and name c3') 2 -22 15 2
assign (residue 41 and name c1') (residue 41 and name c2')
       (residue 41 and name c3') (residue 41 and name c4') 2 36 15 2
assign (residue 41 and name c2') (residue 41 and name c3')
       (residue 41 and name c4') (residue 41 and name o4') 2 -36 15 2
assign (residue 42 and name c4') (residue 42 and name o4')
       (residue 42 and name c1') (residue 42 and name c2') 2 0 15 2
assign (residue 42 and name o4') (residue 42 and name c1')
       (residue 42 and name c2') (residue 42 and name c3') 2 -22 15 2
assign (residue 42 and name c1') (residue 42 and name c2')
       (residue 42 and name c3') (residue 42 and name c4') 2 36 15 2
assign (residue 42 and name c2') (residue 42 and name c3')
       (residue 42 and name c4') (residue 42 and name o4') 2 -36 15 2
assign (residue 43 and name c4') (residue 43 and name o4')
       (residue 43 and name c1') (residue 43 and name c2') 2 0 15 2
assign (residue 43 and name o4') (residue 43 and name c1')
       (residue 43 and name c2') (residue 43 and name c3') 2 -22 15 2
assign (residue 43 and name c1') (residue 43 and name c2')
       (residue 43 and name c3') (residue 43 and name c4') 2 36 15 2
assign (residue 43 and name c2') (residue 43 and name c3')
       (residue 43 and name c4') (residue 43 and name o4') 2 -36 15 2
assign (residue 44 and name c4') (residue 44 and name o4')
       (residue 44 and name c1') (residue 44 and name c2') 2 0 15 2
assign (residue 44 and name o4') (residue 44 and name c1')
       (residue 44 and name c2') (residue 44 and name c3') 2 -22 15 2
assign (residue 44 and name c1') (residue 44 and name c2')
       (residue 44 and name c3') (residue 44 and name c4') 2 36 15 2
assign (residue 44 and name c2') (residue 44 and name c3')
       (residue 44 and name c4') (residue 44 and name o4') 2 -36 15 2
assign (residue 45 and name c4') (residue 45 and name o4')
       (residue 45 and name c1') (residue 45 and name c2') 2 0 15 2
assign (residue 45 and name o4') (residue 45 and name c1')
       (residue 45 and name c2') (residue 45 and name c3') 2 -22 15 2
assign (residue 45 and name c1') (residue 45 and name c2')
       (residue 45 and name c3') (residue 45 and name c4') 2 36 15 2
assign (residue 45 and name c2') (residue 45 and name c3')
       (residue 45 and name c4') (residue 45 and name o4') 2 -36 15 2
assign (residue 46 and name c4') (residue 46 and name o4')
       (residue 46 and name c1') (residue 46 and name c2') 2 0 15 2
assign (residue 46 and name o4') (residue 46 and name c1')
       (residue 46 and name c2') (residue 46 and name c3') 2 -22 15 2
assign (residue 46 and name c1') (residue 46 and name c2')
       (residue 46 and name c3') (residue 46 and name c4') 2 36 15 2
assign (residue 46 and name c2') (residue 46 and name c3')
       (residue 46 and name c4') (residue 46 and name o4') 2 -36 15 2
assign (residue 47 and name c4') (residue 47 and name o4')
       (residue 47 and name c1') (residue 47 and name c2') 2 0 15 2
assign (residue 47 and name o4') (residue 47 and name c1')
       (residue 47 and name c2') (residue 47 and name c3') 2 -22 15 2
assign (residue 47 and name c1') (residue 47 and name c2')
       (residue 47 and name c3') (residue 47 and name c4') 2 36 15 2
assign (residue 47 and name c2') (residue 47 and name c3')
       (residue 47 and name c4') (residue 47 and name o4') 2 -36 15 2
assign (residue 48 and name c4') (residue 48 and name o4')
       (residue 48 and name c1') (residue 48 and name c2') 2 0 15 2
assign (residue 48 and name o4') (residue 48 and name c1')
       (residue 48 and name c2') (residue 48 and name c3') 2 -22 15 2
assign (residue 48 and name c1') (residue 48 and name c2')
       (residue 48 and name c3') (residue 48 and name c4') 2 36 15 2
assign (residue 48 and name c2') (residue 48 and name c3')
       (residue 48 and name c4') (residue 48 and name o4') 2 -36 15 2
assign (residue 25 and name c4') (residue 25 and name o4')
       (residue 25 and name c1') (residue 25 and name c2') 2 -18 15 2
assign (residue 25 and name o4') (residue 25 and name c1')
       (residue 25 and name c2') (residue 25 and name c3') 2 34 15 2
assign (residue 25 and name c1') (residue 25 and name c2')
       (residue 25 and name c3') (residue 25 and name c4') 2 -37 15 2
assign (residue 25 and name c2') (residue 25 and name c3')
       (residue 25 and name c4') (residue 25 and name o4') 2 26 15 2
assign (residue 35 and name c4') (residue 35 and name o4')
       (residue 35 and name c1') (residue 35 and name c2') 2 -18 15 2
assign (residue 35 and name o4') (residue 35 and name c1')
       (residue 35 and name c2') (residue 35 and name c3') 2 34 15 2
assign (residue 35 and name c1') (residue 35 and name c2')
       (residue 35 and name c3') (residue 35 and name c4') 2 -37 15 2
assign (residue 35 and name c2') (residue 35 and name c3')
       (residue 35 and name c4') (residue 35 and name o4') 2 26 15 2
assign (residue 2 and name p) (residue 2 and name o5')
        (residue 2 and name c5') (residue 2 and name c4') 2 170 30 2
assign (residue 3 and name p) (residue 3 and name o5')
        (residue 3 and name c5') (residue 3 and name c4') 2 170 30 2
assign (residue 4 and name p) (residue 4 and name o5')
        (residue 4 and name c5') (residue 4 and name c4') 2 170 30 2
assign (residue 5 and name p) (residue 5 and name o5')
        (residue 5 and name c5') (residue 5 and name c4') 2 170 30 2
assign (residue 6 and name p) (residue 6 and name o5')
        (residue 6 and name c5') (residue 6 and name c4') 2 170 30 2
assign (residue 7 and name p) (residue 7 and name o5')
        (residue 7 and name c5') (residue 7 and name c4') 2 170 30 2
assign (residue 8 and name p) (residue 8 and name o5')
        (residue 8 and name c5') (residue 8 and name c4') 2 170 30 2
assign (residue 9 and name p) (residue 9 and name o5')
        (residue 9 and name c5') (residue 9 and name c4') 2 170 30 2
assign (residue 10 and name p) (residue 10 and name o5')
        (residue 10 and name c5') (residue 10 and name c4') 2 170 30 2
assign (residue 11 and name p) (residue 11 and name o5')
        (residue 11 and name c5') (residue 11 and name c4') 2 170 30 2
assign (residue 12 and name p) (residue 12 and name o5')
        (residue 12 and name c5') (residue 12 and name c4') 2 170 30 2
assign (residue 13 and name p) (residue 13 and name o5')
        (residue 13 and name c5') (residue 13 and name c4') 2 170 30 2
assign (residue 14 and name p) (residue 14 and name o5')
        (residue 14 and name c5') (residue 14 and name c4') 2 170 30 2
assign (residue 15 and name p) (residue 15 and name o5')
        (residue 15 and name c5') (residue 15 and name c4') 2 170 30 2
assign (residue 16 and name p) (residue 16 and name o5')
        (residue 16 and name c5') (residue 16 and name c4') 2 170 30 2
assign (residue 17 and name p) (residue 17 and name o5')
        (residue 17 and name c5') (residue 17 and name c4') 2 170 30 2
assign (residue 18 and name p) (residue 18 and name o5')
        (residue 18 and name c5') (residue 18 and name c4') 2 170 30 2
assign (residue 19 and name p) (residue 19 and name o5')
        (residue 19 and name c5') (residue 19 and name c4') 2 170 30 2
assign (residue 20 and name p) (residue 20 and name o5')
        (residue 20 and name c5') (residue 20 and name c4') 2 170 30 2
assign (residue 21 and name p) (residue 21 and name o5')
        (residue 21 and name c5') (residue 21 and name c4') 2 170 30 2
assign (residue 22 and name p) (residue 22 and name o5')
        (residue 22 and name c5') (residue 22 and name c4') 2 170 30 2
assign (residue 23 and name p) (residue 23 and name o5')
        (residue 23 and name c5') (residue 23 and name c4') 2 170 60 2
assign (residue 24 and name p) (residue 24 and name o5')
        (residue 24 and name c5') (residue 24 and name c4') 2 170 60 2
assign (residue 25 and name p) (residue 25 and name o5')
        (residue 25 and name c5') (residue 25 and name c4') 2 170 60 2
assign (residue 26 and name p) (residue 26 and name o5')
        (residue 26 and name c5') (residue 26 and name c4') 2 170 60 2
assign (residue 27 and name p) (residue 27 and name o5')
        (residue 27 and name c5') (residue 27 and name c4') 2 170 30 2
assign (residue 28 and name p) (residue 28 and name o5')
        (residue 28 and name c5') (residue 28 and name c4') 2 170 30 2
assign (residue 29 and name p) (residue 29 and name o5')
        (residue 29 and name c5') (residue 29 and name c4') 2 170 30 2
assign (residue 30 and name p) (residue 30 and name o5')
        (residue 30 and name c5') (residue 30 and name c4') 2 170 30 2
assign (residue 31 and name p) (residue 31 and name o5')
        (residue 31 and name c5') (residue 31 and name c4') 2 170 30 2
assign (residue 32 and name p) (residue 32 and name o5')
        (residue 32 and name c5') (residue 32 and name c4') 2 170 30 2
assign (residue 33 and name p) (residue 33 and name o5')
        (residue 33 and name c5') (residue 33 and name c4') 2 170 30 2
assign (residue 34 and name p) (residue 34 and name o5')
        (residue 34 and name c5') (residue 34 and name c4') 2 170 30 2
assign (residue 35 and name p) (residue 35 and name o5')
        (residue 35 and name c5') (residue 35 and name c4') 2 170 60 2
assign (residue 36 and name p) (residue 36 and name o5')
        (residue 36 and name c5') (residue 36 and name c4') 2 170 30 2
assign (residue 37 and name p) (residue 37 and name o5')
        (residue 37 and name c5') (residue 37 and name c4') 2 170 30 2
assign (residue 38 and name p) (residue 38 and name o5')
        (residue 38 and name c5') (residue 38 and name c4') 2 170 30 2
assign (residue 39 and name p) (residue 39 and name o5')
        (residue 39 and name c5') (residue 39 and name c4') 2 170 30 2
assign (residue 40 and name p) (residue 40 and name o5')
        (residue 40 and name c5') (residue 40 and name c4') 2 170 30 2
assign (residue 41 and name p) (residue 41 and name o5')
        (residue 41 and name c5') (residue 41 and name c4') 2 170 30 2
assign (residue 42 and name p) (residue 42 and name o5')
        (residue 42 and name c5') (residue 42 and name c4') 2 170 30 2
assign (residue 43 and name p) (residue 43 and name o5')
        (residue 43 and name c5') (residue 43 and name c4') 2 170 30 2
assign (residue 44 and name p) (residue 44 and name o5')
        (residue 44 and name c5') (residue 44 and name c4') 2 170 30 2
assign (residue 45 and name p) (residue 45 and name o5')
        (residue 45 and name c5') (residue 45 and name c4') 2 170 30 2
assign (residue 46 and name p) (residue 46 and name o5')
        (residue 46 and name c5') (residue 46 and name c4') 2 170 30 2
assign (residue 47 and name p) (residue 47 and name o5')
        (residue 47 and name c5') (residue 47 and name c4') 2 170 30 2
assign (residue 48 and name p) (residue 48 and name o5')
        (residue 48 and name c5') (residue 48 and name c4') 2 170 30 2
assign (residue 1 and name o5') (residue 1 and name c5')
        (residue 1 and name c4') (residue 1 and name c3') 2 55 30 2
assign (residue 2 and name o5') (residue 2 and name c5')
        (residue 2 and name c4') (residue 2 and name c3') 2 55 30 2
assign (residue 3 and name o5') (residue 3 and name c5')
        (residue 3 and name c4') (residue 3 and name c3') 2 55 30 2
assign (residue 4 and name o5') (residue 4 and name c5')
        (residue 4 and name c4') (residue 4 and name c3') 2 55 30 2
assign (residue 5 and name o5') (residue 5 and name c5')
        (residue 5 and name c4') (residue 5 and name c3') 2 55 30 2
assign (residue 7 and name o5') (residue 7 and name c5')
        (residue 7 and name c4') (residue 7 and name c3') 2 55 30 2
assign (residue 8 and name o5') (residue 8 and name c5')
        (residue 8 and name c4') (residue 8 and name c3') 2 55 30 2
assign (residue 9 and name o5') (residue 9 and name c5')
        (residue 9 and name c4') (residue 9 and name c3') 2 55 30 2
assign (residue 10 and name o5') (residue 10 and name c5')
        (residue 10 and name c4') (residue 10 and name c3') 2 55 30 2
assign (residue 11 and name o5') (residue 11 and name c5')
        (residue 11 and name c4') (residue 11 and name c3') 2 55 30 2
assign (residue 12 and name o5') (residue 12 and name c5')
        (residue 12 and name c4') (residue 12 and name c3') 2 55 30 2
assign (residue 13 and name o5') (residue 13 and name c5')
        (residue 13 and name c4') (residue 13 and name c3') 2 55 30 2
assign (residue 14 and name o5') (residue 14 and name c5')
        (residue 14 and name c4') (residue 14 and name c3') 2 55 30 2
assign (residue 15 and name o5') (residue 15 and name c5')
        (residue 15 and name c4') (residue 15 and name c3') 2 55 30 2
assign (residue 16 and name o5') (residue 16 and name c5')
        (residue 16 and name c4') (residue 16 and name c3') 2 55 30 2
assign (residue 17 and name o5') (residue 17 and name c5')
        (residue 17 and name c4') (residue 17 and name c3') 2 55 30 2
assign (residue 18 and name o5') (residue 18 and name c5')
        (residue 18 and name c4') (residue 18 and name c3') 2 55 30 2
assign (residue 19 and name o5') (residue 19 and name c5')
        (residue 19 and name c4') (residue 19 and name c3') 2 55 30 2
assign (residue 20 and name o5') (residue 20 and name c5')
        (residue 20 and name c4') (residue 20 and name c3') 2 55 30 2
assign (residue 21 and name o5') (residue 21 and name c5')
        (residue 21 and name c4') (residue 21 and name c3') 2 55 30 2
assign (residue 22 and name o5') (residue 22 and name c5')
        (residue 22 and name c4') (residue 22 and name c3') 2 55 30 2
assign (residue 23 and name o5') (residue 23 and name c5')
        (residue 23 and name c4') (residue 23 and name c3') 2 55 60 2
assign (residue 24 and name o5') (residue 24 and name c5')
        (residue 24 and name c4') (residue 24 and name c3') 2 55 60 2
assign (residue 26 and name o5') (residue 26 and name c5')
        (residue 26 and name c4') (residue 26 and name c3') 2 55 60 2
assign (residue 27 and name o5') (residue 27 and name c5')
        (residue 27 and name c4') (residue 27 and name c3') 2 55 30 2
assign (residue 28 and name o5') (residue 28 and name c5')
        (residue 28 and name c4') (residue 28 and name c3') 2 55 30 2
assign (residue 29 and name o5') (residue 29 and name c5')
        (residue 29 and name c4') (residue 29 and name c3') 2 55 30 2
assign (residue 30 and name o5') (residue 30 and name c5')
        (residue 30 and name c4') (residue 30 and name c3') 2 55 30 2
assign (residue 31 and name o5') (residue 31 and name c5')
        (residue 31 and name c4') (residue 31 and name c3') 2 55 30 2
assign (residue 32 and name o5') (residue 32 and name c5')
        (residue 32 and name c4') (residue 32 and name c3') 2 55 30 2
assign (residue 33 and name o5') (residue 33 and name c5')
        (residue 33 and name c4') (residue 33 and name c3') 2 55 30 2
assign (residue 34 and name o5') (residue 34 and name c5')
        (residue 34 and name c4') (residue 34 and name c3') 2 55 30 2
assign (residue 36 and name o5') (residue 36 and name c5')
        (residue 36 and name c4') (residue 36 and name c3') 2 55 30 2
assign (residue 37 and name o5') (residue 37 and name c5')
        (residue 37 and name c4') (residue 37 and name c3') 2 55 30 2
assign (residue 38 and name o5') (residue 38 and name c5')
        (residue 38 and name c4') (residue 38 and name c3') 2 55 30 2
assign (residue 39 and name o5') (residue 39 and name c5')
        (residue 39 and name c4') (residue 39 and name c3') 2 55 30 2
assign (residue 40 and name o5') (residue 40 and name c5')
        (residue 40 and name c4') (residue 40 and name c3') 2 55 30 2
assign (residue 41 and name o5') (residue 41 and name c5')
        (residue 41 and name c4') (residue 41 and name c3') 2 55 30 2
assign (residue 42 and name o5') (residue 42 and name c5')
        (residue 42 and name c4') (residue 42 and name c3') 2 55 30 2
assign (residue 43 and name o5') (residue 43 and name c5')
        (residue 43 and name c4') (residue 43 and name c3') 2 55 30 2
assign (residue 44 and name o5') (residue 44 and name c5')
        (residue 44 and name c4') (residue 44 and name c3') 2 55 30 2
assign (residue 45 and name o5') (residue 45 and name c5')
        (residue 45 and name c4') (residue 45 and name c3') 2 55 30 2
assign (residue 46 and name o5') (residue 46 and name c5')
        (residue 46 and name c4') (residue 46 and name c3') 2 55 30 2
assign (residue 47 and name o5') (residue 47 and name c5')
        (residue 47 and name c4') (residue 47 and name c3') 2 55 30 2
assign (residue 48 and name o5') (residue 48 and name c5')
        (residue 48 and name c4') (residue 48 and name c3') 2 55 30 2
assign (residue 25 and name o5') (residue 25 and name c5')
        (residue 25 and name c4') (residue 25 and name c3') 2 155 60 2
assign (residue 35 and name o5') (residue 35 and name c5')
        (residue 35 and name c4') (residue 35 and name c3') 2 155 60 2
assign (residue 1 and name c4') (residue 1 and name c3')
        (residue 1 and name o3') (residue 2 and name p) 2 -155 30 2
assign (residue 2 and name c4') (residue 2 and name c3')
        (residue 2 and name o3') (residue 3 and name p) 2 -155 30 2
assign (residue 3 and name c4') (residue 3 and name c3')
        (residue 3 and name o3') (residue 4 and name p) 2 -155 30 2
assign (residue 4 and name c4') (residue 4 and name c3')
        (residue 4 and name o3') (residue 5 and name p) 2 -155 30 2
assign (residue 5 and name c4') (residue 5 and name c3')
        (residue 5 and name o3') (residue 6 and name p) 2 -155 30 2
assign (residue 6 and name c4') (residue 6 and name c3')
        (residue 6 and name o3') (residue 7 and name p) 2 -155 30 2
assign (residue 7 and name c4') (residue 7 and name c3')
        (residue 7 and name o3') (residue 8 and name p) 2 -155 30 2
assign (residue 8 and name c4') (residue 8 and name c3')
        (residue 8 and name o3') (residue 9 and name p) 2 -155 30 2
assign (residue 9 and name c4') (residue 9 and name c3')
        (residue 9 and name o3') (residue 10 and name p) 2 -155 30 2
assign (residue 10 and name c4') (residue 10 and name c3')
        (residue 10 and name o3') (residue 11 and name p) 2 -155 30 2
assign (residue 11 and name c4') (residue 11 and name c3')
        (residue 11 and name o3') (residue 12 and name p) 2 -155 30 2
assign (residue 12 and name c4') (residue 12 and name c3')
        (residue 12 and name o3') (residue 13 and name p) 2 -155 30 2
assign (residue 13 and name c4') (residue 13 and name c3')
        (residue 13 and name o3') (residue 14 and name p) 2 -155 30 2
assign (residue 14 and name c4') (residue 14 and name c3')
        (residue 14 and name o3') (residue 15 and name p) 2 -155 30 2
assign (residue 15 and name c4') (residue 15 and name c3')
        (residue 15 and name o3') (residue 16 and name p) 2 -155 30 2
assign (residue 16 and name c4') (residue 16 and name c3')
        (residue 16 and name o3') (residue 17 and name p) 2 -155 30 2
assign (residue 17 and name c4') (residue 17 and name c3')
        (residue 17 and name o3') (residue 18 and name p) 2 -155 30 2
assign (residue 18 and name c4') (residue 18 and name c3')
        (residue 18 and name o3') (residue 19 and name p) 2 -155 30 2
assign (residue 19 and name c4') (residue 19 and name c3')
        (residue 19 and name o3') (residue 20 and name p) 2 -155 30 2
assign (residue 20 and name c4') (residue 20 and name c3')
        (residue 20 and name o3') (residue 21 and name p) 2 -155 30 2
assign (residue 21 and name c4') (residue 21 and name c3')
        (residue 21 and name o3') (residue 22 and name p) 2 -155 30 2
assign (residue 22 and name c4') (residue 22 and name c3')
        (residue 22 and name o3') (residue 23 and name p) 2 -155 30 2
assign (residue 23 and name c4') (residue 23 and name c3')
        (residue 23 and name o3') (residue 24 and name p) 2 -90 90 2
assign (residue 24 and name c4') (residue 24 and name c3')
        (residue 24 and name o3') (residue 25 and name p) 2 -90 90 2
assign (residue 25 and name c4') (residue 25 and name c3')
        (residue 25 and name o3') (residue 26 and name p) 2 -90 90 2
assign (residue 26 and name c4') (residue 26 and name c3')
        (residue 26 and name o3') (residue 27 and name p) 2 -90 90 2
assign (residue 27 and name c4') (residue 27 and name c3')
        (residue 27 and name o3') (residue 28 and name p) 2 -155 30 2
assign (residue 28 and name c4') (residue 28 and name c3')
        (residue 28 and name o3') (residue 29 and name p) 2 -155 30 2
assign (residue 29 and name c4') (residue 29 and name c3')
        (residue 29 and name o3') (residue 30 and name p) 2 -155 30 2
assign (residue 30 and name c4') (residue 30 and name c3')
        (residue 30 and name o3') (residue 31 and name p) 2 -155 30 2
assign (residue 31 and name c4') (residue 31 and name c3')
        (residue 31 and name o3') (residue 32 and name p) 2 -155 30 2
assign (residue 32 and name c4') (residue 32 and name c3')
        (residue 32 and name o3') (residue 33 and name p) 2 -155 30 2
assign (residue 33 and name c4') (residue 33 and name c3')
        (residue 33 and name o3') (residue 34 and name p) 2 -155 30 2
assign (residue 34 and name c4') (residue 34 and name c3')
        (residue 34 and name o3') (residue 35 and name p) 2 -155 30 2
assign (residue 35 and name c4') (residue 35 and name c3')
        (residue 35 and name o3') (residue 36 and name p) 2 -90 90 2
assign (residue 36 and name c4') (residue 36 and name c3')
        (residue 36 and name o3') (residue 37 and name p) 2 -155 30 2
assign (residue 37 and name c4') (residue 37 and name c3')
        (residue 37 and name o3') (residue 38 and name p) 2 -155 30 2
assign (residue 38 and name c4') (residue 38 and name c3')
        (residue 38 and name o3') (residue 39 and name p) 2 -155 30 2
assign (residue 39 and name c4') (residue 39 and name c3')
        (residue 39 and name o3') (residue 40 and name p) 2 -155 30 2
assign (residue 40 and name c4') (residue 40 and name c3')
        (residue 40 and name o3') (residue 41 and name p) 2 -155 30 2
assign (residue 41 and name c4') (residue 41 and name c3')
        (residue 41 and name o3') (residue 42 and name p) 2 -155 30 2
assign (residue 42 and name c4') (residue 42 and name c3')
        (residue 42 and name o3') (residue 43 and name p) 2 -155 30 2
assign (residue 43 and name c4') (residue 43 and name c3')
        (residue 43 and name o3') (residue 44 and name p) 2 -155 30 2
assign (residue 44 and name c4') (residue 44 and name c3')
        (residue 44 and name o3') (residue 45 and name p) 2 -155 30 2
assign (residue 45 and name c4') (residue 45 and name c3')
        (residue 45 and name o3') (residue 46 and name p) 2 -155 30 2
assign (residue 46 and name c4') (residue 46 and name c3')
        (residue 46 and name o3') (residue 47 and name p) 2 -155 30 2
assign (residue 47 and name c4') (residue 47 and name c3')
        (residue 47 and name o3') (residue 48 and name p) 2 -155 30 2
{RDCs}
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c8 )(residue 1 and name h8 ) 25.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 2 and name c8 )(residue 2 and name h8 ) 23.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 3 and name c6 )(residue 3 and name h6 ) 28.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 4 and name c5 )(residue 4 and name h5 ) 18.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 5 and name c5 )(residue 5 and name h5 ) 25.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 6 and name c8 )(residue 6 and name h8 ) 36.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 8 and name c6 )(residue 8 and name h6 ) 22.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 10 and name c8 )(residue 10 and name h8 ) 33.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c2 )(residue 12 and name h2 ) 27.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 14 and name c8 )(residue 14 and name h8 ) 19.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 16 and name c8 )(residue 16 and name h8 ) 30.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 18 and name c2 )(residue 18 and name h2 ) 33.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 18 and name c8 )(residue 18 and name h8 ) 26.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c2 )(residue 19 and name h2 ) 27.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c8 )(residue 19 and name h8 ) 21.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c5 )(residue 21 and name h5 ) 16.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c6 )(residue 21 and name h6 ) 22.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c5 )(residue 22 and name h5 ) 16.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c8 )(residue 23 and name h8 ) 12.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c8 )(residue 24 and name h8 ) 10.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c5 )(residue 26 and name h5 ) 15.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c5 )(residue 27 and name h5 ) 16.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 29 and name c6 )(residue 29 and name h6 ) 27.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 30 and name c2 )(residue 30 and name h2 ) 27.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 30 and name c8 )(residue 30 and name h8 ) 21.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c2 )(residue 37 and name h2 ) 26.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 36 and name c6 )(residue 36 and name h6 ) 30.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c8 )(residue 37 and name h8 ) 22.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c2 )(residue 39 and name h2 ) 33.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c8 )(residue 39 and name h8 ) 30.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c2 )(residue 40 and name h2 ) 28.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c8 )(residue 40 and name h8 ) 22.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c2 )(residue 41 and name h2 ) 19.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c8 )(residue 41 and name h8 ) 25.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c6 )(residue 42 and name h6 ) 24.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c5 )(residue 43 and name h5 ) 23.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c6 )(residue 43 and name h6 ) 29.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c2 )(residue 44 and name h2 ) 30.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c8 )(residue 44 and name h8 ) 31.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c2 )(residue 45 and name h2 ) 33.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c8 )(residue 45 and name h8 ) 29.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c8 )(residue 46 and name h8 ) 28.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c6 )(residue 47 and name h6 ) 18.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c5 )(residue 48 and name h5 ) 26.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c6 )(residue 48 and name h6 ) 20.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c2' )(residue 1 and name h2'' ) 28.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c4' )(residue 1 and name h4' ) 23.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 2 and name c4' )(residue 2 and name h4' ) 22.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 4 and name c1' )(residue 4 and name h1' ) -19.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 7 and name c3' )(residue 7 and name h3' ) 25.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 10 and name c3' )(residue 10 and name h3' ) 26.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 11 and name c1' )(residue 11 and name h1' ) -9.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c1' )(residue 12 and name h1' ) -22.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 18 and name c1' )(residue 18 and name h1' ) -16.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 18 and name c3' )(residue 18 and name h3' ) 24.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c2' )(residue 20 and name h2'' ) 21.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c3' )(residue 20 and name h3' ) 18.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c1' )(residue 21 and name h1' ) -19.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c2' )(residue 21 and name h2'' ) 19.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c4' )(residue 21 and name h4' ) 21.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c1' )(residue 22 and name h1' ) -6.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c4' )(residue 22 and name h4' ) 12.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c1' )(residue 23 and name h1' ) 4.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c2' )(residue 23 and name h2'' ) -14.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c4' )(residue 23 and name h4' ) -7.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c1' )(residue 24 and name h1' ) 12.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c2' )(residue 24 and name h2'' ) -12.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c3' )(residue 24 and name h3' ) 13.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c4' )(residue 24 and name h4' ) 15.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c1' )(residue 26 and name h1' ) -14.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c4' )(residue 26 and name h4' ) 10.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c1' )(residue 27 and name h1' ) -13.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c2' )(residue 27 and name h2'' ) 8.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c3' )(residue 27 and name h3' ) 12.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c4' )(residue 27 and name h4' ) 15.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c1' )(residue 28 and name h1' ) -29.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c3' )(residue 28 and name h3' ) 14.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c4' )(residue 28 and name h4' ) 25.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 29 and name c3' )(residue 29 and name h3' ) 16.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 30 and name c1' )(residue 30 and name h1' ) -27.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 30 and name c3' )(residue 30 and name h3' ) 17.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c1' )(residue 31 and name h1' ) -26.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c2' )(residue 31 and name h2'' ) 18.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 32 and name c3' )(residue 32 and name h3' ) 24.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 33 and name c1' )(residue 33 and name h1' ) -22.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 33 and name c2' )(residue 33 and name h2'' ) 20.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 33 and name c3' )(residue 33 and name h3' ) 24.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c1' )(residue 34 and name h1' ) 2.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c1' )(residue 35 and name h1' ) -5.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c2' )(residue 35 and name h2'' ) 4.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c1' )(residue 37 and name h1' ) -45.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c3' )(residue 37 and name h3' ) 3.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c1' )(residue 38 and name h1' ) -32.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c1' )(residue 39 and name h1' ) -20.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c2' )(residue 39 and name h2'' ) 8.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c3' )(residue 39 and name h3' ) 3.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c4' )(residue 39 and name h4' ) 16.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c1' )(residue 40 and name h1' ) -10.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c4' )(residue 40 and name h4' ) 17.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c1' )(residue 41 and name h1' ) -26.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c3' )(residue 41 and name h3' ) 10.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c4' )(residue 41 and name h4' ) 18.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c3' )(residue 42 and name h3' ) 10.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c4' )(residue 42 and name h4' ) 18.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c2' )(residue 43 and name h2'' ) -2.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c4' )(residue 43 and name h4' ) 16.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c1' )(residue 44 and name h1' ) -3.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c1' )(residue 45 and name h1' ) -1.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c3' )(residue 45 and name h3' ) 19.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c1' )(residue 46 and name h1' ) -13.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c3' )(residue 46 and name h3' ) 25.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c2' )(residue 47 and name h2'' ) -3.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c3' )(residue 47 and name h3' ) 23.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c1' )(residue 48 and name h1' ) 7.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c2' )(residue 48 and name h2'' ) 19.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c3' )(residue 48 and name h3' ) 22.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c4' )(residue 48 and name h4' ) 26.8 2.5

  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1    H5'    G   1           H5'        G   1  -7.953  32.419 -23.188
    2   H5''    G   1          H5''        G   1  -8.113  30.855 -22.365
    3    H4'    G   1           H4'        G   1  -9.959  31.194 -24.004
    4    H3'    G   1           H3'        G   1  -7.872  29.046 -24.236
    5    H2'    G   1          H2''        G   1  -8.445  28.429 -26.394
    6   HO2'    G   1          H2'         G   1 -11.031  29.405 -25.750
    7    H1'    G   1           H1'        G   1  -9.610  30.810 -27.321
    8    H8     G   1           H8         G   1  -6.254  31.930 -26.510
    9    H1     G   1           H1         G   1  -6.072  27.694 -31.322
   10    H21    G   1           H21        G   1  -7.992  26.618 -31.462
   11    H22    G   1           H22        G   1  -9.289  26.859 -30.313
   12   HO5'    G   1          H5T         G   1  -6.528  31.173 -24.684
   13    H5'    G   2           H5'        G   2 -11.469  25.782 -23.009
   14   H5''    G   2          H5''        G   2 -10.229  24.666 -22.403
   15    H4'    G   2           H4'        G   2 -11.747  23.998 -24.497
   16    H3'    G   2           H3'        G   2  -8.887  23.530 -23.754
   17    H2'    G   2          H2''        G   2  -8.136  22.982 -25.849
   18   HO2'    G   2          H2'         G   2 -10.799  22.231 -26.514
   19    H1'    G   2           H1'        G   2  -9.983  24.301 -27.481
   20    H8     G   2           H8         G   2  -8.359  26.697 -25.055
   21    H1     G   2           H1         G   2  -4.567  25.095 -29.966
   22    H21    G   2           H21        G   2  -5.464  23.426 -31.098
   23    H22    G   2           H22        G   2  -6.891  22.581 -30.541
   24    H5'    C   3           H5'        C   3 -10.161  19.102 -25.753
   25   H5''    C   3          H5''        C   3  -9.167  18.248 -24.558
   26    H4'    C   3           H4'        C   3  -8.708  17.741 -27.060
   27    H3'    C   3           H3'        C   3  -6.764  18.463 -24.877
   28    H2'    C   3          H2''        C   3  -4.959  18.655 -26.308
   29   HO2'    C   3          H2'         C   3  -6.408  16.962 -28.077
   30    H1'    C   3           H1'        C   3  -6.295  19.392 -28.671
   31    H41    C   3           H41        C   3  -2.818  24.336 -26.592
   32    H42    C   3           H42        C   3  -4.111  24.781 -25.503
   33    H5     C   3           H5         C   3  -6.009  23.365 -25.068
   34    H6     C   3           H6         C   3  -7.201  21.339 -25.762
   35    H5'    U   4           H5'        U   4  -4.548  15.174 -26.937
   36   H5''    U   4          H5''        U   4  -3.462  14.582 -25.665
   37    H4'    U   4           H4'        U   4  -2.478  15.871 -27.774
   38    H3'    U   4           H3'        U   4  -1.792  15.914 -24.848
   39    H2'    U   4          H2''        U   4  -0.477  17.786 -24.974
   40   HO2'    U   4          H2'         U   4   0.054  16.989 -27.649
   41    H1'    U   4           H1'        U   4  -1.475  18.921 -27.393
   42    H3     U   4           H3         U   4  -1.013  22.305 -24.388
   43    H5     U   4           H5         U   4  -4.276  20.067 -22.940
   44    H6     U   4           H6         U   4  -3.846  18.432 -24.679
   45    H5'    U   5           H5'        U   5   2.020  15.727 -27.522
   46   H5''    U   5          H5''        U   5   3.097  14.593 -26.684
   47    H4'    U   5           H4'        U   5   4.285  16.684 -27.368
   48    H3'    U   5           H3'        U   5   3.929  15.750 -24.541
   49    H2'    U   5          H2''        U   5   4.621  17.705 -23.555
   50   HO2'    U   5          H2'         U   5   6.682  17.632 -24.518
   51    H1'    U   5           H1'        U   5   4.160  19.538 -25.678
   52    H3     U   5           H3         U   5   2.238  21.567 -22.135
   53    H5     U   5           H5         U   5  -0.083  18.093 -22.660
   54    H6     U   5           H6         U   5   1.471  17.393 -24.388
   55    H5'    G   6           H5'        G   6   7.575  15.674 -21.763
   56   H5''    G   6          H5''        G   6   6.026  16.417 -22.214
   57    H4'    G   6           H4'        G   6   8.540  18.050 -22.550
   58    H3'    G   6           H3'        G   6   7.411  16.968 -20.002
   59    H2'    G   6          H2''        G   6   6.931  18.986 -19.029
   60   HO2'    G   6          H2'         G   6   9.094  19.683 -19.063
   61    H1'    G   6           H1'        G   6   6.776  20.667 -21.301
   62    H8     G   6           H8         G   6   4.238  17.855 -21.390
   63    H1     G   6           H1         G   6   2.589  22.642 -17.453
   64    H21    G   6           H21        G   6   4.318  23.967 -17.105
   65    H22    G   6           H22        G   6   5.818  23.798 -17.988
   66    H5'    A   7           H5'        A   7  11.398  19.599 -19.293
   67   H5''    A   7          H5''        A   7  12.230  18.659 -18.038
   68    H4'    A   7           H4'        A   7  12.265  21.105 -17.536
   69    H3'    A   7           H3'        A   7  10.929  19.022 -15.850
   70    H2'    A   7          H2''        A   7   9.803  20.496 -14.492
   71   HO2'    A   7          H2'         A   7  10.759  22.192 -13.672
   72    H1'    A   7           H1'        A   7   9.635  22.737 -16.197
   73    H8     A   7           H8         A   7   8.136  19.399 -17.403
   74    H61    A   7           H61        A   7   3.006  21.108 -14.406
   75    H62    A   7           H62        A   7   3.680  20.011 -15.590
   76    H2     A   7           H2         A   7   6.217  24.108 -13.499
   77    H5'    U   8           H5'        U   8  13.265  22.170 -13.478
   78   H5''    U   8          H5''        U   8  14.140  21.325 -12.186
   79    H4'    U   8           H4'        U   8  13.016  23.358 -11.312
   80    H3'    U   8           H3'        U   8  12.312  20.565 -10.478
   81    H2'    U   8          H2''        U   8  10.385  21.133  -9.373
   82   HO2'    U   8          H2'         U   8  10.871  22.476  -7.822
   83    H1'    U   8           H1'        U   8   9.785  23.612 -10.618
   84    H3     U   8           H3         U   8   5.824  21.483 -10.914
   85    H5     U   8           H5         U   8   8.416  19.030 -13.154
   86    H6     U   8           H6         U   8  10.264  20.426 -12.417
   87    H5'    U   9           H5'        U   9  12.888  23.147  -6.559
   88   H5''    U   9          H5''        U   9  13.437  21.958  -5.360
   89    H4'    U   9           H4'        U   9  11.352  23.315  -4.716
   90    H3'    U   9           H3'        U   9  11.753  20.347  -4.714
   91    H2'    U   9          H2''        U   9   9.540  19.793  -4.488
   92   HO2'    U   9          H2'         U   9   8.555  20.632  -2.851
   93    H1'    U   9           H1'        U   9   8.300  22.138  -5.479
   94    H3     U   9           H3         U   9   6.199  18.856  -7.732
   95    H5     U   9           H5         U   9  10.194  18.510  -9.019
   96    H6     U   9           H6         U   9  10.790  20.233  -7.419
   97    H5'    G  10           H5'        G  10   9.487  21.668  -1.021
   98   H5''    G  10          H5''        G  10  10.307  20.920   0.364
   99    H4'    G  10           H4'        G  10   7.842  20.676   0.551
  100    H3'    G  10           H3'        G  10   9.703  18.339   0.170
  101    H2'    G  10          H2''        G  10   7.982  16.783   0.004
  102   HO2'    G  10          H2'         G  10   6.773  17.276   1.784
  103    H1'    G  10           H1'        G  10   6.115  18.313  -1.352
  104    H8     G  10           H8         G  10   9.557  18.729  -2.882
  105    H1     G  10           H1         G  10   6.757  13.171  -4.418
  106    H21    G  10           H21        G  10   4.914  12.900  -3.237
  107    H22    G  10           H22        G  10   4.463  13.990  -1.946
  108    H5'    U  11           H5'        U  11   7.524  17.344   4.182
  109   H5''    U  11          H5''        U  11   8.522  16.084   4.932
  110    H4'    U  11           H4'        U  11   6.053  15.532   4.101
  111    H3'    U  11           H3'        U  11   8.633  13.979   3.995
  112    H2'    U  11          H2''        U  11   7.746  12.283   2.679
  113   HO2'    U  11          H2'         U  11   5.207  13.177   3.589
  114    H1'    U  11           H1'        U  11   5.932  13.762   1.171
  115    H3     U  11           H3         U  11   9.023  11.702  -1.546
  116    H5     U  11           H5         U  11  10.856  15.258  -0.224
  117    H6     U  11           H6         U  11   9.020  15.553   1.330
  118    H5'    A  12           H5'        A  12   6.483  10.869   6.660
  119   H5''    A  12          H5''        A  12   7.894   9.914   7.155
  120    H4'    A  12           H4'        A  12   6.193   8.989   5.313
  121    H3'    A  12           H3'        A  12   9.195   8.844   5.574
  122    H2'    A  12          H2''        A  12   9.475   7.889   3.476
  123   HO2'    A  12          H2'         A  12   6.759   7.110   3.728
  124    H1'    A  12           H1'        A  12   7.364   9.106   2.132
  125    H8     A  12           H8         A  12   9.399  11.757   3.895
  126    H61    A  12           H61        A  12  13.591  11.167  -0.607
  127    H62    A  12           H62        A  12  13.011  12.184   0.693
  128    H2     A  12           H2         A  12  10.578   7.877  -1.075
  129    H5'    U  13           H5'        U  13   8.251   5.389   3.770
  130   H5''    U  13          H5''        U  13   8.845   3.996   4.694
  131    H4'    U  13           H4'        U  13   9.662   3.696   2.455
  132    H3'    U  13           H3'        U  13  11.639   4.769   4.478
  133    H2'    U  13          H2''        U  13  13.329   4.905   2.878
  134   HO2'    U  13          H2'         U  13  11.736   3.157   1.290
  135    H1'    U  13           H1'        U  13  11.751   5.624   0.685
  136    H3     U  13           H3         U  13  14.488   9.185   1.175
  137    H5     U  13           H5         U  13  12.175   9.234   4.680
  138    H6     U  13           H6         U  13  11.173   7.147   3.987
  139    H5'    G  14           H5'        G  14  13.828   1.201   3.260
  140   H5''    G  14          H5''        G  14  15.150   1.029   4.430
  141    H4'    G  14           H4'        G  14  15.586   2.022   1.982
  142    H3'    G  14           H3'        G  14  16.713   2.755   4.691
  143    H2'    G  14          H2''        G  14  17.807   4.599   3.856
  144   HO2'    G  14          H2'         G  14  19.106   4.215   2.268
  145    H1'    G  14           H1'        G  14  16.194   4.992   1.508
  146    H8     G  14           H8         G  14  14.263   5.682   4.662
  147    H1     G  14           H1         G  14  18.291  10.390   2.985
  148    H21    G  14           H21        G  14  19.651   9.688   1.400
  149    H22    G  14           H22        G  14  19.693   8.019   0.879
  150    H5'    U  15           H5'        U  15  20.100   2.235   1.557
  151   H5''    U  15          H5''        U  15  21.243   1.177   2.409
  152    H4'    U  15           H4'        U  15  22.509   2.962   1.330
  153    H3'    U  15           H3'        U  15  22.186   2.890   4.318
  154    H2'    U  15          H2''        U  15  23.115   4.972   4.674
  155   HO2'    U  15          H2'         U  15  24.653   5.873   3.334
  156    H1'    U  15           H1'        U  15  22.478   6.228   2.248
  157    H3     U  15           H3         U  15  20.659   8.972   5.336
  158    H5     U  15           H5         U  15  18.425   5.423   5.740
  159    H6     U  15           H6         U  15  19.915   4.379   4.136
  160    H5'    G  16           H5'        G  16  26.856   3.741   3.894
  161   H5''    G  16          H5''        G  16  27.323   3.222   5.524
  162    H4'    G  16           H4'        G  16  27.615   5.762   4.788
  163    H3'    G  16           H3'        G  16  26.691   4.500   7.366
  164    H2'    G  16          H2''        G  16  26.003   6.488   8.270
  165   HO2'    G  16          H2'         G  16  27.984   7.714   6.642
  166    H1'    G  16           H1'        G  16  25.679   7.997   5.856
  167    H8     G  16           H8         G  16  23.398   4.979   6.604
  168    H1     G  16           H1         G  16  21.467  10.529   9.168
  169    H21    G  16           H21        G  16  23.021  12.070   8.885
  170    H22    G  16           H22        G  16  24.598  11.694   8.228
  171    H5'    U  17           H5'        U  17  30.502   7.512   8.876
  172   H5''    U  17          H5''        U  17  30.609   6.676  10.436
  173    H4'    U  17           H4'        U  17  30.133   9.297  10.337
  174    H3'    U  17           H3'        U  17  29.067   7.096  12.095
  175    H2'    U  17          H2''        U  17  27.390   8.372  12.993
  176   HO2'    U  17          H2'         U  17  29.082  10.608  12.510
  177    H1'    U  17           H1'        U  17  27.190  10.380  10.969
  178    H3     U  17           H3         U  17  22.975   9.186  12.184
  179    H5     U  17           H5         U  17  24.416   5.888   9.990
  180    H6     U  17           H6         U  17  26.598   6.948   9.962
  181    H5'    A  18           H5'        A  18  31.037  10.765  15.208
  182   H5''    A  18          H5''        A  18  30.804   9.782  16.665
  183    H4'    A  18           H4'        A  18  29.773  12.235  16.512
  184    H3'    A  18           H3'        A  18  28.592   9.664  17.585
  185    H2'    A  18          H2''        A  18  26.622  10.778  18.212
  186   HO2'    A  18          H2'         A  18  28.058  13.203  17.790
  187    H1'    A  18           H1'        A  18  26.427  12.397  15.961
  188    H8     A  18           H8         A  18  27.368   8.955  14.802
  189    H61    A  18           H61        A  18  21.465   7.328  15.615
  190    H62    A  18           H62        A  18  23.039   6.805  15.057
  191    H2     A  18           H2         A  18  22.069  11.342  17.531
  192    H5'    A  19           H5'        A  19  27.791  12.431  20.336
  193   H5''    A  19          H5''        A  19  28.372  12.077  21.975
  194    H4'    A  19           H4'        A  19  26.031  12.695  22.148
  195    H3'    A  19           H3'        A  19  26.859   9.826  22.496
  196    H2'    A  19          H2''        A  19  24.720   8.998  22.492
  197   HO2'    A  19          H2'         A  19  24.042  11.512  23.587
  198    H1'    A  19           H1'        A  19  23.392  11.064  21.073
  199    H8     A  19           H8         A  19  26.229   9.167  19.299
  200    H61    A  19           H61        A  19  21.940   5.002  17.740
  201    H62    A  19           H62        A  19  23.539   5.616  17.386
  202    H2     A  19           H2         A  19  20.088   7.893  20.625
  203    H5'    A  20           H5'        A  20  23.974  10.821  26.050
  204   H5''    A  20          H5''        A  20  24.622   9.802  27.350
  205    H4'    A  20           H4'        A  20  22.168   9.424  26.913
  206    H3'    A  20           H3'        A  20  24.308   7.313  26.634
  207    H2'    A  20          H2''        A  20  22.812   5.714  25.855
  208   HO2'    A  20          H2'         A  20  21.333   6.406  27.725
  209    H1'    A  20           H1'        A  20  21.000   7.393  24.538
  210    H8     A  20           H8         A  20  24.815   7.577  23.832
  211    H61    A  20           H61        A  20  23.697   3.457  19.366
  212    H62    A  20           H62        A  20  24.928   4.391  20.186
  213    H2     A  20           H2         A  20  19.908   4.052  21.690
  214    H5'    U  21           H5'        U  21  21.496   4.982  29.194
  215   H5''    U  21          H5''        U  21  22.575   3.732  29.845
  216    H4'    U  21           H4'        U  21  20.741   3.115  28.008
  217    H3'    U  21           H3'        U  21  23.600   2.224  28.403
  218    H2'    U  21          H2''        U  21  23.702   1.143  26.343
  219   HO2'    U  21          H2'         U  21  22.204  -0.320  26.211
  220    H1'    U  21           H1'        U  21  21.656   2.538  24.987
  221    H3     U  21           H3         U  21  25.323   2.376  22.259
  222    H5     U  21           H5         U  21  26.489   4.911  25.417
  223    H6     U  21           H6         U  21  24.324   4.536  26.429
  224    H5'    U  22           H5'        U  22  20.765  -1.009  27.926
  225   H5''    U  22          H5''        U  22  20.887  -2.331  29.105
  226    H4'    U  22           H4'        U  22  20.601  -3.251  26.834
  227    H3'    U  22           H3'        U  22  23.059  -3.606  28.492
  228    H2'    U  22          H2''        U  22  24.505  -4.059  26.802
  229   HO2'    U  22          H2'         U  22  23.651  -6.078  26.442
  230    H1'    U  22           H1'        U  22  22.834  -3.464  24.526
  231    H3     U  22           H3         U  22  26.716  -1.899  22.891
  232    H5     U  22           H5         U  22  26.396   0.065  26.606
  233    H6     U  22           H6         U  22  24.350  -1.170  27.011
  234    H5'    A  23           H5'        A  23  25.140  -6.127  29.578
  235   H5''    A  23          H5''        A  23  25.147  -4.996  28.214
  236    H4'    A  23           H4'        A  23  27.180  -6.552  28.369
  237    H3'    A  23           H3'        A  23  25.560  -5.746  26.112
  238    H2'    A  23          H2''        A  23  24.949  -7.789  25.270
  239   HO2'    A  23          H2'         A  23  26.834  -7.566  23.970
  240    H1'    A  23           H1'        A  23  26.658  -9.613  26.725
  241    H8     A  23           H8         A  23  23.502  -8.718  28.434
  242    H61    A  23           H61        A  23  20.388 -12.399  24.558
  243    H62    A  23           H62        A  23  20.290 -11.416  26.003
  244    H2     A  23           H2         A  23  24.604 -12.055  23.070
  245    H5'    A  24           H5'        A  24  28.797  -4.819  22.899
  246   H5''    A  24          H5''        A  24  27.459  -3.983  22.088
  247    H4'    A  24           H4'        A  24  28.231  -6.734  21.818
  248    H3'    A  24           H3'        A  24  26.183  -4.799  20.805
  249    H2'    A  24          H2''        A  24  24.579  -6.384  20.404
  250   HO2'    A  24          H2'         A  24  25.193  -8.516  19.632
  251    H1'    A  24           H1'        A  24  25.793  -8.582  21.901
  252    H8     A  24           H8         A  24  24.322  -6.114  24.172
  253    H61    A  24           H61        A  24  18.734  -8.465  22.962
  254    H62    A  24           H62        A  24  19.624  -7.290  23.906
  255    H2     A  24           H2         A  24  21.625 -10.113  19.953
  256    H5'    U  25           H5'        U  25  25.876  -2.919  17.643
  257   H5''    U  25          H5''        U  25  25.569  -4.345  18.653
  258    H4'    U  25           H4'        U  25  24.807  -3.866  15.891
  259    H3'    U  25           H3'        U  25  23.773  -5.053  18.137
  260    H2'    U  25          H2''        U  25  25.060  -7.019  18.163
  261   HO2'    U  25          H2'         U  25  23.024  -7.849  17.895
  262    H1'    U  25           H1'        U  25  25.005  -7.257  15.181
  263    H3     U  25           H3         U  25  28.253 -10.329  14.979
  264    H5     U  25           H5         U  25  28.975  -8.483  18.697
  265    H6     U  25           H6         U  25  27.107  -7.001  18.256
  266    H5'    U  26           H5'        U  26  22.806  -5.973  19.625
  267   H5''    U  26          H5''        U  26  21.387  -6.723  18.869
  268    H4'    U  26           H4'        U  26  20.428  -6.294  20.953
  269    H3'    U  26           H3'        U  26  20.251  -3.945  19.131
  270    H2'    U  26          H2''        U  26  20.122  -2.280  20.686
  271   HO2'    U  26          H2'         U  26  18.911  -4.220  22.371
  272    H1'    U  26           H1'        U  26  21.267  -3.441  22.936
  273    H3     U  26           H3         U  26  23.853   0.193  22.504
  274    H5     U  26           H5         U  26  24.756  -2.034  19.050
  275    H6     U  26           H6         U  26  23.012  -3.591  19.655
  276    H5'    C  27           H5'        C  27  15.455  -3.677  19.987
  277   H5''    C  27          H5''        C  27  15.247  -2.494  18.681
  278    H4'    C  27           H4'        C  27  15.073  -1.811  21.307
  279    H3'    C  27           H3'        C  27  16.313  -0.352  18.920
  280    H2'    C  27          H2''        C  27  16.905   1.445  20.312
  281   HO2'    C  27          H2'         C  27  14.879   0.498  22.077
  282    H1'    C  27           H1'        C  27  17.229  -0.074  22.661
  283    H41    C  27           H41        C  27  23.045   1.886  20.970
  284    H42    C  27           H42        C  27  22.870   1.196  19.372
  285    H5     C  27           H5         C  27  20.963  -0.121  18.717
  286    H6     C  27           H6         C  27  18.687  -0.793  19.324
  287    H5'    U  28           H5'        U  28  12.469   2.399  19.472
  288   H5''    U  28          H5''        U  28  12.602   3.511  18.096
  289    H4'    U  28           H4'        U  28  13.082   4.345  20.603
  290    H3'    U  28           H3'        U  28  14.519   4.934  17.999
  291    H2'    U  28          H2''        U  28  16.006   6.359  19.086
  292   HO2'    U  28          H2'         U  28  15.265   7.632  20.578
  293    H1'    U  28           H1'        U  28  16.290   4.830  21.404
  294    H3     U  28           H3         U  28  20.201   5.360  19.008
  295    H5     U  28           H5         U  28  18.180   2.120  17.237
  296    H6     U  28           H6         U  28  16.261   2.634  18.615
  297    H5'    U  29           H5'        U  29  13.667   8.736  20.234
  298   H5''    U  29          H5''        U  29  12.834   9.776  19.061
  299    H4'    U  29           H4'        U  29  14.511  11.101  20.268
  300    H3'    U  29           H3'        U  29  14.850  10.412  17.357
  301    H2'    U  29          H2''        U  29  16.981  11.309  17.211
  302   HO2'    U  29          H2'         U  29  17.260  13.205  18.042
  303    H1'    U  29           H1'        U  29  17.910  10.773  19.769
  304    H3     U  29           H3         U  29  20.644   8.597  16.853
  305    H5     U  29           H5         U  29  17.105   6.314  16.867
  306    H6     U  29           H6         U  29  16.080   8.038  18.234
  307    H5'    A  30           H5'        A  30  15.571  15.188  17.331
  308   H5''    A  30          H5''        A  30  15.473  15.402  15.574
  309    H4'    A  30           H4'        A  30  17.748  15.890  16.888
  310    H3'    A  30           H3'        A  30  17.294  14.481  14.238
  311    H2'    A  30          H2''        A  30  19.620  14.316  13.944
  312   HO2'    A  30          H2'         A  30  20.214  16.409  14.561
  313    H1'    A  30           H1'        A  30  20.206  13.640  16.569
  314    H8     A  30           H8         A  30  17.141  11.717  15.396
  315    H61    A  30           H61        A  30  20.999   8.017  12.313
  316    H62    A  30           H62        A  30  19.406   8.156  13.024
  317    H2     A  30           H2         A  30  23.303  11.623  13.652
  318    H5'    C  31           H5'        C  31  19.301  18.532  12.788
  319   H5''    C  31          H5''        C  31  19.003  18.500  11.039
  320    H4'    C  31           H4'        C  31  21.484  18.337  11.988
  321    H3'    C  31           H3'        C  31  20.086  16.950   9.704
  322    H2'    C  31          H2''        C  31  21.879  15.512   9.290
  323   HO2'    C  31          H2'         C  31  23.862  16.199   9.379
  324    H1'    C  31           H1'        C  31  22.840  15.200  11.863
  325    H41    C  31           H41        C  31  19.744   9.925   9.969
  326    H42    C  31           H42        C  31  18.256  10.586  10.605
  327    H5     C  31           H5         C  31  18.127  12.757  11.656
  328    H6     C  31           H6         C  31  19.324  14.846  12.092
  329    H5'    A  32           H5'        A  32  23.477  18.762   7.488
  330   H5''    A  32          H5''        A  32  22.795  19.530   6.040
  331    H4'    A  32           H4'        A  32  24.465  17.858   5.365
  332    H3'    A  32           H3'        A  32  21.524  17.424   4.876
  333    H2'    A  32          H2''        A  32  21.808  15.285   4.058
  334   HO2'    A  32          H2'         A  32  24.522  15.981   3.549
  335    H1'    A  32           H1'        A  32  24.093  14.535   5.503
  336    H8     A  32           H8         A  32  21.095  15.832   7.534
  337    H61    A  32           H61        A  32  18.921  10.053   7.191
  338    H62    A  32           H62        A  32  18.759  11.603   7.986
  339    H2     A  32           H2         A  32  22.589  10.320   4.621
  340    H5'    C  33           H5'        C  33  23.864  17.102   0.445
  341   H5''    C  33          H5''        C  33  22.420  17.021  -0.583
  342    H4'    C  33           H4'        C  33  24.225  15.048  -0.604
  343    H3'    C  33           H3'        C  33  21.200  14.962  -0.636
  344    H2'    C  33          H2''        C  33  21.243  12.602  -0.797
  345   HO2'    C  33          H2'         C  33  22.768  11.970  -2.148
  346    H1'    C  33           H1'        C  33  23.194  12.221   1.111
  347    H41    C  33           H41        C  33  17.499  11.730   3.956
  348    H42    C  33           H42        C  33  17.484  13.458   4.219
  349    H5     C  33           H5         C  33  19.288  14.904   3.522
  350    H6     C  33           H6         C  33  21.325  15.058   2.172
  351    H5'    A  34           H5'        A  34  22.519  13.108  -3.917
  352   H5''    A  34          H5''        A  34  21.944  13.393  -5.573
  353    H4'    A  34           H4'        A  34  21.618  11.039  -5.095
  354    H3'    A  34           H3'        A  34  19.308  12.922  -5.270
  355    H2'    A  34          H2''        A  34  17.765  11.579  -4.246
  356   HO2'    A  34          H2'         A  34  17.578   9.909  -5.558
  357    H1'    A  34           H1'        A  34  19.472   9.731  -2.905
  358    H8     A  34           H8         A  34  19.621  13.403  -1.802
  359    H61    A  34           H61        A  34  15.179  11.893   2.222
  360    H62    A  34           H62        A  34  16.403  13.073   1.809
  361    H2     A  34           H2         A  34  15.774   8.424  -0.556
  362    H5'    C  35           H5'        C  35  15.938  12.961  -7.987
  363   H5''    C  35          H5''        C  35  17.039  13.362  -6.653
  364    H4'    C  35           H4'        C  35  15.643  10.729  -6.424
  365    H3'    C  35           H3'        C  35  14.149  12.987  -7.226
  366    H2'    C  35          H2''        C  35  14.179  14.251  -5.335
  367   HO2'    C  35          H2'         C  35  12.652  13.523  -3.738
  368    H1'    C  35           H1'        C  35  14.603  11.988  -3.421
  369    H41    C  35           H41        C  35  16.560  17.195  -0.274
  370    H42    C  35           H42        C  35  18.025  17.204  -1.230
  371    H5     C  35           H5         C  35  18.323  15.830  -3.188
  372    H6     C  35           H6         C  35  17.387  14.001  -4.518
  373    H5'    U  36           H5'        U  36  15.447   8.781  -8.469
  374   H5''    U  36          H5''        U  36  13.999   8.616  -9.486
  375    H4'    U  36           H4'        U  36  14.776   6.369  -9.162
  376    H3'    U  36           H3'        U  36  12.410   7.391  -7.696
  377    H2'    U  36          H2''        U  36  12.324   5.830  -5.999
  378   HO2'    U  36          H2'         U  36  12.339   4.062  -7.523
  379    H1'    U  36           H1'        U  36  14.979   5.178  -5.656
  380    H3     U  36           H3         U  36  12.291   7.977  -2.609
  381    H5     U  36           H5         U  36  15.821   9.867  -3.908
  382    H6     U  36           H6         U  36  16.124   8.065  -5.499
  383    H5'    A  37           H5'        A  37   9.136   4.311  -9.154
  384   H5''    A  37          H5''        A  37   8.181   5.765  -9.508
  385    H4'    A  37           H4'        A  37   7.475   4.123  -7.526
  386    H3'    A  37           H3'        A  37   7.473   7.134  -7.766
  387    H2'    A  37          H2''        A  37   6.806   7.442  -5.553
  388   HO2'    A  37          H2'         A  37   5.118   5.972  -5.456
  389    H1'    A  37           H1'        A  37   8.314   5.443  -4.389
  390    H8     A  37           H8         A  37  10.694   7.001  -6.769
  391    H61    A  37           H61        A  37  11.090  11.865  -3.001
  392    H62    A  37           H62        A  37  11.880  10.961  -4.273
  393    H2     A  37           H2         A  37   7.493   9.474  -1.796
  394    H5'    C  38           H5'        C  38   3.161   5.777  -7.459
  395   H5''    C  38          H5''        C  38   2.008   6.796  -8.344
  396    H4'    C  38           H4'        C  38   1.593   6.731  -5.852
  397    H3'    C  38           H3'        C  38   2.157   9.178  -7.501
  398    H2'    C  38          H2''        C  38   2.348  10.608  -5.689
  399   HO2'    C  38          H2'         C  38   1.055   8.699  -4.028
  400    H1'    C  38           H1'        C  38   3.378   8.856  -3.779
  401    H41    C  38           H41        C  38   7.998  12.794  -5.866
  402    H42    C  38           H42        C  38   8.492  11.543  -6.985
  403    H5     C  38           H5         C  38   7.150   9.603  -7.456
  404    H6     C  38           H6         C  38   5.176   8.319  -6.791
  405    H5'    A  39           H5'        A  39  -2.199  10.542  -6.533
  406   H5''    A  39          H5''        A  39  -2.358  11.748  -7.825
  407    H4'    A  39           H4'        A  39  -1.955  12.476  -5.261
  408    H3'    A  39           H3'        A  39  -0.825  13.570  -7.865
  409    H2'    A  39          H2''        A  39   0.507  15.104  -6.698
  410   HO2'    A  39          H2'         A  39  -1.315  14.816  -4.526
  411    H1'    A  39           H1'        A  39   0.779  13.623  -4.317
  412    H8     A  39           H8         A  39   2.075  11.749  -7.332
  413    H61    A  39           H61        A  39   7.127  15.297  -7.079
  414    H62    A  39           H62        A  39   6.442  13.814  -7.705
  415    H2     A  39           H2         A  39   4.114  16.969  -4.208
  416    H5'    A  40           H5'        A  40  -3.271  16.245  -5.353
  417   H5''    A  40          H5''        A  40  -4.369  17.384  -6.161
  418    H4'    A  40           H4'        A  40  -3.227  18.541  -4.319
  419    H3'    A  40           H3'        A  40  -2.732  19.159  -7.207
  420    H2'    A  40          H2''        A  40  -0.779  20.331  -6.938
  421   HO2'    A  40          H2'         A  40  -1.494  21.977  -5.693
  422    H1'    A  40           H1'        A  40   0.128  19.362  -4.461
  423    H8     A  40           H8         A  40  -0.557  16.858  -7.319
  424    H61    A  40           H61        A  40   5.437  17.482  -8.666
  425    H62    A  40           H62        A  40   3.934  16.714  -9.122
  426    H2     A  40           H2         A  40   4.380  20.550  -5.560
  427    H5'    A  41           H5'        A  41  -3.623  23.621  -5.816
  428   H5''    A  41          H5''        A  41  -3.883  24.339  -7.418
  429    H4'    A  41           H4'        A  41  -1.709  24.948  -5.953
  430    H3'    A  41           H3'        A  41  -1.967  24.343  -8.917
  431    H2'    A  41          H2''        A  41   0.295  24.887  -9.218
  432   HO2'    A  41          H2'         A  41   0.160  26.096  -6.643
  433    H1'    A  41           H1'        A  41   1.139  23.747  -6.777
  434    H8     A  41           H8         A  41  -1.158  21.482  -8.802
  435    H61    A  41           H61        A  41   3.923  19.653 -11.816
  436    H62    A  41           H62        A  41   2.231  19.328 -11.516
  437    H2     A  41           H2         A  41   5.042  23.092  -9.164
  438    H5'    U  42           H5'        U  42   0.006  28.148  -8.002
  439   H5''    U  42          H5''        U  42  -0.522  29.448  -9.091
  440    H4'    U  42           H4'        U  42   1.965  29.403  -8.906
  441    H3'    U  42           H3'        U  42   0.522  28.556 -11.441
  442    H2'    U  42          H2''        U  42   2.489  28.048 -12.552
  443   HO2'    U  42          H2'         U  42   4.324  29.123 -12.277
  444    H1'    U  42           H1'        U  42   4.006  27.287 -10.298
  445    H3     U  42           H3         U  42   4.208  23.571 -12.848
  446    H5     U  42           H5         U  42   0.153  23.806 -11.748
  447    H6     U  42           H6         U  42   0.585  26.019 -10.876
  448    H5'    U  43           H5'        U  43   3.415  31.366 -13.348
  449   H5''    U  43          H5''        U  43   2.669  31.623 -14.938
  450    H4'    U  43           H4'        U  43   4.856  30.104 -14.682
  451    H3'    U  43           H3'        U  43   2.394  29.904 -16.403
  452    H2'    U  43          H2''        U  43   2.765  27.720 -17.049
  453   HO2'    U  43          H2'         U  43   5.536  28.167 -16.560
  454    H1'    U  43           H1'        U  43   4.434  26.852 -14.927
  455    H3     U  43           H3         U  43   1.315  23.594 -15.235
  456    H5     U  43           H5         U  43  -0.891  26.971 -14.013
  457    H6     U  43           H6         U  43   1.123  28.299 -14.266
  458    H5'    A  44           H5'        A  44   6.662  30.864 -19.511
  459   H5''    A  44          H5''        A  44   5.607  30.972 -20.933
  460    H4'    A  44           H4'        A  44   7.887  29.607 -21.056
  461    H3'    A  44           H3'        A  44   5.152  29.156 -22.200
  462    H2'    A  44          H2''        A  44   5.518  26.963 -22.825
  463   HO2'    A  44          H2'         A  44   8.293  27.587 -22.788
  464    H1'    A  44           H1'        A  44   7.356  26.162 -20.899
  465    H8     A  44           H8         A  44   4.629  27.546 -18.859
  466    H61    A  44           H61        A  44   1.106  22.710 -20.407
  467    H62    A  44           H62        A  44   1.277  24.086 -19.340
  468    H2     A  44           H2         A  44   4.710  22.712 -23.071
  469    H5'    A  45           H5'        A  45   7.541  28.822 -26.278
  470   H5''    A  45          H5''        A  45   6.229  29.283 -27.379
  471    H4'    A  45           H4'        A  45   7.245  26.815 -27.436
  472    H3'    A  45           H3'        A  45   4.420  27.846 -27.660
  473    H2'    A  45          H2''        A  45   3.500  25.718 -27.685
  474   HO2'    A  45          H2'         A  45   6.071  24.733 -28.415
  475    H1'    A  45           H1'        A  45   5.412  24.415 -26.069
  476    H8     A  45           H8         A  45   4.209  27.305 -24.093
  477    H61    A  45           H61        A  45  -1.002  24.162 -23.005
  478    H62    A  45           H62        A  45   0.022  25.475 -22.471
  479    H2     A  45           H2         A  45   1.260  22.032 -26.242
  480    H5'    G  46           H5'        G  46   5.567  26.721 -32.438
  481   H5''    G  46          H5''        G  46   4.061  27.194 -33.249
  482    H4'    G  46           H4'        G  46   4.848  24.646 -33.245
  483    H3'    G  46           H3'        G  46   2.152  25.944 -32.922
  484    H2'    G  46          H2''        G  46   1.060  23.924 -32.481
  485   HO2'    G  46          H2'         G  46   1.873  21.944 -33.023
  486    H1'    G  46           H1'        G  46   2.993  22.761 -30.897
  487    H8     G  46           H8         G  46   2.933  26.274 -29.709
  488    H1     G  46           H1         G  46  -2.389  23.101 -28.073
  489    H21    G  46           H21        G  46  -2.490  21.178 -29.152
  490    H22    G  46           H22        G  46  -1.357  20.756 -30.416
  491    H5'    C  47           H5'        C  47   1.473  22.275 -34.836
  492   H5''    C  47          H5''        C  47   1.111  22.670 -36.529
  493    H4'    C  47           H4'        C  47  -0.420  20.912 -35.891
  494    H3'    C  47           H3'        C  47  -1.396  23.733 -36.142
  495    H2'    C  47          H2''        C  47  -3.514  23.321 -35.315
  496   HO2'    C  47          H2'         C  47  -4.469  21.322 -35.297
  497    H1'    C  47           H1'        C  47  -2.886  21.389 -33.397
  498    H41    C  47           H41        C  47  -3.159  26.482 -29.664
  499    H42    C  47           H42        C  47  -1.821  27.238 -30.497
  500    H5     C  47           H5         C  47  -0.640  26.181 -32.315
  501    H6     C  47           H6         C  47  -0.683  24.333 -33.920
  502    H5'    C  48           H5'        C  48  -4.803  21.635 -37.463
  503   H5''    C  48          H5''        C  48  -5.497  22.548 -38.817
  504    H4'    C  48           H4'        C  48  -7.034  22.401 -36.812
  505    H3'    C  48           H3'        C  48  -5.924  24.986 -37.907
  506   HO3'    C  48          H3T         C  48  -7.972  25.093 -38.802
  507    H2'    C  48          H2''        C  48  -6.944  26.253 -36.284
  508   HO2'    C  48          H2'         C  48  -8.790  24.123 -35.872
  509    H1'    C  48           H1'        C  48  -7.086  24.223 -34.263
  510    H41    C  48           H41        C  48  -3.296  28.748 -31.909
  511    H42    C  48           H42        C  48  -2.121  28.484 -33.178
  512    H5     C  48           H5         C  48  -2.436  26.896 -34.959
  513    H6     C  48           H6         C  48  -3.977  25.276 -35.957
  Start of MODEL    2
    1    H5'    G   1           H5'        G   1  -6.525  33.040 -22.623
    2   H5''    G   1          H5''        G   1  -6.735  31.511 -21.746
    3    H4'    G   1           H4'        G   1  -8.644  31.940 -23.303
    4    H3'    G   1           H3'        G   1  -6.731  29.634 -23.554
    5    H2'    G   1          H2''        G   1  -7.463  28.988 -25.654
    6   HO2'    G   1          H2'         G   1  -9.938  30.200 -24.958
    7    H1'    G   1           H1'        G   1  -8.517  31.415 -26.602
    8    H8     G   1           H8         G   1  -5.037  32.295 -26.031
    9    H1     G   1           H1         G   1  -5.490  27.939 -30.716
   10    H21    G   1           H21        G   1  -7.498  27.022 -30.710
   11    H22    G   1           H22        G   1  -8.689  27.383 -29.482
   12   HO5'    G   1          H5T         G   1  -4.731  31.324 -22.447
   13    H5'    G   2           H5'        G   2 -10.488  26.692 -22.019
   14   H5''    G   2          H5''        G   2  -9.301  25.508 -21.438
   15    H4'    G   2           H4'        G   2 -10.980  24.882 -23.416
   16    H3'    G   2           H3'        G   2  -8.123  24.229 -22.819
   17    H2'    G   2          H2''        G   2  -7.538  23.561 -24.930
   18   HO2'    G   2          H2'         G   2 -10.279  22.914 -25.308
   19    H1'    G   2           H1'        G   2  -9.391  24.946 -26.505
   20    H8     G   2           H8         G   2  -7.420  27.274 -24.264
   21    H1     G   2           H1         G   2  -4.133  25.277 -29.391
   22    H21    G   2           H21        G   2  -5.237  23.659 -30.410
   23    H22    G   2           H22        G   2  -6.683  22.945 -29.733
   24    H5'    C   3           H5'        C   3  -9.938  19.983 -24.625
   25   H5''    C   3          H5''        C   3  -9.025  18.981 -23.480
   26    H4'    C   3           H4'        C   3  -8.762  18.376 -25.966
   27    H3'    C   3           H3'        C   3  -6.603  18.929 -23.944
   28    H2'    C   3          H2''        C   3  -4.889  18.920 -25.490
   29   HO2'    C   3          H2'         C   3  -4.843  17.607 -27.213
   30    H1'    C   3           H1'        C   3  -6.300  19.716 -27.793
   31    H41    C   3           H41        C   3  -2.236  24.361 -26.141
   32    H42    C   3           H42        C   3  -3.400  24.961 -24.984
   33    H5     C   3           H5         C   3  -5.374  23.738 -24.355
   34    H6     C   3           H6         C   3  -6.797  21.816 -24.887
   35    H5'    U   4           H5'        U   4  -4.918  15.367 -26.051
   36   H5''    U   4          H5''        U   4  -3.805  14.683 -24.851
   37    H4'    U   4           H4'        U   4  -2.857  15.821 -27.063
   38    H3'    U   4           H3'        U   4  -1.940  15.831 -24.201
   39    H2'    U   4          H2''        U   4  -0.452  17.551 -24.466
   40   HO2'    U   4          H2'         U   4   0.981  17.404 -25.983
   41    H1'    U   4           H1'        U   4  -1.510  18.763 -26.819
   42    H3     U   4           H3         U   4  -0.512  22.127 -23.930
   43    H5     U   4           H5         U   4  -3.839  20.219 -22.187
   44    H6     U   4           H6         U   4  -3.697  18.528 -23.919
   45    H5'    U   5           H5'        U   5   1.708  15.273 -27.062
   46   H5''    U   5          H5''        U   5   2.707  14.068 -26.227
   47    H4'    U   5           H4'        U   5   4.031  16.068 -26.959
   48    H3'    U   5           H3'        U   5   3.686  15.145 -24.128
   49    H2'    U   5          H2''        U   5   4.545  17.037 -23.152
   50   HO2'    U   5          H2'         U   5   6.059  17.371 -25.538
   51    H1'    U   5           H1'        U   5   4.168  18.914 -25.253
   52    H3     U   5           H3         U   5   2.446  21.100 -21.706
   53    H5     U   5           H5         U   5  -0.045  17.724 -22.072
   54    H6     U   5           H6         U   5   1.410  16.922 -23.841
   55    H5'    G   6           H5'        G   6   7.433  14.830 -21.464
   56   H5''    G   6          H5''        G   6   5.920  15.663 -21.880
   57    H4'    G   6           H4'        G   6   8.516  17.127 -22.338
   58    H3'    G   6           H3'        G   6   7.424  16.162 -19.728
   59    H2'    G   6          H2''        G   6   7.106  18.221 -18.780
   60   HO2'    G   6          H2'         G   6   9.245  19.120 -20.428
   61    H1'    G   6           H1'        G   6   6.982  19.871 -21.079
   62    H8     G   6           H8         G   6   4.256  17.239 -21.000
   63    H1     G   6           H1         G   6   3.101  22.216 -17.124
   64    H21    G   6           H21        G   6   4.923  23.436 -16.892
   65    H22    G   6           H22        G   6   6.374  23.136 -17.822
   66    H5'    A   7           H5'        A   7  11.533  18.621 -19.229
   67   H5''    A   7          H5''        A   7  12.381  17.662 -17.999
   68    H4'    A   7           H4'        A   7  12.561  20.096 -17.519
   69    H3'    A   7           H3'        A   7  11.136  18.130 -15.764
   70    H2'    A   7          H2''        A   7  10.163  19.703 -14.397
   71   HO2'    A   7          H2'         A   7  11.279  21.313 -13.628
   72    H1'    A   7           H1'        A   7  10.087  21.915 -16.146
   73    H8     A   7           H8         A   7   8.340  18.652 -17.218
   74    H61    A   7           H61        A   7   3.428  20.760 -14.112
   75    H62    A   7           H62        A   7   3.995  19.585 -15.278
   76    H2     A   7           H2         A   7   6.845  23.575 -13.390
   77    H5'    U   8           H5'        U   8  13.756  21.155 -13.505
   78   H5''    U   8          H5''        U   8  14.585  20.270 -12.209
   79    H4'    U   8           H4'        U   8  13.618  22.405 -11.371
   80    H3'    U   8           H3'        U   8  12.766  19.683 -10.448
   81    H2'    U   8          H2''        U   8  10.898  20.389  -9.326
   82   HO2'    U   8          H2'         U   8  12.430  22.710  -8.862
   83    H1'    U   8           H1'        U   8  10.420  22.872 -10.615
   84    H3     U   8           H3         U   8   6.336  20.965 -10.767
   85    H5     U   8           H5         U   8   8.728  18.326 -13.017
   86    H6     U   8           H6         U   8  10.667  19.635 -12.368
   87    H5'    U   9           H5'        U   9  13.648  22.222  -6.446
   88   H5''    U   9          H5''        U   9  14.032  20.911  -5.312
   89    H4'    U   9           H4'        U   9  12.081  22.510  -4.677
   90    H3'    U   9           H3'        U   9  12.247  19.517  -4.647
   91    H2'    U   9          H2''        U   9   9.997  19.146  -4.424
   92   HO2'    U   9          H2'         U   9   9.069  20.067  -2.797
   93    H1'    U   9           H1'        U   9   8.957  21.592  -5.412
   94    H3     U   9           H3         U   9   6.541  18.453  -7.564
   95    H5     U   9           H5         U   9  10.458  17.810  -8.973
   96    H6     U   9           H6         U   9  11.228  19.491  -7.402
   97    H5'    G  10           H5'        G  10  10.081  21.071  -0.897
   98   H5''    G  10          H5''        G  10  10.886  20.246   0.452
   99    H4'    G  10           H4'        G  10   8.412  20.206   0.717
  100    H3'    G  10           H3'        G  10  10.077  17.735   0.290
  101    H2'    G  10          H2''        G  10   8.243  16.311   0.168
  102   HO2'    G  10          H2'         G  10   6.763  18.402   1.407
  103    H1'    G  10           H1'        G  10   6.463  17.964  -1.148
  104    H8     G  10           H8         G  10   9.861  18.190  -2.780
  105    H1     G  10           H1         G  10   6.762  12.755  -4.180
  106    H21    G  10           H21        G  10   5.022  12.512  -2.846
  107    H22    G  10           H22        G  10   4.523  13.757  -1.722
  108    H5'    U  11           H5'        U  11   7.673  16.899   4.333
  109   H5''    U  11          H5''        U  11   8.636  15.603   5.068
  110    H4'    U  11           H4'        U  11   6.095  15.176   4.404
  111    H3'    U  11           H3'        U  11   8.570  13.474   4.191
  112    H2'    U  11          H2''        U  11   7.526  11.802   2.960
  113   HO2'    U  11          H2'         U  11   5.770  11.327   4.152
  114    H1'    U  11           H1'        U  11   5.727  13.341   1.502
  115    H3     U  11           H3         U  11   8.597  11.133  -1.330
  116    H5     U  11           H5         U  11  10.660  14.593  -0.093
  117    H6     U  11           H6         U  11   8.907  14.979   1.534
  118    H5'    A  12           H5'        A  12   6.429  10.444   6.785
  119   H5''    A  12          H5''        A  12   7.814   9.443   7.258
  120    H4'    A  12           H4'        A  12   6.109   8.612   5.379
  121    H3'    A  12           H3'        A  12   9.110   8.407   5.635
  122    H2'    A  12          H2''        A  12   9.366   7.508   3.512
  123   HO2'    A  12          H2'         A  12   6.645   6.739   3.756
  124    H1'    A  12           H1'        A  12   7.222   8.758   2.227
  125    H8     A  12           H8         A  12   9.328  11.397   3.893
  126    H61    A  12           H61        A  12  13.337  10.788  -0.770
  127    H62    A  12           H62        A  12  12.917  11.706   0.659
  128    H2     A  12           H2         A  12  10.363   7.446  -1.053
  129    H5'    U  13           H5'        U  13   8.199   4.983   3.781
  130   H5''    U  13          H5''        U  13   8.790   3.587   4.704
  131    H4'    U  13           H4'        U  13   9.687   3.305   2.505
  132    H3'    U  13           H3'        U  13  11.581   4.475   4.553
  133    H2'    U  13          H2''        U  13  13.296   4.667   2.982
  134   HO2'    U  13          H2'         U  13  13.584   3.186   1.524
  135    H1'    U  13           H1'        U  13  11.743   5.358   0.775
  136    H3     U  13           H3         U  13  14.244   9.063   1.408
  137    H5     U  13           H5         U  13  11.886   8.873   4.877
  138    H6     U  13           H6         U  13  11.019   6.753   4.110
  139    H5'    G  14           H5'        G  14  13.943   1.011   3.392
  140   H5''    G  14          H5''        G  14  15.259   0.904   4.575
  141    H4'    G  14           H4'        G  14  15.663   1.921   2.128
  142    H3'    G  14           H3'        G  14  16.744   2.694   4.846
  143    H2'    G  14          H2''        G  14  17.760   4.585   4.018
  144   HO2'    G  14          H2'         G  14  17.873   3.252   1.506
  145    H1'    G  14           H1'        G  14  16.145   4.904   1.662
  146    H8     G  14           H8         G  14  14.165   5.529   4.795
  147    H1     G  14           H1         G  14  18.026  10.387   3.149
  148    H21    G  14           H21        G  14  19.421   9.740   1.572
  149    H22    G  14           H22        G  14  19.533   8.074   1.053
  150    H5'    U  15           H5'        U  15  20.096   2.551   1.724
  151   H5''    U  15          H5''        U  15  21.282   1.473   2.485
  152    H4'    U  15           H4'        U  15  22.534   3.317   1.569
  153    H3'    U  15           H3'        U  15  22.067   3.231   4.540
  154    H2'    U  15          H2''        U  15  22.941   5.335   4.927
  155   HO2'    U  15          H2'         U  15  24.631   6.109   3.875
  156    H1'    U  15           H1'        U  15  22.335   6.574   2.490
  157    H3     U  15           H3         U  15  20.280   9.225   5.510
  158    H5     U  15           H5         U  15  18.221   5.569   5.862
  159    H6     U  15           H6         U  15  19.806   4.599   4.301
  160    H5'    G  16           H5'        G  16  26.705   4.202   4.347
  161   H5''    G  16          H5''        G  16  27.115   3.712   6.002
  162    H4'    G  16           H4'        G  16  27.351   6.255   5.254
  163    H3'    G  16           H3'        G  16  26.340   4.992   7.804
  164    H2'    G  16          H2''        G  16  25.572   6.977   8.646
  165   HO2'    G  16          H2'         G  16  26.988   8.506   8.787
  166    H1'    G  16           H1'        G  16  25.333   8.436   6.189
  167    H8     G  16           H8         G  16  23.025   5.431   6.832
  168    H1     G  16           H1         G  16  21.019  10.957   9.390
  169    H21    G  16           H21        G  16  22.585  12.498   9.175
  170    H22    G  16           H22        G  16  24.183  12.122   8.572
  171    H5'    U  17           H5'        U  17  29.949   8.179   9.347
  172   H5''    U  17          H5''        U  17  30.041   7.445  10.959
  173    H4'    U  17           H4'        U  17  29.447  10.029  10.683
  174    H3'    U  17           H3'        U  17  28.415   7.891  12.538
  175    H2'    U  17          H2''        U  17  26.669   9.154  13.304
  176   HO2'    U  17          H2'         U  17  26.790  11.433  13.464
  177    H1'    U  17           H1'        U  17  26.472  11.031  11.156
  178    H3     U  17           H3         U  17  22.277   9.788  12.416
  179    H5     U  17           H5         U  17  23.821   6.428  10.391
  180    H6     U  17           H6         U  17  25.975   7.544  10.328
  181    H5'    A  18           H5'        A  18  29.958  11.971  15.142
  182   H5''    A  18          H5''        A  18  30.089  11.158  16.713
  183    H4'    A  18           H4'        A  18  28.752  13.361  16.678
  184    H3'    A  18           H3'        A  18  27.745  10.684  17.672
  185    H2'    A  18          H2''        A  18  25.730  11.669  18.373
  186   HO2'    A  18          H2'         A  18  27.020  14.184  18.004
  187    H1'    A  18           H1'        A  18  25.414  13.350  16.178
  188    H8     A  18           H8         A  18  26.501   9.981  14.932
  189    H61    A  18           H61        A  18  20.663   8.117  15.696
  190    H62    A  18           H62        A  18  22.253   7.665  15.123
  191    H2     A  18           H2         A  18  21.126  12.100  17.714
  192    H5'    A  19           H5'        A  19  26.826  13.307  20.632
  193   H5''    A  19          H5''        A  19  27.453  12.828  22.222
  194    H4'    A  19           H4'        A  19  25.079  13.330  22.461
  195    H3'    A  19           H3'        A  19  26.074  10.497  22.607
  196    H2'    A  19          H2''        A  19  23.990   9.542  22.562
  197   HO2'    A  19          H2'         A  19  22.629  10.217  23.992
  198    H1'    A  19           H1'        A  19  22.522  11.610  21.297
  199    H8     A  19           H8         A  19  25.471   9.996  19.414
  200    H61    A  19           H61        A  19  21.391   5.765  17.501
  201    H62    A  19           H62        A  19  22.981   6.446  17.247
  202    H2     A  19           H2         A  19  19.381   8.352  20.564
  203    H5'    A  20           H5'        A  20  23.129  11.038  26.256
  204   H5''    A  20          H5''        A  20  23.848   9.924  27.435
  205    H4'    A  20           H4'        A  20  21.402   9.475  26.936
  206    H3'    A  20           H3'        A  20  23.661   7.513  26.530
  207    H2'    A  20          H2''        A  20  22.259   5.894  25.633
  208   HO2'    A  20          H2'         A  20  20.342   5.539  26.422
  209    H1'    A  20           H1'        A  20  20.393   7.566  24.385
  210    H8     A  20           H8         A  20  24.216   7.992  23.817
  211    H61    A  20           H61        A  20  23.434   4.184  19.013
  212    H62    A  20           H62        A  20  24.564   5.200  19.877
  213    H2     A  20           H2         A  20  19.537   4.464  21.214
  214    H5'    U  21           H5'        U  21  20.912   4.759  28.705
  215   H5''    U  21          H5''        U  21  22.074   3.550  29.285
  216    H4'    U  21           H4'        U  21  20.362   2.951  27.333
  217    H3'    U  21           H3'        U  21  23.268   2.261  27.766
  218    H2'    U  21          H2''        U  21  23.538   1.410  25.615
  219   HO2'    U  21          H2'         U  21  22.167  -0.004  24.900
  220    H1'    U  21           H1'        U  21  21.397   2.710  24.322
  221    H3     U  21           H3         U  21  25.163   3.013  21.721
  222    H5     U  21           H5         U  21  26.003   5.435  25.066
  223    H6     U  21           H6         U  21  23.841   4.832  25.962
  224    H5'    U  22           H5'        U  22  20.963  -1.308  26.418
  225   H5''    U  22          H5''        U  22  21.407  -2.691  27.439
  226    H4'    U  22           H4'        U  22  21.481  -3.265  25.004
  227    H3'    U  22           H3'        U  22  23.773  -3.350  26.918
  228    H2'    U  22          H2''        U  22  25.455  -3.215  25.402
  229   HO2'    U  22          H2'         U  22  25.431  -4.464  23.510
  230    H1'    U  22           H1'        U  22  23.934  -2.628  23.013
  231    H3     U  22           H3         U  22  27.419   0.040  22.090
  232    H5     U  22           H5         U  22  26.357   1.208  25.998
  233    H6     U  22           H6         U  22  24.665  -0.527  25.988
  234    H5'    A  23           H5'        A  23  26.109  -5.268  26.946
  235   H5''    A  23          H5''        A  23  25.465  -5.426  25.304
  236    H4'    A  23           H4'        A  23  27.860  -6.577  26.353
  237    H3'    A  23           H3'        A  23  26.309  -6.381  23.771
  238    H2'    A  23          H2''        A  23  27.291  -8.439  22.859
  239   HO2'    A  23          H2'         A  23  29.399  -8.108  23.423
  240    H1'    A  23           H1'        A  23  27.007  -9.976  24.858
  241    H8     A  23           H8         A  23  24.072  -8.073  25.851
  242    H61    A  23           H61        A  23  21.064 -10.796  21.187
  243    H62    A  23           H62        A  23  20.899  -9.866  22.659
  244    H2     A  23           H2         A  23  25.459 -11.408  20.557
  245    H5'    A  24           H5'        A  24  29.101  -4.906  21.098
  246   H5''    A  24          H5''        A  24  27.847  -4.023  20.209
  247    H4'    A  24           H4'        A  24  28.442  -6.787  20.016
  248    H3'    A  24           H3'        A  24  26.404  -4.808  19.084
  249    H2'    A  24          H2''        A  24  24.708  -6.324  18.804
  250   HO2'    A  24          H2'         A  24  26.661  -8.294  18.147
  251    H1'    A  24           H1'        A  24  25.833  -8.533  20.315
  252    H8     A  24           H8         A  24  24.807  -5.917  22.625
  253    H61    A  24           H61        A  24  18.903  -7.542  21.798
  254    H62    A  24           H62        A  24  20.002  -6.542  22.722
  255    H2     A  24           H2         A  24  21.344  -9.424  18.537
  256    H5'    U  25           H5'        U  25  26.143  -2.715  16.310
  257   H5''    U  25          H5''        U  25  25.789  -4.212  17.191
  258    H4'    U  25           H4'        U  25  24.838  -3.357  14.573
  259    H3'    U  25           H3'        U  25  23.853  -4.613  16.797
  260    H2'    U  25          H2''        U  25  24.907  -6.703  16.560
  261   HO2'    U  25          H2'         U  25  23.459  -8.122  15.460
  262    H1'    U  25           H1'        U  25  24.568  -6.692  13.589
  263    H3     U  25           H3         U  25  27.429 -10.057  12.862
  264    H5     U  25           H5         U  25  28.645  -8.621  16.631
  265    H6     U  25           H6         U  25  26.931  -6.913  16.467
  266    H5'    U  26           H5'        U  26  22.912  -5.466  18.383
  267   H5''    U  26          H5''        U  26  21.413  -6.085  17.662
  268    H4'    U  26           H4'        U  26  20.611  -5.690  19.824
  269    H3'    U  26           H3'        U  26  20.387  -3.333  18.037
  270    H2'    U  26          H2''        U  26  20.432  -1.663  19.589
  271   HO2'    U  26          H2'         U  26  18.588  -2.242  20.675
  272    H1'    U  26           H1'        U  26  21.671  -2.846  21.770
  273    H3     U  26           H3         U  26  24.266   0.754  21.062
  274    H5     U  26           H5         U  26  24.963  -1.621  17.656
  275    H6     U  26           H6         U  26  23.261  -3.148  18.430
  276    H5'    C  27           H5'        C  27  15.511  -3.262  19.202
  277   H5''    C  27          H5''        C  27  15.201  -2.023  17.970
  278    H4'    C  27           H4'        C  27  14.969  -1.491  20.615
  279    H3'    C  27           H3'        C  27  16.159   0.149  18.329
  280    H2'    C  27          H2''        C  27  16.658   1.902  19.801
  281   HO2'    C  27          H2'         C  27  14.661   0.784  21.497
  282    H1'    C  27           H1'        C  27  17.044   0.301  22.083
  283    H41    C  27           H41        C  27  22.803   2.509  20.510
  284    H42    C  27           H42        C  27  22.680   1.836  18.901
  285    H5     C  27           H5         C  27  20.797   0.531  18.164
  286    H6     C  27           H6         C  27  18.533  -0.221  18.723
  287    H5'    U  28           H5'        U  28  12.094   2.638  18.968
  288   H5''    U  28          H5''        U  28  12.186   3.836  17.660
  289    H4'    U  28           H4'        U  28  12.523   4.567  20.216
  290    H3'    U  28           H3'        U  28  14.001   5.375  17.696
  291    H2'    U  28          H2''        U  28  15.380   6.821  18.892
  292   HO2'    U  28          H2'         U  28  14.856   7.730  20.783
  293    H1'    U  28           H1'        U  28  15.724   5.197  21.120
  294    H3     U  28           H3         U  28  19.626   5.956  18.784
  295    H5     U  28           H5         U  28  17.700   2.783  16.800
  296    H6     U  28           H6         U  28  15.766   3.154  18.202
  297    H5'    U  29           H5'        U  29  12.501   9.233  19.924
  298   H5''    U  29          H5''        U  29  11.884  10.212  18.579
  299    H4'    U  29           H4'        U  29  13.345  11.535  20.123
  300    H3'    U  29           H3'        U  29  13.951  11.025  17.218
  301    H2'    U  29          H2''        U  29  16.049  12.012  17.300
  302   HO2'    U  29          H2'         U  29  15.177  13.297  19.684
  303    H1'    U  29           H1'        U  29  16.801  11.343  19.882
  304    H3     U  29           H3         U  29  19.759   9.462  16.951
  305    H5     U  29           H5         U  29  16.362   6.980  16.784
  306    H6     U  29           H6         U  29  15.202   8.589  18.182
  307    H5'    A  30           H5'        A  30  14.516  15.723  17.213
  308   H5''    A  30          H5''        A  30  14.456  15.925  15.453
  309    H4'    A  30           H4'        A  30  16.710  16.388  16.811
  310    H3'    A  30           H3'        A  30  16.288  14.976  14.158
  311    H2'    A  30          H2''        A  30  18.604  14.744  13.915
  312   HO2'    A  30          H2'         A  30  19.258  16.826  14.451
  313    H1'    A  30           H1'        A  30  19.147  14.179  16.593
  314    H8     A  30           H8         A  30  16.204  12.091  15.452
  315    H61    A  30           H61        A  30  20.277   8.442  12.577
  316    H62    A  30           H62        A  30  18.628   8.597  13.141
  317    H2     A  30           H2         A  30  22.387  12.217  13.769
  318    H5'    C  31           H5'        C  31  18.734  19.006  12.936
  319   H5''    C  31          H5''        C  31  18.428  19.009  11.188
  320    H4'    C  31           H4'        C  31  20.918  18.883  12.117
  321    H3'    C  31           H3'        C  31  19.533  17.526   9.812
  322    H2'    C  31          H2''        C  31  21.317  16.102   9.364
  323   HO2'    C  31          H2'         C  31  22.939  17.957  10.786
  324    H1'    C  31           H1'        C  31  22.335  15.776  11.924
  325    H41    C  31           H41        C  31  19.325  10.435  10.085
  326    H42    C  31           H42        C  31  17.812  11.095  10.667
  327    H5     C  31           H5         C  31  17.637  13.279  11.673
  328    H6     C  31           H6         C  31  18.801  15.390  12.101
  329    H5'    A  32           H5'        A  32  23.113  19.000   7.685
  330   H5''    A  32          H5''        A  32  22.480  19.835   6.253
  331    H4'    A  32           H4'        A  32  24.058  18.117   5.519
  332    H3'    A  32           H3'        A  32  21.098  17.742   5.080
  333    H2'    A  32          H2''        A  32  21.351  15.618   4.205
  334   HO2'    A  32          H2'         A  32  24.040  16.363   3.652
  335    H1'    A  32           H1'        A  32  23.644  14.824   5.614
  336    H8     A  32           H8         A  32  20.613  16.118   7.622
  337    H61    A  32           H61        A  32  18.537  10.298   7.351
  338    H62    A  32           H62        A  32  18.293  11.881   8.054
  339    H2     A  32           H2         A  32  22.209  10.592   4.793
  340    H5'    C  33           H5'        C  33  23.463  17.339   0.657
  341   H5''    C  33          H5''        C  33  22.021  17.270  -0.373
  342    H4'    C  33           H4'        C  33  23.802  15.279  -0.387
  343    H3'    C  33           H3'        C  33  20.775  15.198  -0.393
  344    H2'    C  33          H2''        C  33  20.836  12.842  -0.593
  345   HO2'    C  33          H2'         C  33  22.400  11.862  -1.597
  346    H1'    C  33           H1'        C  33  22.838  12.458   1.274
  347    H41    C  33           H41        C  33  17.209  11.681   4.185
  348    H42    C  33           H42        C  33  17.118  13.403   4.468
  349    H5     C  33           H5         C  33  18.845  14.939   3.770
  350    H6     C  33           H6         C  33  20.859  15.203   2.400
  351    H5'    A  34           H5'        A  34  22.151  12.939  -3.362
  352   H5''    A  34          H5''        A  34  21.736  13.336  -5.043
  353    H4'    A  34           H4'        A  34  21.447  10.955  -4.840
  354    H3'    A  34           H3'        A  34  19.083  12.762  -4.967
  355    H2'    A  34          H2''        A  34  17.516  11.300  -4.155
  356   HO2'    A  34          H2'         A  34  17.677   9.043  -4.502
  357    H1'    A  34           H1'        A  34  19.119   9.479  -2.727
  358    H8     A  34           H8         A  34  19.293  13.207  -1.761
  359    H61    A  34           H61        A  34  14.850  11.848   2.311
  360    H62    A  34           H62        A  34  16.078  13.010   1.860
  361    H2     A  34           H2         A  34  15.464   8.273  -0.325
  362    H5'    C  35           H5'        C  35  16.579  11.875  -8.566
  363   H5''    C  35          H5''        C  35  15.771  13.228  -7.749
  364    H4'    C  35           H4'        C  35  15.779  10.316  -7.061
  365    H3'    C  35           H3'        C  35  13.936  12.319  -7.746
  366    H2'    C  35          H2''        C  35  13.768  13.467  -5.768
  367   HO2'    C  35          H2'         C  35  11.805  12.313  -5.808
  368    H1'    C  35           H1'        C  35  14.418  11.139  -4.004
  369    H41    C  35           H41        C  35  15.540  16.250  -0.345
  370    H42    C  35           H42        C  35  17.020  16.541  -1.231
  371    H5     C  35           H5         C  35  17.620  15.335  -3.228
  372    H6     C  35           H6         C  35  16.980  13.535  -4.755
  373    H5'    U  36           H5'        U  36  15.399   7.262  -8.557
  374   H5''    U  36          H5''        U  36  13.967   7.198  -9.606
  375    H4'    U  36           H4'        U  36  14.242   4.954  -8.817
  376    H3'    U  36           H3'        U  36  12.126   6.691  -7.649
  377    H2'    U  36          H2''        U  36  11.685   5.437  -5.756
  378   HO2'    U  36          H2'         U  36  11.998   3.241  -5.644
  379    H1'    U  36           H1'        U  36  14.153   4.359  -5.198
  380    H3     U  36           H3         U  36  12.095   7.731  -2.419
  381    H5     U  36           H5         U  36  15.588   9.214  -4.246
  382    H6     U  36           H6         U  36  15.626   7.224  -5.635
  383    H5'    A  37           H5'        A  37   8.502   3.885  -9.073
  384   H5''    A  37          H5''        A  37   7.578   5.371  -9.370
  385    H4'    A  37           H4'        A  37   6.891   3.704  -7.397
  386    H3'    A  37           H3'        A  37   6.938   6.716  -7.593
  387    H2'    A  37          H2''        A  37   6.347   7.005  -5.355
  388   HO2'    A  37          H2'         A  37   5.663   4.239  -5.288
  389    H1'    A  37           H1'        A  37   7.855   4.975  -4.264
  390    H8     A  37           H8         A  37  10.184   6.508  -6.716
  391    H61    A  37           H61        A  37  10.776  11.352  -2.952
  392    H62    A  37           H62        A  37  11.537  10.413  -4.217
  393    H2     A  37           H2         A  37   7.192   9.002  -1.625
  394    H5'    C  38           H5'        C  38   2.658   5.538  -7.029
  395   H5''    C  38          H5''        C  38   1.493   6.582  -7.866
  396    H4'    C  38           H4'        C  38   1.210   6.592  -5.364
  397    H3'    C  38           H3'        C  38   1.834   8.989  -7.066
  398    H2'    C  38          H2''        C  38   2.154  10.420  -5.270
  399   HO2'    C  38          H2'         C  38   0.283  10.124  -4.155
  400    H1'    C  38           H1'        C  38   3.191   8.627  -3.402
  401    H41    C  38           H41        C  38   7.986  12.248  -5.601
  402    H42    C  38           H42        C  38   8.197  11.138  -6.936
  403    H5     C  38           H5         C  38   6.816   9.195  -7.256
  404    H6     C  38           H6         C  38   4.810   8.012  -6.504
  405    H5'    A  39           H5'        A  39  -2.330  10.627  -5.917
  406   H5''    A  39          H5''        A  39  -2.488  11.830  -7.211
  407    H4'    A  39           H4'        A  39  -1.863  12.549  -4.690
  408    H3'    A  39           H3'        A  39  -0.826  13.534  -7.377
  409    H2'    A  39          H2''        A  39   0.684  14.975  -6.316
  410   HO2'    A  39          H2'         A  39  -1.084  14.877  -4.087
  411    H1'    A  39           H1'        A  39   0.972  13.507  -3.923
  412    H8     A  39           H8         A  39   2.014  11.499  -6.942
  413    H61    A  39           H61        A  39   7.268  14.751  -7.023
  414    H62    A  39           H62        A  39   6.468  13.299  -7.579
  415    H2     A  39           H2         A  39   4.501  16.664  -4.057
  416    H5'    A  40           H5'        A  40  -2.986  16.377  -4.804
  417   H5''    A  40          H5''        A  40  -4.063  17.575  -5.552
  418    H4'    A  40           H4'        A  40  -2.740  18.677  -3.802
  419    H3'    A  40           H3'        A  40  -2.370  19.231  -6.726
  420    H2'    A  40          H2''        A  40  -0.335  20.270  -6.579
  421   HO2'    A  40          H2'         A  40  -1.180  21.077  -3.989
  422    H1'    A  40           H1'        A  40   0.615  19.302  -4.110
  423    H8     A  40           H8         A  40  -0.277  16.787  -6.898
  424    H61    A  40           H61        A  40   5.653  17.223  -8.566
  425    H62    A  40           H62        A  40   4.170  16.312  -8.744
  426    H2     A  40           H2         A  40   4.875  20.282  -5.370
  427    H5'    A  41           H5'        A  41  -2.710  23.792  -5.287
  428   H5''    A  41          H5''        A  41  -3.022  24.497  -6.885
  429    H4'    A  41           H4'        A  41  -0.725  24.985  -5.571
  430    H3'    A  41           H3'        A  41  -1.199  24.342  -8.500
  431    H2'    A  41          H2''        A  41   1.073  24.734  -8.941
  432   HO2'    A  41          H2'         A  41   2.305  26.050  -7.788
  433    H1'    A  41           H1'        A  41   1.980  23.596  -6.518
  434    H8     A  41           H8         A  41  -0.547  21.437  -8.378
  435    H61    A  41           H61        A  41   4.259  19.244 -11.593
  436    H62    A  41           H62        A  41   2.581  18.997 -11.165
  437    H2     A  41           H2         A  41   5.714  22.659  -9.074
  438    H5'    U  42           H5'        U  42   1.120  28.007  -7.706
  439   H5''    U  42          H5''        U  42   0.603  29.329  -8.774
  440    H4'    U  42           H4'        U  42   3.087  29.170  -8.720
  441    H3'    U  42           H3'        U  42   1.482  28.369 -11.167
  442    H2'    U  42          H2''        U  42   3.368  27.767 -12.374
  443   HO2'    U  42          H2'         U  42   4.388  29.895 -11.636
  444    H1'    U  42           H1'        U  42   4.949  26.927 -10.200
  445    H3     U  42           H3         U  42   4.797  23.167 -12.681
  446    H5     U  42           H5         U  42   0.810  23.697 -11.445
  447    H6     U  42           H6         U  42   1.425  25.885 -10.622
  448    H5'    U  43           H5'        U  43   4.374  31.167 -13.181
  449   H5''    U  43          H5''        U  43   3.586  31.454 -14.745
  450    H4'    U  43           H4'        U  43   5.765  29.911 -14.573
  451    H3'    U  43           H3'        U  43   3.252  29.765 -16.226
  452    H2'    U  43          H2''        U  43   3.574  27.587 -16.910
  453   HO2'    U  43          H2'         U  43   6.369  27.946 -16.489
  454    H1'    U  43           H1'        U  43   5.312  26.674 -14.858
  455    H3     U  43           H3         U  43   2.183  23.424 -15.101
  456    H5     U  43           H5         U  43   0.012  26.794 -13.802
  457    H6     U  43           H6         U  43   2.022  28.120 -14.085
  458    H5'    A  44           H5'        A  44   7.394  30.343 -19.530
  459   H5''    A  44          H5''        A  44   6.300  30.506 -20.918
  460    H4'    A  44           H4'        A  44   8.384  28.850 -21.033
  461    H3'    A  44           H3'        A  44   5.577  28.714 -22.069
  462    H2'    A  44          H2''        A  44   5.574  26.462 -22.493
  463   HO2'    A  44          H2'         A  44   8.264  26.932 -23.092
  464    H1'    A  44           H1'        A  44   7.581  25.572 -20.720
  465    H8     A  44           H8         A  44   5.053  27.074 -18.532
  466    H61    A  44           H61        A  44   1.271  22.339 -19.753
  467    H62    A  44           H62        A  44   1.556  23.728 -18.728
  468    H2     A  44           H2         A  44   4.684  22.182 -22.657
  469    H5'    A  45           H5'        A  45   8.165  27.980 -26.368
  470   H5''    A  45          H5''        A  45   6.779  28.456 -27.369
  471    H4'    A  45           H4'        A  45   7.897  26.044 -27.645
  472    H3'    A  45           H3'        A  45   5.053  27.013 -27.738
  473    H2'    A  45          H2''        A  45   4.126  24.885 -27.771
  474   HO2'    A  45          H2'         A  45   5.330  24.070 -29.496
  475    H1'    A  45           H1'        A  45   5.995  23.534 -26.198
  476    H8     A  45           H8         A  45   5.100  26.610 -24.318
  477    H61    A  45           H61        A  45  -0.210  23.864 -22.745
  478    H62    A  45           H62        A  45   0.930  25.126 -22.336
  479    H2     A  45           H2         A  45   1.704  21.436 -25.995
  480    H5'    G  46           H5'        G  46   5.914  25.896 -32.513
  481   H5''    G  46          H5''        G  46   4.414  26.487 -33.256
  482    H4'    G  46           H4'        G  46   4.976  23.880 -33.240
  483    H3'    G  46           H3'        G  46   2.422  25.414 -32.812
  484    H2'    G  46          H2''        G  46   1.185  23.508 -32.260
  485   HO2'    G  46          H2'         G  46   3.338  22.038 -33.404
  486    H1'    G  46           H1'        G  46   3.091  22.212 -30.750
  487    H8     G  46           H8         G  46   3.404  25.746 -29.658
  488    H1     G  46           H1         G  46  -2.055  23.071 -27.626
  489    H21    G  46           H21        G  46  -2.381  21.140 -28.646
  490    H22    G  46           H22        G  46  -1.363  20.594 -29.959
  491    H5'    C  47           H5'        C  47   1.302  21.793 -34.528
  492   H5''    C  47          H5''        C  47   0.888  22.153 -36.218
  493    H4'    C  47           H4'        C  47  -0.773  20.586 -35.443
  494    H3'    C  47           H3'        C  47  -1.491  23.485 -35.696
  495    H2'    C  47          H2''        C  47  -3.591  23.275 -34.748
  496   HO2'    C  47          H2'         C  47  -3.324  20.495 -35.242
  497    H1'    C  47           H1'        C  47  -3.015  21.343 -32.814
  498    H41    C  47           H41        C  47  -2.575  26.519 -29.213
  499    H42    C  47           H42        C  47  -1.245  27.141 -30.162
  500    H5     C  47           H5         C  47  -0.295  25.946 -32.029
  501    H6     C  47           H6         C  47  -0.614  24.077 -33.577
  502    H5'    C  48           H5'        C  48  -5.178  21.657 -36.814
  503   H5''    C  48          H5''        C  48  -5.850  22.647 -38.126
  504    H4'    C  48           H4'        C  48  -7.289  22.601 -36.039
  505    H3'    C  48           H3'        C  48  -6.050  25.089 -37.210
  506   HO3'    C  48          H3T         C  48  -8.180  25.371 -37.924
  507    H2'    C  48          H2''        C  48  -6.878  26.439 -35.542
  508   HO2'    C  48          H2'         C  48  -8.853  24.446 -35.049
  509    H1'    C  48           H1'        C  48  -7.035  24.451 -33.490
  510    H41    C  48           H41        C  48  -2.714  28.655 -31.482
  511    H42    C  48           H42        C  48  -1.711  28.368 -32.886
  512    H5     C  48           H5         C  48  -2.252  26.737 -34.572
  513    H6     C  48           H6         C  48  -3.979  25.219 -35.415
  Start of MODEL    3
    1    H5'    G   1           H5'        G   1  -9.049  33.216 -23.522
    2   H5''    G   1          H5''        G   1  -9.082  31.670 -22.649
    3    H4'    G   1           H4'        G   1 -10.886  31.783 -24.375
    4    H3'    G   1           H3'        G   1  -8.614  29.820 -24.402
    5    H2'    G   1          H2''        G   1  -9.011  29.056 -26.554
    6   HO2'    G   1          H2'         G   1 -11.684  29.725 -25.960
    7    H1'    G   1           H1'        G   1 -10.284  31.281 -27.678
    8    H8     G   1           H8         G   1  -7.132  32.765 -26.684
    9    H1     G   1           H1         G   1  -6.141  28.311 -31.190
   10    H21    G   1           H21        G   1  -7.924  27.027 -31.397
   11    H22    G   1           H22        G   1  -9.334  27.206 -30.376
   12   HO5'    G   1          H5T         G   1  -7.178  31.241 -23.380
   13    H5'    G   2           H5'        G   2 -11.926  26.264 -23.259
   14   H5''    G   2          H5''        G   2 -10.622  25.328 -22.501
   15    H4'    G   2           H4'        G   2 -11.879  24.397 -24.667
   16    H3'    G   2           H3'        G   2  -9.059  24.290 -23.678
   17    H2'    G   2          H2''        G   2  -8.075  23.747 -25.673
   18   HO2'    G   2          H2'         G   2  -9.049  21.876 -26.174
   19    H1'    G   2           H1'        G   2  -9.912  24.771 -27.516
   20    H8     G   2           H8         G   2  -8.775  27.449 -25.108
   21    H1     G   2           H1         G   2  -4.400  26.016 -29.566
   22    H21    G   2           H21        G   2  -5.016  24.204 -30.669
   23    H22    G   2           H22        G   2  -6.397  23.244 -30.188
   24    H5'    C   3           H5'        C   3  -9.749  19.516 -25.430
   25   H5''    C   3          H5''        C   3  -8.587  18.946 -24.218
   26    H4'    C   3           H4'        C   3  -8.179  18.416 -26.780
   27    H3'    C   3           H3'        C   3  -6.313  19.256 -24.574
   28    H2'    C   3          H2''        C   3  -4.518  19.620 -25.979
   29   HO2'    C   3          H2'         C   3  -4.127  18.434 -27.762
   30    H1'    C   3           H1'        C   3  -5.884  20.254 -28.360
   31    H41    C   3           H41        C   3  -2.812  25.434 -26.195
   32    H42    C   3           H42        C   3  -4.210  25.830 -25.222
   33    H5     C   3           H5         C   3  -6.031  24.299 -24.859
   34    H6     C   3           H6         C   3  -7.034  22.173 -25.551
   35    H5'    U   4           H5'        U   4  -3.969  16.156 -26.704
   36   H5''    U   4          H5''        U   4  -2.859  15.500 -25.485
   37    H4'    U   4           H4'        U   4  -1.882  16.869 -27.520
   38    H3'    U   4           H3'        U   4  -1.220  16.879 -24.589
   39    H2'    U   4          H2''        U   4   0.052  18.782 -24.673
   40   HO2'    U   4          H2'         U   4   1.528  19.086 -26.176
   41    H1'    U   4           H1'        U   4  -0.950  19.930 -27.086
   42    H3     U   4           H3         U   4  -0.585  23.290 -24.047
   43    H5     U   4           H5         U   4  -3.843  20.994 -22.679
   44    H6     U   4           H6         U   4  -3.337  19.364 -24.405
   45    H5'    U   5           H5'        U   5   2.440  17.024 -27.252
   46   H5''    U   5          H5''        U   5   3.588  15.823 -26.627
   47    H4'    U   5           H4'        U   5   4.803  17.886 -27.126
   48    H3'    U   5           H3'        U   5   4.366  16.962 -24.305
   49    H2'    U   5          H2''        U   5   5.071  18.912 -23.317
   50   HO2'    U   5          H2'         U   5   7.152  18.731 -24.323
   51    H1'    U   5           H1'        U   5   4.693  20.730 -25.478
   52    H3     U   5           H3         U   5   2.724  22.922 -22.077
   53    H5     U   5           H5         U   5   0.416  19.421 -22.440
   54    H6     U   5           H6         U   5   1.980  18.643 -24.126
   55    H5'    G   6           H5'        G   6   7.873  16.771 -21.437
   56   H5''    G   6          H5''        G   6   6.413  17.586 -22.035
   57    H4'    G   6           H4'        G   6   9.022  19.051 -22.325
   58    H3'    G   6           H3'        G   6   7.785  18.133 -19.763
   59    H2'    G   6          H2''        G   6   7.416  20.213 -18.873
   60   HO2'    G   6          H2'         G   6   9.186  21.319 -18.710
   61    H1'    G   6           H1'        G   6   7.347  21.805 -21.202
   62    H8     G   6           H8         G   6   4.758  19.007 -21.122
   63    H1     G   6           H1         G   6   3.138  24.123 -17.616
   64    H21    G   6           H21        G   6   4.834  25.522 -17.478
   65    H22    G   6           H22        G   6   6.411  25.147 -18.136
   66    H5'    A   7           H5'        A   7  11.505  20.713 -18.928
   67   H5''    A   7          H5''        A   7  12.396  19.897 -17.627
   68    H4'    A   7           H4'        A   7  12.092  22.356 -17.202
   69    H3'    A   7           H3'        A   7  11.086  20.130 -15.468
   70    H2'    A   7          H2''        A   7   9.736  21.437 -14.149
   71   HO2'    A   7          H2'         A   7  11.452  23.613 -14.801
   72    H1'    A   7           H1'        A   7   9.261  23.615 -15.886
   73    H8     A   7           H8         A   7   8.243  20.086 -17.045
   74    H61    A   7           H61        A   7   2.873  21.161 -14.181
   75    H62    A   7           H62        A   7   3.754  20.076 -15.235
   76    H2     A   7           H2         A   7   5.654  24.550 -13.239
   77    H5'    U   8           H5'        U   8  12.662  23.483 -12.984
   78   H5''    U   8          H5''        U   8  13.746  22.787 -11.763
   79    H4'    U   8           H4'        U   8  12.220  24.368 -10.675
   80    H3'    U   8           H3'        U   8  12.039  21.407 -10.207
   81    H2'    U   8          H2''        U   8  10.039  21.487  -9.081
   82   HO2'    U   8          H2'         U   8   9.599  22.984  -7.612
   83    H1'    U   8           H1'        U   8   8.996  23.928 -10.081
   84    H3     U   8           H3         U   8   5.485  21.240 -10.874
   85    H5     U   8           H5         U   8   8.613  19.356 -12.978
   86    H6     U   8           H6         U   8  10.139  21.001 -12.049
   87    H5'    U   9           H5'        U   9  12.309  23.363  -5.844
   88   H5''    U   9          H5''        U   9  12.837  21.976  -4.870
   89    H4'    U   9           H4'        U   9  10.549  23.125  -4.288
   90    H3'    U   9           H3'        U   9  11.317  20.230  -4.518
   91    H2'    U   9          H2''        U   9   9.165  19.435  -4.469
   92   HO2'    U   9          H2'         U   9   8.058  20.024  -2.801
   93    H1'    U   9           H1'        U   9   7.760  21.750  -5.342
   94    H3     U   9           H3         U   9   6.048  18.405  -7.838
   95    H5     U   9           H5         U   9  10.075  18.580  -9.062
   96    H6     U   9           H6         U   9  10.456  20.252  -7.345
   97    H5'    G  10           H5'        G  10   8.805  21.150  -0.933
   98   H5''    G  10          H5''        G  10   9.569  20.438   0.503
   99    H4'    G  10           H4'        G  10   7.110  20.078   0.524
  100    H3'    G  10           H3'        G  10   9.099  17.829   0.272
  101    H2'    G  10          H2''        G  10   7.462  16.200   0.017
  102   HO2'    G  10          H2'         G  10   6.253  17.146   1.879
  103    H1'    G  10           H1'        G  10   5.588  17.667  -1.419
  104    H8     G  10           H8         G  10   9.000  18.193  -2.936
  105    H1     G  10           H1         G  10   6.553  12.410  -4.233
  106    H21    G  10           H21        G  10   4.769  12.046  -2.992
  107    H22    G  10           H22        G  10   4.156  13.229  -1.858
  108    H5'    U  11           H5'        U  11   6.747  16.237   3.598
  109   H5''    U  11          H5''        U  11   7.844  15.149   4.468
  110    H4'    U  11           H4'        U  11   5.820  14.162   3.051
  111    H3'    U  11           H3'        U  11   8.668  13.264   3.431
  112    H2'    U  11          H2''        U  11   8.583  11.687   1.768
  113   HO2'    U  11          H2'         U  11   6.857  10.545   2.737
  114    H1'    U  11           H1'        U  11   6.444  12.755   0.213
  115    H3     U  11           H3         U  11   9.976  11.408  -2.418
  116    H5     U  11           H5         U  11  11.029  15.211  -0.940
  117    H6     U  11           H6         U  11   9.104  15.103   0.532
  118    H5'    A  12           H5'        A  12   6.245   9.471   5.557
  119   H5''    A  12          H5''        A  12   7.675   8.650   6.214
  120    H4'    A  12           H4'        A  12   6.130   7.460   4.385
  121    H3'    A  12           H3'        A  12   9.122   7.514   4.797
  122    H2'    A  12          H2''        A  12   9.543   6.342   2.833
  123   HO2'    A  12          H2'         A  12   6.871   5.450   3.116
  124    H1'    A  12           H1'        A  12   7.460   7.331   1.273
  125    H8     A  12           H8         A  12   9.286  10.222   2.870
  126    H61    A  12           H61        A  12  13.734   9.405  -1.342
  127    H62    A  12           H62        A  12  13.041  10.514  -0.181
  128    H2     A  12           H2         A  12  10.886   5.954  -1.642
  129    H5'    U  13           H5'        U  13   8.490   3.926   3.285
  130   H5''    U  13          H5''        U  13   9.067   2.641   4.361
  131    H4'    U  13           H4'        U  13  10.055   2.181   2.226
  132    H3'    U  13           H3'        U  13  11.859   3.567   4.226
  133    H2'    U  13          H2''        U  13  13.632   3.564   2.708
  134   HO2'    U  13          H2'         U  13  13.943   1.785   1.651
  135    H1'    U  13           H1'        U  13  12.132   3.962   0.374
  136    H3     U  13           H3         U  13  14.829   7.593   0.562
  137    H5     U  13           H5         U  13  12.322   8.048   3.898
  138    H6     U  13           H6         U  13  11.360   5.886   3.411
  139    H5'    G  14           H5'        G  14  14.161  -0.082   3.644
  140   H5''    G  14          H5''        G  14  15.428  -0.077   4.886
  141    H4'    G  14           H4'        G  14  15.959   0.609   2.350
  142    H3'    G  14           H3'        G  14  16.962   1.696   4.989
  143    H2'    G  14          H2''        G  14  18.080   3.426   3.961
  144   HO2'    G  14          H2'         G  14  18.230   1.770   1.652
  145    H1'    G  14           H1'        G  14  16.558   3.481   1.521
  146    H8     G  14           H8         G  14  14.499   4.591   4.463
  147    H1     G  14           H1         G  14  18.611   9.040   2.338
  148    H21    G  14           H21        G  14  20.045   8.131   0.933
  149    H22    G  14           H22        G  14  20.114   6.405   0.659
  150    H5'    U  15           H5'        U  15  20.420   0.749   2.054
  151   H5''    U  15          H5''        U  15  21.546  -0.190   3.054
  152    H4'    U  15           H4'        U  15  22.843   1.406   1.747
  153    H3'    U  15           H3'        U  15  22.486   1.782   4.708
  154    H2'    U  15          H2''        U  15  23.435   3.884   4.765
  155   HO2'    U  15          H2'         U  15  24.771   3.112   2.381
  156    H1'    U  15           H1'        U  15  22.813   4.788   2.190
  157    H3     U  15           H3         U  15  20.963   7.909   4.881
  158    H5     U  15           H5         U  15  18.706   4.448   5.694
  159    H6     U  15           H6         U  15  20.218   3.204   4.261
  160    H5'    G  16           H5'        G  16  27.152   2.493   4.302
  161   H5''    G  16          H5''        G  16  27.574   2.210   6.002
  162    H4'    G  16           H4'        G  16  27.892   4.621   4.918
  163    H3'    G  16           H3'        G  16  26.905   3.737   7.627
  164    H2'    G  16          H2''        G  16  26.202   5.833   8.223
  165   HO2'    G  16          H2'         G  16  28.236   6.803   6.493
  166    H1'    G  16           H1'        G  16  25.938   6.982   5.613
  167    H8     G  16           H8         G  16  23.607   4.109   6.671
  168    H1     G  16           H1         G  16  21.702   9.940   8.535
  169    H21    G  16           H21        G  16  23.284  11.419   8.113
  170    H22    G  16           H22        G  16  24.870  10.952   7.542
  171    H5'    U  17           H5'        U  17  30.603   7.012   8.755
  172   H5''    U  17          H5''        U  17  30.706   6.410  10.420
  173    H4'    U  17           H4'        U  17  30.158   8.974   9.943
  174    H3'    U  17           H3'        U  17  29.116   7.014  11.979
  175    H2'    U  17          H2''        U  17  27.399   8.367  12.666
  176   HO2'    U  17          H2'         U  17  29.170  10.472  12.008
  177    H1'    U  17           H1'        U  17  27.194  10.061  10.373
  178    H3     U  17           H3         U  17  22.982   8.979  11.697
  179    H5     U  17           H5         U  17  24.505   5.431  10.005
  180    H6     U  17           H6         U  17  26.672   6.513   9.861
  181    H5'    A  18           H5'        A  18  30.926  11.131  14.617
  182   H5''    A  18          H5''        A  18  30.703  10.304  16.170
  183    H4'    A  18           H4'        A  18  29.595  12.687  15.746
  184    H3'    A  18           H3'        A  18  28.464  10.204  17.056
  185    H2'    A  18          H2''        A  18  26.459  11.331  17.541
  186   HO2'    A  18          H2'         A  18  26.358  13.681  17.089
  187    H1'    A  18           H1'        A  18  26.269  12.706  15.131
  188    H8     A  18           H8         A  18  27.295   9.178  14.362
  189    H61    A  18           H61        A  18  21.411   7.524  15.252
  190    H62    A  18           H62        A  18  23.003   6.977  14.779
  191    H2     A  18           H2         A  18  21.903  11.734  16.731
  192    H5'    A  19           H5'        A  19  27.544  13.203  19.485
  193   H5''    A  19          H5''        A  19  28.087  13.040  21.166
  194    H4'    A  19           H4'        A  19  25.728  13.606  21.216
  195    H3'    A  19           H3'        A  19  26.617  10.812  21.882
  196    H2'    A  19          H2''        A  19  24.501   9.931  21.909
  197   HO2'    A  19          H2'         A  19  23.931  12.353  23.055
  198    H1'    A  19           H1'        A  19  23.161  11.812  20.258
  199    H8     A  19           H8         A  19  26.072   9.806  18.745
  200    H61    A  19           H61        A  19  21.904   5.401  17.557
  201    H62    A  19           H62        A  19  23.491   6.017  17.158
  202    H2     A  19           H2         A  19  19.935   8.535  20.091
  203    H5'    A  20           H5'        A  20  23.596  12.123  25.256
  204   H5''    A  20          H5''        A  20  24.234  11.245  26.659
  205    H4'    A  20           H4'        A  20  21.789  10.796  26.214
  206    H3'    A  20           H3'        A  20  23.958   8.696  26.205
  207    H2'    A  20          H2''        A  20  22.498   7.006  25.570
  208   HO2'    A  20          H2'         A  20  20.409   8.670  26.555
  209    H1'    A  20           H1'        A  20  20.687   8.520  24.060
  210    H8     A  20           H8         A  20  24.504   8.662  23.368
  211    H61    A  20           H61        A  20  23.505   3.953  19.494
  212    H62    A  20           H62        A  20  24.650   5.171  20.013
  213    H2     A  20           H2         A  20  19.654   4.858  21.602
  214    H5'    U  21           H5'        U  21  21.168   6.561  28.927
  215   H5''    U  21          H5''        U  21  22.275   5.417  29.712
  216    H4'    U  21           H4'        U  21  20.511   4.570  27.897
  217    H3'    U  21           H3'        U  21  23.379   3.819  28.467
  218    H2'    U  21          H2''        U  21  23.624   2.605  26.496
  219   HO2'    U  21          H2'         U  21  22.223   1.060  26.362
  220    H1'    U  21           H1'        U  21  21.567   3.763  24.957
  221    H3     U  21           H3         U  21  25.357   3.537  22.401
  222    H5     U  21           H5         U  21  26.261   6.407  25.351
  223    H6     U  21           H6         U  21  24.075   6.014  26.310
  224    H5'    U  22           H5'        U  22  20.677   0.349  27.908
  225   H5''    U  22          H5''        U  22  20.890  -0.851  29.199
  226    H4'    U  22           H4'        U  22  20.731  -1.955  26.981
  227    H3'    U  22           H3'        U  22  23.027  -2.073  28.840
  228    H2'    U  22          H2''        U  22  24.706  -2.438  27.358
  229   HO2'    U  22          H2'         U  22  22.833  -4.117  26.044
  230    H1'    U  22           H1'        U  22  23.362  -2.049  24.850
  231    H3     U  22           H3         U  22  27.136   0.105  23.767
  232    H5     U  22           H5         U  22  26.038   1.928  27.403
  233    H6     U  22           H6         U  22  24.180   0.376  27.547
  234    H5'    A  23           H5'        A  23  25.057  -4.604  30.287
  235   H5''    A  23          H5''        A  23  25.355  -3.622  28.842
  236    H4'    A  23           H4'        A  23  27.278  -5.127  29.407
  237    H3'    A  23           H3'        A  23  25.736  -5.225  26.804
  238    H2'    A  23          H2''        A  23  26.899  -7.291  26.091
  239   HO2'    A  23          H2'         A  23  28.628  -6.647  28.244
  240    H1'    A  23           H1'        A  23  26.758  -8.645  28.224
  241    H8     A  23           H8         A  23  23.563  -7.080  28.966
  242    H61    A  23           H61        A  23  21.124 -10.343  24.318
  243    H62    A  23           H62        A  23  20.791  -9.497  25.812
  244    H2     A  23           H2         A  23  25.590 -10.464  23.910
  245    H5'    A  24           H5'        A  24  28.648  -3.183  24.171
  246   H5''    A  24          H5''        A  24  27.275  -2.656  23.180
  247    H4'    A  24           H4'        A  24  28.580  -5.188  23.113
  248    H3'    A  24           H3'        A  24  26.216  -3.784  21.918
  249    H2'    A  24          H2''        A  24  25.055  -5.714  21.443
  250   HO2'    A  24          H2'         A  24  27.494  -7.164  21.207
  251    H1'    A  24           H1'        A  24  26.477  -7.529  23.169
  252    H8     A  24           H8         A  24  24.450  -5.252  25.225
  253    H61    A  24           H61        A  24  19.328  -8.162  23.368
  254    H62    A  24           H62        A  24  19.981  -6.936  24.430
  255    H2     A  24           H2         A  24  22.711  -9.490  20.741
  256    H5'    U  25           H5'        U  25  25.228  -4.562  19.841
  257   H5''    U  25          H5''        U  25  26.303  -5.869  19.304
  258    H4'    U  25           H4'        U  25  24.748  -4.442  17.176
  259    H3'    U  25           H3'        U  25  23.394  -5.127  19.461
  260    H2'    U  25          H2''        U  25  23.874  -7.412  19.566
  261   HO2'    U  25          H2'         U  25  22.081  -8.416  18.991
  262    H1'    U  25           H1'        U  25  23.770  -7.775  16.603
  263    H3     U  25           H3         U  25  25.505 -11.883  16.919
  264    H5     U  25           H5         U  25  27.336  -9.878  20.141
  265    H6     U  25           H6         U  25  26.110  -7.884  19.514
  266    H5'    U  26           H5'        U  26  22.367  -5.498  21.085
  267   H5''    U  26          H5''        U  26  20.800  -6.017  20.430
  268    H4'    U  26           H4'        U  26  20.098  -5.240  22.524
  269    H3'    U  26           H3'        U  26  20.031  -3.204  20.368
  270    H2'    U  26          H2''        U  26  20.163  -1.303  21.628
  271   HO2'    U  26          H2'         U  26  19.079  -2.778  23.808
  272    H1'    U  26           H1'        U  26  21.444  -2.155  23.921
  273    H3     U  26           H3         U  26  24.160   1.080  22.346
  274    H5     U  26           H5         U  26  24.585  -2.009  19.517
  275    H6     U  26           H6         U  26  22.872  -3.247  20.685
  276    H5'    C  27           H5'        C  27  15.158  -2.664  21.314
  277   H5''    C  27          H5''        C  27  14.959  -1.644  19.876
  278    H4'    C  27           H4'        C  27  14.761  -0.653  22.400
  279    H3'    C  27           H3'        C  27  16.019   0.491  19.855
  280    H2'    C  27          H2''        C  27  16.681   2.434  21.011
  281   HO2'    C  27          H2'         C  27  14.701   3.041  21.860
  282    H1'    C  27           H1'        C  27  17.019   1.236  23.515
  283    H41    C  27           H41        C  27  22.821   2.711  21.325
  284    H42    C  27           H42        C  27  22.631   1.628  19.964
  285    H5     C  27           H5         C  27  20.594   0.439  19.504
  286    H6     C  27           H6         C  27  18.311  -0.012  20.267
  287    H5'    U  28           H5'        U  28  12.247   3.351  20.084
  288   H5''    U  28          H5''        U  28  12.348   4.257  18.562
  289    H4'    U  28           H4'        U  28  12.938   5.423  20.906
  290    H3'    U  28           H3'        U  28  14.296   5.595  18.199
  291    H2'    U  28          H2''        U  28  15.857   7.119  19.022
  292   HO2'    U  28          H2'         U  28  14.091   7.456  21.232
  293    H1'    U  28           H1'        U  28  16.202   5.909  21.514
  294    H3     U  28           H3         U  28  19.997   5.955  18.875
  295    H5     U  28           H5         U  28  17.797   2.563  17.709
  296    H6     U  28           H6         U  28  15.972   3.336  19.091
  297    H5'    U  29           H5'        U  29  13.515   9.680  19.721
  298   H5''    U  29          H5''        U  29  12.716  10.587  18.421
  299    H4'    U  29           H4'        U  29  14.493  11.967  19.409
  300    H3'    U  29           H3'        U  29  14.728  10.865  16.615
  301    H2'    U  29          H2''        U  29  16.894  11.620  16.321
  302   HO2'    U  29          H2'         U  29  17.238  13.616  16.834
  303    H1'    U  29           H1'        U  29  17.823  11.457  18.944
  304    H3     U  29           H3         U  29  20.544   8.875  16.368
  305    H5     U  29           H5         U  29  16.983   6.646  16.686
  306    H6     U  29           H6         U  29  15.969   8.553  17.793
  307    H5'    A  30           H5'        A  30  15.532  15.613  15.942
  308   H5''    A  30          H5''        A  30  15.452  15.594  14.171
  309    H4'    A  30           H4'        A  30  17.719  16.236  15.437
  310    H3'    A  30           H3'        A  30  17.275  14.512  12.979
  311    H2'    A  30          H2''        A  30  19.601  14.284  12.732
  312   HO2'    A  30          H2'         A  30  20.839  15.910  13.186
  313    H1'    A  30           H1'        A  30  20.160  13.946  15.430
  314    H8     A  30           H8         A  30  17.092  11.911  14.485
  315    H61    A  30           H61        A  30  20.948   7.804  11.966
  316    H62    A  30           H62        A  30  19.353   8.046  12.642
  317    H2     A  30           H2         A  30  23.267  11.544  12.829
  318    H5'    C  31           H5'        C  31  19.490  18.326  11.151
  319   H5''    C  31          H5''        C  31  19.216  18.108   9.411
  320    H4'    C  31           H4'        C  31  21.683  18.038  10.405
  321    H3'    C  31           H3'        C  31  20.308  16.416   8.267
  322    H2'    C  31          H2''        C  31  22.093  14.929   8.043
  323   HO2'    C  31          H2'         C  31  23.811  16.194   7.711
  324    H1'    C  31           H1'        C  31  23.029  14.911  10.646
  325    H41    C  31           H41        C  31  19.960   9.447   9.340
  326    H42    C  31           H42        C  31  18.457  10.182   9.850
  327    H5     C  31           H5         C  31  18.309  12.461  10.627
  328    H6     C  31           H6         C  31  19.501  14.590  10.835
  329    H5'    A  32           H5'        A  32  23.803  17.819   6.021
  330   H5''    A  32          H5''        A  32  23.227  18.495   4.485
  331    H4'    A  32           H4'        A  32  24.834  16.728   3.987
  332    H3'    A  32           H3'        A  32  21.895  16.283   3.498
  333    H2'    A  32          H2''        A  32  22.166  14.069   2.897
  334   HO2'    A  32          H2'         A  32  23.694  13.572   1.558
  335    H1'    A  32           H1'        A  32  24.413  13.441   4.453
  336    H8     A  32           H8         A  32  21.381  14.987   6.254
  337    H61    A  32           H61        A  32  19.167   9.223   6.546
  338    H62    A  32           H62        A  32  19.018  10.851   7.170
  339    H2     A  32           H2         A  32  22.901   9.160   4.059
  340    H5'    C  33           H5'        C  33  24.322  15.432  -0.802
  341   H5''    C  33          H5''        C  33  22.904  15.246  -1.852
  342    H4'    C  33           H4'        C  33  24.681  13.267  -1.593
  343    H3'    C  33           H3'        C  33  21.656  13.195  -1.680
  344    H2'    C  33          H2''        C  33  21.699  10.825  -1.579
  345   HO2'    C  33          H2'         C  33  23.282   9.736  -2.424
  346    H1'    C  33           H1'        C  33  23.610  10.662   0.391
  347    H41    C  33           H41        C  33  17.824  10.449   3.113
  348    H42    C  33           H42        C  33  17.781  12.195   3.154
  349    H5     C  33           H5         C  33  19.598  13.570   2.355
  350    H6     C  33           H6         C  33  21.682  13.588   1.068
  351    H5'    A  34           H5'        A  34  23.045  10.778  -4.337
  352   H5''    A  34          H5''        A  34  22.779  10.867  -6.090
  353    H4'    A  34           H4'        A  34  22.322   8.593  -5.541
  354    H3'    A  34           H3'        A  34  20.022  10.445  -5.966
  355    H2'    A  34          H2''        A  34  18.406   9.139  -5.002
  356   HO2'    A  34          H2'         A  34  18.210   7.218  -5.790
  357    H1'    A  34           H1'        A  34  19.970   7.482  -3.327
  358    H8     A  34           H8         A  34  20.146  11.285  -2.761
  359    H61    A  34           H61        A  34  15.512  10.420   1.235
  360    H62    A  34           H62        A  34  16.763  11.520   0.700
  361    H2     A  34           H2         A  34  16.179   6.577  -0.976
  362    H5'    C  35           H5'        C  35  17.588   9.512  -9.382
  363   H5''    C  35          H5''        C  35  17.000  11.068  -8.761
  364    H4'    C  35           H4'        C  35  16.769   8.318  -7.554
  365    H3'    C  35           H3'        C  35  15.068  10.276  -8.690
  366    H2'    C  35          H2''        C  35  14.845  11.713  -6.910
  367   HO2'    C  35          H2'         C  35  13.429   9.494  -5.820
  368    H1'    C  35           H1'        C  35  15.383   9.640  -4.812
  369    H41    C  35           H41        C  35  16.248  15.340  -1.993
  370    H42    C  35           H42        C  35  17.911  15.279  -2.532
  371    H5     C  35           H5         C  35  18.713  13.676  -4.142
  372    H6     C  35           H6         C  35  18.151  11.672  -5.434
  373    H5'    U  36           H5'        U  36  16.009   4.776  -8.451
  374   H5''    U  36          H5''        U  36  14.609   4.773  -9.544
  375    H4'    U  36           H4'        U  36  14.393   2.745  -8.296
  376    H3'    U  36           H3'        U  36  12.689   5.088  -7.606
  377    H2'    U  36          H2''        U  36  11.982   4.374  -5.526
  378   HO2'    U  36          H2'         U  36  12.837   1.728  -5.777
  379    H1'    U  36           H1'        U  36  14.163   2.947  -4.644
  380    H3     U  36           H3         U  36  12.909   7.058  -2.552
  381    H5     U  36           H5         U  36  16.438   7.617  -4.782
  382    H6     U  36           H6         U  36  16.090   5.425  -5.759
  383    H5'    A  37           H5'        A  37   8.724   2.687  -8.488
  384   H5''    A  37          H5''        A  37   7.902   4.153  -9.057
  385    H4'    A  37           H4'        A  37   7.203   3.005  -6.751
  386    H3'    A  37           H3'        A  37   7.521   5.912  -7.527
  387    H2'    A  37          H2''        A  37   6.976   6.636  -5.377
  388   HO2'    A  37          H2'         A  37   6.077   3.984  -4.837
  389    H1'    A  37           H1'        A  37   8.341   4.685  -3.967
  390    H8     A  37           H8         A  37  10.729   5.698  -6.638
  391    H61    A  37           H61        A  37  11.600  11.038  -3.665
  392    H62    A  37           H62        A  37  12.288   9.896  -4.797
  393    H2     A  37           H2         A  37   7.953   9.076  -1.947
  394    H5'    C  38           H5'        C  38   3.364   4.729  -6.701
  395   H5''    C  38          H5''        C  38   2.020   5.391  -7.654
  396    H4'    C  38           H4'        C  38   1.588   5.722  -5.251
  397    H3'    C  38           H3'        C  38   2.136   8.012  -7.121
  398    H2'    C  38          H2''        C  38   2.214   9.612  -5.446
  399   HO2'    C  38          H2'         C  38   1.223   9.318  -3.425
  400    H1'    C  38           H1'        C  38   3.248   8.078  -3.358
  401    H41    C  38           H41        C  38   7.791  11.984  -5.649
  402    H42    C  38           H42        C  38   8.329  10.684  -6.691
  403    H5     C  38           H5         C  38   7.047   8.680  -7.053
  404    H6     C  38           H6         C  38   5.109   7.378  -6.321
  405    H5'    A  39           H5'        A  39  -2.236   9.365  -6.410
  406   H5''    A  39          H5''        A  39  -2.390  10.435  -7.818
  407    H4'    A  39           H4'        A  39  -2.036  11.419  -5.333
  408    H3'    A  39           H3'        A  39  -0.871  12.268  -8.014
  409    H2'    A  39          H2''        A  39   0.409  13.934  -6.977
  410   HO2'    A  39          H2'         A  39  -0.228  14.965  -5.128
  411    H1'    A  39           H1'        A  39   0.639  12.691  -4.450
  412    H8     A  39           H8         A  39   2.073  10.564  -7.221
  413    H61    A  39           H61        A  39   7.056  14.216  -7.123
  414    H62    A  39           H62        A  39   6.414  12.673  -7.638
  415    H2     A  39           H2         A  39   3.910  16.096  -4.540
  416    H5'    A  40           H5'        A  40  -3.052  14.990  -5.435
  417   H5''    A  40          H5''        A  40  -4.335  15.929  -6.226
  418    H4'    A  40           H4'        A  40  -3.406  17.353  -4.508
  419    H3'    A  40           H3'        A  40  -2.819  17.846  -7.396
  420    H2'    A  40          H2''        A  40  -1.014  19.236  -7.117
  421   HO2'    A  40          H2'         A  40  -2.204  19.927  -4.631
  422    H1'    A  40           H1'        A  40  -0.086  18.483  -4.588
  423    H8     A  40           H8         A  40  -0.549  15.801  -7.341
  424    H61    A  40           H61        A  40   5.345  16.934  -8.801
  425    H62    A  40           H62        A  40   3.994  15.846  -9.016
  426    H2     A  40           H2         A  40   4.079  19.920  -5.697
  427    H5'    A  41           H5'        A  41  -4.383  22.239  -6.200
  428   H5''    A  41          H5''        A  41  -4.627  22.890  -7.832
  429    H4'    A  41           H4'        A  41  -2.705  23.865  -6.232
  430    H3'    A  41           H3'        A  41  -2.622  23.161  -9.179
  431    H2'    A  41          H2''        A  41  -0.455  24.053  -9.329
  432   HO2'    A  41          H2'         A  41   0.020  25.786  -8.252
  433    H1'    A  41           H1'        A  41   0.371  23.093  -6.808
  434    H8     A  41           H8         A  41  -1.432  20.486  -8.935
  435    H61    A  41           H61        A  41   4.029  19.441 -11.641
  436    H62    A  41           H62        A  41   2.385  18.877 -11.449
  437    H2     A  41           H2         A  41   4.478  22.989  -8.935
  438    H5'    U  42           H5'        U  42  -1.562  27.240  -8.130
  439   H5''    U  42          H5''        U  42  -2.287  28.482  -9.174
  440    H4'    U  42           H4'        U  42   0.093  29.020  -8.771
  441    H3'    U  42           H3'        U  42  -0.872  27.985 -11.454
  442    H2'    U  42          H2''        U  42   1.245  27.944 -12.392
  443   HO2'    U  42          H2'         U  42   2.787  29.363 -11.922
  444    H1'    U  42           H1'        U  42   2.708  27.418 -10.050
  445    H3     U  42           H3         U  42   3.788  23.861 -12.602
  446    H5     U  42           H5         U  42  -0.306  23.308 -11.812
  447    H6     U  42           H6         U  42  -0.360  25.538 -10.884
  448    H5'    U  43           H5'        U  43   1.498  31.534 -12.929
  449   H5''    U  43          H5''        U  43   0.876  31.731 -14.579
  450    H4'    U  43           H4'        U  43   3.341  30.778 -14.147
  451    H3'    U  43           H3'        U  43   1.196  30.109 -16.160
  452    H2'    U  43          H2''        U  43   2.200  28.157 -16.868
  453   HO2'    U  43          H2'         U  43   4.627  29.474 -16.204
  454    H1'    U  43           H1'        U  43   3.871  27.640 -14.617
  455    H3     U  43           H3         U  43   2.004  23.606 -15.393
  456    H5     U  43           H5         U  43  -1.280  26.032 -14.351
  457    H6     U  43           H6         U  43   0.212  27.942 -14.349
  458    H5'    A  44           H5'        A  44   5.166  32.500 -18.723
  459   H5''    A  44          H5''        A  44   4.293  32.482 -20.267
  460    H4'    A  44           H4'        A  44   6.840  31.719 -20.158
  461    H3'    A  44           H3'        A  44   4.459  30.735 -21.692
  462    H2'    A  44          H2''        A  44   5.452  28.767 -22.423
  463   HO2'    A  44          H2'         A  44   7.346  29.862 -23.206
  464    H1'    A  44           H1'        A  44   7.054  28.167 -20.260
  465    H8     A  44           H8         A  44   3.826  28.989 -18.659
  466    H61    A  44           H61        A  44   1.562  23.628 -20.718
  467    H62    A  44           H62        A  44   1.237  25.053 -19.757
  468    H2     A  44           H2         A  44   5.455  24.383 -22.813
  469    H5'    A  45           H5'        A  45   6.917  31.025 -25.415
  470   H5''    A  45          H5''        A  45   5.623  31.241 -26.610
  471    H4'    A  45           H4'        A  45   6.913  28.913 -26.415
  472    H3'    A  45           H3'        A  45   3.996  29.566 -26.828
  473    H2'    A  45          H2''        A  45   3.365  27.338 -26.747
  474   HO2'    A  45          H2'         A  45   4.874  26.665 -28.353
  475    H1'    A  45           H1'        A  45   5.395  26.411 -24.996
  476    H8     A  45           H8         A  45   3.714  29.062 -23.090
  477    H61    A  45           H61        A  45  -1.124  25.294 -22.326
  478    H62    A  45           H62        A  45  -0.306  26.723 -21.735
  479    H2     A  45           H2         A  45   1.574  23.478 -25.415
  480    H5'    G  46           H5'        G  46   5.613  28.444 -31.477
  481   H5''    G  46          H5''        G  46   4.134  28.695 -32.426
  482    H4'    G  46           H4'        G  46   5.223  26.274 -32.278
  483    H3'    G  46           H3'        G  46   2.368  27.217 -32.166
  484    H2'    G  46          H2''        G  46   1.513  25.088 -31.705
  485   HO2'    G  46          H2'         G  46   4.053  24.105 -32.535
  486    H1'    G  46           H1'        G  46   3.458  24.251 -29.942
  487    H8     G  46           H8         G  46   2.966  27.748 -28.899
  488    H1     G  46           H1         G  46  -2.183  24.170 -27.578
  489    H21    G  46           H21        G  46  -2.038  22.221 -28.605
  490    H22    G  46           H22        G  46  -0.781  21.871 -29.771
  491    H5'    C  47           H5'        C  47   2.200  23.483 -33.929
  492   H5''    C  47          H5''        C  47   1.877  23.732 -35.657
  493    H4'    C  47           H4'        C  47   0.503  21.868 -34.953
  494    H3'    C  47           H3'        C  47  -0.732  24.550 -35.455
  495    H2'    C  47          H2''        C  47  -2.837  23.987 -34.686
  496   HO2'    C  47          H2'         C  47  -3.627  21.950 -34.645
  497    H1'    C  47           H1'        C  47  -2.119  22.251 -32.616
  498    H41    C  47           H41        C  47  -3.142  27.522 -29.277
  499    H42    C  47           H42        C  47  -1.822  28.351 -30.070
  500    H5     C  47           H5         C  47  -0.423  27.299 -31.730
  501    H6     C  47           H6         C  47  -0.183  25.361 -33.206
  502    H5'    C  48           H5'        C  48  -3.832  22.012 -36.782
  503   H5''    C  48          H5''        C  48  -4.540  22.742 -38.237
  504    H4'    C  48           H4'        C  48  -6.165  22.572 -36.297
  505    H3'    C  48           H3'        C  48  -5.274  25.175 -37.545
  506   HO3'    C  48          H3T         C  48  -6.643  24.285 -38.909
  507    H2'    C  48          H2''        C  48  -6.509  26.439 -36.078
  508   HO2'    C  48          H2'         C  48  -8.533  25.736 -36.324
  509    H1'    C  48           H1'        C  48  -6.571  24.543 -33.924
  510    H41    C  48           H41        C  48  -3.465  29.608 -31.670
  511    H42    C  48           H42        C  48  -2.166  29.373 -32.819
  512    H5     C  48           H5         C  48  -2.193  27.662 -34.510
  513    H6     C  48           H6         C  48  -3.485  25.830 -35.496
  Start of MODEL    4
    1    H5'    G   1           H5'        G   1  -9.280  32.127 -23.950
    2   H5''    G   1          H5''        G   1  -9.290  30.539 -23.157
    3    H4'    G   1           H4'        G   1 -11.176  30.762 -24.782
    4    H3'    G   1           H3'        G   1  -8.937  28.775 -25.023
    5    H2'    G   1          H2''        G   1  -9.460  28.124 -27.186
    6   HO2'    G   1          H2'         G   1 -12.110  28.962 -26.598
    7    H1'    G   1           H1'        G   1 -10.762  30.418 -28.124
    8    H8     G   1           H8         G   1  -7.530  31.801 -27.239
    9    H1     G   1           H1         G   1  -6.888  27.588 -32.032
   10    H21    G   1           H21        G   1  -8.709  26.357 -32.212
   11    H22    G   1           H22        G   1 -10.044  26.484 -31.088
   12   HO5'    G   1          H5T         G   1  -7.217  31.360 -24.000
   13    H5'    G   2           H5'        G   2 -12.218  25.203 -23.907
   14   H5''    G   2          H5''        G   2 -10.893  24.219 -23.252
   15    H4'    G   2           H4'        G   2 -12.246  23.412 -25.410
   16    H3'    G   2           H3'        G   2  -9.385  23.236 -24.550
   17    H2'    G   2          H2''        G   2  -8.497  22.789 -26.611
   18   HO2'    G   2          H2'         G   2 -11.027  21.657 -27.235
   19    H1'    G   2           H1'        G   2 -10.419  23.902 -28.316
   20    H8     G   2           H8         G   2  -9.119  26.457 -25.854
   21    H1     G   2           H1         G   2  -5.031  25.210 -30.629
   22    H21    G   2           H21        G   2  -5.734  23.461 -31.782
   23    H22    G   2           H22        G   2  -7.091  22.488 -31.266
   24    H5'    C   3           H5'        C   3 -10.063  18.439 -26.331
   25   H5''    C   3          H5''        C   3  -8.803  17.942 -25.186
   26    H4'    C   3           H4'        C   3  -8.525  17.453 -27.788
   27    H3'    C   3           H3'        C   3  -6.569  18.343 -25.674
   28    H2'    C   3          H2''        C   3  -4.862  18.729 -27.188
   29   HO2'    C   3          H2'         C   3  -4.635  17.620 -29.079
   30    H1'    C   3           H1'        C   3  -6.384  19.402 -29.451
   31    H41    C   3           H41        C   3  -3.362  24.632 -27.380
   32    H42    C   3           H42        C   3  -4.553  24.831 -26.116
   33    H5     C   3           H5         C   3  -6.420  23.338 -25.825
   34    H6     C   3           H6         C   3  -7.430  21.224 -26.544
   35    H5'    U   4           H5'        U   4  -4.235  15.565 -27.993
   36   H5''    U   4          H5''        U   4  -3.058  14.836 -26.884
   37    H4'    U   4           H4'        U   4  -2.147  16.358 -28.796
   38    H3'    U   4           H3'        U   4  -1.498  16.333 -25.858
   39    H2'    U   4          H2''        U   4  -0.316  18.295 -25.909
   40   HO2'    U   4          H2'         U   4   1.152  18.680 -27.396
   41    H1'    U   4           H1'        U   4  -1.382  19.430 -28.304
   42    H3     U   4           H3         U   4  -1.147  22.765 -25.222
   43    H5     U   4           H5         U   4  -4.255  20.282 -23.831
   44    H6     U   4           H6         U   4  -3.706  18.712 -25.598
   45    H5'    U   5           H5'        U   5   2.265  16.572 -28.519
   46   H5''    U   5          H5''        U   5   3.442  15.470 -27.777
   47    H4'    U   5           H4'        U   5   4.514  17.626 -28.339
   48    H3'    U   5           H3'        U   5   4.134  16.668 -25.520
   49    H2'    U   5          H2''        U   5   4.710  18.658 -24.529
   50   HO2'    U   5          H2'         U   5   6.297  19.143 -26.841
   51    H1'    U   5           H1'        U   5   4.216  20.448 -26.691
   52    H3     U   5           H3         U   5   2.160  22.480 -23.236
   53    H5     U   5           H5         U   5   0.033  18.869 -23.653
   54    H6     U   5           H6         U   5   1.625  18.204 -25.358
   55    H5'    G   6           H5'        G   6   7.605  16.718 -22.637
   56   H5''    G   6          H5''        G   6   6.076  17.448 -23.170
   57    H4'    G   6           H4'        G   6   8.576  19.120 -23.357
   58    H3'    G   6           H3'        G   6   7.357  17.980 -20.877
   59    H2'    G   6          H2''        G   6   6.808  19.976 -19.892
   60   HO2'    G   6          H2'         G   6   8.134  21.677 -19.888
   61    H1'    G   6           H1'        G   6   6.713  21.689 -22.142
   62    H8     G   6           H8         G   6   4.262  18.788 -22.324
   63    H1     G   6           H1         G   6   2.286  23.584 -18.552
   64    H21    G   6           H21        G   6   3.910  25.052 -18.277
   65    H22    G   6           H22        G   6   5.535  24.768 -18.858
   66    H5'    A   7           H5'        A   7  11.041  20.739 -20.109
   67   H5''    A   7          H5''        A   7  12.033  19.902 -18.899
   68    H4'    A   7           H4'        A   7  11.874  22.325 -18.385
   69    H3'    A   7           H3'        A   7  10.731  20.165 -16.650
   70    H2'    A   7          H2''        A   7   9.547  21.575 -15.270
   71   HO2'    A   7          H2'         A   7  11.366  23.638 -16.011
   72    H1'    A   7           H1'        A   7   9.165  23.770 -16.997
   73    H8     A   7           H8         A   7   7.893  20.307 -18.118
   74    H61    A   7           H61        A   7   2.731  21.673 -15.000
   75    H62    A   7           H62        A   7   3.457  20.604 -16.180
   76    H2     A   7           H2         A   7   5.721  24.930 -14.241
   77    H5'    U   8           H5'        U   8  12.808  23.448 -14.308
   78   H5''    U   8          H5''        U   8  13.807  22.670 -13.064
   79    H4'    U   8           H4'        U   8  12.523  24.545 -12.089
   80    H3'    U   8           H3'        U   8  12.059  21.675 -11.346
   81    H2'    U   8          H2''        U   8  10.128  22.063 -10.166
   82   HO2'    U   8          H2'         U   8  10.133  23.538  -8.681
   83    H1'    U   8           H1'        U   8   9.313  24.522 -11.329
   84    H3     U   8           H3         U   8   5.504  22.149 -11.637
   85    H5     U   8           H5         U   8   8.239  19.875 -13.898
   86    H6     U   8           H6         U   8   9.994  21.390 -13.172
   87    H5'    U   9           H5'        U   9  12.520  24.111  -7.434
   88   H5''    U   9          H5''        U   9  13.228  22.998  -6.247
   89    H4'    U   9           H4'        U   9  11.036  24.078  -5.521
   90    H3'    U   9           H3'        U   9  11.682  21.150  -5.670
   91    H2'    U   9          H2''        U   9   9.525  20.424  -5.385
   92   HO2'    U   9          H2'         U   9   8.324  21.196  -3.834
   93    H1'    U   9           H1'        U   9   8.094  22.724  -6.238
   94    H3     U   9           H3         U   9   6.082  19.421  -8.528
   95    H5     U   9           H5         U   9  10.054  19.274  -9.925
   96    H6     U   9           H6         U   9  10.616  20.998  -8.312
   97    H5'    G  10           H5'        G  10   9.667  22.331  -1.675
   98   H5''    G  10          H5''        G  10  10.504  21.419  -0.402
   99    H4'    G  10           H4'        G  10   7.985  21.345  -0.212
  100    H3'    G  10           H3'        G  10   9.780  18.949  -0.569
  101    H2'    G  10          H2''        G  10   8.002  17.450  -0.678
  102   HO2'    G  10          H2'         G  10   6.411  19.515   0.469
  103    H1'    G  10           H1'        G  10   6.186  19.024  -2.058
  104    H8     G  10           H8         G  10   9.548  19.328  -3.729
  105    H1     G  10           H1         G  10   6.737  13.665  -4.802
  106    H21    G  10           H21        G  10   5.035  13.395  -3.426
  107    H22    G  10           H22        G  10   4.485  14.664  -2.356
  108    H5'    U  11           H5'        U  11   8.058  18.107   3.560
  109   H5''    U  11          H5''        U  11   9.089  16.869   4.303
  110    H4'    U  11           H4'        U  11   6.659  16.245   3.403
  111    H3'    U  11           H3'        U  11   9.294  14.797   3.362
  112    H2'    U  11          H2''        U  11   8.587  13.146   1.918
  113   HO2'    U  11          H2'         U  11   6.625  12.277   1.992
  114    H1'    U  11           H1'        U  11   6.565  14.544   0.526
  115    H3     U  11           H3         U  11   9.565  12.510  -2.324
  116    H5     U  11           H5         U  11  11.301  16.190  -1.231
  117    H6     U  11           H6         U  11   9.556  16.450   0.431
  118    H5'    A  12           H5'        A  12   6.830  11.893   6.347
  119   H5''    A  12          H5''        A  12   8.143  10.850   6.932
  120    H4'    A  12           H4'        A  12   6.259   9.882   5.309
  121    H3'    A  12           H3'        A  12   9.229   9.423   5.506
  122    H2'    A  12          H2''        A  12   9.341   8.188   3.542
  123   HO2'    A  12          H2'         A  12   6.546   7.786   3.875
  124    H1'    A  12           H1'        A  12   7.367   9.451   2.068
  125    H8     A  12           H8         A  12   9.655  12.074   3.554
  126    H61    A  12           H61        A  12  13.772  10.597  -0.813
  127    H62    A  12           H62        A  12  13.325  11.765   0.412
  128    H2     A  12           H2         A  12  10.431   7.607  -0.984
  129    H5'    U  13           H5'        U  13   7.919   5.826   4.237
  130   H5''    U  13          H5''        U  13   8.495   4.533   5.307
  131    H4'    U  13           H4'        U  13   9.185   3.975   3.048
  132    H3'    U  13           H3'        U  13  11.273   5.000   4.979
  133    H2'    U  13          H2''        U  13  12.956   4.901   3.373
  134   HO2'    U  13          H2'         U  13  11.222   3.175   1.915
  135    H1'    U  13           H1'        U  13  11.441   5.596   1.133
  136    H3     U  13           H3         U  13  14.482   8.932   1.437
  137    H5     U  13           H5         U  13  12.081   9.462   4.842
  138    H6     U  13           H6         U  13  10.932   7.408   4.289
  139    H5'    G  14           H5'        G  14  13.167   1.208   3.983
  140   H5''    G  14          H5''        G  14  14.459   0.996   5.179
  141    H4'    G  14           H4'        G  14  15.001   1.813   2.687
  142    H3'    G  14           H3'        G  14  16.152   2.587   5.372
  143    H2'    G  14          H2''        G  14  17.379   4.316   4.485
  144   HO2'    G  14          H2'         G  14  18.701   3.465   3.056
  145    H1'    G  14           H1'        G  14  15.847   4.726   2.089
  146    H8     G  14           H8         G  14  13.961   5.626   5.239
  147    H1     G  14           H1         G  14  18.210  10.061   3.385
  148    H21    G  14           H21        G  14  19.538   9.234   1.835
  149    H22    G  14           H22        G  14  19.496   7.547   1.375
  150    H5'    U  15           H5'        U  15  19.703   1.401   2.357
  151   H5''    U  15          H5''        U  15  20.775   0.540   3.479
  152    H4'    U  15           H4'        U  15  22.006   2.217   2.083
  153    H3'    U  15           H3'        U  15  21.798   2.283   5.079
  154    H2'    U  15          H2''        U  15  22.726   4.375   5.313
  155   HO2'    U  15          H2'         U  15  24.509   4.830   4.313
  156    H1'    U  15           H1'        U  15  22.087   5.499   2.808
  157    H3     U  15           H3         U  15  20.546   8.489   5.833
  158    H5     U  15           H5         U  15  18.022   5.154   6.339
  159    H6     U  15           H6         U  15  19.430   3.933   4.784
  160    H5'    G  16           H5'        G  16  26.555   2.940   4.539
  161   H5''    G  16          H5''        G  16  26.974   2.440   6.189
  162    H4'    G  16           H4'        G  16  27.426   4.938   5.379
  163    H3'    G  16           H3'        G  16  26.439   3.788   7.983
  164    H2'    G  16          H2''        G  16  25.820   5.816   8.843
  165   HO2'    G  16          H2'         G  16  27.937   6.845   7.269
  166    H1'    G  16           H1'        G  16  25.558   7.299   6.414
  167    H8     G  16           H8         G  16  23.219   4.333   7.215
  168    H1     G  16           H1         G  16  21.360   9.972   9.632
  169    H21    G  16           H21        G  16  22.935  11.485   9.316
  170    H22    G  16           H22        G  16  24.507  11.073   8.667
  171    H5'    U  17           H5'        U  17  30.296   6.781   9.352
  172   H5''    U  17          H5''        U  17  30.425   6.020  10.949
  173    H4'    U  17           H4'        U  17  29.977   8.638  10.735
  174    H3'    U  17           H3'        U  17  28.923   6.536  12.615
  175    H2'    U  17          H2''        U  17  27.275   7.868  13.484
  176   HO2'    U  17          H2'         U  17  29.002  10.042  12.881
  177    H1'    U  17           H1'        U  17  27.038   9.774  11.372
  178    H3     U  17           H3         U  17  22.849   8.618  12.719
  179    H5     U  17           H5         U  17  24.261   5.243  10.626
  180    H6     U  17           H6         U  17  26.441   6.306  10.523
  181    H5'    A  18           H5'        A  18  30.946  10.350  15.489
  182   H5''    A  18          H5''        A  18  30.781   9.431  16.997
  183    H4'    A  18           H4'        A  18  29.716  11.862  16.780
  184    H3'    A  18           H3'        A  18  28.604   9.325  17.996
  185    H2'    A  18          H2''        A  18  26.641  10.438  18.645
  186   HO2'    A  18          H2'         A  18  26.494  12.584  18.920
  187    H1'    A  18           H1'        A  18  26.342  11.954  16.337
  188    H8     A  18           H8         A  18  27.322   8.481  15.301
  189    H61    A  18           H61        A  18  21.483   6.769  16.368
  190    H62    A  18           H62        A  18  23.047   6.260  15.773
  191    H2     A  18           H2         A  18  22.050  10.879  18.079
  192    H5'    A  19           H5'        A  19  27.914  12.160  20.719
  193   H5''    A  19          H5''        A  19  28.591  11.865  22.332
  194    H4'    A  19           H4'        A  19  26.260  12.450  22.631
  195    H3'    A  19           H3'        A  19  27.140   9.597  22.980
  196    H2'    A  19          H2''        A  19  25.011   8.742  23.125
  197   HO2'    A  19          H2'         A  19  23.588   9.646  24.375
  198    H1'    A  19           H1'        A  19  23.586  10.699  21.676
  199    H8     A  19           H8         A  19  26.483   8.894  19.894
  200    H61    A  19           H61        A  19  22.356   4.517  18.482
  201    H62    A  19           H62        A  19  23.920   5.194  18.087
  202    H2     A  19           H2         A  19  20.426   7.382  21.341
  203    H5'    A  20           H5'        A  20  24.394  10.510  26.501
  204   H5''    A  20          H5''        A  20  25.091   9.600  27.856
  205    H4'    A  20           H4'        A  20  22.680   9.036  27.453
  206    H3'    A  20           H3'        A  20  24.945   7.055  27.204
  207    H2'    A  20          H2''        A  20  23.550   5.351  26.472
  208   HO2'    A  20          H2'         A  20  21.666   5.026  27.355
  209    H1'    A  20           H1'        A  20  21.595   6.891  25.174
  210    H8     A  20           H8         A  20  25.374   7.242  24.342
  211    H61    A  20           H61        A  20  24.366   2.858  20.107
  212    H62    A  20           H62        A  20  25.484   4.077  20.674
  213    H2     A  20           H2         A  20  20.577   3.437  22.437
  214    H5'    U  21           H5'        U  21  22.266   4.647  29.834
  215   H5''    U  21          H5''        U  21  23.402   3.470  30.521
  216    H4'    U  21           H4'        U  21  21.600   2.705  28.715
  217    H3'    U  21           H3'        U  21  24.508   1.975  29.103
  218    H2'    U  21          H2''        U  21  24.633   0.828  27.075
  219   HO2'    U  21          H2'         U  21  23.159  -0.709  27.207
  220    H1'    U  21           H1'        U  21  22.531   2.099  25.697
  221    H3     U  21           H3         U  21  26.198   2.053  22.970
  222    H5     U  21           H5         U  21  27.252   4.699  26.077
  223    H6     U  21           H6         U  21  25.104   4.249  27.097
  224    H5'    U  22           H5'        U  22  21.742  -1.338  28.960
  225   H5''    U  22          H5''        U  22  21.893  -2.621  30.177
  226    H4'    U  22           H4'        U  22  21.545  -3.624  27.955
  227    H3'    U  22           H3'        U  22  24.047  -3.912  29.551
  228    H2'    U  22          H2''        U  22  25.467  -4.364  27.841
  229   HO2'    U  22          H2'         U  22  24.720  -6.408  27.533
  230    H1'    U  22           H1'        U  22  23.725  -3.892  25.586
  231    H3     U  22           H3         U  22  27.528  -2.308  23.788
  232    H5     U  22           H5         U  22  27.262  -0.212  27.435
  233    H6     U  22           H6         U  22  25.252  -1.471  27.938
  234    H5'    A  23           H5'        A  23  26.169  -6.317  30.694
  235   H5''    A  23          H5''        A  23  26.127  -5.218  29.305
  236    H4'    A  23           H4'        A  23  28.221  -6.682  29.485
  237    H3'    A  23           H3'        A  23  26.567  -6.002  27.216
  238    H2'    A  23          H2''        A  23  26.024  -8.091  26.440
  239   HO2'    A  23          H2'         A  23  27.583  -9.081  25.268
  240    H1'    A  23           H1'        A  23  27.822  -9.805  27.919
  241    H8     A  23           H8         A  23  24.645  -9.002  29.640
  242    H61    A  23           H61        A  23  21.660 -12.916  25.893
  243    H62    A  23           H62        A  23  21.528 -11.889  27.302
  244    H2     A  23           H2         A  23  25.844 -12.429  24.355
  245    H5'    A  24           H5'        A  24  29.714  -5.117  23.924
  246   H5''    A  24          H5''        A  24  28.344  -4.334  23.113
  247    H4'    A  24           H4'        A  24  29.172  -7.076  22.914
  248    H3'    A  24           H3'        A  24  27.062  -5.221  21.876
  249    H2'    A  24          H2''        A  24  25.492  -6.856  21.551
  250   HO2'    A  24          H2'         A  24  27.501  -8.794  21.036
  251    H1'    A  24           H1'        A  24  26.795  -8.976  23.091
  252    H8     A  24           H8         A  24  25.283  -6.486  25.309
  253    H61    A  24           H61        A  24  19.738  -9.004  24.224
  254    H62    A  24           H62        A  24  20.635  -7.862  25.202
  255    H2     A  24           H2         A  24  22.647 -10.699  21.263
  256    H5'    U  25           H5'        U  25  26.638  -3.481  18.637
  257   H5''    U  25          H5''        U  25  26.387  -4.877  19.702
  258    H4'    U  25           H4'        U  25  25.575  -4.524  16.935
  259    H3'    U  25           H3'        U  25  24.610  -5.664  19.236
  260    H2'    U  25          H2''        U  25  25.963  -7.583  19.312
  261   HO2'    U  25          H2'         U  25  23.860  -8.216  17.505
  262    H1'    U  25           H1'        U  25  25.872  -7.928  16.342
  263    H3     U  25           H3         U  25  29.236 -10.877  16.174
  264    H5     U  25           H5         U  25  29.912  -8.932  19.849
  265    H6     U  25           H6         U  25  27.993  -7.522  19.388
  266    H5'    U  26           H5'        U  26  23.693  -6.559  20.766
  267   H5''    U  26          H5''        U  26  22.282  -7.373  20.063
  268    H4'    U  26           H4'        U  26  21.346  -6.890  22.147
  269    H3'    U  26           H3'        U  26  21.084  -4.610  20.246
  270    H2'    U  26          H2''        U  26  20.940  -2.896  21.745
  271   HO2'    U  26          H2'         U  26  19.381  -3.076  23.121
  272    H1'    U  26           H1'        U  26  22.144  -3.956  24.016
  273    H3     U  26           H3         U  26  24.634  -0.277  23.432
  274    H5     U  26           H5         U  26  25.540  -2.589  20.037
  275    H6     U  26           H6         U  26  23.843  -4.168  20.715
  276    H5'    C  27           H5'        C  27  16.305  -4.391  21.204
  277   H5''    C  27          H5''        C  27  16.046  -3.262  19.859
  278    H4'    C  27           H4'        C  27  15.912  -2.484  22.462
  279    H3'    C  27           H3'        C  27  17.068  -1.094  19.994
  280    H2'    C  27          H2''        C  27  17.661   0.765  21.302
  281   HO2'    C  27          H2'         C  27  15.990   1.460  22.405
  282    H1'    C  27           H1'        C  27  18.056  -0.656  23.704
  283    H41    C  27           H41        C  27  23.797   1.362  21.831
  284    H42    C  27           H42        C  27  23.619   0.585  20.273
  285    H5     C  27           H5         C  27  21.718  -0.771  19.692
  286    H6     C  27           H6         C  27  19.464  -1.460  20.363
  287    H5'    U  28           H5'        U  28  13.058   1.506  20.547
  288   H5''    U  28          H5''        U  28  13.112   2.600  19.151
  289    H4'    U  28           H4'        U  28  13.524   3.519  21.635
  290    H3'    U  28           H3'        U  28  14.930   4.141  19.023
  291    H2'    U  28          H2''        U  28  16.322   5.686  20.080
  292   HO2'    U  28          H2'         U  28  15.331   6.946  21.453
  293    H1'    U  28           H1'        U  28  16.739   4.217  22.404
  294    H3     U  28           H3         U  28  20.556   4.876  19.889
  295    H5     U  28           H5         U  28  18.637   1.519  18.228
  296    H6     U  28           H6         U  28  16.739   1.964  19.656
  297    H5'    U  29           H5'        U  29  13.619   8.060  20.937
  298   H5''    U  29          H5''        U  29  12.855   8.970  19.619
  299    H4'    U  29           H4'        U  29  14.450  10.396  20.884
  300    H3'    U  29           H3'        U  29  14.832   9.630  17.999
  301    H2'    U  29          H2''        U  29  16.945  10.555  17.838
  302   HO2'    U  29          H2'         U  29  16.196  12.141  20.070
  303    H1'    U  29           H1'        U  29  17.856  10.173  20.437
  304    H3     U  29           H3         U  29  20.701   8.034  17.587
  305    H5     U  29           H5         U  29  17.310   5.543  17.768
  306    H6     U  29           H6         U  29  16.192   7.273  19.049
  307    H5'    A  30           H5'        A  30  15.396  14.464  17.876
  308   H5''    A  30          H5''        A  30  15.279  14.628  16.114
  309    H4'    A  30           H4'        A  30  17.529  15.275  17.399
  310    H3'    A  30           H3'        A  30  17.130  13.778  14.791
  311    H2'    A  30          H2''        A  30  19.459  13.697  14.482
  312   HO2'    A  30          H2'         A  30  20.059  15.774  15.009
  313    H1'    A  30           H1'        A  30  20.096  13.100  17.106
  314    H8     A  30           H8         A  30  17.064  11.067  16.038
  315    H61    A  30           H61        A  30  20.962   7.402  12.965
  316    H62    A  30           H62        A  30  19.382   7.513  13.707
  317    H2     A  30           H2         A  30  23.192  11.100  14.175
  318    H5'    C  31           H5'        C  31  19.027  17.868  13.242
  319   H5''    C  31          H5''        C  31  18.708  17.783  11.500
  320    H4'    C  31           H4'        C  31  21.206  17.750  12.420
  321    H3'    C  31           H3'        C  31  19.840  16.278  10.173
  322    H2'    C  31          H2''        C  31  21.664  14.873   9.777
  323   HO2'    C  31          H2'         C  31  23.334  16.217   9.514
  324    H1'    C  31           H1'        C  31  22.674  14.640  12.328
  325    H41    C  31           H41        C  31  19.674   9.280  10.513
  326    H42    C  31           H42        C  31  18.180   9.909  11.168
  327    H5     C  31           H5         C  31  18.019  12.077  12.221
  328    H6     C  31           H6         C  31  19.173  14.197  12.629
  329    H5'    A  32           H5'        A  32  23.527  17.945   8.165
  330   H5''    A  32          H5''        A  32  22.902  18.804   6.744
  331    H4'    A  32           H4'        A  32  24.667  17.307   5.990
  332    H3'    A  32           H3'        A  32  21.787  16.633   5.414
  333    H2'    A  32          H2''        A  32  22.314  14.593   4.413
  334   HO2'    A  32          H2'         A  32  24.085  14.290   3.297
  335    H1'    A  32           H1'        A  32  24.370  13.817   6.066
  336    H8     A  32           H8         A  32  21.378  15.320   7.935
  337    H61    A  32           H61        A  32  18.838   9.700   7.527
  338    H62    A  32           H62        A  32  18.762  11.254   8.326
  339    H2     A  32           H2         A  32  22.603   9.713   5.089
  340    H5'    C  33           H5'        C  33  23.756  16.817   0.998
  341   H5''    C  33          H5''        C  33  22.298  16.681  -0.005
  342    H4'    C  33           H4'        C  33  24.161  14.752  -0.001
  343    H3'    C  33           H3'        C  33  21.136  14.586  -0.019
  344    H2'    C  33          H2''        C  33  21.263  12.215  -0.161
  345   HO2'    C  33          H2'         C  33  22.840  11.361  -1.246
  346    H1'    C  33           H1'        C  33  23.186  11.929   1.766
  347    H41    C  33           H41        C  33  17.388  11.410   4.433
  348    H42    C  33           H42        C  33  17.363  13.136   4.697
  349    H5     C  33           H5         C  33  19.197  14.580   4.082
  350    H6     C  33           H6         C  33  21.275  14.741   2.796
  351    H5'    A  34           H5'        A  34  22.645  12.667  -3.011
  352   H5''    A  34          H5''        A  34  22.442  12.911  -4.758
  353    H4'    A  34           H4'        A  34  22.093  10.579  -4.479
  354    H3'    A  34           H3'        A  34  19.690  12.324  -4.746
  355    H2'    A  34          H2''        A  34  18.141  10.832  -3.950
  356   HO2'    A  34          H2'         A  34  18.244   8.661  -4.343
  357    H1'    A  34           H1'        A  34  19.754   9.133  -2.382
  358    H8     A  34           H8         A  34  19.853  12.858  -1.479
  359    H61    A  34           H61        A  34  15.126  11.603   2.291
  360    H62    A  34           H62        A  34  16.395  12.745   1.908
  361    H2     A  34           H2         A  34  15.871   7.986  -0.253
  362    H5'    C  35           H5'        C  35  17.669  11.238  -8.623
  363   H5''    C  35          H5''        C  35  16.653  12.551  -7.997
  364    H4'    C  35           H4'        C  35  16.819   9.695  -7.137
  365    H3'    C  35           H3'        C  35  14.899  11.512  -8.107
  366    H2'    C  35          H2''        C  35  14.367  12.666  -6.189
  367   HO2'    C  35          H2'         C  35  12.564  11.294  -6.391
  368    H1'    C  35           H1'        C  35  15.097  10.497  -4.271
  369    H41    C  35           H41        C  35  15.246  15.922  -0.898
  370    H42    C  35           H42        C  35  16.877  16.178  -1.473
  371    H5     C  35           H5         C  35  17.869  14.870  -3.240
  372    H6     C  35           H6         C  35  17.566  12.966  -4.740
  373    H5'    U  36           H5'        U  36  15.656   6.114  -8.076
  374   H5''    U  36          H5''        U  36  14.649   5.779  -9.499
  375    H4'    U  36           H4'        U  36  13.923   4.016  -8.198
  376    H3'    U  36           H3'        U  36  12.375   6.505  -7.633
  377    H2'    U  36          H2''        U  36  11.505   5.855  -5.604
  378   HO2'    U  36          H2'         U  36  11.965   3.154  -6.382
  379    H1'    U  36           H1'        U  36  13.472   4.105  -4.688
  380    H3     U  36           H3         U  36  12.368   7.965  -2.150
  381    H5     U  36           H5         U  36  16.005   8.637  -4.165
  382    H6     U  36           H6         U  36  15.595   6.610  -5.443
  383    H5'    A  37           H5'        A  37   8.445   4.195  -8.834
  384   H5''    A  37          H5''        A  37   7.543   5.651  -9.298
  385    H4'    A  37           H4'        A  37   6.918   4.314  -7.074
  386    H3'    A  37           H3'        A  37   7.084   7.279  -7.654
  387    H2'    A  37          H2''        A  37   6.517   7.830  -5.456
  388   HO2'    A  37          H2'         A  37   4.780   6.394  -5.195
  389    H1'    A  37           H1'        A  37   8.014   5.885  -4.189
  390    H8     A  37           H8         A  37  10.267   7.170  -6.872
  391    H61    A  37           H61        A  37  11.107  12.272  -3.502
  392    H62    A  37           H62        A  37  11.637  11.363  -4.900
  393    H2     A  37           H2         A  37   7.527  10.118  -1.876
  394    H5'    C  38           H5'        C  38   2.738   6.162  -7.076
  395   H5''    C  38          H5''        C  38   1.567   7.154  -7.968
  396    H4'    C  38           H4'        C  38   1.301   7.288  -5.459
  397    H3'    C  38           H3'        C  38   1.855   9.592  -7.311
  398    H2'    C  38          H2''        C  38   2.168  11.135  -5.608
  399   HO2'    C  38          H2'         C  38   0.826   9.347  -3.846
  400    H1'    C  38           H1'        C  38   3.254   9.481  -3.643
  401    H41    C  38           H41        C  38   7.852  13.145  -6.224
  402    H42    C  38           H42        C  38   8.235  11.825  -7.306
  403    H5     C  38           H5         C  38   6.852   9.873  -7.541
  404    H6     C  38           H6         C  38   4.892   8.687  -6.683
  405    H5'    A  39           H5'        A  39  -2.347  11.222  -6.246
  406   H5''    A  39          H5''        A  39  -2.520  12.333  -7.618
  407    H4'    A  39           H4'        A  39  -1.911  13.220  -5.142
  408    H3'    A  39           H3'        A  39  -0.903  14.061  -7.891
  409    H2'    A  39          H2''        A  39   0.584  15.599  -6.924
  410   HO2'    A  39          H2'         A  39  -1.151  15.576  -4.662
  411    H1'    A  39           H1'        A  39   0.932  14.280  -4.464
  412    H8     A  39           H8         A  39   1.939  12.098  -7.369
  413    H61    A  39           H61        A  39   7.131  15.419  -7.800
  414    H62    A  39           H62        A  39   6.338  13.926  -8.245
  415    H2     A  39           H2         A  39   4.404  17.480  -4.896
  416    H5'    A  40           H5'        A  40  -3.308  16.851  -5.586
  417   H5''    A  40          H5''        A  40  -4.486  17.962  -6.313
  418    H4'    A  40           H4'        A  40  -3.201  19.218  -4.672
  419    H3'    A  40           H3'        A  40  -2.848  19.652  -7.616
  420    H2'    A  40          H2''        A  40  -0.868  20.802  -7.507
  421   HO2'    A  40          H2'         A  40  -1.584  22.520  -6.313
  422    H1'    A  40           H1'        A  40   0.123  19.972  -5.003
  423    H8     A  40           H8         A  40  -0.650  17.340  -7.723
  424    H61    A  40           H61        A  40   5.253  18.021  -9.413
  425    H62    A  40           H62        A  40   3.808  17.049  -9.585
  426    H2     A  40           H2         A  40   4.330  21.113  -6.292
  427    H5'    A  41           H5'        A  41  -3.901  24.163  -6.375
  428   H5''    A  41          H5''        A  41  -4.202  24.838  -7.988
  429    H4'    A  41           H4'        A  41  -2.044  25.567  -6.557
  430    H3'    A  41           H3'        A  41  -2.300  24.878  -9.503
  431    H2'    A  41          H2''        A  41  -0.062  25.499  -9.837
  432   HO2'    A  41          H2'         A  41  -0.252  26.796  -7.310
  433    H1'    A  41           H1'        A  41   0.843  24.463  -7.371
  434    H8     A  41           H8         A  41  -1.363  22.042  -9.312
  435    H61    A  41           H61        A  41   3.756  20.400 -12.369
  436    H62    A  41           H62        A  41   2.096  19.978 -12.009
  437    H2     A  41           H2         A  41   4.752  23.927  -9.784
  438    H5'    U  42           H5'        U  42  -0.549  28.766  -8.770
  439   H5''    U  42          H5''        U  42  -1.142  30.037  -9.860
  440    H4'    U  42           H4'        U  42   1.343  30.077  -9.746
  441    H3'    U  42           H3'        U  42  -0.132  29.123 -12.222
  442    H2'    U  42          H2''        U  42   1.813  28.616 -13.365
  443   HO2'    U  42          H2'         U  42   3.062  30.493 -11.636
  444    H1'    U  42           H1'        U  42   3.426  28.007 -11.125
  445    H3     U  42           H3         U  42   3.737  24.218 -13.553
  446    H5     U  42           H5         U  42  -0.287  24.294 -12.321
  447    H6     U  42           H6         U  42   0.058  26.561 -11.558
  448    H5'    U  43           H5'        U  43   2.681  31.879 -14.305
  449   H5''    U  43          H5''        U  43   1.873  32.076 -15.873
  450    H4'    U  43           H4'        U  43   4.079  30.577 -15.646
  451    H3'    U  43           H3'        U  43   1.553  30.308 -17.264
  452    H2'    U  43          H2''        U  43   1.909  28.106 -17.848
  453   HO2'    U  43          H2'         U  43   4.033  27.252 -18.063
  454    H1'    U  43           H1'        U  43   3.679  27.324 -15.769
  455    H3     U  43           H3         U  43   0.597  24.018 -15.806
  456    H5     U  43           H5         U  43  -1.612  27.419 -14.661
  457    H6     U  43           H6         U  43   0.377  28.757 -15.036
  458    H5'    A  44           H5'        A  44   5.541  31.875 -20.179
  459   H5''    A  44          H5''        A  44   4.640  32.099 -21.690
  460    H4'    A  44           H4'        A  44   7.023  31.050 -21.840
  461    H3'    A  44           H3'        A  44   4.432  30.232 -23.112
  462    H2'    A  44          H2''        A  44   5.201  28.188 -23.898
  463   HO2'    A  44          H2'         A  44   7.817  29.269 -23.613
  464    H1'    A  44           H1'        A  44   6.982  27.509 -21.894
  465    H8     A  44           H8         A  44   4.001  28.511 -19.967
  466    H61    A  44           H61        A  44   1.128  23.386 -21.867
  467    H62    A  44           H62        A  44   1.140  24.676 -20.685
  468    H2     A  44           H2         A  44   4.891  23.837 -24.266
  469    H5'    A  45           H5'        A  45   6.640  30.233 -27.032
  470   H5''    A  45          H5''        A  45   5.294  30.561 -28.139
  471    H4'    A  45           H4'        A  45   6.418  28.143 -28.053
  472    H3'    A  45           H3'        A  45   3.531  29.004 -28.259
  473    H2'    A  45          H2''        A  45   2.762  26.822 -28.172
  474   HO2'    A  45          H2'         A  45   4.282  26.217 -29.916
  475    H1'    A  45           H1'        A  45   4.877  25.727 -26.612
  476    H8     A  45           H8         A  45   3.430  28.371 -24.508
  477    H61    A  45           H61        A  45  -1.458  24.721 -23.504
  478    H62    A  45           H62        A  45  -0.555  26.106 -22.932
  479    H2     A  45           H2         A  45   0.951  22.934 -26.839
  480    H5'    G  46           H5'        G  46   4.926  27.649 -32.897
  481   H5''    G  46          H5''        G  46   3.479  27.987 -33.866
  482    H4'    G  46           H4'        G  46   4.419  25.534 -33.826
  483    H3'    G  46           H3'        G  46   1.609  26.564 -33.515
  484    H2'    G  46          H2''        G  46   0.711  24.447 -33.091
  485   HO2'    G  46          H2'         G  46   1.886  22.527 -33.495
  486    H1'    G  46           H1'        G  46   2.731  23.468 -31.491
  487    H8     G  46           H8         G  46   2.350  26.956 -30.306
  488    H1     G  46           H1         G  46  -2.700  23.342 -28.720
  489    H21    G  46           H21        G  46  -2.627  21.419 -29.802
  490    H22    G  46           H22        G  46  -1.448  21.095 -31.055
  491    H5'    C  47           H5'        C  47   1.280  22.892 -35.456
  492   H5''    C  47          H5''        C  47   0.892  23.247 -37.153
  493    H4'    C  47           H4'        C  47  -0.472  21.354 -36.514
  494    H3'    C  47           H3'        C  47  -1.701  24.071 -36.794
  495    H2'    C  47          H2''        C  47  -3.776  23.480 -35.963
  496   HO2'    C  47          H2'         C  47  -3.004  20.813 -36.524
  497    H1'    C  47           H1'        C  47  -2.988  21.618 -34.034
  498    H41    C  47           H41        C  47  -3.752  26.692 -30.339
  499    H42    C  47           H42        C  47  -2.468  27.552 -31.155
  500    H5     C  47           H5         C  47  -1.179  26.590 -32.951
  501    H6     C  47           H6         C  47  -1.038  24.734 -34.541
  502    H5'    C  48           H5'        C  48  -4.898  21.650 -38.094
  503   H5''    C  48          H5''        C  48  -5.665  22.469 -39.470
  504    H4'    C  48           H4'        C  48  -7.194  22.214 -37.463
  505    H3'    C  48           H3'        C  48  -6.322  24.872 -38.604
  506   HO3'    C  48          H3T         C  48  -8.789  23.433 -38.607
  507    H2'    C  48          H2''        C  48  -7.468  26.065 -37.010
  508   HO2'    C  48          H2'         C  48  -9.136  23.780 -36.672
  509    H1'    C  48           H1'        C  48  -7.459  24.043 -34.970
  510    H41    C  48           H41        C  48  -4.154  28.885 -32.525
  511    H42    C  48           H42        C  48  -2.981  28.800 -33.820
  512    H5     C  48           H5         C  48  -3.075  27.152 -35.574
  513    H6     C  48           H6         C  48  -4.433  25.392 -36.603
  Start of MODEL    5
    1    H5'    G   1           H5'        G   1  -9.648  31.069 -24.561
    2   H5''    G   1          H5''        G   1  -9.565  29.457 -23.819
    3    H4'    G   1           H4'        G   1 -11.409  29.603 -25.503
    4    H3'    G   1           H3'        G   1  -9.032  27.782 -25.709
    5    H2'    G   1          H2''        G   1  -9.417  27.165 -27.919
    6   HO2'    G   1          H2'         G   1 -11.459  26.346 -27.648
    7    H1'    G   1           H1'        G   1 -10.806  29.397 -28.857
    8    H8     G   1           H8         G   1  -7.750  30.980 -27.714
    9    H1     G   1           H1         G   1  -6.485  27.015 -32.592
   10    H21    G   1           H21        G   1  -8.184  25.647 -32.925
   11    H22    G   1           H22        G   1  -9.603  25.646 -31.902
   12   HO5'    G   1          H5T         G   1  -7.518  29.891 -24.352
   13    H5'    G   2           H5'        G   2 -12.057  23.953 -24.950
   14   H5''    G   2          H5''        G   2 -10.717  23.058 -24.205
   15    H4'    G   2           H4'        G   2 -11.794  22.219 -26.498
   16    H3'    G   2           H3'        G   2  -9.014  22.270 -25.394
   17    H2'    G   2          H2''        G   2  -7.917  21.973 -27.382
   18   HO2'    G   2          H2'         G   2  -8.614  20.113 -28.157
   19    H1'    G   2           H1'        G   2  -9.800  22.954 -29.216
   20    H8     G   2           H8         G   2  -8.903  25.542 -26.607
   21    H1     G   2           H1         G   2  -4.418  24.803 -31.124
   22    H21    G   2           H21        G   2  -4.878  23.031 -32.359
   23    H22    G   2           H22        G   2  -6.173  21.925 -31.958
   24    H5'    C   3           H5'        C   3  -9.046  17.511 -27.331
   25   H5''    C   3          H5''        C   3  -7.877  17.092 -26.064
   26    H4'    C   3           H4'        C   3  -7.262  16.724 -28.623
   27    H3'    C   3           H3'        C   3  -5.657  17.742 -26.284
   28    H2'    C   3          H2''        C   3  -3.853  18.370 -27.583
   29   HO2'    C   3          H2'         C   3  -4.793  16.480 -29.490
   30    H1'    C   3           H1'        C   3  -5.182  18.888 -30.016
   31    H41    C   3           H41        C   3  -2.847  24.331 -27.603
   32    H42    C   3           H42        C   3  -4.304  24.521 -26.656
   33    H5     C   3           H5         C   3  -5.940  22.768 -26.397
   34    H6     C   3           H6         C   3  -6.660  20.565 -27.194
   35    H5'    U   4           H5'        U   4  -2.802  15.141 -28.360
   36   H5''    U   4          H5''        U   4  -1.673  14.581 -27.111
   37    H4'    U   4           H4'        U   4  -0.785  16.172 -29.010
   38    H3'    U   4           H3'        U   4  -0.323  16.169 -26.038
   39    H2'    U   4          H2''        U   4   0.680  18.231 -25.996
   40   HO2'    U   4          H2'         U   4   1.492  17.676 -28.664
   41    H1'    U   4           H1'        U   4  -0.340  19.306 -28.437
   42    H3     U   4           H3         U   4  -0.618  22.570 -25.280
   43    H5     U   4           H5         U   4  -3.560  19.775 -24.146
   44    H6     U   4           H6         U   4  -2.758  18.311 -25.907
   45    H5'    U   5           H5'        U   5   3.532  16.848 -28.390
   46   H5''    U   5          H5''        U   5   4.758  15.812 -27.632
   47    H4'    U   5           H4'        U   5   5.677  18.069 -28.015
   48    H3'    U   5           H3'        U   5   5.183  16.961 -25.269
   49    H2'    U   5          H2''        U   5   5.517  18.948 -24.168
   50   HO2'    U   5          H2'         U   5   7.602  19.320 -24.743
   51    H1'    U   5           H1'        U   5   5.037  20.779 -26.303
   52    H3     U   5           H3         U   5   2.589  22.538 -22.958
   53    H5     U   5           H5         U   5   0.824  18.764 -23.569
   54    H6     U   5           H6         U   5   2.560  18.286 -25.197
   55    H5'    G   6           H5'        G   6   8.448  17.008 -22.169
   56   H5''    G   6          H5''        G   6   6.923  17.761 -22.682
   57    H4'    G   6           H4'        G   6   9.438  19.441 -22.518
   58    H3'    G   6           H3'        G   6   7.905  18.142 -20.305
   59    H2'    G   6          H2''        G   6   7.259  20.069 -19.242
   60   HO2'    G   6          H2'         G   6   8.648  21.612 -18.837
   61    H1'    G   6           H1'        G   6   7.425  21.941 -21.351
   62    H8     G   6           H8         G   6   5.060  19.019 -21.999
   63    H1     G   6           H1         G   6   2.552  23.612 -18.295
   64    H21    G   6           H21        G   6   4.103  25.082 -17.750
   65    H22    G   6           H22        G   6   5.787  24.864 -18.169
   66    H5'    A   7           H5'        A   7  11.493  20.754 -18.981
   67   H5''    A   7          H5''        A   7  12.326  19.916 -17.657
   68    H4'    A   7           H4'        A   7  12.062  22.368 -17.212
   69    H3'    A   7           H3'        A   7  10.880  20.166 -15.555
   70    H2'    A   7          H2''        A   7   9.549  21.536 -14.274
   71   HO2'    A   7          H2'         A   7  11.391  23.628 -14.855
   72    H1'    A   7           H1'        A   7   9.262  23.736 -16.033
   73    H8     A   7           H8         A   7   8.063  20.290 -17.253
   74    H61    A   7           H61        A   7   2.741  21.587 -14.386
   75    H62    A   7           H62        A   7   3.540  20.524 -15.523
   76    H2     A   7           H2         A   7   5.677  24.834 -13.411
   77    H5'    U   8           H5'        U   8  12.695  23.521 -13.129
   78   H5''    U   8          H5''        U   8  13.670  22.799 -11.833
   79    H4'    U   8           H4'        U   8  12.298  24.634 -10.925
   80    H3'    U   8           H3'        U   8  11.850  21.758 -10.191
   81    H2'    U   8          H2''        U   8   9.851  22.113  -9.122
   82   HO2'    U   8          H2'         U   8   9.934  23.502  -7.568
   83    H1'    U   8           H1'        U   8   9.066  24.568 -10.326
   84    H3     U   8           H3         U   8   5.301  22.147 -10.767
   85    H5     U   8           H5         U   8   8.139  19.918 -12.942
   86    H6     U   8           H6         U   8   9.848  21.455 -12.156
   87    H5'    U   9           H5'        U   9  12.102  24.212  -6.201
   88   H5''    U   9          H5''        U   9  12.723  23.050  -5.012
   89    H4'    U   9           H4'        U   9  10.498  24.163  -4.403
   90    H3'    U   9           H3'        U   9  11.136  21.231  -4.532
   91    H2'    U   9          H2''        U   9   8.960  20.527  -4.350
   92   HO2'    U   9          H2'         U   9   8.542  22.927  -2.892
   93    H1'    U   9           H1'        U   9   7.603  22.864  -5.247
   94    H3     U   9           H3         U   9   5.588  19.593  -7.580
   95    H5     U   9           H5         U   9   9.592  19.365  -8.869
   96    H6     U   9           H6         U   9  10.145  21.081  -7.243
   97    H5'    G  10           H5'        G  10   8.937  22.507  -0.712
   98   H5''    G  10          H5''        G  10   9.716  21.680   0.652
   99    H4'    G  10           H4'        G  10   7.217  21.613   0.803
  100    H3'    G  10           H3'        G  10   8.959  19.169   0.510
  101    H2'    G  10          H2''        G  10   7.147  17.709   0.400
  102   HO2'    G  10          H2'         G  10   5.957  18.356   2.146
  103    H1'    G  10           H1'        G  10   5.395  19.296  -1.044
  104    H8     G  10           H8         G  10   8.800  19.511  -2.638
  105    H1     G  10           H1         G  10   5.897  13.894  -3.709
  106    H21    G  10           H21        G  10   4.076  13.738  -2.471
  107    H22    G  10           H22        G  10   3.682  14.918  -1.242
  108    H5'    U  11           H5'        U  11   6.944  18.013   4.287
  109   H5''    U  11          H5''        U  11   8.019  16.820   5.040
  110    H4'    U  11           H4'        U  11   5.723  16.056   3.924
  111    H3'    U  11           H3'        U  11   8.474  14.830   3.972
  112    H2'    U  11          H2''        U  11   7.972  13.212   2.413
  113   HO2'    U  11          H2'         U  11   6.107  12.170   2.377
  114    H1'    U  11           H1'        U  11   5.903  14.535   1.004
  115    H3     U  11           H3         U  11   9.141  12.791  -1.784
  116    H5     U  11           H5         U  11  10.578  16.546  -0.522
  117    H6     U  11           H6         U  11   8.761  16.633   1.081
  118    H5'    A  12           H5'        A  12   6.004  11.504   6.577
  119   H5''    A  12          H5''        A  12   7.364  10.513   7.140
  120    H4'    A  12           H4'        A  12   5.553   9.515   5.448
  121    H3'    A  12           H3'        A  12   8.548   9.198   5.653
  122    H2'    A  12          H2''        A  12   8.698   7.995   3.670
  123   HO2'    A  12          H2'         A  12   6.910   6.937   2.744
  124    H1'    A  12           H1'        A  12   6.654   9.221   2.239
  125    H8     A  12           H8         A  12   8.882  11.891   3.703
  126    H61    A  12           H61        A  12  12.899  10.645  -0.826
  127    H62    A  12           H62        A  12  12.549  11.678   0.543
  128    H2     A  12           H2         A  12   9.733   7.471  -0.865
  129    H5'    U  13           H5'        U  13   7.377   5.655   4.279
  130   H5''    U  13          H5''        U  13   7.926   4.329   5.321
  131    H4'    U  13           H4'        U  13   8.661   3.795   3.087
  132    H3'    U  13           H3'        U  13  10.738   4.879   5.001
  133    H2'    U  13          H2''        U  13  12.408   4.784   3.381
  134   HO2'    U  13          H2'         U  13  10.691   3.012   1.959
  135    H1'    U  13           H1'        U  13  10.847   5.416   1.146
  136    H3     U  13           H3         U  13  13.873   8.777   1.322
  137    H5     U  13           H5         U  13  11.552   9.348   4.774
  138    H6     U  13           H6         U  13  10.394   7.287   4.277
  139    H5'    G  14           H5'        G  14  12.649   1.065   4.093
  140   H5''    G  14          H5''        G  14  13.964   0.897   5.271
  141    H4'    G  14           H4'        G  14  14.446   1.662   2.748
  142    H3'    G  14           H3'        G  14  15.649   2.511   5.390
  143    H2'    G  14          H2''        G  14  16.855   4.214   4.421
  144   HO2'    G  14          H2'         G  14  18.105   3.100   3.027
  145    H1'    G  14           H1'        G  14  15.258   4.543   2.052
  146    H8     G  14           H8         G  14  13.415   5.586   5.167
  147    H1     G  14           H1         G  14  17.721   9.882   3.124
  148    H21    G  14           H21        G  14  19.021   8.980   1.592
  149    H22    G  14           H22        G  14  18.955   7.276   1.203
  150    H5'    U  15           H5'        U  15  19.119   1.149   2.326
  151   H5''    U  15          H5''        U  15  20.225   0.347   3.459
  152    H4'    U  15           H4'        U  15  21.396   1.951   1.912
  153    H3'    U  15           H3'        U  15  21.349   2.113   4.909
  154    H2'    U  15          H2''        U  15  22.298   4.205   5.033
  155   HO2'    U  15          H2'         U  15  23.440   3.650   2.489
  156    H1'    U  15           H1'        U  15  21.533   5.268   2.541
  157    H3     U  15           H3         U  15  20.143   8.326   5.570
  158    H5     U  15           H5         U  15  17.656   5.001   6.287
  159    H6     U  15           H6         U  15  18.981   3.748   4.687
  160    H5'    G  16           H5'        G  16  26.061   2.735   4.087
  161   H5''    G  16          H5''        G  16  26.579   2.276   5.720
  162    H4'    G  16           H4'        G  16  26.988   4.750   4.824
  163    H3'    G  16           H3'        G  16  26.147   3.674   7.509
  164    H2'    G  16          H2''        G  16  25.591   5.728   8.351
  165   HO2'    G  16          H2'         G  16  27.436   6.827   8.289
  166    H1'    G  16           H1'        G  16  25.186   7.147   5.903
  167    H8     G  16           H8         G  16  22.888   4.210   6.903
  168    H1     G  16           H1         G  16  21.194   9.905   9.306
  169    H21    G  16           H21        G  16  22.755  11.401   8.873
  170    H22    G  16           H22        G  16  24.290  10.967   8.153
  171    H5'    U  17           H5'        U  17  30.138   6.604   8.690
  172   H5''    U  17          H5''        U  17  30.291   5.823  10.276
  173    H4'    U  17           H4'        U  17  29.906   8.456  10.094
  174    H3'    U  17           H3'        U  17  28.865   6.363  11.990
  175    H2'    U  17          H2''        U  17  27.270   7.719  12.920
  176   HO2'    U  17          H2'         U  17  29.054   9.838  12.309
  177    H1'    U  17           H1'        U  17  27.005   9.649  10.835
  178    H3     U  17           H3         U  17  22.826   8.583  12.248
  179    H5     U  17           H5         U  17  24.133   5.162  10.161
  180    H6     U  17           H6         U  17  26.329   6.183  10.003
  181    H5'    A  18           H5'        A  18  31.103  10.062  14.848
  182   H5''    A  18          H5''        A  18  30.904   9.165  16.365
  183    H4'    A  18           H4'        A  18  29.944  11.641  16.121
  184    H3'    A  18           H3'        A  18  28.739   9.172  17.387
  185    H2'    A  18          H2''        A  18  26.833  10.387  18.042
  186   HO2'    A  18          H2'         A  18  28.296  12.739  17.372
  187    H1'    A  18           H1'        A  18  26.554  11.841  15.700
  188    H8     A  18           H8         A  18  27.451   8.307  14.771
  189    H61    A  18           H61        A  18  21.576   6.777  15.900
  190    H62    A  18           H62        A  18  23.130   6.208  15.331
  191    H2     A  18           H2         A  18  22.241  10.931  17.466
  192    H5'    A  19           H5'        A  19  28.291  12.057  20.086
  193   H5''    A  19          H5''        A  19  28.977  11.776  21.698
  194    H4'    A  19           H4'        A  19  26.684  12.479  22.020
  195    H3'    A  19           H3'        A  19  27.429   9.597  22.424
  196    H2'    A  19          H2''        A  19  25.264   8.841  22.607
  197   HO2'    A  19          H2'         A  19  23.986   9.832  23.927
  198    H1'    A  19           H1'        A  19  23.913  10.787  21.095
  199    H8     A  19           H8         A  19  26.789   8.898  19.371
  200    H61    A  19           H61        A  19  22.604   4.557  18.025
  201    H62    A  19           H62        A  19  24.181   5.202  17.629
  202    H2     A  19           H2         A  19  20.703   7.500  20.823
  203    H5'    A  20           H5'        A  20  24.765  10.670  26.018
  204   H5''    A  20          H5''        A  20  25.457   9.704  27.337
  205    H4'    A  20           H4'        A  20  22.997   9.275  26.946
  206    H3'    A  20           H3'        A  20  25.178   7.200  26.748
  207    H2'    A  20          H2''        A  20  23.726   5.538  26.036
  208   HO2'    A  20          H2'         A  20  21.892   5.290  27.011
  209    H1'    A  20           H1'        A  20  21.847   7.119  24.683
  210    H8     A  20           H8         A  20  25.635   7.373  23.876
  211    H61    A  20           H61        A  20  24.561   2.956  19.690
  212    H62    A  20           H62        A  20  25.730   4.098  20.312
  213    H2     A  20           H2         A  20  20.789   3.605  22.026
  214    H5'    U  21           H5'        U  21  22.485   4.928  29.451
  215   H5''    U  21          H5''        U  21  23.598   3.732  30.144
  216    H4'    U  21           H4'        U  21  21.778   3.000  28.337
  217    H3'    U  21           H3'        U  21  24.657   2.198  28.764
  218    H2'    U  21          H2''        U  21  24.801   1.065  26.737
  219   HO2'    U  21          H2'         U  21  22.003   0.657  27.028
  220    H1'    U  21           H1'        U  21  22.707   2.342  25.336
  221    H3     U  21           H3         U  21  26.367   2.197  22.602
  222    H5     U  21           H5         U  21  27.465   4.874  25.666
  223    H6     U  21           H6         U  21  25.315   4.471  26.698
  224    H5'    U  22           H5'        U  22  21.859  -1.111  28.535
  225   H5''    U  22          H5''        U  22  22.006  -2.383  29.766
  226    H4'    U  22           H4'        U  22  21.708  -3.401  27.540
  227    H3'    U  22           H3'        U  22  24.165  -3.668  29.201
  228    H2'    U  22          H2''        U  22  25.642  -4.113  27.537
  229   HO2'    U  22          H2'         U  22  23.542  -5.678  26.443
  230    H1'    U  22           H1'        U  22  23.988  -3.644  25.222
  231    H3     U  22           H3         U  22  27.836  -1.971  23.609
  232    H5     U  22           H5         U  22  27.370   0.083  27.260
  233    H6     U  22           H6         U  22  25.366  -1.219  27.663
  234    H5'    A  23           H5'        A  23  26.276  -6.078  30.398
  235   H5''    A  23          H5''        A  23  26.267  -4.968  29.016
  236    H4'    A  23           H4'        A  23  28.364  -6.418  29.235
  237    H3'    A  23           H3'        A  23  26.763  -5.740  26.933
  238    H2'    A  23          H2''        A  23  26.231  -7.827  26.147
  239   HO2'    A  23          H2'         A  23  27.813  -8.826  25.005
  240    H1'    A  23           H1'        A  23  28.012  -9.542  27.652
  241    H8     A  23           H8         A  23  24.794  -8.756  29.301
  242    H61    A  23           H61        A  23  21.913 -12.678  25.481
  243    H62    A  23           H62        A  23  21.731 -11.619  26.862
  244    H2     A  23           H2         A  23  26.122 -12.153  24.027
  245    H5'    A  24           H5'        A  24  30.031  -4.748  23.781
  246   H5''    A  24          H5''        A  24  28.686  -3.969  22.927
  247    H4'    A  24           H4'        A  24  29.541  -6.700  22.727
  248    H3'    A  24           H3'        A  24  27.444  -4.858  21.642
  249    H2'    A  24          H2''        A  24  25.909  -6.510  21.256
  250   HO2'    A  24          H2'         A  24  27.886  -8.480  20.807
  251    H1'    A  24           H1'        A  24  27.211  -8.631  22.804
  252    H8     A  24           H8         A  24  25.549  -6.211  24.994
  253    H61    A  24           H61        A  24  20.108  -8.815  23.637
  254    H62    A  24           H62        A  24  20.966  -7.773  24.750
  255    H2     A  24           H2         A  24  23.186 -10.450  20.811
  256    H5'    U  25           H5'        U  25  27.105  -3.142  18.374
  257   H5''    U  25          H5''        U  25  26.863  -4.556  19.416
  258    H4'    U  25           H4'        U  25  26.195  -4.214  16.602
  259    H3'    U  25           H3'        U  25  25.117  -5.362  18.847
  260    H2'    U  25          H2''        U  25  26.504  -7.254  19.017
  261   HO2'    U  25          H2'         U  25  24.571  -8.249  18.712
  262    H1'    U  25           H1'        U  25  26.608  -7.617  16.050
  263    H3     U  25           H3         U  25  30.009 -10.523  16.144
  264    H5     U  25           H5         U  25  30.475  -8.458  19.787
  265    H6     U  25           H6         U  25  28.555  -7.101  19.195
  266    H5'    U  26           H5'        U  26  24.186  -6.352  20.299
  267   H5''    U  26          H5''        U  26  22.829  -7.242  19.584
  268    H4'    U  26           H4'        U  26  21.807  -6.782  21.623
  269    H3'    U  26           H3'        U  26  21.543  -4.491  19.737
  270    H2'    U  26          H2''        U  26  21.309  -2.801  21.251
  271   HO2'    U  26          H2'         U  26  19.452  -3.469  22.217
  272    H1'    U  26           H1'        U  26  22.455  -3.871  23.550
  273    H3     U  26           H3         U  26  24.836  -0.098  23.143
  274    H5     U  26           H5         U  26  25.959  -2.305  19.742
  275    H6     U  26           H6         U  26  24.294  -3.957  20.319
  276    H5'    C  27           H5'        C  27  16.745  -4.406  20.548
  277   H5''    C  27          H5''        C  27  16.494  -3.272  19.207
  278    H4'    C  27           H4'        C  27  16.281  -2.517  21.810
  279    H3'    C  27           H3'        C  27  17.470  -1.085  19.384
  280    H2'    C  27          H2''        C  27  17.992   0.774  20.718
  281   HO2'    C  27          H2'         C  27  15.973   1.180  21.586
  282    H1'    C  27           H1'        C  27  18.350  -0.658  23.121
  283    H41    C  27           H41        C  27  24.091   1.510  21.431
  284    H42    C  27           H42        C  27  23.962   0.775  19.849
  285    H5     C  27           H5         C  27  22.124  -0.645  19.214
  286    H6     C  27           H6         C  27  19.872  -1.401  19.817
  287    H5'    U  28           H5'        U  28  13.362   1.429  19.868
  288   H5''    U  28          H5''        U  28  13.440   2.541  18.488
  289    H4'    U  28           H4'        U  28  13.721   3.442  20.999
  290    H3'    U  28           H3'        U  28  15.197   4.141  18.448
  291    H2'    U  28          H2''        U  28  16.513   5.709  19.565
  292   HO2'    U  28          H2'         U  28  16.009   6.520  21.602
  293    H1'    U  28           H1'        U  28  16.898   4.228  21.885
  294    H3     U  28           H3         U  28  20.763   5.012  19.477
  295    H5     U  28           H5         U  28  18.988   1.608  17.755
  296    H6     U  28           H6         U  28  17.041   1.993  19.131
  297    H5'    U  29           H5'        U  29  13.661   8.102  20.332
  298   H5''    U  29          H5''        U  29  12.989   8.956  18.928
  299    H4'    U  29           H4'        U  29  14.496  10.413  20.304
  300    H3'    U  29           H3'        U  29  14.973   9.668  17.430
  301    H2'    U  29          H2''        U  29  17.078  10.622  17.330
  302   HO2'    U  29          H2'         U  29  16.994  12.622  18.015
  303    H1'    U  29           H1'        U  29  17.929  10.234  19.945
  304    H3     U  29           H3         U  29  20.841   8.134  17.123
  305    H5     U  29           H5         U  29  17.488   5.590  17.289
  306    H6     U  29           H6         U  29  16.327   7.313  18.541
  307    H5'    A  30           H5'        A  30  15.506  14.526  17.364
  308   H5''    A  30          H5''        A  30  15.414  14.693  15.601
  309    H4'    A  30           H4'        A  30  17.632  15.376  16.915
  310    H3'    A  30           H3'        A  30  17.290  13.870  14.305
  311    H2'    A  30          H2''        A  30  19.627  13.807  14.029
  312   HO2'    A  30          H2'         A  30  20.603  15.596  14.570
  313    H1'    A  30           H1'        A  30  20.232  13.182  16.642
  314    H8     A  30           H8         A  30  17.165  11.210  15.545
  315    H61    A  30           H61        A  30  21.012   7.465  12.512
  316    H62    A  30           H62        A  30  19.427   7.611  13.236
  317    H2     A  30           H2         A  30  23.303  11.122  13.727
  318    H5'    C  31           H5'        C  31  19.107  17.947  12.677
  319   H5''    C  31          H5''        C  31  18.782  17.819  10.938
  320    H4'    C  31           H4'        C  31  21.283  17.777  11.854
  321    H3'    C  31           H3'        C  31  19.892  16.263   9.651
  322    H2'    C  31          H2''        C  31  21.702  14.831   9.279
  323   HO2'    C  31          H2'         C  31  23.678  15.542   9.326
  324    H1'    C  31           H1'        C  31  22.685  14.614  11.841
  325    H41    C  31           H41        C  31  19.499   9.309  10.205
  326    H42    C  31           H42        C  31  18.043   9.994  10.889
  327    H5     C  31           H5         C  31  17.966  12.195  11.876
  328    H6     C  31           H6         C  31  19.191  14.290  12.200
  329    H5'    A  32           H5'        A  32  23.274  18.012   7.355
  330   H5''    A  32          H5''        A  32  22.579  18.755   5.900
  331    H4'    A  32           H4'        A  32  24.266  17.102   5.230
  332    H3'    A  32           H3'        A  32  21.331  16.628   4.767
  333    H2'    A  32          H2''        A  32  21.615  14.467   4.002
  334   HO2'    A  32          H2'         A  32  24.336  15.138   3.495
  335    H1'    A  32           H1'        A  32  23.860  13.724   5.482
  336    H8     A  32           H8         A  32  20.965  15.221   7.508
  337    H61    A  32           H61        A  32  18.528   9.540   7.420
  338    H62    A  32           H62        A  32  18.469  11.115   8.179
  339    H2     A  32           H2         A  32  22.135   9.553   4.750
  340    H5'    C  33           H5'        C  33  23.505  16.232   0.297
  341   H5''    C  33          H5''        C  33  22.035  16.123  -0.691
  342    H4'    C  33           H4'        C  33  23.825  14.132  -0.664
  343    H3'    C  33           H3'        C  33  20.798  14.085  -0.653
  344    H2'    C  33          H2''        C  33  20.806  11.711  -0.688
  345   HO2'    C  33          H2'         C  33  23.429  12.081  -1.605
  346    H1'    C  33           H1'        C  33  22.752  11.396   1.215
  347    H41    C  33           H41        C  33  17.021  11.268   4.055
  348    H42    C  33           H42        C  33  17.076  13.006   4.231
  349    H5     C  33           H5         C  33  18.947  14.338   3.488
  350    H6     C  33           H6         C  33  20.995  14.342   2.145
  351    H5'    A  34           H5'        A  34  22.094  11.964  -3.659
  352   H5''    A  34          H5''        A  34  21.721  12.165  -5.383
  353    H4'    A  34           H4'        A  34  21.252   9.866  -4.915
  354    H3'    A  34           H3'        A  34  18.988  11.793  -5.172
  355    H2'    A  34          H2''        A  34  17.374  10.489  -4.201
  356   HO2'    A  34          H2'         A  34  18.882   8.237  -5.071
  357    H1'    A  34           H1'        A  34  18.954   8.707  -2.673
  358    H8     A  34           H8         A  34  19.288  12.450  -1.883
  359    H61    A  34           H61        A  34  14.700  11.532   2.154
  360    H62    A  34           H62        A  34  15.997  12.603   1.673
  361    H2     A  34           H2         A  34  15.157   7.808  -0.300
  362    H5'    C  35           H5'        C  35  16.572  10.929  -8.705
  363   H5''    C  35          H5''        C  35  15.919  12.459  -8.086
  364    H4'    C  35           H4'        C  35  15.658   9.687  -6.981
  365    H3'    C  35           H3'        C  35  14.002  11.749  -7.975
  366    H2'    C  35          H2''        C  35  13.860  13.112  -6.129
  367   HO2'    C  35          H2'         C  35  11.828  12.163  -6.044
  368    H1'    C  35           H1'        C  35  14.365  10.955  -4.115
  369    H41    C  35           H41        C  35  15.574  16.532  -1.189
  370    H42    C  35           H42        C  35  17.213  16.419  -1.790
  371    H5     C  35           H5         C  35  17.881  14.847  -3.492
  372    H6     C  35           H6         C  35  17.190  12.907  -4.813
  373    H5'    U  36           H5'        U  36  14.699   6.193  -8.074
  374   H5''    U  36          H5''        U  36  13.234   6.318  -9.071
  375    H4'    U  36           H4'        U  36  13.018   4.236  -7.893
  376    H3'    U  36           H3'        U  36  11.429   6.614  -7.063
  377    H2'    U  36          H2''        U  36  10.778   5.858  -4.981
  378   HO2'    U  36          H2'         U  36   9.942   3.871  -5.842
  379    H1'    U  36           H1'        U  36  12.927   4.295  -4.243
  380    H3     U  36           H3         U  36  11.900   8.346  -1.914
  381    H5     U  36           H5         U  36  15.398   8.862  -4.204
  382    H6     U  36           H6         U  36  14.919   6.748  -5.293
  383    H5'    A  37           H5'        A  37   7.337   4.352  -7.932
  384   H5''    A  37          H5''        A  37   6.550   5.874  -8.390
  385    H4'    A  37           H4'        A  37   5.867   4.608  -6.140
  386    H3'    A  37           H3'        A  37   6.247   7.542  -6.768
  387    H2'    A  37          H2''        A  37   5.799   8.174  -4.566
  388   HO2'    A  37          H2'         A  37   4.130   7.145  -3.767
  389    H1'    A  37           H1'        A  37   7.163   6.143  -3.299
  390    H8     A  37           H8         A  37   9.446   7.165  -6.065
  391    H61    A  37           H61        A  37  10.654  12.378  -2.987
  392    H62    A  37           H62        A  37  11.223  11.265  -4.211
  393    H2     A  37           H2         A  37   7.039  10.482  -1.134
  394    H5'    C  38           H5'        C  38   1.918   6.510  -6.070
  395   H5''    C  38          H5''        C  38   0.679   7.413  -6.961
  396    H4'    C  38           H4'        C  38   0.360   7.602  -4.495
  397    H3'    C  38           H3'        C  38   0.984   9.917  -6.306
  398    H2'    C  38          H2''        C  38   1.266  11.446  -4.585
  399   HO2'    C  38          H2'         C  38  -0.108   9.655  -2.849
  400    H1'    C  38           H1'        C  38   2.301   9.774  -2.609
  401    H41    C  38           H41        C  38   6.991  13.376  -5.115
  402    H42    C  38           H42        C  38   7.400  12.027  -6.151
  403    H5     C  38           H5         C  38   5.980  10.109  -6.430
  404    H6     C  38           H6         C  38   3.982   8.956  -5.615
  405    H5'    A  39           H5'        A  39  -3.125  11.644  -5.288
  406   H5''    A  39          H5''        A  39  -3.278  12.752  -6.665
  407    H4'    A  39           H4'        A  39  -2.609  13.640  -4.211
  408    H3'    A  39           H3'        A  39  -1.578  14.404  -6.974
  409    H2'    A  39          H2''        A  39  -0.033  15.894  -6.035
  410   HO2'    A  39          H2'         A  39  -1.625  17.085  -4.875
  411    H1'    A  39           H1'        A  39   0.250  14.602  -3.546
  412    H8     A  39           H8         A  39   1.239  12.333  -6.383
  413    H61    A  39           H61        A  39   6.506  15.532  -6.845
  414    H62    A  39           H62        A  39   5.680  14.050  -7.270
  415    H2     A  39           H2         A  39   3.793  17.728  -4.030
  416    H5'    A  40           H5'        A  40  -3.996  17.296  -4.776
  417   H5''    A  40          H5''        A  40  -5.115  18.446  -5.534
  418    H4'    A  40           H4'        A  40  -3.765  19.667  -3.911
  419    H3'    A  40           H3'        A  40  -3.399  20.030  -6.865
  420    H2'    A  40          H2''        A  40  -1.372  21.089  -6.773
  421   HO2'    A  40          H2'         A  40  -2.255  22.071  -4.259
  422    H1'    A  40           H1'        A  40  -0.459  20.302  -4.214
  423    H8     A  40           H8         A  40  -1.188  17.627  -6.902
  424    H61    A  40           H61        A  40   4.759  18.217  -8.462
  425    H62    A  40           H62        A  40   3.314  17.249  -8.640
  426    H2     A  40           H2         A  40   3.798  21.366  -5.407
  427    H5'    A  41           H5'        A  41  -4.058  24.659  -5.667
  428   H5''    A  41          H5''        A  41  -4.338  25.292  -7.300
  429    H4'    A  41           H4'        A  41  -2.135  25.961  -5.907
  430    H3'    A  41           H3'        A  41  -2.443  25.193  -8.829
  431    H2'    A  41          H2''        A  41  -0.182  25.699  -9.192
  432   HO2'    A  41          H2'         A  41   0.845  27.209  -8.127
  433    H1'    A  41           H1'        A  41   0.688  24.703  -6.696
  434    H8     A  41           H8         A  41  -1.632  22.327  -8.563
  435    H61    A  41           H61        A  41   3.407  20.361 -11.561
  436    H62    A  41           H62        A  41   1.736  20.016 -11.177
  437    H2     A  41           H2         A  41   4.562  23.920  -9.087
  438    H5'    U  42           H5'        U  42  -0.411  29.011  -8.205
  439   H5''    U  42          H5''        U  42  -0.943  30.245  -9.367
  440    H4'    U  42           H4'        U  42   1.547  30.160  -9.243
  441    H3'    U  42           H3'        U  42   0.021  29.173 -11.677
  442    H2'    U  42          H2''        U  42   1.949  28.549 -12.798
  443   HO2'    U  42          H2'         U  42   3.805  29.610 -12.653
  444    H1'    U  42           H1'        U  42   3.516  27.934 -10.530
  445    H3     U  42           H3         U  42   3.637  24.063 -12.846
  446    H5     U  42           H5         U  42  -0.386  24.391 -11.654
  447    H6     U  42           H6         U  42   0.078  26.656 -10.948
  448    H5'    U  43           H5'        U  43   2.978  31.770 -13.819
  449   H5''    U  43          H5''        U  43   2.191  31.966 -15.396
  450    H4'    U  43           H4'        U  43   4.351  30.414 -15.134
  451    H3'    U  43           H3'        U  43   1.825  30.174 -16.758
  452    H2'    U  43          H2''        U  43   2.145  27.957 -17.310
  453   HO2'    U  43          H2'         U  43   4.174  27.080 -17.649
  454    H1'    U  43           H1'        U  43   3.887  27.176 -15.207
  455    H3     U  43           H3         U  43   0.752  23.921 -15.224
  456    H5     U  43           H5         U  43  -1.416  27.376 -14.166
  457    H6     U  43           H6         U  43   0.600  28.675 -14.529
  458    H5'    A  44           H5'        A  44   5.435  32.244 -19.969
  459   H5''    A  44          H5''        A  44   4.432  32.188 -21.433
  460    H4'    A  44           H4'        A  44   6.948  31.329 -21.499
  461    H3'    A  44           H3'        A  44   4.406  30.371 -22.769
  462    H2'    A  44          H2''        A  44   5.249  28.328 -23.466
  463   HO2'    A  44          H2'         A  44   7.829  29.495 -23.202
  464    H1'    A  44           H1'        A  44   7.042  27.782 -21.442
  465    H8     A  44           H8         A  44   4.036  28.708 -19.524
  466    H61    A  44           H61        A  44   1.297  23.494 -21.391
  467    H62    A  44           H62        A  44   1.263  24.802 -20.229
  468    H2     A  44           H2         A  44   5.054  24.020 -23.780
  469    H5'    A  45           H5'        A  45   6.784  30.508 -26.703
  470   H5''    A  45          H5''        A  45   5.453  30.781 -27.845
  471    H4'    A  45           H4'        A  45   6.763  28.456 -27.817
  472    H3'    A  45           H3'        A  45   3.828  29.104 -28.109
  473    H2'    A  45          H2''        A  45   3.220  26.869 -28.131
  474   HO2'    A  45          H2'         A  45   4.683  26.312 -29.825
  475    H1'    A  45           H1'        A  45   5.326  25.867 -26.509
  476    H8     A  45           H8         A  45   3.649  28.371 -24.405
  477    H61    A  45           H61        A  45  -1.049  24.420 -23.677
  478    H62    A  45           H62        A  45  -0.255  25.844 -23.041
  479    H2     A  45           H2         A  45   1.592  22.856 -26.948
  480    H5'    G  46           H5'        G  46   5.543  28.080 -32.665
  481   H5''    G  46          H5''        G  46   4.173  28.378 -33.753
  482    H4'    G  46           H4'        G  46   5.177  25.967 -33.685
  483    H3'    G  46           H3'        G  46   2.311  26.868 -33.492
  484    H2'    G  46          H2''        G  46   1.499  24.693 -33.189
  485   HO2'    G  46          H2'         G  46   2.729  22.855 -33.629
  486    H1'    G  46           H1'        G  46   3.483  23.779 -31.500
  487    H8     G  46           H8         G  46   2.785  27.231 -30.299
  488    H1     G  46           H1         G  46  -2.027  23.201 -28.999
  489    H21    G  46           H21        G  46  -1.735  21.298 -30.079
  490    H22    G  46           H22        G  46  -0.468  21.084 -31.266
  491    H5'    C  47           H5'        C  47   2.376  23.241 -35.665
  492   H5''    C  47          H5''        C  47   2.012  23.659 -37.353
  493    H4'    C  47           H4'        C  47   0.816  21.607 -36.844
  494    H3'    C  47           H3'        C  47  -0.638  24.211 -37.111
  495    H2'    C  47          H2''        C  47  -2.691  23.416 -36.407
  496   HO2'    C  47          H2'         C  47  -3.329  21.340 -36.589
  497    H1'    C  47           H1'        C  47  -1.841  21.547 -34.510
  498    H41    C  47           H41        C  47  -3.311  26.387 -30.710
  499    H42    C  47           H42        C  47  -2.063  27.391 -31.411
  500    H5     C  47           H5         C  47  -0.576  26.616 -33.143
  501    H6     C  47           H6         C  47  -0.160  24.842 -34.776
  502    H5'    C  48           H5'        C  48  -3.513  21.548 -38.676
  503   H5''    C  48          H5''        C  48  -4.278  22.334 -40.073
  504    H4'    C  48           H4'        C  48  -5.884  21.865 -38.160
  505    H3'    C  48           H3'        C  48  -5.220  24.632 -39.186
  506   HO3'    C  48          H3T         C  48  -7.445  22.859 -39.414
  507    H2'    C  48          H2''        C  48  -6.561  25.656 -37.627
  508   HO2'    C  48          H2'         C  48  -8.382  24.656 -36.727
  509    H1'    C  48           H1'        C  48  -6.478  23.571 -35.656
  510    H41    C  48           H41        C  48  -3.845  28.632 -32.861
  511    H42    C  48           H42        C  48  -2.545  28.654 -34.031
  512    H5     C  48           H5         C  48  -2.388  27.099 -35.860
  513    H6     C  48           H6         C  48  -3.503  25.264 -37.038
  Start of MODEL    6
    1    H5'    G   1           H5'        G   1 -10.301  31.204 -23.967
    2   H5''    G   1          H5''        G   1 -10.236  29.588 -23.235
    3    H4'    G   1           H4'        G   1 -12.020  29.671 -24.948
    4    H3'    G   1           H3'        G   1  -9.543  27.998 -25.224
    5    H2'    G   1          H2''        G   1  -9.885  27.460 -27.457
    6   HO2'    G   1          H2'         G   1 -11.760  26.689 -27.931
    7    H1'    G   1           H1'        G   1 -11.356  29.672 -28.312
    8    H8     G   1           H8         G   1  -8.443  31.387 -27.057
    9    H1     G   1           H1         G   1  -6.780  27.623 -31.975
   10    H21    G   1           H21        G   1  -8.362  26.140 -32.371
   11    H22    G   1           H22        G   1  -9.818  26.037 -31.406
   12   HO5'    G   1          H5T         G   1  -8.327  30.940 -24.553
   13    H5'    G   2           H5'        G   2 -12.233  23.931 -24.760
   14   H5''    G   2          H5''        G   2 -10.838  23.120 -24.019
   15    H4'    G   2           H4'        G   2 -11.753  22.340 -26.404
   16    H3'    G   2           H3'        G   2  -9.030  22.561 -25.184
   17    H2'    G   2          H2''        G   2  -7.847  22.485 -27.140
   18   HO2'    G   2          H2'         G   2 -10.026  20.968 -28.136
   19    H1'    G   2           H1'        G   2  -9.756  23.395 -28.987
   20    H8     G   2           H8         G   2  -9.150  25.934 -26.253
   21    H1     G   2           H1         G   2  -4.437  25.676 -30.591
   22    H21    G   2           H21        G   2  -4.738  23.936 -31.920
   23    H22    G   2           H22        G   2  -5.975  22.736 -31.619
   24    H5'    C   3           H5'        C   3  -9.023  18.579 -27.901
   25   H5''    C   3          H5''        C   3  -8.136  17.522 -26.785
   26    H4'    C   3           H4'        C   3  -7.203  17.505 -29.128
   27    H3'    C   3           H3'        C   3  -5.680  18.352 -26.668
   28    H2'    C   3          H2''        C   3  -3.816  19.028 -27.860
   29   HO2'    C   3          H2'         C   3  -4.735  17.321 -29.945
   30    H1'    C   3           H1'        C   3  -5.048  19.768 -30.277
   31    H41    C   3           H41        C   3  -2.925  25.066 -27.429
   32    H42    C   3           H42        C   3  -4.210  24.975 -26.248
   33    H5     C   3           H5         C   3  -5.892  23.248 -26.268
   34    H6     C   3           H6         C   3  -6.575  21.124 -27.288
   35    H5'    U   4           H5'        U   4  -2.794  15.744 -28.858
   36   H5''    U   4          H5''        U   4  -1.673  15.165 -27.610
   37    H4'    U   4           H4'        U   4  -0.824  16.820 -29.514
   38    H3'    U   4           H3'        U   4  -0.240  16.628 -26.568
   39    H2'    U   4          H2''        U   4   0.815  18.659 -26.451
   40   HO2'    U   4          H2'         U   4   2.366  19.084 -27.793
   41    H1'    U   4           H1'        U   4  -0.279  19.904 -28.774
   42    H3     U   4           H3         U   4  -0.312  22.947 -25.379
   43    H5     U   4           H5         U   4  -3.345  20.204 -24.366
   44    H6     U   4           H6         U   4  -2.650  18.836 -26.247
   45    H5'    U   5           H5'        U   5   3.602  17.621 -28.721
   46   H5''    U   5          H5''        U   5   4.713  16.338 -28.199
   47    H4'    U   5           H4'        U   5   5.918  18.427 -28.018
   48    H3'    U   5           H3'        U   5   4.947  17.056 -25.532
   49    H2'    U   5          H2''        U   5   5.354  18.825 -24.123
   50   HO2'    U   5          H2'         U   5   7.616  18.802 -24.780
   51    H1'    U   5           H1'        U   5   5.345  20.968 -25.995
   52    H3     U   5           H3         U   5   2.578  22.572 -22.836
   53    H5     U   5           H5         U   5   0.582  19.132 -24.221
   54    H6     U   5           H6         U   5   2.538  18.616 -25.563
   55    H5'    G   6           H5'        G   6   8.012  16.622 -22.042
   56   H5''    G   6          H5''        G   6   6.587  17.426 -22.733
   57    H4'    G   6           H4'        G   6   9.111  19.044 -22.429
   58    H3'    G   6           H3'        G   6   7.517  17.769 -20.242
   59    H2'    G   6          H2''        G   6   6.879  19.713 -19.203
   60   HO2'    G   6          H2'         G   6   8.517  20.862 -18.599
   61    H1'    G   6           H1'        G   6   7.162  21.572 -21.321
   62    H8     G   6           H8         G   6   4.675  18.768 -22.003
   63    H1     G   6           H1         G   6   2.327  23.476 -18.338
   64    H21    G   6           H21        G   6   3.937  24.867 -17.762
   65    H22    G   6           H22        G   6   5.618  24.555 -18.132
   66    H5'    A   7           H5'        A   7  11.021  20.374 -18.959
   67   H5''    A   7          H5''        A   7  11.937  19.564 -17.672
   68    H4'    A   7           H4'        A   7  11.671  21.999 -17.208
   69    H3'    A   7           H3'        A   7  10.527  19.805 -15.516
   70    H2'    A   7          H2''        A   7   9.215  21.172 -14.218
   71   HO2'    A   7          H2'         A   7   9.960  22.975 -13.400
   72    H1'    A   7           H1'        A   7   8.891  23.372 -15.970
   73    H8     A   7           H8         A   7   7.667  19.933 -17.180
   74    H61    A   7           H61        A   7   2.379  21.252 -14.259
   75    H62    A   7           H62        A   7   3.220  20.088 -15.260
   76    H2     A   7           H2         A   7   5.362  24.441 -13.243
   77    H5'    U   8           H5'        U   8  12.337  23.166 -13.159
   78   H5''    U   8          H5''        U   8  13.397  22.477 -11.914
   79    H4'    U   8           H4'        U   8  12.054  24.258 -10.908
   80    H3'    U   8           H3'        U   8  11.611  21.371 -10.222
   81    H2'    U   8          H2''        U   8   9.648  21.711  -9.082
   82   HO2'    U   8          H2'         U   8   9.784  23.081  -7.514
   83    H1'    U   8           H1'        U   8   8.809  24.165 -10.230
   84    H3     U   8           H3         U   8   5.075  21.692 -10.690
   85    H5     U   8           H5         U   8   7.936  19.537 -12.909
   86    H6     U   8           H6         U   8   9.626  21.091 -12.114
   87    H5'    U   9           H5'        U   9  12.033  23.679  -6.209
   88   H5''    U   9          H5''        U   9  12.671  22.499  -5.047
   89    H4'    U   9           H4'        U   9  10.446  23.607  -4.403
   90    H3'    U   9           H3'        U   9  11.113  20.684  -4.545
   91    H2'    U   9          H2''        U   9   8.947  19.949  -4.346
   92   HO2'    U   9          H2'         U   9   7.853  20.652  -2.713
   93    H1'    U   9           H1'        U   9   7.547  22.250  -5.246
   94    H3     U   9           H3         U   9   5.648  18.908  -7.590
   95    H5     U   9           H5         U   9   9.648  18.870  -8.914
   96    H6     U   9           H6         U   9  10.139  20.583  -7.268
   97    H5'    G  10           H5'        G  10   8.842  21.810  -0.789
   98   H5''    G  10          H5''        G  10   9.668  21.056   0.588
   99    H4'    G  10           H4'        G  10   7.193  20.798   0.749
  100    H3'    G  10           H3'        G  10   9.088  18.477   0.408
  101    H2'    G  10          H2''        G  10   7.378  16.906   0.274
  102   HO2'    G  10          H2'         G  10   6.241  17.600   2.123
  103    H1'    G  10           H1'        G  10   5.496  18.415  -1.100
  104    H8     G  10           H8         G  10   8.876  18.816  -2.735
  105    H1     G  10           H1         G  10   6.162  13.133  -3.936
  106    H21    G  10           H21        G  10   4.368  12.870  -2.680
  107    H22    G  10           H22        G  10   3.923  14.015  -1.436
  108    H5'    U  11           H5'        U  11   7.201  17.260   4.244
  109   H5''    U  11          H5''        U  11   8.307  16.087   4.986
  110    H4'    U  11           H4'        U  11   6.019  15.280   3.881
  111    H3'    U  11           H3'        U  11   8.795  14.108   3.909
  112    H2'    U  11          H2''        U  11   8.300  12.469   2.365
  113   HO2'    U  11          H2'         U  11   6.530  11.651   3.587
  114    H1'    U  11           H1'        U  11   6.217  13.764   0.957
  115    H3     U  11           H3         U  11   9.480  12.076  -1.836
  116    H5     U  11           H5         U  11  10.869  15.845  -0.558
  117    H6     U  11           H6         U  11   9.048  15.903   1.043
  118    H5'    A  12           H5'        A  12   6.520  10.817   6.681
  119   H5''    A  12          H5''        A  12   7.914   9.860   7.215
  120    H4'    A  12           H4'        A  12   6.110   8.835   5.528
  121    H3'    A  12           H3'        A  12   9.112   8.590   5.707
  122    H2'    A  12          H2''        A  12   9.282   7.426   3.703
  123   HO2'    A  12          H2'         A  12   6.519   6.837   4.035
  124    H1'    A  12           H1'        A  12   7.190   8.611   2.306
  125    H8     A  12           H8         A  12   9.366  11.316   3.791
  126    H61    A  12           H61        A  12  13.373  10.230  -0.790
  127    H62    A  12           H62        A  12  12.980  11.263   0.567
  128    H2     A  12           H2         A  12  10.277   6.989  -0.856
  129    H5'    U  13           H5'        U  13   8.051   5.086   4.199
  130   H5''    U  13          H5''        U  13   8.601   3.744   5.219
  131    H4'    U  13           H4'        U  13   9.396   3.252   3.008
  132    H3'    U  13           H3'        U  13  11.430   4.423   4.922
  133    H2'    U  13          H2''        U  13  13.103   4.332   3.298
  134   HO2'    U  13          H2'         U  13  12.595   2.128   2.702
  135    H1'    U  13           H1'        U  13  11.511   4.917   1.070
  136    H3     U  13           H3         U  13  14.471   8.336   1.189
  137    H5     U  13           H5         U  13  12.196   8.877   4.676
  138    H6     U  13           H6         U  13  11.061   6.797   4.198
  139    H5'    G  14           H5'        G  14  13.400   0.636   4.054
  140   H5''    G  14          H5''        G  14  14.743   0.498   5.203
  141    H4'    G  14           H4'        G  14  15.158   1.239   2.661
  142    H3'    G  14           H3'        G  14  16.410   2.135   5.264
  143    H2'    G  14          H2''        G  14  17.578   3.833   4.242
  144   HO2'    G  14          H2'         G  14  18.697   3.472   2.496
  145    H1'    G  14           H1'        G  14  15.921   4.112   1.907
  146    H8     G  14           H8         G  14  14.124   5.201   5.025
  147    H1     G  14           H1         G  14  18.381   9.480   2.843
  148    H21    G  14           H21        G  14  19.671   8.552   1.319
  149    H22    G  14           H22        G  14  19.610   6.840   0.964
  150    H5'    U  15           H5'        U  15  19.657   1.110   2.079
  151   H5''    U  15          H5''        U  15  20.750   0.054   2.997
  152    H4'    U  15           H4'        U  15  22.108   1.624   1.721
  153    H3'    U  15           H3'        U  15  21.869   1.882   4.707
  154    H2'    U  15          H2''        U  15  22.967   3.911   4.821
  155   HO2'    U  15          H2'         U  15  24.659   4.378   3.616
  156    H1'    U  15           H1'        U  15  22.315   4.976   2.317
  157    H3     U  15           H3         U  15  20.756   8.084   5.193
  158    H5     U  15           H5         U  15  18.346   4.722   5.988
  159    H6     U  15           H6         U  15  19.717   3.454   4.439
  160    H5'    G  16           H5'        G  16  26.581   2.350   4.115
  161   H5''    G  16          H5''        G  16  27.042   1.960   5.783
  162    H4'    G  16           H4'        G  16  27.498   4.389   4.792
  163    H3'    G  16           H3'        G  16  26.549   3.451   7.497
  164    H2'    G  16          H2''        G  16  26.006   5.554   8.213
  165   HO2'    G  16          H2'         G  16  27.371   7.151   8.017
  166    H1'    G  16           H1'        G  16  25.723   6.848   5.676
  167    H8     G  16           H8         G  16  23.278   4.057   6.713
  168    H1     G  16           H1         G  16  21.766   9.899   8.873
  169    H21    G  16           H21        G  16  23.402  11.313   8.431
  170    H22    G  16           H22        G  16  24.935  10.788   7.771
  171    H5'    U  17           H5'        U  17  30.529   6.398   8.629
  172   H5''    U  17          H5''        U  17  30.629   5.730  10.269
  173    H4'    U  17           H4'        U  17  30.273   8.346   9.890
  174    H3'    U  17           H3'        U  17  29.151   6.404  11.900
  175    H2'    U  17          H2''        U  17  27.564   7.855  12.691
  176   HO2'    U  17          H2'         U  17  29.420   9.881  11.983
  177    H1'    U  17           H1'        U  17  27.393   9.629  10.461
  178    H3     U  17           H3         U  17  23.177   8.731  11.933
  179    H5     U  17           H5         U  17  24.418   5.185  10.022
  180    H6     U  17           H6         U  17  26.636   6.148   9.827
  181    H5'    A  18           H5'        A  18  31.332  10.315  14.590
  182   H5''    A  18          H5''        A  18  31.115   9.445  16.120
  183    H4'    A  18           H4'        A  18  30.158  11.914  15.826
  184    H3'    A  18           H3'        A  18  28.927   9.462  17.106
  185    H2'    A  18          H2''        A  18  27.015  10.686  17.713
  186   HO2'    A  18          H2'         A  18  28.446  13.050  17.013
  187    H1'    A  18           H1'        A  18  26.792  12.138  15.360
  188    H8     A  18           H8         A  18  27.627   8.596  14.436
  189    H61    A  18           H61        A  18  21.727   7.155  15.556
  190    H62    A  18           H62        A  18  23.272   6.562  14.987
  191    H2     A  18           H2         A  18  22.460  11.295  17.126
  192    H5'    A  19           H5'        A  19  28.369  12.399  19.707
  193   H5''    A  19          H5''        A  19  29.004  12.148  21.346
  194    H4'    A  19           H4'        A  19  26.699  12.856  21.574
  195    H3'    A  19           H3'        A  19  27.426   9.979  22.063
  196    H2'    A  19          H2''        A  19  25.255   9.246  22.209
  197   HO2'    A  19          H2'         A  19  24.972  11.545  23.564
  198    H1'    A  19           H1'        A  19  23.957  11.224  20.665
  199    H8     A  19           H8         A  19  26.732   9.185  18.958
  200    H61    A  19           H61        A  19  22.380   4.955  17.801
  201    H62    A  19           H62        A  19  23.973   5.530  17.365
  202    H2     A  19           H2         A  19  20.621   8.053  20.523
  203    H5'    A  20           H5'        A  20  24.778  11.229  25.749
  204   H5''    A  20          H5''        A  20  25.455  10.193  27.020
  205    H4'    A  20           H4'        A  20  22.950   9.930  26.661
  206    H3'    A  20           H3'        A  20  25.010   7.733  26.460
  207    H2'    A  20          H2''        A  20  23.440   6.145  25.818
  208   HO2'    A  20          H2'         A  20  22.025   7.000  27.662
  209    H1'    A  20           H1'        A  20  21.671   7.807  24.422
  210    H8     A  20           H8         A  20  25.466   7.861  23.618
  211    H61    A  20           H61        A  20  24.172   3.459  19.481
  212    H62    A  20           H62        A  20  25.439   4.424  20.206
  213    H2     A  20           H2         A  20  20.453   4.273  21.850
  214    H5'    U  21           H5'        U  21  22.269   5.602  29.114
  215   H5''    U  21          H5''        U  21  23.331   4.397  29.865
  216    H4'    U  21           H4'        U  21  21.561   3.626  28.056
  217    H3'    U  21           H3'        U  21  24.457   2.865  28.467
  218    H2'    U  21          H2''        U  21  24.593   1.707  26.449
  219   HO2'    U  21          H2'         U  21  21.790   1.316  26.733
  220    H1'    U  21           H1'        U  21  22.506   2.967  25.043
  221    H3     U  21           H3         U  21  26.194   2.882  22.339
  222    H5     U  21           H5         U  21  27.231   5.564  25.420
  223    H6     U  21           H6         U  21  25.077   5.128  26.433
  224    H5'    U  22           H5'        U  22  21.477  -0.199  28.782
  225   H5''    U  22          H5''        U  22  21.432  -1.449  30.042
  226    H4'    U  22           H4'        U  22  21.043  -2.543  27.906
  227    H3'    U  22           H3'        U  22  23.564  -2.916  29.448
  228    H2'    U  22          H2''        U  22  24.918  -3.500  27.725
  229   HO2'    U  22          H2'         U  22  22.675  -4.985  26.823
  230    H1'    U  22           H1'        U  22  23.147  -3.024  25.493
  231    H3     U  22           H3         U  22  26.983  -1.714  23.547
  232    H5     U  22           H5         U  22  26.908   0.542  27.105
  233    H6     U  22           H6         U  22  24.852  -0.589  27.705
  234    H5'    A  23           H5'        A  23  25.575  -5.412  30.617
  235   H5''    A  23          H5''        A  23  25.556  -4.373  29.182
  236    H4'    A  23           H4'        A  23  27.558  -5.963  29.362
  237    H3'    A  23           H3'        A  23  25.864  -5.281  27.118
  238    H2'    A  23          H2''        A  23  25.188  -7.363  26.440
  239   HO2'    A  23          H2'         A  23  27.998  -7.851  26.214
  240    H1'    A  23           H1'        A  23  26.908  -9.120  27.966
  241    H8     A  23           H8         A  23  23.845  -8.021  29.717
  242    H61    A  23           H61        A  23  20.488 -11.878  26.235
  243    H62    A  23           H62        A  23  20.474 -10.799  27.612
  244    H2     A  23           H2         A  23  24.653 -11.765  24.575
  245    H5'    A  24           H5'        A  24  29.024  -4.548  23.816
  246   H5''    A  24          H5''        A  24  27.688  -3.729  22.987
  247    H4'    A  24           H4'        A  24  28.373  -6.515  22.890
  248    H3'    A  24           H3'        A  24  26.339  -4.597  21.806
  249    H2'    A  24          H2''        A  24  24.700  -6.172  21.547
  250   HO2'    A  24          H2'         A  24  26.644  -8.188  21.062
  251    H1'    A  24           H1'        A  24  25.936  -8.293  23.143
  252    H8     A  24           H8         A  24  24.508  -5.686  25.284
  253    H61    A  24           H61        A  24  18.901  -8.109  24.324
  254    H62    A  24           H62        A  24  19.806  -6.885  25.184
  255    H2     A  24           H2         A  24  21.741  -9.938  21.371
  256    H5'    U  25           H5'        U  25  25.995  -2.967  18.485
  257   H5''    U  25          H5''        U  25  25.713  -4.318  19.601
  258    H4'    U  25           H4'        U  25  24.961  -4.065  16.799
  259    H3'    U  25           H3'        U  25  23.902  -5.049  19.128
  260    H2'    U  25          H2''        U  25  25.209  -6.996  19.339
  261   HO2'    U  25          H2'         U  25  23.165  -7.844  19.147
  262    H1'    U  25           H1'        U  25  25.148  -7.494  16.387
  263    H3     U  25           H3         U  25  28.386 -10.582  16.414
  264    H5     U  25           H5         U  25  29.094  -8.489  20.002
  265    H6     U  25           H6         U  25  27.243  -7.026  19.443
  266    H5'    U  26           H5'        U  26  22.962  -5.911  20.642
  267   H5''    U  26          H5''        U  26  21.526  -6.747  20.023
  268    H4'    U  26           H4'        U  26  20.608  -6.125  22.066
  269    H3'    U  26           H3'        U  26  20.441  -3.891  20.098
  270    H2'    U  26          H2''        U  26  20.366  -2.137  21.557
  271   HO2'    U  26          H2'         U  26  18.698  -2.312  22.818
  272    H1'    U  26           H1'        U  26  21.519  -3.208  23.855
  273    H3     U  26           H3         U  26  24.125   0.385  23.238
  274    H5     U  26           H5         U  26  24.977  -2.001  19.878
  275    H6     U  26           H6         U  26  23.233  -3.520  20.570
  276    H5'    C  27           H5'        C  27  15.723  -3.392  21.069
  277   H5''    C  27          H5''        C  27  15.501  -2.300  19.688
  278    H4'    C  27           H4'        C  27  15.480  -1.422  22.263
  279    H3'    C  27           H3'        C  27  16.649  -0.193  19.715
  280    H2'    C  27          H2''        C  27  17.385   1.676  20.939
  281   HO2'    C  27          H2'         C  27  15.486   0.954  22.938
  282    H1'    C  27           H1'        C  27  17.763   0.328  23.376
  283    H41    C  27           H41        C  27  23.540   1.950  21.235
  284    H42    C  27           H42        C  27  23.260   1.131  19.713
  285    H5     C  27           H5         C  27  21.280  -0.161  19.266
  286    H6     C  27           H6         C  27  19.021  -0.703  20.040
  287    H5'    U  28           H5'        U  28  12.921   2.721  20.253
  288   H5''    U  28          H5''        U  28  13.000   3.721  18.789
  289    H4'    U  28           H4'        U  28  13.645   4.730  21.192
  290    H3'    U  28           H3'        U  28  14.944   5.073  18.473
  291    H2'    U  28          H2''        U  28  16.524   6.538  19.360
  292   HO2'    U  28          H2'         U  28  14.618   7.447  20.805
  293    H1'    U  28           H1'        U  28  16.904   5.184  21.772
  294    H3     U  28           H3         U  28  20.675   5.409  19.118
  295    H5     U  28           H5         U  28  18.479   2.091  17.748
  296    H6     U  28           H6         U  28  16.659   2.771  19.184
  297    H5'    U  29           H5'        U  29  13.951   9.252  20.214
  298   H5''    U  29          H5''        U  29  13.263  10.122  18.829
  299    H4'    U  29           H4'        U  29  14.975  11.491  20.025
  300    H3'    U  29           H3'        U  29  15.247  10.554  17.179
  301    H2'    U  29          H2''        U  29  17.419  11.308  16.940
  302   HO2'    U  29          H2'         U  29  16.868  13.442  17.716
  303    H1'    U  29           H1'        U  29  18.343  10.998  19.546
  304    H3     U  29           H3         U  29  20.989   8.523  16.773
  305    H5     U  29           H5         U  29  17.431   6.295  17.111
  306    H6     U  29           H6         U  29  16.459   8.158  18.323
  307    H5'    A  30           H5'        A  30  16.160  15.342  16.804
  308   H5''    A  30          H5''        A  30  16.013  15.418  15.038
  309    H4'    A  30           H4'        A  30  18.330  15.983  16.241
  310    H3'    A  30           H3'        A  30  17.774  14.371  13.730
  311    H2'    A  30          H2''        A  30  20.084  14.118  13.383
  312   HO2'    A  30          H2'         A  30  20.825  16.181  13.772
  313    H1'    A  30           H1'        A  30  20.743  13.638  16.028
  314    H8     A  30           H8         A  30  17.570  11.743  15.126
  315    H61    A  30           H61        A  30  21.198   7.623  12.300
  316    H62    A  30           H62        A  30  19.606   7.924  12.960
  317    H2     A  30           H2         A  30  23.658  11.260  13.195
  318    H5'    C  31           H5'        C  31  20.003  18.206  11.951
  319   H5''    C  31          H5''        C  31  19.634  18.053  10.223
  320    H4'    C  31           H4'        C  31  22.147  17.890  11.086
  321    H3'    C  31           H3'        C  31  20.625  16.389   8.960
  322    H2'    C  31          H2''        C  31  22.353  14.860   8.593
  323   HO2'    C  31          H2'         C  31  24.456  15.333   8.871
  324    H1'    C  31           H1'        C  31  23.406  14.703  11.140
  325    H41    C  31           H41        C  31  20.058   9.419   9.773
  326    H42    C  31           H42        C  31  18.616  10.186  10.399
  327    H5     C  31           H5         C  31  18.602  12.432  11.280
  328    H6     C  31           H6         C  31  19.886  14.503  11.510
  329    H5'    A  32           H5'        A  32  24.121  17.779   6.575
  330   H5''    A  32          H5''        A  32  23.446  18.504   5.102
  331    H4'    A  32           H4'        A  32  25.030  16.742   4.469
  332    H3'    A  32           H3'        A  32  22.067  16.379   4.083
  333    H2'    A  32          H2''        A  32  22.254  14.185   3.387
  334   HO2'    A  32          H2'         A  32  24.960  14.795   2.756
  335    H1'    A  32           H1'        A  32  24.517  13.421   4.840
  336    H8     A  32           H8         A  32  21.651  15.052   6.820
  337    H61    A  32           H61        A  32  19.131   9.409   6.988
  338    H62    A  32           H62        A  32  19.090  11.021   7.668
  339    H2     A  32           H2         A  32  22.747   9.245   4.337
  340    H5'    C  33           H5'        C  33  24.221  15.648  -0.384
  341   H5''    C  33          H5''        C  33  22.733  15.556  -1.346
  342    H4'    C  33           H4'        C  33  24.449  13.503  -1.271
  343    H3'    C  33           H3'        C  33  21.422  13.558  -1.197
  344    H2'    C  33          H2''        C  33  21.360  11.186  -1.161
  345   HO2'    C  33          H2'         C  33  23.053   9.924  -1.725
  346    H1'    C  33           H1'        C  33  23.354  10.870   0.699
  347    H41    C  33           H41        C  33  17.719  10.904   3.721
  348    H42    C  33           H42        C  33  17.790  12.646   3.828
  349    H5     C  33           H5         C  33  19.642  13.937   2.973
  350    H6     C  33           H6         C  33  21.648  13.875   1.569
  351    H5'    A  34           H5'        A  34  22.565  11.319  -4.111
  352   H5''    A  34          H5''        A  34  22.201  11.446  -5.843
  353    H4'    A  34           H4'        A  34  21.618   9.204  -5.291
  354    H3'    A  34           H3'        A  34  19.421  11.211  -5.530
  355    H2'    A  34          H2''        A  34  17.797   9.984  -4.482
  356   HO2'    A  34          H2'         A  34  17.428   8.126  -5.354
  357    H1'    A  34           H1'        A  34  19.380   8.177  -2.974
  358    H8     A  34           H8         A  34  19.789  11.931  -2.258
  359    H61    A  34           H61        A  34  15.357  11.114   1.972
  360    H62    A  34           H62        A  34  16.585  12.202   1.365
  361    H2     A  34           H2         A  34  15.665   7.361  -0.462
  362    H5'    C  35           H5'        C  35  16.853  10.425  -8.919
  363   H5''    C  35          H5''        C  35  16.307  11.992  -8.286
  364    H4'    C  35           H4'        C  35  16.005   9.245  -7.113
  365    H3'    C  35           H3'        C  35  14.370  11.341  -8.089
  366    H2'    C  35          H2''        C  35  14.308  12.716  -6.254
  367   HO2'    C  35          H2'         C  35  12.281  11.470  -6.198
  368    H1'    C  35           H1'        C  35  14.847  10.547  -4.252
  369    H41    C  35           H41        C  35  16.229  16.029  -1.247
  370    H42    C  35           H42        C  35  17.763  16.067  -2.085
  371    H5     C  35           H5         C  35  18.424  14.392  -3.687
  372    H6     C  35           H6         C  35  17.681  12.458  -4.993
  373    H5'    U  36           H5'        U  36  15.281   5.993  -8.117
  374   H5''    U  36          H5''        U  36  13.885   5.972  -9.217
  375    H4'    U  36           H4'        U  36  13.767   3.865  -8.109
  376    H3'    U  36           H3'        U  36  11.968   6.068  -7.237
  377    H2'    U  36          H2''        U  36  11.349   5.203  -5.188
  378   HO2'    U  36          H2'         U  36  11.131   3.073  -4.796
  379    H1'    U  36           H1'        U  36  13.599   3.780  -4.459
  380    H3     U  36           H3         U  36  12.229   7.676  -2.027
  381    H5     U  36           H5         U  36  15.759   8.478  -4.180
  382    H6     U  36           H6         U  36  15.447   6.375  -5.348
  383    H5'    A  37           H5'        A  37   8.063   3.632  -8.183
  384   H5''    A  37          H5''        A  37   7.221   5.116  -8.667
  385    H4'    A  37           H4'        A  37   6.574   3.861  -6.402
  386    H3'    A  37           H3'        A  37   6.857   6.801  -7.059
  387    H2'    A  37          H2''        A  37   6.355   7.431  -4.869
  388   HO2'    A  37          H2'         A  37   4.629   6.284  -4.265
  389    H1'    A  37           H1'        A  37   7.776   5.443  -3.574
  390    H8     A  37           H8         A  37  10.062   6.574  -6.290
  391    H61    A  37           H61        A  37  11.035  11.787  -3.132
  392    H62    A  37           H62        A  37  11.697  10.683  -4.318
  393    H2     A  37           H2         A  37   7.460   9.741  -1.360
  394    H5'    C  38           H5'        C  38   2.580   5.581  -6.437
  395   H5''    C  38          H5''        C  38   1.296   6.425  -7.324
  396    H4'    C  38           H4'        C  38   0.980   6.596  -4.855
  397    H3'    C  38           H3'        C  38   1.484   8.940  -6.668
  398    H2'    C  38          H2''        C  38   1.692  10.477  -4.943
  399   HO2'    C  38          H2'         C  38   0.332   8.608  -3.282
  400    H1'    C  38           H1'        C  38   2.797   8.849  -2.967
  401    H41    C  38           H41        C  38   7.398  12.640  -5.301
  402    H42    C  38           H42        C  38   7.695  11.476  -6.572
  403    H5     C  38           H5         C  38   6.448   9.432  -6.796
  404    H6     C  38           H6         C  38   4.512   8.165  -5.999
  405    H5'    A  39           H5'        A  39  -2.792  10.397  -5.696
  406   H5''    A  39          H5''        A  39  -2.974  11.511  -7.066
  407    H4'    A  39           H4'        A  39  -2.448  12.406  -4.575
  408    H3'    A  39           H3'        A  39  -1.403  13.291  -7.295
  409    H2'    A  39          H2''        A  39   0.006  14.872  -6.284
  410   HO2'    A  39          H2'         A  39  -1.805  14.789  -4.087
  411    H1'    A  39           H1'        A  39   0.329  13.547  -3.815
  412    H8     A  39           H8         A  39   1.503  11.439  -6.715
  413    H61    A  39           H61        A  39   6.609  14.916  -6.879
  414    H62    A  39           H62        A  39   5.872  13.416  -7.395
  415    H2     A  39           H2         A  39   3.703  16.852  -4.067
  416    H5'    A  40           H5'        A  40  -3.665  16.050  -4.849
  417   H5''    A  40          H5''        A  40  -4.886  17.111  -5.578
  418    H4'    A  40           H4'        A  40  -3.705  18.414  -3.904
  419    H3'    A  40           H3'        A  40  -3.289  18.889  -6.830
  420    H2'    A  40          H2''        A  40  -1.357  20.112  -6.667
  421   HO2'    A  40          H2'         A  40  -2.125  21.797  -5.481
  422    H1'    A  40           H1'        A  40  -0.377  19.290  -4.162
  423    H8     A  40           H8         A  40  -1.061  16.653  -6.904
  424    H61    A  40           H61        A  40   4.838  17.483  -8.538
  425    H62    A  40           H62        A  40   3.423  16.471  -8.719
  426    H2     A  40           H2         A  40   3.820  20.527  -5.398
  427    H5'    A  41           H5'        A  41  -4.484  23.361  -5.595
  428   H5''    A  41          H5''        A  41  -4.772  24.028  -7.214
  429    H4'    A  41           H4'        A  41  -2.664  24.814  -5.740
  430    H3'    A  41           H3'        A  41  -2.843  24.129  -8.692
  431    H2'    A  41          H2''        A  41  -0.618  24.818  -8.981
  432   HO2'    A  41          H2'         A  41  -0.847  26.058  -6.425
  433    H1'    A  41           H1'        A  41   0.272  23.790  -6.508
  434    H8     A  41           H8         A  41  -1.844  21.330  -8.501
  435    H61    A  41           H61        A  41   3.364  19.831 -11.482
  436    H62    A  41           H62        A  41   1.704  19.380 -11.169
  437    H2     A  41           H2         A  41   4.232  23.363  -8.856
  438    H5'    U  42           H5'        U  42  -1.139  28.035  -7.858
  439   H5''    U  42          H5''        U  42  -1.756  29.299  -8.942
  440    H4'    U  42           H4'        U  42   0.722  29.430  -8.777
  441    H3'    U  42           H3'        U  42  -0.671  28.459 -11.293
  442    H2'    U  42          H2''        U  42   1.314  28.044 -12.409
  443   HO2'    U  42          H2'         U  42   2.047  30.302 -11.550
  444    H1'    U  42           H1'        U  42   2.900  27.431 -10.159
  445    H3     U  42           H3         U  42   3.331  23.683 -12.634
  446    H5     U  42           H5         U  42  -0.720  23.668 -11.490
  447    H6     U  42           H6         U  42  -0.433  25.927 -10.681
  448    H5'    U  43           H5'        U  43   2.062  31.437 -13.234
  449   H5''    U  43          H5''        U  43   1.297  31.641 -14.821
  450    H4'    U  43           H4'        U  43   3.583  30.274 -14.568
  451    H3'    U  43           H3'        U  43   1.133  29.908 -16.284
  452    H2'    U  43          H2''        U  43   1.646  27.754 -16.926
  453   HO2'    U  43          H2'         U  43   3.809  27.049 -17.140
  454    H1'    U  43           H1'        U  43   3.415  27.024 -14.821
  455    H3     U  43           H3         U  43   0.610  23.490 -15.058
  456    H5     U  43           H5         U  43  -1.901  26.670 -13.898
  457    H6     U  43           H6         U  43  -0.018  28.173 -14.173
  458    H5'    A  44           H5'        A  44   5.109  31.818 -18.742
  459   H5''    A  44          H5''        A  44   4.400  32.274 -20.303
  460    H4'    A  44           H4'        A  44   6.750  31.250 -20.408
  461    H3'    A  44           H3'        A  44   4.278  30.418 -21.896
  462    H2'    A  44          H2''        A  44   5.208  28.481 -22.783
  463   HO2'    A  44          H2'         A  44   7.075  29.371 -23.641
  464    H1'    A  44           H1'        A  44   6.840  27.714 -20.703
  465    H8     A  44           H8         A  44   3.628  28.568 -19.030
  466    H61    A  44           H61        A  44   1.119  23.481 -21.474
  467    H62    A  44           H62        A  44   0.961  24.713 -20.243
  468    H2     A  44           H2         A  44   5.132  24.101 -23.375
  469    H5'    A  45           H5'        A  45   6.588  31.346 -25.698
  470   H5''    A  45          H5''        A  45   5.252  31.583 -26.841
  471    H4'    A  45           H4'        A  45   6.710  29.336 -26.873
  472    H3'    A  45           H3'        A  45   3.747  29.818 -27.221
  473    H2'    A  45          H2''        A  45   3.300  27.546 -27.384
  474   HO2'    A  45          H2'         A  45   6.056  27.074 -27.923
  475    H1'    A  45           H1'        A  45   5.401  26.619 -25.716
  476    H8     A  45           H8         A  45   3.509  28.880 -23.539
  477    H61    A  45           H61        A  45  -1.042  24.700 -23.308
  478    H62    A  45           H62        A  45  -0.343  26.110 -22.543
  479    H2     A  45           H2         A  45   1.815  23.468 -26.537
  480    H5'    G  46           H5'        G  46   5.387  29.370 -32.015
  481   H5''    G  46          H5''        G  46   3.855  29.554 -32.891
  482    H4'    G  46           H4'        G  46   5.239  27.275 -33.043
  483    H3'    G  46           H3'        G  46   2.298  27.870 -32.843
  484    H2'    G  46          H2''        G  46   1.686  25.618 -32.642
  485   HO2'    G  46          H2'         G  46   3.091  23.921 -33.138
  486    H1'    G  46           H1'        G  46   3.702  24.814 -30.949
  487    H8     G  46           H8         G  46   2.940  28.042 -29.442
  488    H1     G  46           H1         G  46  -2.020  24.027 -28.851
  489    H21    G  46           H21        G  46  -1.741  22.279 -30.171
  490    H22    G  46           H22        G  46  -0.431  22.179 -31.325
  491    H5'    C  47           H5'        C  47   2.551  24.390 -35.076
  492   H5''    C  47          H5''        C  47   2.152  24.800 -36.757
  493    H4'    C  47           H4'        C  47   1.036  22.702 -36.232
  494    H3'    C  47           H3'        C  47  -0.514  25.254 -36.487
  495    H2'    C  47          H2''        C  47  -2.530  24.371 -35.785
  496   HO2'    C  47          H2'         C  47  -3.084  22.272 -35.977
  497    H1'    C  47           H1'        C  47  -1.593  22.526 -33.904
  498    H41    C  47           H41        C  47  -3.364  27.267 -30.106
  499    H42    C  47           H42        C  47  -2.136  28.325 -30.764
  500    H5     C  47           H5         C  47  -0.571  27.624 -32.460
  501    H6     C  47           H6         C  47  -0.052  25.889 -34.108
  502    H5'    C  48           H5'        C  48  -3.300  22.417 -38.062
  503   H5''    C  48          H5''        C  48  -4.085  23.189 -39.455
  504    H4'    C  48           H4'        C  48  -5.675  22.600 -37.546
  505    H3'    C  48           H3'        C  48  -5.173  25.411 -38.559
  506   HO3'    C  48          H3T         C  48  -6.930  24.988 -39.769
  507    H2'    C  48          H2''        C  48  -6.594  26.335 -37.009
  508   HO2'    C  48          H2'         C  48  -8.402  25.080 -37.675
  509    H1'    C  48           H1'        C  48  -6.417  24.223 -35.068
  510    H41    C  48           H41        C  48  -4.281  29.467 -32.173
  511    H42    C  48           H42        C  48  -2.864  29.493 -33.199
  512    H5     C  48           H5         C  48  -2.589  28.039 -35.099
  513    H6     C  48           H6         C  48  -3.536  26.151 -36.339
  Start of MODEL    7
    1    H5'    G   1           H5'        G   1  -8.753  31.293 -23.166
    2   H5''    G   1          H5''        G   1  -8.686  29.729 -22.328
    3    H4'    G   1           H4'        G   1 -10.484  29.747 -24.056
    4    H3'    G   1           H3'        G   1  -8.065  27.968 -24.145
    5    H2'    G   1          H2''        G   1  -8.417  27.237 -26.318
    6   HO2'    G   1          H2'         G   1 -10.479  26.416 -25.950
    7    H1'    G   1           H1'        G   1  -9.847  29.398 -27.374
    8    H8     G   1           H8         G   1  -6.820  31.087 -26.332
    9    H1     G   1           H1         G   1  -5.480  26.850 -30.955
   10    H21    G   1           H21        G   1  -7.158  25.439 -31.206
   11    H22    G   1           H22        G   1  -8.567  25.463 -30.170
   12   HO5'    G   1          H5T         G   1  -6.636  30.028 -22.826
   13    H5'    G   2           H5'        G   2 -11.002  24.094 -23.159
   14   H5''    G   2          H5''        G   2  -9.618  23.275 -22.407
   15    H4'    G   2           H4'        G   2 -10.726  22.303 -24.636
   16    H3'    G   2           H3'        G   2  -7.929  22.458 -23.587
   17    H2'    G   2          H2''        G   2  -6.861  22.102 -25.578
   18   HO2'    G   2          H2'         G   2  -7.573  20.174 -26.211
   19    H1'    G   2           H1'        G   2  -8.777  22.974 -27.423
   20    H8     G   2           H8         G   2  -7.925  25.680 -24.922
   21    H1     G   2           H1         G   2  -3.405  24.818 -29.380
   22    H21    G   2           H21        G   2  -3.843  22.996 -30.552
   23    H22    G   2           H22        G   2  -5.130  21.894 -30.115
   24    H5'    C   3           H5'        C   3  -8.137  17.658 -25.471
   25   H5''    C   3          H5''        C   3  -6.849  17.205 -24.339
   26    H4'    C   3           H4'        C   3  -6.542  16.810 -26.954
   27    H3'    C   3           H3'        C   3  -4.640  17.759 -24.814
   28    H2'    C   3          H2''        C   3  -2.957  18.271 -26.322
   29   HO2'    C   3          H2'         C   3  -2.726  17.266 -28.291
   30    H1'    C   3           H1'        C   3  -4.515  18.956 -28.548
   31    H41    C   3           H41        C   3  -1.832  24.260 -26.202
   32    H42    C   3           H42        C   3  -3.083  24.355 -24.984
   33    H5     C   3           H5         C   3  -4.871  22.753 -24.813
   34    H6     C   3           H6         C   3  -5.726  20.605 -25.623
   35    H5'    U   4           H5'        U   4  -2.150  15.239 -27.206
   36   H5''    U   4          H5''        U   4  -0.945  14.516 -26.123
   37    H4'    U   4           H4'        U   4  -0.071  16.147 -27.940
   38    H3'    U   4           H3'        U   4   0.495  16.102 -24.985
   39    H2'    U   4          H2''        U   4   1.566  18.127 -24.976
   40   HO2'    U   4          H2'         U   4   2.252  17.601 -27.685
   41    H1'    U   4           H1'        U   4   0.495  19.236 -27.381
   42    H3     U   4           H3         U   4   0.488  22.530 -24.244
   43    H5     U   4           H5         U   4  -2.547  19.891 -22.993
   44    H6     U   4           H6         U   4  -1.862  18.369 -24.754
   45    H5'    U   5           H5'        U   5   4.438  16.804 -27.318
   46   H5''    U   5          H5''        U   5   5.529  15.622 -26.569
   47    H4'    U   5           H4'        U   5   6.690  17.765 -26.720
   48    H3'    U   5           H3'        U   5   5.802  16.661 -24.072
   49    H2'    U   5          H2''        U   5   6.222  18.583 -22.884
   50   HO2'    U   5          H2'         U   5   8.007  19.723 -23.151
   51    H1'    U   5           H1'        U   5   6.119  20.498 -24.987
   52    H3     U   5           H3         U   5   3.457  22.377 -21.883
   53    H5     U   5           H5         U   5   1.434  18.824 -22.889
   54    H6     U   5           H6         U   5   3.348  18.196 -24.243
   55    H5'    G   6           H5'        G   6   8.843  16.687 -20.608
   56   H5''    G   6          H5''        G   6   7.378  17.318 -21.389
   57    H4'    G   6           H4'        G   6   9.776  19.132 -21.274
   58    H3'    G   6           H3'        G   6   8.320  17.966 -18.936
   59    H2'    G   6          H2''        G   6   7.538  19.945 -18.082
   60   HO2'    G   6          H2'         G   6   8.698  21.914 -18.343
   61    H1'    G   6           H1'        G   6   7.635  21.602 -20.376
   62    H8     G   6           H8         G   6   5.371  18.598 -20.830
   63    H1     G   6           H1         G   6   2.723  23.272 -17.328
   64    H21    G   6           H21        G   6   4.254  24.747 -16.746
   65    H22    G   6           H22        G   6   5.905  24.662 -17.318
   66    H5'    A   7           H5'        A   7  11.610  21.021 -17.989
   67   H5''    A   7          H5''        A   7  12.631  20.333 -16.711
   68    H4'    A   7           H4'        A   7  12.304  22.740 -16.306
   69    H3'    A   7           H3'        A   7  11.148  20.622 -14.529
   70    H2'    A   7          H2''        A   7   9.837  22.056 -13.287
   71   HO2'    A   7          H2'         A   7  11.536  24.186 -14.114
   72    H1'    A   7           H1'        A   7   9.376  24.081 -15.170
   73    H8     A   7           H8         A   7   8.500  20.491 -16.240
   74    H61    A   7           H61        A   7   3.068  21.415 -13.438
   75    H62    A   7           H62        A   7   3.959  20.393 -14.543
   76    H2     A   7           H2         A   7   5.689  24.954 -12.593
   77    H5'    U   8           H5'        U   8  12.595  24.027 -12.163
   78   H5''    U   8          H5''        U   8  13.678  23.412 -10.898
   79    H4'    U   8           H4'        U   8  12.136  25.011  -9.885
   80    H3'    U   8           H3'        U   8  11.922  22.070  -9.319
   81    H2'    U   8          H2''        U   8   9.903  22.206  -8.237
   82   HO2'    U   8          H2'         U   8   9.933  23.513  -6.607
   83    H1'    U   8           H1'        U   8   8.907  24.628  -9.334
   84    H3     U   8           H3         U   8   5.383  21.918 -10.014
   85    H5     U   8           H5         U   8   8.489  19.984 -12.104
   86    H6     U   8           H6         U   8  10.025  21.653 -11.233
   87    H5'    U   9           H5'        U   9  11.906  24.286  -5.235
   88   H5''    U   9          H5''        U   9  12.611  23.135  -4.082
   89    H4'    U   9           H4'        U   9  10.287  23.991  -3.465
   90    H3'    U   9           H3'        U   9  11.158  21.130  -3.782
   91    H2'    U   9          H2''        U   9   9.036  20.261  -3.654
   92   HO2'    U   9          H2'         U   9   8.059  20.796  -1.882
   93    H1'    U   9           H1'        U   9   7.528  22.542  -4.441
   94    H3     U   9           H3         U   9   5.790  19.244  -6.964
   95    H5     U   9           H5         U   9   9.819  19.375  -8.192
   96    H6     U   9           H6         U   9  10.217  21.055  -6.486
   97    H5'    G  10           H5'        G  10   8.898  21.943   0.171
   98   H5''    G  10          H5''        G  10   9.666  20.951   1.425
   99    H4'    G  10           H4'        G  10   7.125  20.839   1.402
  100    H3'    G  10           H3'        G  10   9.004  18.495   1.093
  101    H2'    G  10          H2''        G  10   7.267  16.978   0.795
  102   HO2'    G  10          H2'         G  10   5.768  18.895   2.206
  103    H1'    G  10           H1'        G  10   5.485  18.625  -0.582
  104    H8     G  10           H8         G  10   8.810  18.959  -2.251
  105    H1     G  10           H1         G  10   6.113  13.235  -3.296
  106    H21    G  10           H21        G  10   4.437  12.927  -1.895
  107    H22    G  10           H22        G  10   3.854  14.199  -0.845
  108    H5'    U  11           H5'        U  11   6.276  16.928   3.879
  109   H5''    U  11          H5''        U  11   7.159  15.868   4.995
  110    H4'    U  11           H4'        U  11   5.386  14.755   3.467
  111    H3'    U  11           H3'        U  11   8.262  13.959   3.907
  112    H2'    U  11          H2''        U  11   8.228  12.356   2.267
  113   HO2'    U  11          H2'         U  11   6.726  10.908   2.386
  114    H1'    U  11           H1'        U  11   6.033  13.357   0.716
  115    H3     U  11           H3         U  11   9.418  11.980  -2.047
  116    H5     U  11           H5         U  11  10.656  15.715  -0.538
  117    H6     U  11           H6         U  11   8.772  15.655   0.988
  118    H5'    A  12           H5'        A  12   5.680  10.026   5.876
  119   H5''    A  12          H5''        A  12   7.127   9.195   6.480
  120    H4'    A  12           H4'        A  12   5.476   7.993   4.754
  121    H3'    A  12           H3'        A  12   8.488   8.008   5.002
  122    H2'    A  12          H2''        A  12   8.772   6.771   3.051
  123   HO2'    A  12          H2'         A  12   6.076   5.980   3.450
  124    H1'    A  12           H1'        A  12   6.632   7.778   1.583
  125    H8     A  12           H8         A  12   8.601  10.654   3.023
  126    H61    A  12           H61        A  12  12.799   9.669  -1.404
  127    H62    A  12           H62        A  12  12.188  10.816  -0.232
  128    H2     A  12           H2         A  12   9.874   6.270  -1.481
  129    H5'    U  13           H5'        U  13   7.701   4.380   3.634
  130   H5''    U  13          H5''        U  13   8.334   3.118   4.706
  131    H4'    U  13           H4'        U  13   9.166   2.598   2.515
  132    H3'    U  13           H3'        U  13  11.115   3.963   4.388
  133    H2'    U  13          H2''        U  13  12.795   3.926   2.771
  134   HO2'    U  13          H2'         U  13  13.039   2.196   1.621
  135    H1'    U  13           H1'        U  13  11.175   4.313   0.518
  136    H3     U  13           H3         U  13  13.935   7.901   0.505
  137    H5     U  13           H5         U  13  11.607   8.453   3.956
  138    H6     U  13           H6         U  13  10.594   6.295   3.559
  139    H5'    G  14           H5'        G  14  13.332   0.278   3.675
  140   H5''    G  14          H5''        G  14  14.667   0.271   4.843
  141    H4'    G  14           H4'        G  14  15.068   0.938   2.280
  142    H3'    G  14           H3'        G  14  16.222   2.024   4.857
  143    H2'    G  14          H2''        G  14  17.296   3.746   3.772
  144   HO2'    G  14          H2'         G  14  18.611   3.045   2.299
  145    H1'    G  14           H1'        G  14  15.654   3.810   1.411
  146    H8     G  14           H8         G  14  13.732   4.942   4.427
  147    H1     G  14           H1         G  14  17.800   9.348   2.141
  148    H21    G  14           H21        G  14  19.169   8.427   0.683
  149    H22    G  14           H22        G  14  19.214   6.700   0.410
  150    H5'    U  15           H5'        U  15  19.610   0.959   1.765
  151   H5''    U  15          H5''        U  15  20.766   0.089   2.794
  152    H4'    U  15           H4'        U  15  21.973   1.681   1.358
  153    H3'    U  15           H3'        U  15  21.781   2.025   4.336
  154    H2'    U  15          H2''        U  15  22.685   4.144   4.369
  155   HO2'    U  15          H2'         U  15  23.970   3.361   1.969
  156    H1'    U  15           H1'        U  15  21.961   5.052   1.817
  157    H3     U  15           H3         U  15  20.235   8.186   4.573
  158    H5     U  15           H5         U  15  18.009   4.731   5.494
  159    H6     U  15           H6         U  15  19.459   3.478   4.005
  160    H5'    G  16           H5'        G  16  26.446   2.884   3.678
  161   H5''    G  16          H5''        G  16  26.923   2.551   5.353
  162    H4'    G  16           H4'        G  16  27.196   4.996   4.339
  163    H3'    G  16           H3'        G  16  26.287   4.023   7.046
  164    H2'    G  16          H2''        G  16  25.596   6.097   7.726
  165   HO2'    G  16          H2'         G  16  27.362   7.304   7.680
  166    H1'    G  16           H1'        G  16  25.259   7.323   5.159
  167    H8     G  16           H8         G  16  22.984   4.410   6.257
  168    H1     G  16           H1         G  16  21.070  10.212   8.197
  169    H21    G  16           H21        G  16  22.618  11.713   7.725
  170    H22    G  16           H22        G  16  24.190  11.266   7.102
  171    H5'    U  17           H5'        U  17  30.084   7.218   8.142
  172   H5''    U  17          H5''        U  17  30.206   6.610   9.803
  173    H4'    U  17           H4'        U  17  29.709   9.188   9.338
  174    H3'    U  17           H3'        U  17  28.680   7.252  11.401
  175    H2'    U  17          H2''        U  17  27.008   8.636  12.133
  176   HO2'    U  17          H2'         U  17  28.651  10.802  11.289
  177    H1'    U  17           H1'        U  17  26.764  10.329   9.845
  178    H3     U  17           H3         U  17  22.586   9.275  11.307
  179    H5     U  17           H5         U  17  24.020   5.727   9.538
  180    H6     U  17           H6         U  17  26.189   6.792   9.326
  181    H5'    A  18           H5'        A  18  30.643  11.359  13.955
  182   H5''    A  18          H5''        A  18  30.452  10.550  15.521
  183    H4'    A  18           H4'        A  18  29.388  12.955  15.119
  184    H3'    A  18           H3'        A  18  28.239  10.505  16.472
  185    H2'    A  18          H2''        A  18  26.271  11.674  17.006
  186   HO2'    A  18          H2'         A  18  27.727  14.026  16.333
  187    H1'    A  18           H1'        A  18  26.022  13.015  14.591
  188    H8     A  18           H8         A  18  27.036   9.473  13.848
  189    H61    A  18           H61        A  18  21.171   7.835  14.876
  190    H62    A  18           H62        A  18  22.754   7.282  14.378
  191    H2     A  18           H2         A  18  21.687  12.067  16.277
  192    H5'    A  19           H5'        A  19  27.518  13.492  19.038
  193   H5''    A  19          H5''        A  19  28.059  13.221  20.707
  194    H4'    A  19           H4'        A  19  25.698  13.839  20.751
  195    H3'    A  19           H3'        A  19  26.572  11.029  21.370
  196    H2'    A  19          H2''        A  19  24.443  10.164  21.408
  197   HO2'    A  19          H2'         A  19  23.418  12.772  21.898
  198    H1'    A  19           H1'        A  19  23.126  12.015  19.728
  199    H8     A  19           H8         A  19  26.105  10.129  18.215
  200    H61    A  19           H61        A  19  22.116   5.571  16.990
  201    H62    A  19           H62        A  19  23.682   6.250  16.605
  202    H2     A  19           H2         A  19  20.018   8.609  19.535
  203    H5'    A  20           H5'        A  20  23.474  12.132  24.429
  204   H5''    A  20          H5''        A  20  24.082  11.497  25.969
  205    H4'    A  20           H4'        A  20  21.777  10.708  25.563
  206    H3'    A  20           H3'        A  20  24.128   8.814  25.535
  207    H2'    A  20          H2''        A  20  22.827   6.999  24.899
  208   HO2'    A  20          H2'         A  20  21.281   7.688  26.718
  209    H1'    A  20           H1'        A  20  20.820   8.347  23.474
  210    H8     A  20           H8         A  20  24.606   8.732  22.671
  211    H61    A  20           H61        A  20  23.791   3.986  18.800
  212    H62    A  20           H62        A  20  24.886   5.246  19.322
  213    H2     A  20           H2         A  20  19.942   4.660  20.999
  214    H5'    U  21           H5'        U  21  21.471   6.551  28.319
  215   H5''    U  21          H5''        U  21  22.621   5.455  29.109
  216    H4'    U  21           H4'        U  21  20.869   4.518  27.331
  217    H3'    U  21           H3'        U  21  23.788   3.887  27.814
  218    H2'    U  21          H2''        U  21  23.947   2.558  25.898
  219   HO2'    U  21          H2'         U  21  21.121   2.237  25.961
  220    H1'    U  21           H1'        U  21  21.879   3.709  24.381
  221    H3     U  21           H3         U  21  25.610   3.548  21.745
  222    H5     U  21           H5         U  21  26.535   6.435  24.673
  223    H6     U  21           H6         U  21  24.385   5.993  25.693
  224    H5'    U  22           H5'        U  22  21.396   0.486  27.269
  225   H5''    U  22          H5''        U  22  21.474  -0.709  28.580
  226    H4'    U  22           H4'        U  22  21.488  -1.901  26.445
  227    H3'    U  22           H3'        U  22  24.034  -1.688  28.074
  228    H2'    U  22          H2''        U  22  25.359  -2.554  26.443
  229   HO2'    U  22          H2'         U  22  24.456  -4.581  26.422
  230    H1'    U  22           H1'        U  22  23.531  -2.227  24.231
  231    H3     U  22           H3         U  22  28.129  -1.512  23.379
  232    H5     U  22           H5         U  22  26.187   2.179  23.965
  233    H6     U  22           H6         U  22  24.311   0.961  24.919
  234    H5'    A  23           H5'        A  23  26.464  -4.311  29.118
  235   H5''    A  23          H5''        A  23  26.367  -3.730  27.447
  236    H4'    A  23           H4'        A  23  28.115  -5.588  27.984
  237    H3'    A  23           H3'        A  23  26.489  -4.987  25.703
  238    H2'    A  23          H2''        A  23  25.247  -6.903  25.527
  239   HO2'    A  23          H2'         A  23  27.325  -7.376  24.219
  240    H1'    A  23           H1'        A  23  26.717  -8.746  27.235
  241    H8     A  23           H8         A  23  24.097  -6.766  28.915
  242    H61    A  23           H61        A  23  19.752 -10.328  26.329
  243    H62    A  23           H62        A  23  20.087  -9.141  27.571
  244    H2     A  23           H2         A  23  23.707 -11.397  24.503
  245    H5'    A  24           H5'        A  24  29.619  -5.405  22.329
  246   H5''    A  24          H5''        A  24  28.442  -4.425  21.435
  247    H4'    A  24           H4'        A  24  28.478  -7.280  21.767
  248    H3'    A  24           H3'        A  24  26.851  -5.130  20.442
  249    H2'    A  24          H2''        A  24  24.903  -6.324  20.484
  250   HO2'    A  24          H2'         A  24  24.952  -8.660  20.150
  251    H1'    A  24           H1'        A  24  25.811  -8.431  22.322
  252    H8     A  24           H8         A  24  24.955  -5.310  24.078
  253    H61    A  24           H61        A  24  19.002  -6.954  23.776
  254    H62    A  24           H62        A  24  20.142  -5.792  24.419
  255    H2     A  24           H2         A  24  21.338  -9.628  21.030
  256    H5'    U  25           H5'        U  25  26.435  -3.967  17.167
  257   H5''    U  25          H5''        U  25  26.047  -5.214  18.367
  258    H4'    U  25           H4'        U  25  25.168  -4.976  15.575
  259    H3'    U  25           H3'        U  25  24.061  -5.495  18.027
  260    H2'    U  25          H2''        U  25  24.912  -7.651  18.402
  261   HO2'    U  25          H2'         U  25  22.665  -8.033  16.699
  262    H1'    U  25           H1'        U  25  24.650  -8.435  15.530
  263    H3     U  25           H3         U  25  27.183 -12.096  15.964
  264    H5     U  25           H5         U  25  28.584  -9.646  19.093
  265    H6     U  25           H6         U  25  27.002  -7.948  18.392
  266    H5'    U  26           H5'        U  26  23.061  -6.020  19.673
  267   H5''    U  26          H5''        U  26  21.473  -6.622  19.162
  268    H4'    U  26           H4'        U  26  20.811  -5.703  21.193
  269    H3'    U  26           H3'        U  26  20.788  -3.711  18.990
  270    H2'    U  26          H2''        U  26  21.042  -1.799  20.213
  271   HO2'    U  26          H2'         U  26  19.869  -1.433  21.939
  272    H1'    U  26           H1'        U  26  22.247  -2.714  22.547
  273    H3     U  26           H3         U  26  25.170   0.410  21.171
  274    H5     U  26           H5         U  26  25.423  -2.527  18.165
  275    H6     U  26           H6         U  26  23.628  -3.724  19.249
  276    H5'    C  27           H5'        C  27  15.935  -3.147  20.146
  277   H5''    C  27          H5''        C  27  15.636  -2.087  18.755
  278    H4'    C  27           H4'        C  27  15.529  -1.169  21.301
  279    H3'    C  27           H3'        C  27  16.705   0.063  18.764
  280    H2'    C  27          H2''        C  27  17.358   1.970  19.944
  281   HO2'    C  27          H2'         C  27  15.171   1.310  21.600
  282    H1'    C  27           H1'        C  27  17.667   0.688  22.456
  283    H41    C  27           H41        C  27  23.493   2.517  20.661
  284    H42    C  27           H42        C  27  23.439   1.465  19.264
  285    H5     C  27           H5         C  27  21.453   0.282  18.586
  286    H6     C  27           H6         C  27  19.156  -0.305  19.203
  287    H5'    U  28           H5'        U  28  12.701   2.731  19.148
  288   H5''    U  28          H5''        U  28  12.752   3.720  17.676
  289    H4'    U  28           H4'        U  28  13.182   4.814  20.089
  290    H3'    U  28           H3'        U  28  14.575   5.238  17.429
  291    H2'    U  28          H2''        U  28  15.988   6.839  18.356
  292   HO2'    U  28          H2'         U  28  13.930   7.110  20.223
  293    H1'    U  28           H1'        U  28  16.379   5.560  20.802
  294    H3     U  28           H3         U  28  20.227   6.021  18.287
  295    H5     U  28           H5         U  28  18.332   2.530  16.896
  296    H6     U  28           H6         U  28  16.415   3.094  18.253
  297    H5'    U  29           H5'        U  29  13.183   9.313  19.171
  298   H5''    U  29          H5''        U  29  12.449  10.116  17.769
  299    H4'    U  29           H4'        U  29  13.952  11.662  19.011
  300    H3'    U  29           H3'        U  29  14.461  10.746  16.189
  301    H2'    U  29          H2''        U  29  16.547  11.738  16.046
  302   HO2'    U  29          H2'         U  29  15.693  13.396  18.190
  303    H1'    U  29           H1'        U  29  17.390  11.502  18.679
  304    H3     U  29           H3         U  29  20.343   9.265  16.014
  305    H5     U  29           H5         U  29  16.991   6.728  16.245
  306    H6     U  29           H6         U  29  15.812   8.502  17.408
  307    H5'    A  30           H5'        A  30  14.921  15.520  15.670
  308   H5''    A  30          H5''        A  30  14.847  15.523  13.899
  309    H4'    A  30           H4'        A  30  17.066  16.283  15.178
  310    H3'    A  30           H3'        A  30  16.727  14.564  12.701
  311    H2'    A  30          H2''        A  30  19.060  14.456  12.457
  312   HO2'    A  30          H2'         A  30  19.264  16.469  14.462
  313    H1'    A  30           H1'        A  30  19.641  14.111  15.141
  314    H8     A  30           H8         A  30  16.653  11.954  14.197
  315    H61    A  30           H61        A  30  20.654   8.047  11.594
  316    H62    A  30           H62        A  30  19.049   8.222  12.266
  317    H2     A  30           H2         A  30  22.822  11.872  12.473
  318    H5'    C  31           H5'        C  31  18.725  18.505  10.855
  319   H5''    C  31          H5''        C  31  18.424  18.263   9.125
  320    H4'    C  31           H4'        C  31  20.913  18.318  10.069
  321    H3'    C  31           H3'        C  31  19.568  16.647   7.954
  322    H2'    C  31          H2''        C  31  21.388  15.212   7.697
  323   HO2'    C  31          H2'         C  31  23.297  16.047   7.567
  324    H1'    C  31           H1'        C  31  22.376  15.208  10.277
  325    H41    C  31           H41        C  31  19.370   9.689   9.067
  326    H42    C  31           H42        C  31  17.873  10.395   9.633
  327    H5     C  31           H5         C  31  17.708  12.676  10.403
  328    H6     C  31           H6         C  31  18.866  14.825  10.570
  329    H5'    A  32           H5'        A  32  22.992  18.177   5.543
  330   H5''    A  32          H5''        A  32  22.277  18.759   4.026
  331    H4'    A  32           H4'        A  32  23.977  17.047   3.537
  332    H3'    A  32           H3'        A  32  21.040  16.535   3.106
  333    H2'    A  32          H2''        A  32  21.340  14.318   2.537
  334   HO2'    A  32          H2'         A  32  24.052  14.962   1.956
  335    H1'    A  32           H1'        A  32  23.628  13.749   4.051
  336    H8     A  32           H8         A  32  20.634  15.271   5.924
  337    H61    A  32           H61        A  32  18.497   9.484   6.330
  338    H62    A  32           H62        A  32  18.325  11.123   6.915
  339    H2     A  32           H2         A  32  22.134   9.447   3.703
  340    H5'    C  33           H5'        C  33  23.389  15.680  -1.250
  341   H5''    C  33          H5''        C  33  21.943  15.473  -2.257
  342    H4'    C  33           H4'        C  33  23.750  13.514  -2.041
  343    H3'    C  33           H3'        C  33  20.724  13.422  -2.053
  344    H2'    C  33          H2''        C  33  20.771  11.054  -1.909
  345   HO2'    C  33          H2'         C  33  23.589  11.166  -2.308
  346    H1'    C  33           H1'        C  33  22.735  10.913   0.003
  347    H41    C  33           H41        C  33  17.036  10.773   2.906
  348    H42    C  33           H42        C  33  17.004  12.519   2.924
  349    H5     C  33           H5         C  33  18.802  13.871   2.049
  350    H6     C  33           H6         C  33  20.844  13.859   0.697
  351    H5'    A  34           H5'        A  34  22.010  11.010  -4.803
  352   H5''    A  34          H5''        A  34  21.617  11.082  -6.532
  353    H4'    A  34           H4'        A  34  21.162   8.823  -5.889
  354    H3'    A  34           H3'        A  34  18.885  10.717  -6.256
  355    H2'    A  34          H2''        A  34  17.292   9.473  -5.180
  356   HO2'    A  34          H2'         A  34  17.052   7.388  -5.555
  357    H1'    A  34           H1'        A  34  18.918   7.792  -3.575
  358    H8     A  34           H8         A  34  19.153  11.588  -3.004
  359    H61    A  34           H61        A  34  14.660  10.757   1.159
  360    H62    A  34           H62        A  34  15.917  11.837   0.599
  361    H2     A  34           H2         A  34  15.206   6.913  -1.087
  362    H5'    C  35           H5'        C  35  16.294   9.740  -9.549
  363   H5''    C  35          H5''        C  35  15.759  11.328  -8.961
  364    H4'    C  35           H4'        C  35  15.481   8.623  -7.681
  365    H3'    C  35           H3'        C  35  13.819  10.647  -8.745
  366    H2'    C  35          H2''        C  35  13.788  12.130  -6.989
  367   HO2'    C  35          H2'         C  35  12.223   9.971  -6.015
  368    H1'    C  35           H1'        C  35  14.322  10.073  -4.877
  369    H41    C  35           H41        C  35  15.691  15.769  -2.258
  370    H42    C  35           H42        C  35  17.299  15.628  -2.932
  371    H5     C  35           H5         C  35  17.894  13.965  -4.570
  372    H6     C  35           H6         C  35  17.144  11.963  -5.764
  373    H5'    U  36           H5'        U  36  14.610   5.222  -8.581
  374   H5''    U  36          H5''        U  36  13.122   5.211  -9.552
  375    H4'    U  36           H4'        U  36  13.037   3.171  -8.306
  376    H3'    U  36           H3'        U  36  11.367   5.487  -7.456
  377    H2'    U  36          H2''        U  36  10.841   4.742  -5.332
  378   HO2'    U  36          H2'         U  36  11.563   2.115  -6.165
  379    H1'    U  36           H1'        U  36  13.112   3.350  -4.644
  380    H3     U  36           H3         U  36  11.935   7.474  -2.493
  381    H5     U  36           H5         U  36  15.338   8.023  -4.912
  382    H6     U  36           H6         U  36  14.941   5.826  -5.857
  383    H5'    A  37           H5'        A  37   7.294   3.211  -7.927
  384   H5''    A  37          H5''        A  37   6.528   4.707  -8.495
  385    H4'    A  37           H4'        A  37   5.923   3.693  -6.102
  386    H3'    A  37           H3'        A  37   6.387   6.548  -7.001
  387    H2'    A  37          H2''        A  37   6.013   7.363  -4.850
  388   HO2'    A  37          H2'         A  37   4.403   6.494  -3.822
  389    H1'    A  37           H1'        A  37   7.327   5.358  -3.463
  390    H8     A  37           H8         A  37   9.621   6.174  -6.276
  391    H61    A  37           H61        A  37  10.972  11.503  -3.459
  392    H62    A  37           H62        A  37  11.529  10.302  -4.603
  393    H2     A  37           H2         A  37   7.330   9.782  -1.493
  394    H5'    C  38           H5'        C  38   2.551   5.737  -5.236
  395   H5''    C  38          H5''        C  38   1.107   6.279  -6.114
  396    H4'    C  38           H4'        C  38   0.750   6.725  -3.751
  397    H3'    C  38           H3'        C  38   1.265   8.974  -5.671
  398    H2'    C  38          H2''        C  38   1.459  10.607  -4.036
  399   HO2'    C  38          H2'         C  38   0.093   8.826  -2.287
  400    H1'    C  38           H1'        C  38   2.585   9.117  -1.976
  401    H41    C  38           H41        C  38   7.227  12.643  -4.612
  402    H42    C  38           H42        C  38   7.440  11.430  -5.854
  403    H5     C  38           H5         C  38   6.107   9.433  -5.979
  404    H6     C  38           H6         C  38   4.168   8.251  -5.069
  405    H5'    A  39           H5'        A  39  -2.917  10.557  -4.778
  406   H5''    A  39          H5''        A  39  -3.104  11.577  -6.218
  407    H4'    A  39           H4'        A  39  -2.484  12.628  -3.813
  408    H3'    A  39           H3'        A  39  -1.472  13.288  -6.609
  409    H2'    A  39          H2''        A  39  -0.002  14.892  -5.733
  410   HO2'    A  39          H2'         A  39  -0.453  16.072  -3.934
  411    H1'    A  39           H1'        A  39   0.289  13.738  -3.165
  412    H8     A  39           H8         A  39   1.464  11.410  -5.881
  413    H61    A  39           H61        A  39   6.588  14.835  -6.314
  414    H62    A  39           H62        A  39   5.839  13.307  -6.719
  415    H2     A  39           H2         A  39   3.696  16.999  -3.658
  416    H5'    A  40           H5'        A  40  -3.403  16.206  -4.121
  417   H5''    A  40          H5''        A  40  -4.696  17.196  -4.828
  418    H4'    A  40           H4'        A  40  -3.552  18.620  -3.255
  419    H3'    A  40           H3'        A  40  -3.131  18.970  -6.198
  420    H2'    A  40          H2''        A  40  -1.230  20.243  -6.088
  421   HO2'    A  40          H2'         A  40  -2.159  21.109  -3.540
  422    H1'    A  40           H1'        A  40  -0.229  19.556  -3.557
  423    H8     A  40           H8         A  40  -0.886  16.787  -6.179
  424    H61    A  40           H61        A  40   4.981  17.675  -7.907
  425    H62    A  40           H62        A  40   3.583  16.633  -8.044
  426    H2     A  40           H2         A  40   3.924  20.818  -4.882
  427    H5'    A  41           H5'        A  41  -4.299  23.518  -5.097
  428   H5''    A  41          H5''        A  41  -4.596  24.105  -6.745
  429    H4'    A  41           H4'        A  41  -2.521  25.017  -5.300
  430    H3'    A  41           H3'        A  41  -2.650  24.187  -8.216
  431    H2'    A  41          H2''        A  41  -0.448  24.941  -8.515
  432   HO2'    A  41          H2'         A  41   0.357  26.573  -7.445
  433    H1'    A  41           H1'        A  41   0.444  24.060  -5.983
  434    H8     A  41           H8         A  41  -1.547  21.446  -7.918
  435    H61    A  41           H61        A  41   3.773  20.022 -10.736
  436    H62    A  41           H62        A  41   2.111  19.546 -10.470
  437    H2     A  41           H2         A  41   4.458  23.686  -8.244
  438    H5'    U  42           H5'        U  42  -1.178  28.240  -7.525
  439   H5''    U  42          H5''        U  42  -1.832  29.417  -8.683
  440    H4'    U  42           H4'        U  42   0.632  29.691  -8.450
  441    H3'    U  42           H3'        U  42  -0.629  28.551 -10.965
  442    H2'    U  42          H2''        U  42   1.412  28.219 -12.008
  443   HO2'    U  42          H2'         U  42   3.080  29.537 -11.783
  444    H1'    U  42           H1'        U  42   2.955  27.773  -9.689
  445    H3     U  42           H3         U  42   3.673  23.980 -12.026
  446    H5     U  42           H5         U  42  -0.396  23.754 -10.975
  447    H6     U  42           H6         U  42  -0.267  26.056 -10.246
  448    H5'    U  43           H5'        U  43   1.942  31.693 -12.906
  449   H5''    U  43          H5''        U  43   1.236  31.791 -14.531
  450    H4'    U  43           H4'        U  43   3.614  30.627 -14.137
  451    H3'    U  43           H3'        U  43   1.290  30.015 -15.953
  452    H2'    U  43          H2''        U  43   2.015  27.899 -16.510
  453   HO2'    U  43          H2'         U  43   4.599  28.994 -16.124
  454    H1'    U  43           H1'        U  43   3.730  27.373 -14.304
  455    H3     U  43           H3         U  43   1.258  23.604 -14.589
  456    H5     U  43           H5         U  43  -1.568  26.570 -13.602
  457    H6     U  43           H6         U  43   0.185  28.228 -13.835
  458    H5'    A  44           H5'        A  44   5.527  31.758 -18.122
  459   H5''    A  44          H5''        A  44   4.879  32.179 -19.720
  460    H4'    A  44           H4'        A  44   7.279  31.296 -19.717
  461    H3'    A  44           H3'        A  44   4.933  30.305 -21.300
  462    H2'    A  44          H2''        A  44   5.976  28.388 -22.087
  463   HO2'    A  44          H2'         A  44   7.897  28.645 -22.867
  464    H1'    A  44           H1'        A  44   7.591  27.759 -19.940
  465    H8     A  44           H8         A  44   4.291  28.463 -18.384
  466    H61    A  44           H61        A  44   2.211  23.112 -20.659
  467    H62    A  44           H62        A  44   1.869  24.455 -19.593
  468    H2     A  44           H2         A  44   6.179  23.978 -22.558
  469    H5'    A  45           H5'        A  45   7.412  30.867 -24.997
  470   H5''    A  45          H5''        A  45   6.125  31.065 -26.203
  471    H4'    A  45           H4'        A  45   7.521  28.792 -26.061
  472    H3'    A  45           H3'        A  45   4.579  29.316 -26.501
  473    H2'    A  45          H2''        A  45   4.073  27.054 -26.524
  474   HO2'    A  45          H2'         A  45   5.391  25.540 -27.309
  475    H1'    A  45           H1'        A  45   6.135  26.179 -24.774
  476    H8     A  45           H8         A  45   4.226  28.628 -22.806
  477    H61    A  45           H61        A  45  -0.329  24.477 -22.295
  478    H62    A  45           H62        A  45   0.358  25.949 -21.643
  479    H2     A  45           H2         A  45   2.556  23.001 -25.395
  480    H5'    G  46           H5'        G  46   6.328  28.149 -31.177
  481   H5''    G  46          H5''        G  46   4.802  28.278 -32.074
  482    H4'    G  46           H4'        G  46   6.175  25.990 -32.069
  483    H3'    G  46           H3'        G  46   3.236  26.610 -31.922
  484    H2'    G  46          H2''        G  46   2.609  24.385 -31.552
  485   HO2'    G  46          H2'         G  46   5.229  23.725 -32.447
  486    H1'    G  46           H1'        G  46   4.623  23.679 -29.815
  487    H8     G  46           H8         G  46   3.842  27.056 -28.614
  488    H1     G  46           H1         G  46  -1.026  23.033 -27.525
  489    H21    G  46           H21        G  46  -0.732  21.160 -28.656
  490    H22    G  46           H22        G  46   0.551  20.970 -29.830
  491    H5'    C  47           H5'        C  47   3.405  22.929 -33.788
  492   H5''    C  47          H5''        C  47   3.057  23.211 -35.505
  493    H4'    C  47           H4'        C  47   1.842  21.217 -34.859
  494    H3'    C  47           H3'        C  47   0.398  23.804 -35.292
  495    H2'    C  47          H2''        C  47  -1.657  23.057 -34.543
  496   HO2'    C  47          H2'         C  47  -2.295  20.974 -34.584
  497    H1'    C  47           H1'        C  47  -0.807  21.321 -32.524
  498    H41    C  47           H41        C  47  -2.262  26.398 -29.043
  499    H42    C  47           H42        C  47  -1.014  27.352 -29.809
  500    H5     C  47           H5         C  47   0.470  26.465 -31.490
  501    H6     C  47           H6         C  47   0.871  24.595 -33.017
  502    H5'    C  48           H5'        C  48  -2.487  21.030 -36.750
  503   H5''    C  48          H5''        C  48  -3.242  21.765 -38.177
  504    H4'    C  48           H4'        C  48  -4.853  21.360 -36.250
  505    H3'    C  48           H3'        C  48  -4.212  24.077 -37.407
  506   HO3'    C  48          H3T         C  48  -5.379  22.736 -38.742
  507    H2'    C  48          H2''        C  48  -5.573  25.163 -35.910
  508   HO2'    C  48          H2'         C  48  -7.443  24.339 -35.146
  509    H1'    C  48           H1'        C  48  -5.464  23.191 -33.824
  510    H41    C  48           H41        C  48  -2.855  28.400 -31.297
  511    H42    C  48           H42        C  48  -1.603  28.423 -32.518
  512    H5     C  48           H5         C  48  -1.409  26.741 -34.231
  513    H6     C  48           H6         C  48  -2.508  24.834 -35.306
  Start of MODEL    8
    1    H5'    G   1           H5'        G   1  -8.067  32.019 -22.294
    2   H5''    G   1          H5''        G   1  -8.103  30.390 -21.590
    3    H4'    G   1           H4'        G   1  -9.958  30.682 -23.218
    4    H3'    G   1           H3'        G   1  -7.682  28.762 -23.596
    5    H2'    G   1          H2''        G   1  -8.157  28.285 -25.811
    6   HO2'    G   1          H2'         G   1 -10.165  27.504 -25.711
    7    H1'    G   1           H1'        G   1  -9.512  30.613 -26.576
    8    H8     G   1           H8         G   1  -6.326  32.003 -25.570
    9    H1     G   1           H1         G   1  -5.542  28.152 -30.639
   10    H21    G   1           H21        G   1  -7.312  26.863 -30.896
   11    H22    G   1           H22        G   1  -8.702  26.952 -29.837
   12   HO5'    G   1          H5T         G   1  -6.511  31.079 -23.832
   13    H5'    G   2           H5'        G   2 -11.015  25.086 -22.691
   14   H5''    G   2          H5''        G   2  -9.677  24.041 -22.175
   15    H4'    G   2           H4'        G   2 -11.148  23.408 -24.316
   16    H3'    G   2           H3'        G   2  -8.248  23.135 -23.618
   17    H2'    G   2          H2''        G   2  -7.479  22.797 -25.753
   18   HO2'    G   2          H2'         G   2  -8.657  21.774 -27.336
   19    H1'    G   2           H1'        G   2  -9.399  24.127 -27.268
   20    H8     G   2           H8         G   2  -8.064  26.451 -24.630
   21    H1     G   2           H1         G   2  -3.948  25.500 -29.444
   22    H21    G   2           H21        G   2  -4.652  23.841 -30.721
   23    H22    G   2           H22        G   2  -6.022  22.845 -30.287
   24    H5'    C   3           H5'        C   3  -8.948  18.662 -25.881
   25   H5''    C   3          H5''        C   3  -7.721  17.978 -24.797
   26    H4'    C   3           H4'        C   3  -7.390  17.866 -27.433
   27    H3'    C   3           H3'        C   3  -5.474  18.412 -25.172
   28    H2'    C   3          H2''        C   3  -3.737  19.016 -26.568
   29   HO2'    C   3          H2'         C   3  -3.339  18.039 -28.432
   30    H1'    C   3           H1'        C   3  -5.204  19.975 -28.770
   31    H41    C   3           H41        C   3  -2.210  24.930 -26.091
   32    H42    C   3           H42        C   3  -3.401  24.973 -24.812
   33    H5     C   3           H5         C   3  -5.260  23.444 -24.695
   34    H6     C   3           H6         C   3  -6.252  21.415 -25.648
   35    H5'    U   4           H5'        U   4  -3.011  15.561 -27.776
   36   H5''    U   4          H5''        U   4  -1.878  14.913 -26.574
   37    H4'    U   4           H4'        U   4  -0.993  16.454 -28.551
   38    H3'    U   4           H3'        U   4  -0.281  16.276 -25.633
   39    H2'    U   4          H2''        U   4   0.936  18.217 -25.614
   40   HO2'    U   4          H2'         U   4   2.454  18.478 -27.034
   41    H1'    U   4           H1'        U   4  -0.160  19.491 -27.921
   42    H3     U   4           H3         U   4   0.161  22.671 -24.695
   43    H5     U   4           H5         U   4  -2.957  20.167 -23.377
   44    H6     U   4           H6         U   4  -2.443  18.666 -25.212
   45    H5'    U   5           H5'        U   5   3.601  16.631 -28.188
   46   H5''    U   5          H5''        U   5   4.729  15.529 -27.375
   47    H4'    U   5           H4'        U   5   5.728  17.791 -27.771
   48    H3'    U   5           H3'        U   5   5.299  16.539 -25.077
   49    H2'    U   5          H2''        U   5   5.742  18.442 -23.870
   50   HO2'    U   5          H2'         U   5   7.349  19.803 -24.370
   51    H1'    U   5           H1'        U   5   5.235  20.423 -25.850
   52    H3     U   5           H3         U   5   2.878  22.006 -22.355
   53    H5     U   5           H5         U   5   1.085  18.274 -23.109
   54    H6     U   5           H6         U   5   2.770  17.883 -24.814
   55    H5'    G   6           H5'        G   6   8.708  16.607 -22.043
   56   H5''    G   6          H5''        G   6   7.124  17.170 -22.617
   57    H4'    G   6           H4'        G   6   9.386  19.151 -22.665
   58    H3'    G   6           H3'        G   6   8.306  17.754 -20.249
   59    H2'    G   6          H2''        G   6   7.519  19.627 -19.188
   60   HO2'    G   6          H2'         G   6   9.573  21.029 -20.567
   61    H1'    G   6           H1'        G   6   7.227  21.404 -21.372
   62    H8     G   6           H8         G   6   5.100  18.286 -21.723
   63    H1     G   6           H1         G   6   2.679  22.557 -17.598
   64    H21    G   6           H21        G   6   4.187  24.094 -17.121
   65    H22    G   6           H22        G   6   5.736  24.169 -17.929
   66    H5'    A   7           H5'        A   7  11.513  21.022 -19.425
   67   H5''    A   7          H5''        A   7  12.671  20.262 -18.315
   68    H4'    A   7           H4'        A   7  12.346  22.565 -17.596
   69    H3'    A   7           H3'        A   7  11.195  20.291 -16.007
   70    H2'    A   7          H2''        A   7   9.969  21.632 -14.585
   71   HO2'    A   7          H2'         A   7  11.790  23.718 -15.241
   72    H1'    A   7           H1'        A   7   9.520  23.845 -16.255
   73    H8     A   7           H8         A   7   8.479  20.377 -17.564
   74    H61    A   7           H61        A   7   3.150  21.300 -14.573
   75    H62    A   7           H62        A   7   3.971  20.339 -15.782
   76    H2     A   7           H2         A   7   5.927  24.668 -13.540
   77    H5'    U   8           H5'        U   8  12.775  23.329 -13.238
   78   H5''    U   8          H5''        U   8  13.710  22.494 -11.983
   79    H4'    U   8           H4'        U   8  12.069  24.047 -10.967
   80    H3'    U   8           H3'        U   8  11.903  21.059 -10.663
   81    H2'    U   8          H2''        U   8   9.834  21.086  -9.671
   82   HO2'    U   8          H2'         U   8   9.633  22.277  -7.970
   83    H1'    U   8           H1'        U   8   8.907  23.629 -10.586
   84    H3     U   8           H3         U   8   5.325  21.033 -11.424
   85    H5     U   8           H5         U   8   8.358  19.282 -13.768
   86    H6     U   8           H6         U   8   9.936  20.833 -12.768
   87    H5'    U   9           H5'        U   9  11.792  23.094  -6.360
   88   H5''    U   9          H5''        U   9  12.384  21.818  -5.276
   89    H4'    U   9           H4'        U   9  10.086  22.832  -4.696
   90    H3'    U   9           H3'        U   9  10.865  19.950  -4.999
   91    H2'    U   9          H2''        U   9   8.720  19.138  -5.011
   92   HO2'    U   9          H2'         U   9   7.211  19.831  -3.645
   93    H1'    U   9           H1'        U   9   7.303  21.491  -5.770
   94    H3     U   9           H3         U   9   5.525  18.295  -8.402
   95    H5     U   9           H5         U   9   9.553  18.440  -9.629
   96    H6     U   9           H6         U   9   9.972  20.030  -7.843
   97    H5'    G  10           H5'        G  10   8.196  20.844  -1.513
   98   H5''    G  10          H5''        G  10   8.994  20.221  -0.055
   99    H4'    G  10           H4'        G  10   6.593  19.788   0.121
  100    H3'    G  10           H3'        G  10   8.527  17.530  -0.361
  101    H2'    G  10          H2''        G  10   6.853  15.928  -0.556
  102   HO2'    G  10          H2'         G  10   5.710  16.442   1.319
  103    H1'    G  10           H1'        G  10   4.916  17.458  -1.822
  104    H8     G  10           H8         G  10   8.276  18.013  -3.458
  105    H1     G  10           H1         G  10   5.646  12.366  -4.978
  106    H21    G  10           H21        G  10   3.943  11.941  -3.640
  107    H22    G  10           H22        G  10   3.326  13.126  -2.510
  108    H5'    U  11           H5'        U  11   6.410  16.502   3.620
  109   H5''    U  11          H5''        U  11   7.395  15.279   4.446
  110    H4'    U  11           H4'        U  11   4.966  14.655   3.596
  111    H3'    U  11           H3'        U  11   7.573  13.154   3.538
  112    H2'    U  11          H2''        U  11   6.762  11.436   2.213
  113   HO2'    U  11          H2'         U  11   4.618  10.848   2.141
  114    H1'    U  11           H1'        U  11   4.879  12.842   0.702
  115    H3     U  11           H3         U  11   7.972  10.831  -2.042
  116    H5     U  11           H5         U  11   9.747  14.435  -0.772
  117    H6     U  11           H6         U  11   7.928  14.702   0.806
  118    H5'    A  12           H5'        A  12   5.366  10.034   6.009
  119   H5''    A  12          H5''        A  12   6.724   9.057   6.599
  120    H4'    A  12           H4'        A  12   5.179   8.177   4.611
  121    H3'    A  12           H3'        A  12   8.154   8.028   5.091
  122    H2'    A  12          H2''        A  12   8.587   7.120   3.003
  123   HO2'    A  12          H2'         A  12   5.844   6.363   2.912
  124    H1'    A  12           H1'        A  12   6.503   8.296   1.553
  125    H8     A  12           H8         A  12   8.491  10.968   3.341
  126    H61    A  12           H61        A  12  12.721  10.415  -1.134
  127    H62    A  12           H62        A  12  12.212  11.340   0.261
  128    H2     A  12           H2         A  12   9.772   7.069  -1.588
  129    H5'    U  13           H5'        U  13   7.399   4.640   3.193
  130   H5''    U  13          H5''        U  13   7.946   3.221   4.107
  131    H4'    U  13           H4'        U  13   8.967   3.007   1.956
  132    H3'    U  13           H3'        U  13  10.740   4.144   4.130
  133    H2'    U  13          H2''        U  13  12.539   4.343   2.655
  134   HO2'    U  13          H2'         U  13  12.894   2.891   1.180
  135    H1'    U  13           H1'        U  13  11.093   5.064   0.378
  136    H3     U  13           H3         U  13  13.603   8.744   1.142
  137    H5     U  13           H5         U  13  11.144   8.518   4.537
  138    H6     U  13           H6         U  13  10.264   6.430   3.703
  139    H5'    G  14           H5'        G  14  13.101   0.620   3.155
  140   H5''    G  14          H5''        G  14  14.346   0.508   4.414
  141    H4'    G  14           H4'        G  14  14.901   1.494   1.983
  142    H3'    G  14           H3'        G  14  15.840   2.298   4.747
  143    H2'    G  14          H2''        G  14  16.959   4.138   3.923
  144   HO2'    G  14          H2'         G  14  18.252   3.931   2.283
  145    H1'    G  14           H1'        G  14  15.453   4.439   1.489
  146    H8     G  14           H8         G  14  13.429   5.174   4.598
  147    H1     G  14           H1         G  14  17.371   9.915   2.809
  148    H21    G  14           H21        G  14  18.751   9.196   1.251
  149    H22    G  14           H22        G  14  18.830   7.513   0.781
  150    H5'    U  15           H5'        U  15  19.187   1.846   1.795
  151   H5''    U  15          H5''        U  15  20.388   0.782   2.553
  152    H4'    U  15           H4'        U  15  21.602   2.580   1.476
  153    H3'    U  15           H3'        U  15  21.345   2.552   4.474
  154    H2'    U  15          H2''        U  15  22.287   4.640   4.763
  155   HO2'    U  15          H2'         U  15  23.550   4.148   2.273
  156    H1'    U  15           H1'        U  15  21.558   5.844   2.335
  157    H3     U  15           H3         U  15  19.885   8.620   5.486
  158    H5     U  15           H5         U  15  17.619   5.098   5.966
  159    H6     U  15           H6         U  15  19.043   4.033   4.314
  160    H5'    G  16           H5'        G  16  25.861   3.416   3.681
  161   H5''    G  16          H5''        G  16  26.601   2.857   5.193
  162    H4'    G  16           H4'        G  16  26.870   5.374   4.551
  163    H3'    G  16           H3'        G  16  26.044   4.136   7.176
  164    H2'    G  16          H2''        G  16  25.500   6.151   8.122
  165   HO2'    G  16          H2'         G  16  27.489   7.231   6.411
  166    H1'    G  16           H1'        G  16  25.102   7.674   5.726
  167    H8     G  16           H8         G  16  22.746   4.759   6.659
  168    H1     G  16           H1         G  16  21.208  10.435   9.214
  169    H21    G  16           H21        G  16  22.796  11.908   8.778
  170    H22    G  16           H22        G  16  24.310  11.452   8.029
  171    H5'    U  17           H5'        U  17  30.068   6.990   8.348
  172   H5''    U  17          H5''        U  17  30.264   6.230   9.939
  173    H4'    U  17           H4'        U  17  29.890   8.861   9.734
  174    H3'    U  17           H3'        U  17  28.867   6.806  11.686
  175    H2'    U  17          H2''        U  17  27.346   8.226  12.651
  176   HO2'    U  17          H2'         U  17  27.705  10.443  12.854
  177    H1'    U  17           H1'        U  17  27.072  10.121  10.530
  178    H3     U  17           H3         U  17  22.929   9.226  12.177
  179    H5     U  17           H5         U  17  23.990   5.760  10.025
  180    H6     U  17           H6         U  17  26.215   6.690   9.757
  181    H5'    A  18           H5'        A  18  31.147  10.625  14.049
  182   H5''    A  18          H5''        A  18  31.325   9.873  15.646
  183    H4'    A  18           H4'        A  18  30.235  12.224  15.570
  184    H3'    A  18           H3'        A  18  29.076   9.737  16.852
  185    H2'    A  18          H2''        A  18  27.275  10.999  17.704
  186   HO2'    A  18          H2'         A  18  27.345  13.121  18.030
  187    H1'    A  18           H1'        A  18  26.860  12.504  15.407
  188    H8     A  18           H8         A  18  27.562   8.915  14.449
  189    H61    A  18           H61        A  18  21.701   7.662  15.947
  190    H62    A  18           H62        A  18  23.178   7.031  15.254
  191    H2     A  18           H2         A  18  22.642  11.808  17.389
  192    H5'    A  19           H5'        A  19  28.846  12.669  19.556
  193   H5''    A  19          H5''        A  19  29.656  12.370  21.106
  194    H4'    A  19           H4'        A  19  27.449  13.204  21.625
  195    H3'    A  19           H3'        A  19  28.026  10.273  21.976
  196    H2'    A  19          H2''        A  19  25.833   9.700  22.423
  197   HO2'    A  19          H2'         A  19  25.525  12.406  23.221
  198    H1'    A  19           H1'        A  19  24.499  11.669  20.945
  199    H8     A  19           H8         A  19  27.163   9.582  19.100
  200    H61    A  19           H61        A  19  22.641   5.504  18.045
  201    H62    A  19           H62        A  19  24.264   5.998  17.615
  202    H2     A  19           H2         A  19  21.093   8.584  20.906
  203    H5'    A  20           H5'        A  20  25.885  11.506  25.697
  204   H5''    A  20          H5''        A  20  26.558  10.527  27.015
  205    H4'    A  20           H4'        A  20  24.068  10.256  26.742
  206    H3'    A  20           H3'        A  20  26.075   8.019  26.452
  207    H2'    A  20          H2''        A  20  24.454   6.474  25.841
  208   HO2'    A  20          H2'         A  20  22.635   8.184  27.199
  209    H1'    A  20           H1'        A  20  22.612   8.213  24.624
  210    H8     A  20           H8         A  20  26.317   8.098  23.479
  211    H61    A  20           H61        A  20  24.476   3.717  19.527
  212    H62    A  20           H62        A  20  25.834   4.659  20.103
  213    H2     A  20           H2         A  20  21.017   4.720  22.198
  214    H5'    U  21           H5'        U  21  23.349   6.167  29.397
  215   H5''    U  21          H5''        U  21  24.317   4.876  30.136
  216    H4'    U  21           H4'        U  21  22.351   4.242  28.480
  217    H3'    U  21           H3'        U  21  25.179   3.179  28.685
  218    H2'    U  21          H2''        U  21  24.957   1.885  26.757
  219   HO2'    U  21          H2'         U  21  22.161   1.939  27.284
  220    H1'    U  21           H1'        U  21  22.963   3.385  25.446
  221    H3     U  21           H3         U  21  26.352   2.760  22.453
  222    H5     U  21           H5         U  21  27.991   5.351  25.345
  223    H6     U  21           H6         U  21  25.911   5.195  26.570
  224    H5'    U  22           H5'        U  22  22.207   0.178  28.537
  225   H5''    U  22          H5''        U  22  22.296  -1.077  29.790
  226    H4'    U  22           H4'        U  22  21.823  -2.128  27.620
  227    H3'    U  22           H3'        U  22  24.533  -2.444  28.933
  228    H2'    U  22          H2''        U  22  25.498  -3.391  27.106
  229   HO2'    U  22          H2'         U  22  22.952  -4.560  26.619
  230    H1'    U  22           H1'        U  22  23.424  -2.706  25.190
  231    H3     U  22           H3         U  22  27.812  -2.828  23.501
  232    H5     U  22           H5         U  22  26.821   1.128  24.545
  233    H6     U  22           H6         U  22  24.944   0.246  25.823
  234    H5'    A  23           H5'        A  23  26.595  -5.202  29.863
  235   H5''    A  23          H5''        A  23  26.498  -4.446  28.262
  236    H4'    A  23           H4'        A  23  28.141  -6.442  28.542
  237    H3'    A  23           H3'        A  23  26.479  -5.547  26.395
  238    H2'    A  23          H2''        A  23  25.117  -7.365  26.107
  239   HO2'    A  23          H2'         A  23  27.094  -7.820  24.656
  240    H1'    A  23           H1'        A  23  26.560  -9.438  27.561
  241    H8     A  23           H8         A  23  24.090  -7.538  29.533
  242    H61    A  23           H61        A  23  19.504 -10.626  26.757
  243    H62    A  23           H62        A  23  19.922  -9.528  28.054
  244    H2     A  23           H2         A  23  23.337 -11.624  24.654
  245    H5'    A  24           H5'        A  24  29.519  -5.864  22.900
  246   H5''    A  24          H5''        A  24  28.392  -4.744  22.113
  247    H4'    A  24           H4'        A  24  28.262  -7.609  22.180
  248    H3'    A  24           H3'        A  24  26.722  -5.259  21.119
  249    H2'    A  24          H2''        A  24  24.719  -6.353  21.110
  250   HO2'    A  24          H2'         A  24  24.669  -8.671  20.559
  251    H1'    A  24           H1'        A  24  25.589  -8.685  22.687
  252    H8     A  24           H8         A  24  24.861  -5.739  24.771
  253    H61    A  24           H61        A  24  18.845  -7.108  24.371
  254    H62    A  24           H62        A  24  20.053  -6.171  25.221
  255    H2     A  24           H2         A  24  21.058  -9.621  21.383
  256    H5'    U  25           H5'        U  25  26.265  -3.834  17.924
  257   H5''    U  25          H5''        U  25  25.872  -5.172  19.022
  258    H4'    U  25           H4'        U  25  24.983  -4.699  16.259
  259    H3'    U  25           H3'        U  25  23.873  -5.368  18.676
  260    H2'    U  25          H2''        U  25  24.657  -7.569  18.881
  261   HO2'    U  25          H2'         U  25  23.049  -8.969  18.211
  262    H1'    U  25           H1'        U  25  24.374  -8.122  15.957
  263    H3     U  25           H3         U  25  26.797 -11.877  16.095
  264    H5     U  25           H5         U  25  28.253  -9.736  19.418
  265    H6     U  25           H6         U  25  26.731  -7.937  18.850
  266    H5'    U  26           H5'        U  26  22.879  -6.055  20.256
  267   H5''    U  26          H5''        U  26  21.259  -6.573  19.754
  268    H4'    U  26           H4'        U  26  20.685  -5.817  21.876
  269    H3'    U  26           H3'        U  26  20.679  -3.619  19.872
  270    H2'    U  26          H2''        U  26  21.018  -1.850  21.276
  271   HO2'    U  26          H2'         U  26  19.754  -1.631  22.929
  272    H1'    U  26           H1'        U  26  22.245  -3.040  23.472
  273    H3     U  26           H3         U  26  25.206   0.149  22.353
  274    H5     U  26           H5         U  26  25.344  -2.485  19.074
  275    H6     U  26           H6         U  26  23.539  -3.743  20.066
  276    H5'    C  27           H5'        C  27  15.984  -2.808  21.250
  277   H5''    C  27          H5''        C  27  15.713  -1.634  19.946
  278    H4'    C  27           H4'        C  27  15.839  -0.888  22.550
  279    H3'    C  27           H3'        C  27  16.965   0.415  20.024
  280    H2'    C  27          H2''        C  27  17.846   2.177  21.289
  281   HO2'    C  27          H2'         C  27  16.925   2.920  23.121
  282    H1'    C  27           H1'        C  27  18.201   0.700  23.675
  283    H41    C  27           H41        C  27  24.009   2.226  21.552
  284    H42    C  27           H42        C  27  23.774   1.277  20.101
  285    H5     C  27           H5         C  27  21.665   0.276  19.513
  286    H6     C  27           H6         C  27  19.380  -0.185  20.267
  287    H5'    U  28           H5'        U  28  13.228   3.333  20.842
  288   H5''    U  28          H5''        U  28  13.252   4.421  19.440
  289    H4'    U  28           H4'        U  28  13.930   5.306  21.878
  290    H3'    U  28           H3'        U  28  15.176   5.809  19.161
  291    H2'    U  28          H2''        U  28  16.767   7.237  20.092
  292   HO2'    U  28          H2'         U  28  15.856   8.591  21.466
  293    H1'    U  28           H1'        U  28  17.223   5.750  22.405
  294    H3     U  28           H3         U  28  20.898   6.106  19.619
  295    H5     U  28           H5         U  28  18.645   2.854  18.188
  296    H6     U  28           H6         U  28  16.883   3.467  19.722
  297    H5'    U  29           H5'        U  29  14.207   9.866  20.893
  298   H5''    U  29          H5''        U  29  13.457  10.798  19.582
  299    H4'    U  29           H4'        U  29  15.287  12.079  20.685
  300    H3'    U  29           H3'        U  29  15.335  11.203  17.810
  301    H2'    U  29          H2''        U  29  17.522  11.840  17.442
  302   HO2'    U  29          H2'         U  29  17.243  13.578  19.679
  303    H1'    U  29           H1'        U  29  18.584  11.516  20.007
  304    H3     U  29           H3         U  29  21.074   9.022  17.119
  305    H5     U  29           H5         U  29  17.508   6.832  17.608
  306    H6     U  29           H6         U  29  16.604   8.710  18.850
  307    H5'    A  30           H5'        A  30  16.344  15.959  17.485
  308   H5''    A  30          H5''        A  30  16.129  16.101  15.731
  309    H4'    A  30           H4'        A  30  18.509  16.550  16.857
  310    H3'    A  30           H3'        A  30  17.802  15.053  14.315
  311    H2'    A  30          H2''        A  30  20.091  14.747  13.863
  312   HO2'    A  30          H2'         A  30  20.852  16.815  14.330
  313    H1'    A  30           H1'        A  30  20.834  14.142  16.466
  314    H8     A  30           H8         A  30  17.565  12.392  15.614
  315    H61    A  30           H61        A  30  20.948   8.224  12.567
  316    H62    A  30           H62        A  30  19.387   8.573  13.274
  317    H2     A  30           H2         A  30  23.564  11.752  13.463
  318    H5'    C  31           H5'        C  31  19.825  18.853  12.486
  319   H5''    C  31          H5''        C  31  19.379  18.766  10.771
  320    H4'    C  31           H4'        C  31  21.903  18.398  11.526
  321    H3'    C  31           H3'        C  31  20.192  17.010   9.460
  322    H2'    C  31          H2''        C  31  21.851  15.446   8.967
  323   HO2'    C  31          H2'         C  31  23.493  17.067   8.689
  324    H1'    C  31           H1'        C  31  22.997  15.206  11.488
  325    H41    C  31           H41        C  31  19.510  10.017  10.112
  326    H42    C  31           H42        C  31  18.107  10.790  10.811
  327    H5     C  31           H5         C  31  18.166  13.015  11.751
  328    H6     C  31           H6         C  31  19.496  15.055  11.990
  329    H5'    A  32           H5'        A  32  23.467  18.293   6.968
  330   H5''    A  32          H5''        A  32  22.840  19.099   5.518
  331    H4'    A  32           H4'        A  32  24.222  17.225   4.802
  332    H3'    A  32           H3'        A  32  21.221  17.051   4.554
  333    H2'    A  32          H2''        A  32  21.255  14.854   3.846
  334   HO2'    A  32          H2'         A  32  22.542  14.504   2.232
  335    H1'    A  32           H1'        A  32  23.626  14.002   5.112
  336    H8     A  32           H8         A  32  20.861  15.515   7.324
  337    H61    A  32           H61        A  32  18.427   9.831   7.386
  338    H62    A  32           H62        A  32  18.397  11.414   8.130
  339    H2     A  32           H2         A  32  21.884   9.839   4.523
  340    H5'    C  33           H5'        C  33  23.229  16.373   0.025
  341   H5''    C  33          H5''        C  33  21.738  16.327  -0.934
  342    H4'    C  33           H4'        C  33  23.430  14.257  -0.935
  343    H3'    C  33           H3'        C  33  20.404  14.317  -0.821
  344    H2'    C  33          H2''        C  33  20.358  11.948  -0.915
  345   HO2'    C  33          H2'         C  33  23.143  12.076  -1.508
  346    H1'    C  33           H1'        C  33  22.396  11.557   0.892
  347    H41    C  33           H41        C  33  16.742  11.228   3.874
  348    H42    C  33           H42        C  33  16.775  12.957   4.126
  349    H5     C  33           H5         C  33  18.618  14.350   3.404
  350    H6     C  33           H6         C  33  20.638  14.439   2.019
  351    H5'    A  34           H5'        A  34  21.598  12.198  -3.833
  352   H5''    A  34          H5''        A  34  21.291  12.463  -5.562
  353    H4'    A  34           H4'        A  34  20.803  10.158  -5.248
  354    H3'    A  34           H3'        A  34  18.516  12.069  -5.368
  355    H2'    A  34          H2''        A  34  16.923  10.688  -4.470
  356   HO2'    A  34          H2'         A  34  18.460   8.505  -5.461
  357    H1'    A  34           H1'        A  34  18.525   8.851  -3.043
  358    H8     A  34           H8         A  34  18.829  12.570  -2.111
  359    H61    A  34           H61        A  34  14.353  11.416   1.989
  360    H62    A  34           H62        A  34  15.619  12.528   1.519
  361    H2     A  34           H2         A  34  14.815   7.799  -0.621
  362    H5'    C  35           H5'        C  35  16.115  11.285  -9.015
  363   H5''    C  35          H5''        C  35  15.349  12.717  -8.296
  364    H4'    C  35           H4'        C  35  15.226   9.854  -7.438
  365    H3'    C  35           H3'        C  35  13.480  11.923  -8.243
  366    H2'    C  35          H2''        C  35  13.229  13.086  -6.291
  367   HO2'    C  35          H2'         C  35  11.305  11.745  -6.414
  368    H1'    C  35           H1'        C  35  13.872  10.814  -4.452
  369    H41    C  35           H41        C  35  14.903  16.120  -1.038
  370    H42    C  35           H42        C  35  16.449  16.299  -1.837
  371    H5     C  35           H5         C  35  17.184  14.858  -3.623
  372    H6     C  35           H6         C  35  16.566  12.997  -5.085
  373    H5'    U  36           H5'        U  36  14.936   6.914  -8.983
  374   H5''    U  36          H5''        U  36  13.566   6.849 -10.113
  375    H4'    U  36           H4'        U  36  13.796   4.600  -9.336
  376    H3'    U  36           H3'        U  36  11.633   6.329  -8.253
  377    H2'    U  36          H2''        U  36  11.122   5.097  -6.370
  378   HO2'    U  36          H2'         U  36  10.798   3.152  -7.566
  379    H1'    U  36           H1'        U  36  13.557   3.965  -5.735
  380    H3     U  36           H3         U  36  11.463   7.297  -2.949
  381    H5     U  36           H5         U  36  15.011   8.791  -4.660
  382    H6     U  36           H6         U  36  15.058   6.840  -6.103
  383    H5'    A  37           H5'        A  37   8.141   3.493  -9.754
  384   H5''    A  37          H5''        A  37   7.154   4.929 -10.093
  385    H4'    A  37           H4'        A  37   6.528   3.283  -8.084
  386    H3'    A  37           H3'        A  37   6.455   6.293  -8.341
  387    H2'    A  37          H2''        A  37   5.808   6.588  -6.117
  388   HO2'    A  37          H2'         A  37   4.167   4.979  -6.120
  389    H1'    A  37           H1'        A  37   7.394   4.627  -4.978
  390    H8     A  37           H8         A  37   9.671   6.273  -7.406
  391    H61    A  37           H61        A  37  10.076  11.055  -3.528
  392    H62    A  37           H62        A  37  10.783  10.258  -4.915
  393    H2     A  37           H2         A  37   6.535   8.588  -2.316
  394    H5'    C  38           H5'        C  38   2.158   4.864  -8.008
  395   H5''    C  38          H5''        C  38   0.990   5.892  -8.861
  396    H4'    C  38           H4'        C  38   0.640   5.785  -6.352
  397    H3'    C  38           H3'        C  38   1.110   8.255  -8.000
  398    H2'    C  38          H2''        C  38   1.288   9.676  -6.175
  399   HO2'    C  38          H2'         C  38   0.206   9.394  -4.325
  400    H1'    C  38           H1'        C  38   2.416   7.927  -4.309
  401    H41    C  38           H41        C  38   6.876  12.023  -6.442
  402    H42    C  38           H42        C  38   7.384  10.796  -7.582
  403    H5     C  38           H5         C  38   6.087   8.825  -8.051
  404    H6     C  38           H6         C  38   4.166   7.476  -7.359
  405    H5'    A  39           H5'        A  39  -3.107   9.649  -6.935
  406   H5''    A  39          H5''        A  39  -3.303  10.833  -8.242
  407    H4'    A  39           H4'        A  39  -2.701  11.593  -5.724
  408    H3'    A  39           H3'        A  39  -1.708  12.601  -8.421
  409    H2'    A  39          H2''        A  39  -0.252  14.106  -7.365
  410   HO2'    A  39          H2'         A  39  -0.827  15.207  -5.642
  411    H1'    A  39           H1'        A  39   0.107  12.652  -4.975
  412    H8     A  39           H8         A  39   1.190  10.666  -7.991
  413    H61    A  39           H61        A  39   6.305  14.130  -8.171
  414    H62    A  39           H62        A  39   5.559  12.638  -8.700
  415    H2     A  39           H2         A  39   3.503  15.949  -5.179
  416    H5'    A  40           H5'        A  40  -3.843  15.273  -5.764
  417   H5''    A  40          H5''        A  40  -5.052  16.401  -6.415
  418    H4'    A  40           H4'        A  40  -3.803  17.584  -4.697
  419    H3'    A  40           H3'        A  40  -3.435  18.201  -7.607
  420    H2'    A  40          H2''        A  40  -1.478  19.375  -7.415
  421   HO2'    A  40          H2'         A  40  -1.601  21.024  -6.140
  422    H1'    A  40           H1'        A  40  -0.490  18.419  -4.958
  423    H8     A  40           H8         A  40  -1.195  15.929  -7.829
  424    H61    A  40           H61        A  40   4.715  16.817  -9.415
  425    H62    A  40           H62        A  40   3.245  15.935  -9.768
  426    H2     A  40           H2         A  40   3.684  19.741  -6.169
  427    H5'    A  41           H5'        A  41  -4.008  22.717  -5.885
  428   H5''    A  41          H5''        A  41  -4.354  23.478  -7.451
  429    H4'    A  41           H4'        A  41  -2.153  24.126  -6.058
  430    H3'    A  41           H3'        A  41  -2.481  23.574  -9.022
  431    H2'    A  41          H2''        A  41  -0.253  24.234  -9.373
  432   HO2'    A  41          H2'         A  41  -0.309  25.322  -6.738
  433    H1'    A  41           H1'        A  41   0.710  23.064  -6.985
  434    H8     A  41           H8         A  41  -1.546  20.774  -9.042
  435    H61    A  41           H61        A  41   3.499  19.339 -12.316
  436    H62    A  41           H62        A  41   1.855  18.882 -11.933
  437    H2     A  41           H2         A  41   4.567  22.669  -9.506
  438    H5'    U  42           H5'        U  42  -0.736  27.350  -7.872
  439   H5''    U  42          H5''        U  42  -1.436  28.750  -8.712
  440    H4'    U  42           H4'        U  42   1.005  29.034  -8.590
  441    H3'    U  42           H3'        U  42  -0.336  28.261 -11.196
  442    H2'    U  42          H2''        U  42   1.657  28.083 -12.359
  443   HO2'    U  42          H2'         U  42   3.360  29.345 -12.003
  444    H1'    U  42           H1'        U  42   3.309  27.342 -10.195
  445    H3     U  42           H3         U  42   3.969  23.866 -12.981
  446    H5     U  42           H5         U  42  -0.095  23.535 -11.940
  447    H6     U  42           H6         U  42   0.064  25.708 -10.891
  448    H5'    U  43           H5'        U  43   2.157  31.693 -12.722
  449   H5''    U  43          H5''        U  43   1.401  32.039 -14.289
  450    H4'    U  43           H4'        U  43   3.792  30.844 -14.157
  451    H3'    U  43           H3'        U  43   1.404  30.507 -15.964
  452    H2'    U  43          H2''        U  43   2.086  28.493 -16.842
  453   HO2'    U  43          H2'         U  43   4.717  29.472 -16.407
  454    H1'    U  43           H1'        U  43   3.929  27.677 -14.827
  455    H3     U  43           H3         U  43   1.539  23.913 -15.518
  456    H5     U  43           H5         U  43  -1.325  26.646 -14.073
  457    H6     U  43           H6         U  43   0.380  28.370 -14.137
  458    H5'    A  44           H5'        A  44   5.720  31.545 -18.398
  459   H5''    A  44          H5''        A  44   5.059  32.051 -19.966
  460    H4'    A  44           H4'        A  44   7.059  30.433 -20.054
  461    H3'    A  44           H3'        A  44   4.379  30.185 -21.393
  462    H2'    A  44          H2''        A  44   4.660  28.007 -22.025
  463   HO2'    A  44          H2'         A  44   7.445  28.576 -22.105
  464    H1'    A  44           H1'        A  44   6.696  27.212 -20.188
  465    H8     A  44           H8         A  44   3.678  27.886 -18.188
  466    H61    A  44           H61        A  44   1.174  22.681 -20.392
  467    H62    A  44           H62        A  44   1.033  23.954 -19.201
  468    H2     A  44           H2         A  44   4.876  23.562 -22.765
  469    H5'    A  45           H5'        A  45   7.791  30.100 -25.410
  470   H5''    A  45          H5''        A  45   6.428  30.410 -26.502
  471    H4'    A  45           H4'        A  45   8.058  28.335 -26.914
  472    H3'    A  45           H3'        A  45   5.077  28.669 -27.198
  473    H2'    A  45          H2''        A  45   4.719  26.409 -27.662
  474   HO2'    A  45          H2'         A  45   7.472  26.371 -28.327
  475    H1'    A  45           H1'        A  45   6.604  25.308 -25.957
  476    H8     A  45           H8         A  45   4.983  27.858 -23.861
  477    H61    A  45           H61        A  45   0.024  24.196 -23.439
  478    H62    A  45           H62        A  45   0.881  25.544 -22.725
  479    H2     A  45           H2         A  45   2.696  22.555 -26.646
  480    H5'    G  46           H5'        G  46   6.249  28.136 -31.836
  481   H5''    G  46          H5''        G  46   4.717  28.568 -32.623
  482    H4'    G  46           H4'        G  46   5.578  26.039 -32.617
  483    H3'    G  46           H3'        G  46   2.835  27.241 -32.249
  484    H2'    G  46          H2''        G  46   1.847  25.153 -31.869
  485   HO2'    G  46          H2'         G  46   4.241  24.040 -32.937
  486    H1'    G  46           H1'        G  46   3.881  24.052 -30.339
  487    H8     G  46           H8         G  46   3.543  27.479 -28.967
  488    H1     G  46           H1         G  46  -1.519  23.808 -27.545
  489    H21    G  46           H21        G  46  -1.471  21.955 -28.743
  490    H22    G  46           H22        G  46  -0.312  21.705 -30.029
  491    H5'    C  47           H5'        C  47   2.441  23.610 -34.345
  492   H5''    C  47          H5''        C  47   2.062  24.048 -36.024
  493    H4'    C  47           H4'        C  47   0.716  22.110 -35.500
  494    H3'    C  47           H3'        C  47  -0.548  24.822 -35.638
  495    H2'    C  47          H2''        C  47  -2.617  24.160 -34.850
  496   HO2'    C  47          H2'         C  47  -1.813  21.538 -35.565
  497    H1'    C  47           H1'        C  47  -1.814  22.189 -33.035
  498    H41    C  47           H41        C  47  -2.696  26.994 -29.025
  499    H42    C  47           H42        C  47  -1.416  27.926 -29.768
  500    H5     C  47           H5         C  47  -0.092  27.102 -31.608
  501    H6     C  47           H6         C  47   0.085  25.363 -33.323
  502    H5'    C  48           H5'        C  48  -3.731  22.474 -37.069
  503   H5''    C  48          H5''        C  48  -4.503  23.380 -38.384
  504    H4'    C  48           H4'        C  48  -6.010  23.011 -36.375
  505    H3'    C  48           H3'        C  48  -5.149  25.725 -37.384
  506   HO3'    C  48          H3T         C  48  -6.554  24.735 -38.741
  507    H2'    C  48          H2''        C  48  -6.278  26.833 -35.720
  508   HO2'    C  48          H2'         C  48  -8.107  25.961 -34.688
  509    H1'    C  48           H1'        C  48  -6.245  24.706 -33.787
  510    H41    C  48           H41        C  48  -2.918  29.410 -31.119
  511    H42    C  48           H42        C  48  -1.756  29.395 -32.427
  512    H5     C  48           H5         C  48  -1.869  27.846 -34.269
  513    H6     C  48           H6         C  48  -3.233  26.139 -35.374
  Start of MODEL    9
    1    H5'    G   1           H5'        G   1  -7.629  31.735 -22.543
    2   H5''    G   1          H5''        G   1  -7.080  30.288 -21.674
    3    H4'    G   1           H4'        G   1  -9.304  29.864 -22.608
    4    H3'    G   1           H3'        G   1  -6.843  28.453 -23.468
    5    H2'    G   1          H2''        G   1  -7.597  27.624 -25.460
    6   HO2'    G   1          H2'         G   1  -9.724  27.030 -25.818
    7    H1'    G   1           H1'        G   1  -9.576  29.437 -26.177
    8    H8     G   1           H8         G   1  -6.568  31.520 -25.553
    9    H1     G   1           H1         G   1  -5.786  27.770 -30.703
   10    H21    G   1           H21        G   1  -7.421  26.289 -30.816
   11    H22    G   1           H22        G   1  -8.592  26.091 -29.531
   12   HO5'    G   1          H5T         G   1  -5.559  29.979 -23.108
   13    H5'    G   2           H5'        G   2  -9.606  24.204 -21.642
   14   H5''    G   2          H5''        G   2  -7.997  23.458 -21.644
   15    H4'    G   2           H4'        G   2 -10.042  22.273 -22.874
   16    H3'    G   2           H3'        G   2  -7.120  22.492 -23.438
   17    H2'    G   2          H2''        G   2  -7.210  21.836 -25.660
   18   HO2'    G   2          H2'         G   2  -8.343  19.932 -25.414
   19    H1'    G   2           H1'        G   2  -9.596  22.896 -26.462
   20    H8     G   2           H8         G   2  -8.256  25.714 -24.589
   21    H1     G   2           H1         G   2  -4.437  24.418 -29.562
   22    H21    G   2           H21        G   2  -4.973  22.462 -30.441
   23    H22    G   2           H22        G   2  -6.139  21.391 -29.697
   24    H5'    C   3           H5'        C   3  -7.775  17.601 -24.606
   25   H5''    C   3          H5''        C   3  -6.233  17.262 -23.796
   26    H4'    C   3           H4'        C   3  -6.586  16.576 -26.342
   27    H3'    C   3           H3'        C   3  -4.255  17.675 -24.810
   28    H2'    C   3          H2''        C   3  -2.979  18.202 -26.666
   29   HO2'    C   3          H2'         C   3  -4.573  16.313 -28.075
   30    H1'    C   3           H1'        C   3  -4.963  18.809 -28.511
   31    H41    C   3           H41        C   3  -2.165  24.188 -26.436
   32    H42    C   3           H42        C   3  -3.354  24.289 -25.158
   33    H5     C   3           H5         C   3  -5.094  22.649 -24.852
   34    H6     C   3           H6         C   3  -5.959  20.480 -25.598
   35    H5'    U   4           H5'        U   4  -2.262  15.618 -27.554
   36   H5''    U   4          H5''        U   4  -0.999  14.607 -26.824
   37    H4'    U   4           H4'        U   4  -0.050  16.290 -28.409
   38    H3'    U   4           H3'        U   4   0.542  16.200 -25.463
   39    H2'    U   4          H2''        U   4   1.621  18.218 -25.418
   40   HO2'    U   4          H2'         U   4   2.305  17.758 -28.141
   41    H1'    U   4           H1'        U   4   0.581  19.370 -27.817
   42    H3     U   4           H3         U   4   0.513  22.707 -24.752
   43    H5     U   4           H5         U   4  -2.453  20.027 -23.420
   44    H6     U   4           H6         U   4  -1.745  18.481 -25.152
   45    H5'    U   5           H5'        U   5   4.262  16.778 -28.056
   46   H5''    U   5          H5''        U   5   5.509  15.696 -27.404
   47    H4'    U   5           H4'        U   5   6.512  17.887 -27.821
   48    H3'    U   5           H3'        U   5   6.072  16.856 -25.040
   49    H2'    U   5          H2''        U   5   6.490  18.849 -23.980
   50   HO2'    U   5          H2'         U   5   8.147  20.095 -24.506
   51    H1'    U   5           H1'        U   5   6.011  20.669 -26.118
   52    H3     U   5           H3         U   5   3.584  22.569 -22.848
   53    H5     U   5           H5         U   5   1.837  18.759 -23.246
   54    H6     U   5           H6         U   5   3.564  18.207 -24.860
   55    H5'    G   6           H5'        G   6   9.115  16.848 -21.960
   56   H5''    G   6          H5''        G   6   7.679  17.549 -22.736
   57    H4'    G   6           H4'        G   6  10.093  19.316 -22.588
   58    H3'    G   6           H3'        G   6   8.737  18.048 -20.238
   59    H2'    G   6          H2''        G   6   8.062  20.001 -19.243
   60   HO2'    G   6          H2'         G   6   9.438  21.564 -18.943
   61    H1'    G   6           H1'        G   6   8.067  21.762 -21.462
   62    H8     G   6           H8         G   6   5.714  18.798 -21.847
   63    H1     G   6           H1         G   6   3.369  23.467 -18.130
   64    H21    G   6           H21        G   6   4.919  24.988 -17.749
   65    H22    G   6           H22        G   6   6.584  24.764 -18.233
   66    H5'    A   7           H5'        A   7  12.115  20.902 -19.072
   67   H5''    A   7          H5''        A   7  13.103  20.094 -17.838
   68    H4'    A   7           H4'        A   7  12.698  22.453 -17.210
   69    H3'    A   7           H3'        A   7  11.596  20.122 -15.676
   70    H2'    A   7          H2''        A   7  10.219  21.377 -14.321
   71   HO2'    A   7          H2'         A   7  11.990  23.544 -14.829
   72    H1'    A   7           H1'        A   7   9.765  23.602 -15.982
   73    H8     A   7           H8         A   7   8.909  20.120 -17.385
   74    H61    A   7           H61        A   7   3.431  20.806 -14.602
   75    H62    A   7           H62        A   7   4.354  19.860 -15.749
   76    H2     A   7           H2         A   7   6.042  24.247 -13.403
   77    H5'    U   8           H5'        U   8  13.057  23.311 -12.949
   78   H5''    U   8          H5''        U   8  14.043  22.558 -11.681
   79    H4'    U   8           H4'        U   8  12.438  24.122 -10.664
   80    H3'    U   8           H3'        U   8  12.226  21.146 -10.283
   81    H2'    U   8          H2''        U   8  10.171  21.228  -9.269
   82   HO2'    U   8          H2'         U   8  10.944  23.816  -8.389
   83    H1'    U   8           H1'        U   8   9.263  23.756 -10.233
   84    H3     U   8           H3         U   8   5.649  21.181 -10.991
   85    H5     U   8           H5         U   8   8.652  19.334 -13.300
   86    H6     U   8           H6         U   8  10.249  20.898 -12.356
   87    H5'    U   9           H5'        U   9  12.225  23.223  -5.931
   88   H5''    U   9          H5''        U   9  12.745  21.880  -4.893
   89    H4'    U   9           H4'        U   9  10.487  23.018  -4.312
   90    H3'    U   9           H3'        U   9  11.150  20.103  -4.620
   91    H2'    U   9          H2''        U   9   8.970  19.390  -4.618
   92   HO2'    U   9          H2'         U   9   8.314  21.711  -3.104
   93    H1'    U   9           H1'        U   9   7.663  21.817  -5.362
   94    H3     U   9           H3         U   9   5.671  18.716  -7.953
   95    H5     U   9           H5         U   9   9.684  18.631  -9.237
   96    H6     U   9           H6         U   9  10.215  20.200  -7.464
   97    H5'    G  10           H5'        G  10   8.594  21.171  -1.094
   98   H5''    G  10          H5''        G  10   9.371  20.514   0.361
   99    H4'    G  10           H4'        G  10   6.953  20.245   0.584
  100    H3'    G  10           H3'        G  10   8.715  17.853   0.083
  101    H2'    G  10          H2''        G  10   6.929  16.372  -0.066
  102   HO2'    G  10          H2'         G  10   5.593  16.640   1.554
  103    H1'    G  10           H1'        G  10   5.086  18.020  -1.317
  104    H8     G  10           H8         G  10   8.430  18.358  -3.031
  105    H1     G  10           H1         G  10   5.470  12.836  -4.400
  106    H21    G  10           H21        G  10   3.781  12.520  -3.017
  107    H22    G  10           H22        G  10   3.253  13.752  -1.892
  108    H5'    U  11           H5'        U  11   6.505  16.973   4.038
  109   H5''    U  11          H5''        U  11   7.430  15.724   4.895
  110    H4'    U  11           H4'        U  11   4.980  15.180   4.100
  111    H3'    U  11           H3'        U  11   7.519  13.570   3.961
  112    H2'    U  11          H2''        U  11   6.581  11.878   2.680
  113   HO2'    U  11          H2'         U  11   4.032  12.826   3.523
  114    H1'    U  11           H1'        U  11   4.745  13.367   1.202
  115    H3     U  11           H3         U  11   7.705  11.228  -1.589
  116    H5     U  11           H5         U  11   9.664  14.742  -0.337
  117    H6     U  11           H6         U  11   7.878  15.091   1.265
  118    H5'    A  12           H5'        A  12   5.318  10.503   6.456
  119   H5''    A  12          H5''        A  12   6.675   9.496   6.997
  120    H4'    A  12           H4'        A  12   5.061   8.670   5.038
  121    H3'    A  12           H3'        A  12   8.045   8.459   5.435
  122    H2'    A  12          H2''        A  12   8.398   7.562   3.328
  123   HO2'    A  12          H2'         A  12   5.644   6.848   3.323
  124    H1'    A  12           H1'        A  12   6.281   8.783   1.957
  125    H8     A  12           H8         A  12   8.369  11.435   3.637
  126    H61    A  12           H61        A  12  12.476  10.731  -0.929
  127    H62    A  12           H62        A  12  12.034  11.670   0.479
  128    H2     A  12           H2         A  12   9.469   7.423  -1.246
  129    H5'    U  13           H5'        U  13   7.150   5.059   3.546
  130   H5''    U  13          H5''        U  13   7.673   3.641   4.477
  131    H4'    U  13           H4'        U  13   8.632   3.339   2.311
  132    H3'    U  13           H3'        U  13  10.497   4.480   4.402
  133    H2'    U  13          H2''        U  13  12.257   4.605   2.873
  134   HO2'    U  13          H2'         U  13  12.460   3.302   1.167
  135    H1'    U  13           H1'        U  13  10.770   5.313   0.622
  136    H3     U  13           H3         U  13  13.370   8.950   1.250
  137    H5     U  13           H5         U  13  10.981   8.854   4.702
  138    H6     U  13           H6         U  13  10.046   6.762   3.936
  139    H5'    G  14           H5'        G  14  12.753   0.900   3.398
  140   H5''    G  14          H5''        G  14  14.034   0.770   4.617
  141    H4'    G  14           H4'        G  14  14.537   1.719   2.161
  142    H3'    G  14           H3'        G  14  15.580   2.514   4.889
  143    H2'    G  14          H2''        G  14  16.698   4.338   4.035
  144   HO2'    G  14          H2'         G  14  16.841   2.862   1.611
  145    H1'    G  14           H1'        G  14  15.145   4.658   1.635
  146    H8     G  14           H8         G  14  13.190   5.442   4.770
  147    H1     G  14           H1         G  14  17.185  10.112   2.912
  148    H21    G  14           H21        G  14  18.536   9.365   1.341
  149    H22    G  14           H22        G  14  18.584   7.679   0.878
  150    H5'    U  15           H5'        U  15  18.887   1.924   1.801
  151   H5''    U  15          H5''        U  15  20.078   0.876   2.597
  152    H4'    U  15           H4'        U  15  21.291   2.631   1.427
  153    H3'    U  15           H3'        U  15  21.111   2.651   4.428
  154    H2'    U  15          H2''        U  15  22.072   4.735   4.671
  155   HO2'    U  15          H2'         U  15  23.744   5.334   3.525
  156    H1'    U  15           H1'        U  15  21.305   5.921   2.249
  157    H3     U  15           H3         U  15  19.700   8.733   5.405
  158    H5     U  15           H5         U  15  17.410   5.236   5.936
  159    H6     U  15           H6         U  15  18.807   4.146   4.279
  160    H5'    G  16           H5'        G  16  25.584   3.535   3.575
  161   H5''    G  16          H5''        G  16  26.349   2.957   5.068
  162    H4'    G  16           H4'        G  16  26.597   5.482   4.477
  163    H3'    G  16           H3'        G  16  25.779   4.195   7.080
  164    H2'    G  16          H2''        G  16  25.207   6.184   8.058
  165   HO2'    G  16          H2'         G  16  27.425   7.056   6.675
  166    H1'    G  16           H1'        G  16  24.809   7.751   5.690
  167    H8     G  16           H8         G  16  22.477   4.800   6.573
  168    H1     G  16           H1         G  16  20.868  10.426   9.193
  169    H21    G  16           H21        G  16  22.445  11.918   8.795
  170    H22    G  16           H22        G  16  23.968  11.487   8.051
  171    H5'    U  17           H5'        U  17  29.777   7.089   8.276
  172   H5''    U  17          H5''        U  17  29.984   6.322   9.862
  173    H4'    U  17           H4'        U  17  29.585   8.951   9.674
  174    H3'    U  17           H3'        U  17  28.591   6.873  11.614
  175    H2'    U  17          H2''        U  17  27.043   8.257  12.584
  176   HO2'    U  17          H2'         U  17  28.855  10.330  11.914
  177    H1'    U  17           H1'        U  17  26.741  10.169  10.484
  178    H3     U  17           H3         U  17  22.618   9.173  12.124
  179    H5     U  17           H5         U  17  23.738   5.764   9.914
  180    H6     U  17           H6         U  17  25.948   6.736   9.666
  181    H5'    A  18           H5'        A  18  30.861  10.684  14.143
  182   H5''    A  18          H5''        A  18  30.928   9.858  15.711
  183    H4'    A  18           H4'        A  18  29.861  12.247  15.616
  184    H3'    A  18           H3'        A  18  28.716   9.741  16.870
  185    H2'    A  18          H2''        A  18  26.876  10.960  17.687
  186   HO2'    A  18          H2'         A  18  26.923  13.059  18.084
  187    H1'    A  18           H1'        A  18  26.484  12.491  15.405
  188    H8     A  18           H8         A  18  27.225   8.952  14.356
  189    H61    A  18           H61        A  18  21.420   7.529  15.910
  190    H62    A  18           H62        A  18  22.822   7.039  14.985
  191    H2     A  18           H2         A  18  22.271  11.683  17.390
  192    H5'    A  19           H5'        A  19  28.450  12.641  19.658
  193   H5''    A  19          H5''        A  19  29.238  12.288  21.208
  194    H4'    A  19           H4'        A  19  27.011  13.095  21.709
  195    H3'    A  19           H3'        A  19  27.636  10.169  22.007
  196    H2'    A  19          H2''        A  19  25.452   9.535  22.384
  197   HO2'    A  19          H2'         A  19  24.170  10.647  23.641
  198    H1'    A  19           H1'        A  19  24.097  11.535  20.960
  199    H8     A  19           H8         A  19  26.795   9.530  19.076
  200    H61    A  19           H61        A  19  22.348   5.409  17.910
  201    H62    A  19           H62        A  19  23.922   5.997  17.423
  202    H2     A  19           H2         A  19  20.741   8.393  20.846
  203    H5'    A  20           H5'        A  20  25.311  11.328  25.647
  204   H5''    A  20          H5''        A  20  25.998  10.405  26.998
  205    H4'    A  20           H4'        A  20  23.536  10.030  26.741
  206    H3'    A  20           H3'        A  20  25.608   7.860  26.426
  207    H2'    A  20          H2''        A  20  24.044   6.270  25.787
  208   HO2'    A  20          H2'         A  20  22.192   6.098  26.780
  209    H1'    A  20           H1'        A  20  22.130   7.952  24.604
  210    H8     A  20           H8         A  20  25.849   7.953  23.483
  211    H61    A  20           H61        A  20  24.120   3.665  19.382
  212    H62    A  20           H62        A  20  25.451   4.626  19.987
  213    H2     A  20           H2         A  20  20.619   4.529  22.045
  214    H5'    U  21           H5'        U  21  22.958   5.778  29.321
  215   H5''    U  21          H5''        U  21  24.016   4.499  29.948
  216    H4'    U  21           H4'        U  21  22.037   3.911  28.255
  217    H3'    U  21           H3'        U  21  24.883   2.899  28.473
  218    H2'    U  21          H2''        U  21  24.743   1.703  26.478
  219   HO2'    U  21          H2'         U  21  22.967   0.646  25.875
  220    H1'    U  21           H1'        U  21  22.726   3.197  25.197
  221    H3     U  21           H3         U  21  26.210   2.753  22.269
  222    H5     U  21           H5         U  21  27.701   5.299  25.279
  223    H6     U  21           H6         U  21  25.582   5.074  26.426
  224    H5'    U  22           H5'        U  22  22.031  -0.243  28.112
  225   H5''    U  22          H5''        U  22  22.187  -1.538  29.316
  226    H4'    U  22           H4'        U  22  21.835  -2.504  27.069
  227    H3'    U  22           H3'        U  22  24.502  -2.741  28.491
  228    H2'    U  22          H2''        U  22  25.589  -3.563  26.673
  229   HO2'    U  22          H2'         U  22  23.138  -4.800  25.923
  230    H1'    U  22           H1'        U  22  23.565  -2.901  24.697
  231    H3     U  22           H3         U  22  28.040  -2.718  23.230
  232    H5     U  22           H5         U  22  26.744   1.135  24.324
  233    H6     U  22           H6         U  22  24.877   0.097  25.494
  234    H5'    A  23           H5'        A  23  26.674  -5.360  29.444
  235   H5''    A  23          H5''        A  23  26.614  -4.529  27.879
  236    H4'    A  23           H4'        A  23  28.387  -6.409  28.161
  237    H3'    A  23           H3'        A  23  26.791  -5.530  25.959
  238    H2'    A  23          H2''        A  23  25.561  -7.418  25.534
  239   HO2'    A  23          H2'         A  23  26.596  -8.910  24.293
  240    H1'    A  23           H1'        A  23  27.101  -9.455  26.943
  241    H8     A  23           H8         A  23  24.387  -7.874  28.885
  242    H61    A  23           H61        A  23  20.217 -11.166  25.720
  243    H62    A  23           H62        A  23  20.493 -10.175  27.135
  244    H2     A  23           H2         A  23  24.223 -11.764  23.795
  245    H5'    A  24           H5'        A  24  29.970  -5.490  22.562
  246   H5''    A  24          H5''        A  24  28.779  -4.423  21.795
  247    H4'    A  24           H4'        A  24  28.887  -7.292  21.706
  248    H3'    A  24           H3'        A  24  27.198  -5.024  20.693
  249    H2'    A  24          H2''        A  24  25.300  -6.282  20.550
  250   HO2'    A  24          H2'         A  24  25.483  -8.575  19.901
  251    H1'    A  24           H1'        A  24  26.295  -8.605  22.062
  252    H8     A  24           H8         A  24  25.256  -5.839  24.245
  253    H61    A  24           H61        A  24  19.371  -7.567  23.459
  254    H62    A  24           H62        A  24  20.474  -6.627  24.439
  255    H2     A  24           H2         A  24  21.897  -9.804  20.501
  256    H5'    U  25           H5'        U  25  26.800  -3.509  17.427
  257   H5''    U  25          H5''        U  25  26.445  -4.871  18.508
  258    H4'    U  25           H4'        U  25  25.660  -4.460  15.712
  259    H3'    U  25           H3'        U  25  24.511  -5.277  18.067
  260    H2'    U  25          H2''        U  25  25.479  -7.405  18.265
  261   HO2'    U  25          H2'         U  25  23.377  -7.815  16.387
  262    H1'    U  25           H1'        U  25  25.380  -7.905  15.320
  263    H3     U  25           H3         U  25  28.120 -11.436  15.483
  264    H5     U  25           H5         U  25  29.210  -9.280  18.935
  265    H6     U  25           H6         U  25  27.566  -7.604  18.334
  266    H5'    U  26           H5'        U  26  23.528  -6.097  19.573
  267   H5''    U  26          H5''        U  26  21.978  -6.760  19.022
  268    H4'    U  26           H4'        U  26  21.255  -6.091  21.123
  269    H3'    U  26           H3'        U  26  21.168  -3.840  19.181
  270    H2'    U  26          H2''        U  26  21.349  -2.095  20.640
  271   HO2'    U  26          H2'         U  26  19.527  -2.407  21.810
  272    H1'    U  26           H1'        U  26  22.535  -3.278  22.868
  273    H3     U  26           H3         U  26  25.319   0.147  22.039
  274    H5     U  26           H5         U  26  25.841  -2.350  18.693
  275    H6     U  26           H6         U  26  24.061  -3.756  19.519
  276    H5'    C  27           H5'        C  27  16.372  -3.352  20.397
  277   H5''    C  27          H5''        C  27  16.097  -2.164  19.110
  278    H4'    C  27           H4'        C  27  16.045  -1.476  21.730
  279    H3'    C  27           H3'        C  27  17.226  -0.048  19.301
  280    H2'    C  27          H2''        C  27  17.913   1.736  20.650
  281   HO2'    C  27          H2'         C  27  16.765   2.456  22.294
  282    H1'    C  27           H1'        C  27  18.260   0.215  23.013
  283    H41    C  27           H41        C  27  24.044   2.157  21.198
  284    H42    C  27           H42        C  27  23.944   1.220  19.724
  285    H5     C  27           H5         C  27  21.934   0.096  19.018
  286    H6     C  27           H6         C  27  19.650  -0.525  19.652
  287    H5'    U  28           H5'        U  28  13.146   2.580  19.923
  288   H5''    U  28          H5''        U  28  13.246   3.742  18.586
  289    H4'    U  28           H4'        U  28  13.533   4.543  21.129
  290    H3'    U  28           H3'        U  28  15.019   5.313  18.604
  291    H2'    U  28          H2''        U  28  16.383   6.802  19.775
  292   HO2'    U  28          H2'         U  28  15.855   7.716  21.671
  293    H1'    U  28           H1'        U  28  16.773   5.215  22.015
  294    H3     U  28           H3         U  28  20.580   5.970  19.493
  295    H5     U  28           H5         U  28  18.650   2.666  17.744
  296    H6     U  28           H6         U  28  16.766   3.063  19.201
  297    H5'    U  29           H5'        U  29  13.702   9.153  20.503
  298   H5''    U  29          H5''        U  29  12.957  10.111  19.207
  299    H4'    U  29           H4'        U  29  14.614  11.454  20.491
  300    H3'    U  29           H3'        U  29  14.915  10.755  17.582
  301    H2'    U  29          H2''        U  29  17.061  11.596  17.401
  302   HO2'    U  29          H2'         U  29  16.394  13.173  19.664
  303    H1'    U  29           H1'        U  29  18.004  11.129  19.977
  304    H3     U  29           H3         U  29  20.717   8.963  17.012
  305    H5     U  29           H5         U  29  17.274   6.550  17.276
  306    H6     U  29           H6         U  29  16.233   8.298  18.595
  307    H5'    A  30           H5'        A  30  15.655  15.502  17.446
  308   H5''    A  30          H5''        A  30  15.492  15.689  15.690
  309    H4'    A  30           H4'        A  30  17.823  16.161  16.907
  310    H3'    A  30           H3'        A  30  17.231  14.732  14.298
  311    H2'    A  30          H2''        A  30  19.535  14.482  13.910
  312   HO2'    A  30          H2'         A  30  19.762  16.557  15.799
  313    H1'    A  30           H1'        A  30  20.218  13.827  16.517
  314    H8     A  30           H8         A  30  17.038  11.989  15.552
  315    H61    A  30           H61        A  30  20.594   8.088  12.358
  316    H62    A  30           H62        A  30  19.053   8.293  13.160
  317    H2     A  30           H2         A  30  23.088  11.642  13.477
  318    H5'    C  31           H5'        C  31  19.225  18.677  12.645
  319   H5''    C  31          H5''        C  31  18.822  18.619  10.918
  320    H4'    C  31           H4'        C  31  21.344  18.343  11.725
  321    H3'    C  31           H3'        C  31  19.742  16.968   9.569
  322    H2'    C  31          H2''        C  31  21.445  15.450   9.083
  323   HO2'    C  31          H2'         C  31  23.129  16.867   8.777
  324    H1'    C  31           H1'        C  31  22.540  15.161  11.614
  325    H41    C  31           H41        C  31  19.156   9.959  10.040
  326    H42    C  31           H42        C  31  17.730  10.693  10.738
  327    H5     C  31           H5         C  31  17.741  12.893  11.732
  328    H6     C  31           H6         C  31  19.036  14.946  12.046
  329    H5'    A  32           H5'        A  32  23.056  18.447   7.147
  330   H5''    A  32          H5''        A  32  22.384  19.251   5.715
  331    H4'    A  32           H4'        A  32  23.854  17.443   4.977
  332    H3'    A  32           H3'        A  32  20.864  17.189   4.691
  333    H2'    A  32          H2''        A  32  20.969  15.016   3.916
  334   HO2'    A  32          H2'         A  32  23.655  15.591   3.172
  335    H1'    A  32           H1'        A  32  23.325  14.185   5.210
  336    H8     A  32           H8         A  32  20.506  15.619   7.404
  337    H61    A  32           H61        A  32  18.135   9.910   7.320
  338    H62    A  32           H62        A  32  18.090  11.471   8.109
  339    H2     A  32           H2         A  32  21.646  10.004   4.526
  340    H5'    C  33           H5'        C  33  22.949  16.639   0.169
  341   H5''    C  33          H5''        C  33  21.466  16.601  -0.804
  342    H4'    C  33           H4'        C  33  23.179  14.549  -0.842
  343    H3'    C  33           H3'        C  33  20.153  14.580  -0.740
  344    H2'    C  33          H2''        C  33  20.118  12.218  -0.888
  345   HO2'    C  33          H2'         C  33  22.909  12.367  -1.447
  346    H1'    C  33           H1'        C  33  22.137  11.802   0.943
  347    H41    C  33           H41        C  33  16.505  11.450   3.948
  348    H42    C  33           H42        C  33  16.532  13.179   4.199
  349    H5     C  33           H5         C  33  18.356  14.581   3.458
  350    H6     C  33           H6         C  33  20.366  14.683   2.062
  351    H5'    A  34           H5'        A  34  21.343  12.418  -3.743
  352   H5''    A  34          H5''        A  34  20.984  12.719  -5.456
  353    H4'    A  34           H4'        A  34  20.547  10.392  -5.158
  354    H3'    A  34           H3'        A  34  18.244  12.282  -5.265
  355    H2'    A  34          H2''        A  34  16.661  10.888  -4.369
  356   HO2'    A  34          H2'         A  34  18.214   8.726  -5.379
  357    H1'    A  34           H1'        A  34  18.269   9.061  -2.942
  358    H8     A  34           H8         A  34  18.571  12.788  -2.031
  359    H61    A  34           H61        A  34  14.118  11.647   2.096
  360    H62    A  34           H62        A  34  15.374  12.762   1.610
  361    H2     A  34           H2         A  34  14.578   8.015  -0.493
  362    H5'    C  35           H5'        C  35  15.820  11.335  -8.924
  363   H5''    C  35          H5''        C  35  14.973  12.727  -8.219
  364    H4'    C  35           H4'        C  35  14.972   9.865  -7.365
  365    H3'    C  35           H3'        C  35  13.142  11.857  -8.159
  366    H2'    C  35          H2''        C  35  12.904  13.033  -6.202
  367   HO2'    C  35          H2'         C  35  11.551  10.607  -5.611
  368    H1'    C  35           H1'        C  35  13.576  10.746  -4.390
  369    H41    C  35           H41        C  35  14.430  16.002  -0.849
  370    H42    C  35           H42        C  35  16.012  16.184  -1.573
  371    H5     C  35           H5         C  35  16.719  14.933  -3.511
  372    H6     C  35           H6         C  35  16.158  13.101  -5.031
  373    H5'    U  36           H5'        U  36  14.439   6.521  -8.726
  374   H5''    U  36          H5''        U  36  13.001   6.540  -9.770
  375    H4'    U  36           H4'        U  36  13.051   4.340  -8.806
  376    H3'    U  36           H3'        U  36  11.115   6.379  -7.825
  377    H2'    U  36          H2''        U  36  10.524   5.341  -5.848
  378   HO2'    U  36          H2'         U  36   9.938   3.368  -6.804
  379    H1'    U  36           H1'        U  36  12.850   4.018  -5.178
  380    H3     U  36           H3         U  36  11.176   7.672  -2.549
  381    H5     U  36           H5         U  36  14.726   8.793  -4.520
  382    H6     U  36           H6         U  36  14.571   6.748  -5.821
  383    H5'    A  37           H5'        A  37   7.342   3.747  -9.147
  384   H5''    A  37          H5''        A  37   6.440   5.235  -9.493
  385    H4'    A  37           H4'        A  37   5.768   3.669  -7.432
  386    H3'    A  37           H3'        A  37   5.859   6.671  -7.758
  387    H2'    A  37          H2''        A  37   5.292   7.053  -5.527
  388   HO2'    A  37          H2'         A  37   4.513   4.314  -5.421
  389    H1'    A  37           H1'        A  37   6.785   5.027  -4.381
  390    H8     A  37           H8         A  37   9.112   6.479  -6.880
  391    H61    A  37           H61        A  37   9.875  11.298  -3.101
  392    H62    A  37           H62        A  37  10.452  10.490  -4.541
  393    H2     A  37           H2         A  37   6.183   9.102  -1.816
  394    H5'    C  38           H5'        C  38   1.519   5.488  -7.244
  395   H5''    C  38          H5''        C  38   0.372   6.541  -8.097
  396    H4'    C  38           H4'        C  38   0.073   6.530  -5.585
  397    H3'    C  38           H3'        C  38   0.646   8.929  -7.303
  398    H2'    C  38          H2''        C  38   0.940  10.379  -5.520
  399   HO2'    C  38          H2'         C  38  -1.013   9.930  -4.484
  400    H1'    C  38           H1'        C  38   1.993   8.615  -3.626
  401    H41    C  38           H41        C  38   6.731  12.331  -5.791
  402    H42    C  38           H42        C  38   6.973  11.225  -7.125
  403    H5     C  38           H5         C  38   5.640   9.251  -7.449
  404    H6     C  38           H6         C  38   3.658   8.024  -6.708
  405    H5'    A  39           H5'        A  39  -3.472  10.579  -6.190
  406   H5''    A  39          H5''        A  39  -3.625  11.744  -7.519
  407    H4'    A  39           H4'        A  39  -2.950  12.528  -5.030
  408    H3'    A  39           H3'        A  39  -1.934  13.417  -7.758
  409    H2'    A  39          H2''        A  39  -0.394  14.870  -6.753
  410   HO2'    A  39          H2'         A  39  -1.719  16.112  -5.514
  411    H1'    A  39           H1'        A  39  -0.079  13.449  -4.336
  412    H8     A  39           H8         A  39   0.852  11.357  -7.336
  413    H61    A  39           H61        A  39   6.161  14.508  -7.606
  414    H62    A  39           H62        A  39   5.324  13.058  -8.110
  415    H2     A  39           H2         A  39   3.500  16.529  -4.616
  416    H5'    A  40           H5'        A  40  -3.796  16.281  -5.069
  417   H5''    A  40          H5''        A  40  -4.939  17.459  -5.748
  418    H4'    A  40           H4'        A  40  -3.615  18.608  -4.061
  419    H3'    A  40           H3'        A  40  -3.239  19.136  -6.986
  420    H2'    A  40          H2''        A  40  -1.220  20.208  -6.838
  421   HO2'    A  40          H2'         A  40  -2.458  21.457  -4.881
  422    H1'    A  40           H1'        A  40  -0.247  19.243  -4.385
  423    H8     A  40           H8         A  40  -1.171  16.742  -7.187
  424    H61    A  40           H61        A  40   4.714  17.308  -8.996
  425    H62    A  40           H62        A  40   3.244  16.375  -9.159
  426    H2     A  40           H2         A  40   3.971  20.275  -5.711
  427    H5'    A  41           H5'        A  41  -3.477  23.712  -5.468
  428   H5''    A  41          H5''        A  41  -3.794  24.427  -7.061
  429    H4'    A  41           H4'        A  41  -1.508  24.934  -5.745
  430    H3'    A  41           H3'        A  41  -1.959  24.289  -8.676
  431    H2'    A  41          H2''        A  41   0.307  24.724  -9.102
  432   HO2'    A  41          H2'         A  41   1.464  26.113  -7.986
  433    H1'    A  41           H1'        A  41   1.220  23.600  -6.674
  434    H8     A  41           H8         A  41  -1.232  21.384  -8.572
  435    H61    A  41           H61        A  41   3.638  19.423 -11.842
  436    H62    A  41           H62        A  41   1.971  19.110 -11.418
  437    H2     A  41           H2         A  41   4.990  22.806  -9.223
  438    H5'    U  42           H5'        U  42   0.266  27.983  -7.955
  439   H5''    U  42          H5''        U  42  -0.269  29.292  -9.029
  440    H4'    U  42           H4'        U  42   2.219  29.127  -9.005
  441    H3'    U  42           H3'        U  42   0.573  28.325 -11.427
  442    H2'    U  42          H2''        U  42   2.433  27.695 -12.654
  443   HO2'    U  42          H2'         U  42   4.344  28.670 -12.512
  444    H1'    U  42           H1'        U  42   4.065  26.909 -10.487
  445    H3     U  42           H3         U  42   3.963  23.156 -12.990
  446    H5     U  42           H5         U  42   0.008  23.545 -11.601
  447    H6     U  42           H6         U  42   0.571  25.761 -10.815
  448    H5'    U  43           H5'        U  43   3.543  31.037 -13.477
  449   H5''    U  43          H5''        U  43   2.733  31.347 -15.026
  450    H4'    U  43           H4'        U  43   4.897  29.780 -14.904
  451    H3'    U  43           H3'        U  43   2.346  29.643 -16.507
  452    H2'    U  43          H2''        U  43   2.693  27.484 -17.236
  453   HO2'    U  43          H2'         U  43   5.458  28.094 -16.984
  454    H1'    U  43           H1'        U  43   4.492  26.588 -15.214
  455    H3     U  43           H3         U  43   1.492  23.225 -15.447
  456    H5     U  43           H5         U  43  -0.797  26.499 -14.102
  457    H6     U  43           H6         U  43   1.154  27.907 -14.411
  458    H5'    A  44           H5'        A  44   5.700  32.371 -19.492
  459   H5''    A  44          H5''        A  44   4.714  32.395 -20.967
  460    H4'    A  44           H4'        A  44   7.264  31.635 -21.065
  461    H3'    A  44           H3'        A  44   4.776  30.743 -22.463
  462    H2'    A  44          H2''        A  44   5.608  28.745 -23.253
  463   HO2'    A  44          H2'         A  44   7.358  29.586 -24.362
  464    H1'    A  44           H1'        A  44   7.529  28.147 -21.315
  465    H8     A  44           H8         A  44   4.445  28.699 -19.352
  466    H61    A  44           H61        A  44   2.271  23.315 -21.451
  467    H62    A  44           H62        A  44   2.097  24.565 -20.239
  468    H2     A  44           H2         A  44   5.986  24.303 -23.758
  469    H5'    A  45           H5'        A  45   7.248  31.084 -26.424
  470   H5''    A  45          H5''        A  45   5.861  31.367 -27.493
  471    H4'    A  45           H4'        A  45   7.242  29.093 -27.653
  472    H3'    A  45           H3'        A  45   4.284  29.669 -27.769
  473    H2'    A  45          H2''        A  45   3.710  27.434 -27.833
  474   HO2'    A  45          H2'         A  45   6.337  26.994 -28.824
  475    H1'    A  45           H1'        A  45   5.887  26.391 -26.360
  476    H8     A  45           H8         A  45   3.968  29.108 -24.525
  477    H61    A  45           H61        A  45  -0.139  24.733 -23.024
  478    H62    A  45           H62        A  45   0.455  26.335 -22.650
  479    H2     A  45           H2         A  45   2.713  22.998 -26.018
  480    H5'    G  46           H5'        G  46   5.753  27.651 -32.424
  481   H5''    G  46          H5''        G  46   4.155  27.967 -33.127
  482    H4'    G  46           H4'        G  46   5.241  25.539 -33.291
  483    H3'    G  46           H3'        G  46   2.429  26.480 -32.768
  484    H2'    G  46          H2''        G  46   1.616  24.332 -32.343
  485   HO2'    G  46          H2'         G  46   4.052  23.291 -33.399
  486    H1'    G  46           H1'        G  46   3.758  23.346 -30.927
  487    H8     G  46           H8         G  46   3.350  26.803 -29.626
  488    H1     G  46           H1         G  46  -1.431  22.955 -27.791
  489    H21    G  46           H21        G  46  -1.333  21.047 -28.898
  490    H22    G  46           H22        G  46  -0.224  20.795 -30.226
  491    H5'    C  47           H5'        C  47   2.052  22.820 -34.632
  492   H5''    C  47          H5''        C  47   1.591  23.165 -36.311
  493    H4'    C  47           H4'        C  47   0.293  21.247 -35.640
  494    H3'    C  47           H3'        C  47  -1.036  23.937 -35.761
  495    H2'    C  47          H2''        C  47  -3.061  23.186 -34.939
  496   HO2'    C  47          H2'         C  47  -3.703  21.055 -34.980
  497    H1'    C  47           H1'        C  47  -2.097  21.270 -33.129
  498    H41    C  47           H41        C  47  -3.470  26.176 -29.356
  499    H42    C  47           H42        C  47  -2.091  27.066 -29.951
  500    H5     C  47           H5         C  47  -0.793  26.361 -31.858
  501    H6     C  47           H6         C  47  -0.416  24.555 -33.468
  502    H5'    C  48           H5'        C  48  -4.130  21.610 -36.977
  503   H5''    C  48          H5''        C  48  -4.955  22.381 -38.347
  504    H4'    C  48           H4'        C  48  -6.439  22.151 -36.322
  505    H3'    C  48           H3'        C  48  -5.576  24.835 -37.425
  506   HO3'    C  48          H3T         C  48  -7.044  24.146 -38.788
  507    H2'    C  48          H2''        C  48  -6.721  25.981 -35.793
  508   HO2'    C  48          H2'         C  48  -8.595  25.240 -34.859
  509    H1'    C  48           H1'        C  48  -6.707  23.893 -33.826
  510    H41    C  48           H41        C  48  -3.590  28.816 -31.275
  511    H42    C  48           H42        C  48  -2.383  28.768 -32.541
  512    H5     C  48           H5         C  48  -2.459  27.214 -34.377
  513    H6     C  48           H6         C  48  -3.734  25.408 -35.434
  Start of MODEL   10
    1    H5'    G   1           H5'        G   1  -9.784  31.543 -23.416
    2   H5''    G   1          H5''        G   1  -9.164  30.162 -22.488
    3    H4'    G   1           H4'        G   1 -11.235  29.510 -23.638
    4    H3'    G   1           H3'        G   1  -8.560  28.362 -24.225
    5    H2'    G   1          H2''        G   1  -9.031  27.440 -26.267
    6   HO2'    G   1          H2'         G   1 -11.047  26.633 -26.812
    7    H1'    G   1           H1'        G   1 -11.111  29.027 -27.193
    8    H8     G   1           H8         G   1  -8.436  31.446 -26.366
    9    H1     G   1           H1         G   1  -6.720  27.692 -31.280
   10    H21    G   1           H21        G   1  -8.153  26.026 -31.496
   11    H22    G   1           H22        G   1  -9.416  25.723 -30.325
   12   HO5'    G   1          H5T         G   1  -7.893  31.578 -24.283
   13    H5'    G   2           H5'        G   2 -10.982  23.860 -22.549
   14   H5''    G   2          H5''        G   2  -9.307  23.295 -22.396
   15    H4'    G   2           H4'        G   2 -11.094  21.878 -23.770
   16    H3'    G   2           H3'        G   2  -8.175  22.409 -24.084
   17    H2'    G   2          H2''        G   2  -7.995  21.705 -26.289
   18   HO2'    G   2          H2'         G   2  -8.869  19.811 -26.576
   19    H1'    G   2           H1'        G   2 -10.389  22.509 -27.323
   20    H8     G   2           H8         G   2  -9.588  25.490 -25.430
   21    H1     G   2           H1         G   2  -5.100  24.538 -29.895
   22    H21    G   2           H21        G   2  -5.297  22.511 -30.750
   23    H22    G   2           H22        G   2  -6.412  21.327 -30.105
   24    H5'    C   3           H5'        C   3  -8.329  18.058 -25.313
   25   H5''    C   3          H5''        C   3  -7.124  17.310 -24.246
   26    H4'    C   3           H4'        C   3  -6.774  16.818 -26.712
   27    H3'    C   3           H3'        C   3  -4.834  18.034 -24.788
   28    H2'    C   3          H2''        C   3  -3.314  18.765 -26.358
   29   HO2'    C   3          H2'         C   3  -4.366  16.754 -28.074
   30    H1'    C   3           H1'        C   3  -4.959  19.147 -28.582
   31    H41    C   3           H41        C   3  -3.018  24.788 -26.240
   32    H42    C   3           H42        C   3  -4.501  24.872 -25.317
   33    H5     C   3           H5         C   3  -5.981  22.989 -25.038
   34    H6     C   3           H6         C   3  -6.506  20.722 -25.814
   35    H5'    U   4           H5'        U   4  -2.251  15.721 -27.200
   36   H5''    U   4          H5''        U   4  -1.051  14.922 -26.164
   37    H4'    U   4           H4'        U   4  -0.079  16.535 -27.886
   38    H3'    U   4           H3'        U   4   0.328  16.563 -24.908
   39    H2'    U   4          H2''        U   4   1.324  18.623 -24.854
   40   HO2'    U   4          H2'         U   4   2.207  18.096 -27.506
   41    H1'    U   4           H1'        U   4   0.403  19.675 -27.343
   42    H3     U   4           H3         U   4  -0.045  23.075 -24.389
   43    H5     U   4           H5         U   4  -2.975  20.288 -23.203
   44    H6     U   4           H6         U   4  -2.061  18.732 -24.825
   45    H5'    U   5           H5'        U   5   4.182  17.171 -27.335
   46   H5''    U   5          H5''        U   5   5.442  16.203 -26.544
   47    H4'    U   5           H4'        U   5   6.319  18.444 -27.072
   48    H3'    U   5           H3'        U   5   5.895  17.476 -24.269
   49    H2'    U   5          H2''        U   5   6.156  19.523 -23.262
   50   HO2'    U   5          H2'         U   5   7.739  20.856 -23.792
   51    H1'    U   5           H1'        U   5   5.599  21.249 -25.455
   52    H3     U   5           H3         U   5   2.964  23.046 -22.286
   53    H5     U   5           H5         U   5   1.461  19.133 -22.681
   54    H6     U   5           H6         U   5   3.277  18.661 -24.222
   55    H5'    G   6           H5'        G   6   9.000  17.875 -21.156
   56   H5''    G   6          H5''        G   6   7.488  18.394 -21.931
   57    H4'    G   6           H4'        G   6   9.741  20.375 -21.922
   58    H3'    G   6           H3'        G   6   8.504  19.134 -19.499
   59    H2'    G   6          H2''        G   6   7.628  21.061 -18.625
   60   HO2'    G   6          H2'         G   6   9.732  22.432 -19.965
   61    H1'    G   6           H1'        G   6   7.482  22.689 -20.936
   62    H8     G   6           H8         G   6   5.432  19.489 -21.153
   63    H1     G   6           H1         G   6   2.620  24.115 -17.717
   64    H21    G   6           H21        G   6   4.014  25.794 -17.414
   65    H22    G   6           H22        G   6   5.696  25.708 -17.889
   66    H5'    A   7           H5'        A   7  11.530  22.390 -18.453
   67   H5''    A   7          H5''        A   7  12.598  21.733 -17.195
   68    H4'    A   7           H4'        A   7  11.948  24.037 -16.613
   69    H3'    A   7           H3'        A   7  11.047  21.643 -15.050
   70    H2'    A   7          H2''        A   7   9.499  22.765 -13.768
   71   HO2'    A   7          H2'         A   7   9.832  24.735 -12.983
   72    H1'    A   7           H1'        A   7   8.866  24.906 -15.479
   73    H8     A   7           H8         A   7   8.447  21.317 -16.820
   74    H61    A   7           H61        A   7   2.807  21.488 -14.303
   75    H62    A   7           H62        A   7   3.858  20.640 -15.415
   76    H2     A   7           H2         A   7   4.974  25.228 -13.112
   77    H5'    U   8           H5'        U   8  11.938  24.958 -12.352
   78   H5''    U   8          H5''        U   8  13.040  24.390 -11.081
   79    H4'    U   8           H4'        U   8  11.237  25.649 -10.025
   80    H3'    U   8           H3'        U   8  11.390  22.658  -9.744
   81    H2'    U   8          H2''        U   8   9.330  22.453  -8.745
   82   HO2'    U   8          H2'         U   8   8.765  23.717  -7.151
   83    H1'    U   8           H1'        U   8   8.108  24.851  -9.677
   84    H3     U   8           H3         U   8   4.888  21.899 -10.724
   85    H5     U   8           H5         U   8   8.239  20.434 -12.819
   86    H6     U   8           H6         U   8   9.579  22.150 -11.743
   87    H5'    U   9           H5'        U   9  10.782  24.581  -5.717
   88   H5''    U   9          H5''        U   9  11.649  23.642  -4.486
   89    H4'    U   9           H4'        U   9   9.238  23.991  -3.898
   90    H3'    U   9           H3'        U   9  10.517  21.310  -4.367
   91    H2'    U   9          H2''        U   9   8.539  20.141  -4.320
   92   HO2'    U   9          H2'         U   9   7.085  20.485  -2.819
   93    H1'    U   9           H1'        U   9   6.733  22.235  -5.004
   94    H3     U   9           H3         U   9   5.443  18.977  -7.810
   95    H5     U   9           H5         U   9   9.483  19.577  -8.849
   96    H6     U   9           H6         U   9   9.644  21.178  -7.033
   97    H5'    G  10           H5'        G  10   8.052  21.601  -0.728
   98   H5''    G  10          H5''        G  10   8.843  20.865   0.680
   99    H4'    G  10           H4'        G  10   6.438  20.233   0.550
  100    H3'    G  10           H3'        G  10   8.670  18.227   0.215
  101    H2'    G  10          H2''        G  10   7.191  16.469  -0.148
  102   HO2'    G  10          H2'         G  10   5.718  16.475   1.388
  103    H1'    G  10           H1'        G  10   5.190  17.880  -1.504
  104    H8     G  10           H8         G  10   8.575  18.630  -3.014
  105    H1     G  10           H1         G  10   6.390  12.790  -4.514
  106    H21    G  10           H21        G  10   4.572  12.341  -3.345
  107    H22    G  10           H22        G  10   4.008  13.386  -2.062
  108    H5'    U  11           H5'        U  11   6.616  16.680   3.926
  109   H5''    U  11          H5''        U  11   7.750  15.572   4.723
  110    H4'    U  11           H4'        U  11   5.565  14.640   3.510
  111    H3'    U  11           H3'        U  11   8.402  13.612   3.635
  112    H2'    U  11          H2''        U  11   7.973  11.885   2.149
  113   HO2'    U  11          H2'         U  11   6.179  11.039   3.240
  114    H1'    U  11           H1'        U  11   6.000  13.136   0.584
  115    H3     U  11           H3         U  11   9.541  11.575  -1.933
  116    H5     U  11           H5         U  11  10.697  15.376  -0.529
  117    H6     U  11           H6         U  11   8.742  15.373   0.907
  118    H5'    A  12           H5'        A  12   6.343  10.150   6.063
  119   H5''    A  12          H5''        A  12   7.758   9.286   6.696
  120    H4'    A  12           H4'        A  12   6.279   8.246   4.723
  121    H3'    A  12           H3'        A  12   9.264   8.280   5.216
  122    H2'    A  12          H2''        A  12   9.718   7.246   3.185
  123   HO2'    A  12          H2'         A  12   8.047   6.126   2.014
  124    H1'    A  12           H1'        A  12   7.606   8.303   1.686
  125    H8     A  12           H8         A  12   9.484  11.136   3.316
  126    H61    A  12           H61        A  12  13.940  10.288  -0.887
  127    H62    A  12           H62        A  12  13.262  11.398   0.283
  128    H2     A  12           H2         A  12  11.013   6.910  -1.261
  129    H5'    U  13           H5'        U  13   8.573   4.800   3.429
  130   H5''    U  13          H5''        U  13   9.050   3.436   4.457
  131    H4'    U  13           H4'        U  13  10.051   2.986   2.337
  132    H3'    U  13           H3'        U  13  11.908   4.250   4.371
  133    H2'    U  13          H2''        U  13  13.684   4.174   2.858
  134   HO2'    U  13          H2'         U  13  13.930   2.503   1.620
  135    H1'    U  13           H1'        U  13  12.210   4.689   0.529
  136    H3     U  13           H3         U  13  15.102   8.165   0.769
  137    H5     U  13           H5         U  13  12.640   8.690   4.130
  138    H6     U  13           H6         U  13  11.552   6.599   3.602
  139    H5'    G  14           H5'        G  14  13.994   0.478   3.751
  140   H5''    G  14          H5''        G  14  15.267   0.393   4.984
  141    H4'    G  14           H4'        G  14  15.819   1.078   2.451
  142    H3'    G  14           H3'        G  14  16.906   2.072   5.094
  143    H2'    G  14          H2''        G  14  18.123   3.739   4.072
  144   HO2'    G  14          H2'         G  14  18.206   1.985   1.845
  145    H1'    G  14           H1'        G  14  16.582   3.913   1.649
  146    H8     G  14           H8         G  14  14.630   5.124   4.627
  147    H1     G  14           H1         G  14  18.999   9.310   2.481
  148    H21    G  14           H21        G  14  20.346   8.321   1.046
  149    H22    G  14           H22        G  14  20.295   6.597   0.757
  150    H5'    U  15           H5'        U  15  20.285   0.920   2.143
  151   H5''    U  15          H5''        U  15  21.351  -0.099   3.132
  152    H4'    U  15           H4'        U  15  22.746   1.420   1.833
  153    H3'    U  15           H3'        U  15  22.422   1.796   4.798
  154    H2'    U  15          H2''        U  15  23.516   3.827   4.865
  155   HO2'    U  15          H2'         U  15  25.276   2.725   3.498
  156    H1'    U  15           H1'        U  15  22.945   4.788   2.298
  157    H3     U  15           H3         U  15  21.343   8.009   5.031
  158    H5     U  15           H5         U  15  18.837   4.715   5.814
  159    H6     U  15           H6         U  15  20.248   3.378   4.363
  160    H5'    G  16           H5'        G  16  27.142   2.121   4.378
  161   H5''    G  16          H5''        G  16  27.546   1.799   6.075
  162    H4'    G  16           H4'        G  16  28.073   4.173   4.995
  163    H3'    G  16           H3'        G  16  27.019   3.373   7.704
  164    H2'    G  16          H2''        G  16  26.502   5.520   8.310
  165   HO2'    G  16          H2'         G  16  28.278   6.666   8.281
  166    H1'    G  16           H1'        G  16  26.325   6.697   5.705
  167    H8     G  16           H8         G  16  23.777   4.018   6.775
  168    H1     G  16           H1         G  16  22.353   9.982   8.643
  169    H21    G  16           H21        G  16  24.042  11.333   8.199
  170    H22    G  16           H22        G  16  25.580  10.741   7.614
  171    H5'    U  17           H5'        U  17  31.002   6.281   8.824
  172   H5''    U  17          H5''        U  17  31.060   5.684  10.493
  173    H4'    U  17           H4'        U  17  30.747   8.284   9.998
  174    H3'    U  17           H3'        U  17  29.542   6.444  12.055
  175    H2'    U  17          H2''        U  17  27.965   7.956  12.743
  176   HO2'    U  17          H2'         U  17  29.895   9.903  12.026
  177    H1'    U  17           H1'        U  17  27.900   9.644  10.438
  178    H3     U  17           H3         U  17  23.619   8.956  11.820
  179    H5     U  17           H5         U  17  24.792   5.280  10.122
  180    H6     U  17           H6         U  17  27.047   6.159   9.946
  181    H5'    A  18           H5'        A  18  31.756  10.370  14.678
  182   H5''    A  18          H5''        A  18  31.460   9.568  16.231
  183    H4'    A  18           H4'        A  18  30.581  12.048  15.804
  184    H3'    A  18           H3'        A  18  29.233   9.687  17.135
  185    H2'    A  18          H2''        A  18  27.343  10.991  17.621
  186   HO2'    A  18          H2'         A  18  28.956  13.249  16.976
  187    H1'    A  18           H1'        A  18  27.269  12.375  15.208
  188    H8     A  18           H8         A  18  27.946   8.767  14.435
  189    H61    A  18           H61        A  18  21.935   7.690  15.370
  190    H62    A  18           H62        A  18  23.464   6.991  14.886
  191    H2     A  18           H2         A  18  22.843  11.831  16.842
  192    H5'    A  19           H5'        A  19  28.743  12.713  19.742
  193   H5''    A  19          H5''        A  19  29.221  12.371  21.417
  194    H4'    A  19           H4'        A  19  26.916  13.191  21.410
  195    H3'    A  19           H3'        A  19  27.541  10.312  22.022
  196    H2'    A  19          H2''        A  19  25.354   9.625  21.987
  197   HO2'    A  19          H2'         A  19  23.784  10.739  22.910
  198    H1'    A  19           H1'        A  19  24.227  11.663  20.361
  199    H8     A  19           H8         A  19  26.951   9.454  18.805
  200    H61    A  19           H61        A  19  22.434   5.427  17.548
  201    H62    A  19           H62        A  19  24.076   5.904  17.178
  202    H2     A  19           H2         A  19  20.733   8.663  20.146
  203    H5'    A  20           H5'        A  20  24.497  11.835  25.104
  204   H5''    A  20          H5''        A  20  25.014  11.095  26.631
  205    H4'    A  20           H4'        A  20  22.604  10.686  26.223
  206    H3'    A  20           H3'        A  20  24.634   8.450  26.203
  207    H2'    A  20          H2''        A  20  23.057   6.854  25.603
  208   HO2'    A  20          H2'         A  20  21.190   6.820  26.554
  209    H1'    A  20           H1'        A  20  21.301   8.483  24.140
  210    H8     A  20           H8         A  20  25.091   8.320  23.322
  211    H61    A  20           H61        A  20  23.613   3.656  19.551
  212    H62    A  20           H62        A  20  24.863   4.786  20.018
  213    H2     A  20           H2         A  20  19.909   4.882  21.760
  214    H5'    U  21           H5'        U  21  21.787   6.555  29.012
  215   H5''    U  21          H5''        U  21  22.814   5.326  29.777
  216    H4'    U  21           H4'        U  21  20.963   4.626  27.987
  217    H3'    U  21           H3'        U  21  23.764   3.647  28.526
  218    H2'    U  21          H2''        U  21  23.906   2.437  26.539
  219   HO2'    U  21          H2'         U  21  22.366   1.105  26.040
  220    H1'    U  21           H1'        U  21  21.924   3.746  25.029
  221    H3     U  21           H3         U  21  25.661   3.263  22.427
  222    H5     U  21           H5         U  21  26.798   6.050  25.376
  223    H6     U  21           H6         U  21  24.601   5.809  26.358
  224    H5'    U  22           H5'        U  22  20.836   0.532  27.743
  225   H5''    U  22          H5''        U  22  20.765  -0.657  29.060
  226    H4'    U  22           H4'        U  22  20.578  -1.841  26.928
  227    H3'    U  22           H3'        U  22  22.903  -2.095  28.755
  228    H2'    U  22          H2''        U  22  24.461  -2.819  27.265
  229   HO2'    U  22          H2'         U  22  23.288  -4.764  26.940
  230    H1'    U  22           H1'        U  22  23.243  -2.202  24.779
  231    H3     U  22           H3         U  22  27.288  -0.457  23.943
  232    H5     U  22           H5         U  22  26.148   1.487  27.504
  233    H6     U  22           H6         U  22  24.136   0.135  27.523
  234    H5'    A  23           H5'        A  23  24.811  -5.091  29.874
  235   H5''    A  23          H5''        A  23  25.074  -4.400  28.263
  236    H4'    A  23           H4'        A  23  26.594  -6.350  28.818
  237    H3'    A  23           H3'        A  23  24.711  -6.192  26.438
  238    H2'    A  23          H2''        A  23  25.192  -8.545  25.821
  239   HO2'    A  23          H2'         A  23  26.902  -9.586  26.738
  240    H1'    A  23           H1'        A  23  24.986  -9.634  28.096
  241    H8     A  23           H8         A  23  22.469  -7.136  28.953
  242    H61    A  23           H61        A  23  18.588 -10.082  25.153
  243    H62    A  23           H62        A  23  18.746  -8.800  26.333
  244    H2     A  23           H2         A  23  22.745 -11.521  24.286
  245    H5'    A  24           H5'        A  24  27.628  -6.725  23.695
  246   H5''    A  24          H5''        A  24  27.020  -5.862  22.270
  247    H4'    A  24           H4'        A  24  26.442  -8.478  22.770
  248    H3'    A  24           H3'        A  24  25.108  -6.196  21.387
  249    H2'    A  24          H2''        A  24  22.991  -7.056  21.495
  250   HO2'    A  24          H2'         A  24  22.648  -9.371  21.232
  251    H1'    A  24           H1'        A  24  23.514  -9.209  23.412
  252    H8     A  24           H8         A  24  23.373  -5.908  25.015
  253    H61    A  24           H61        A  24  17.200  -6.208  24.817
  254    H62    A  24           H62        A  24  18.577  -5.312  25.418
  255    H2     A  24           H2         A  24  18.849  -9.415  22.145
  256    H5'    U  25           H5'        U  25  24.925  -5.061  18.080
  257   H5''    U  25          H5''        U  25  24.314  -6.157  19.332
  258    H4'    U  25           H4'        U  25  23.450  -5.856  16.547
  259    H3'    U  25           H3'        U  25  22.315  -6.089  19.033
  260    H2'    U  25          H2''        U  25  22.740  -8.358  19.454
  261   HO2'    U  25          H2'         U  25  20.912  -9.557  18.895
  262    H1'    U  25           H1'        U  25  22.285  -9.143  16.607
  263    H3     U  25           H3         U  25  24.015 -13.230  17.153
  264    H5     U  25           H5         U  25  26.001 -11.003  20.126
  265    H6     U  25           H6         U  25  24.774  -9.043  19.391
  266    H5'    U  26           H5'        U  26  21.276  -6.323  20.707
  267   H5''    U  26          H5''        U  26  19.598  -6.615  20.213
  268    H4'    U  26           H4'        U  26  19.167  -5.538  22.237
  269    H3'    U  26           H3'        U  26  19.438  -3.653  19.957
  270    H2'    U  26          H2''        U  26  20.049  -1.772  21.101
  271   HO2'    U  26          H2'         U  26  18.965  -1.147  22.797
  272    H1'    U  26           H1'        U  26  21.151  -2.795  23.435
  273    H3     U  26           H3         U  26  24.494  -0.268  21.789
  274    H5     U  26           H5         U  26  24.162  -3.382  18.977
  275    H6     U  26           H6         U  26  22.245  -4.210  20.187
  276    H5'    C  27           H5'        C  27  14.841  -2.132  21.225
  277   H5''    C  27          H5''        C  27  14.693  -1.088  19.798
  278    H4'    C  27           H4'        C  27  14.868  -0.070  22.301
  279    H3'    C  27           H3'        C  27  16.161   0.818  19.680
  280    H2'    C  27          H2''        C  27  17.193   2.613  20.758
  281   HO2'    C  27          H2'         C  27  15.192   2.377  22.775
  282    H1'    C  27           H1'        C  27  17.315   1.388  23.322
  283    H41    C  27           H41        C  27  23.338   2.122  21.404
  284    H42    C  27           H42        C  27  23.083   1.049  20.046
  285    H5     C  27           H5         C  27  20.911   0.208  19.429
  286    H6     C  27           H6         C  27  18.557   0.044  20.091
  287    H5'    U  28           H5'        U  28  12.633   4.121  20.037
  288   H5''    U  28          H5''        U  28  12.803   5.050  18.534
  289    H4'    U  28           H4'        U  28  13.435   6.139  20.901
  290    H3'    U  28           H3'        U  28  14.830   6.262  18.211
  291    H2'    U  28          H2''        U  28  16.490   7.654  19.064
  292   HO2'    U  28          H2'         U  28  14.524   8.586  20.598
  293    H1'    U  28           H1'        U  28  16.732   6.403  21.542
  294    H3     U  28           H3         U  28  20.536   6.174  18.928
  295    H5     U  28           H5         U  28  18.082   2.983  17.701
  296    H6     U  28           H6         U  28  16.317   3.878  19.087
  297    H5'    U  29           H5'        U  29  14.265  10.473  19.851
  298   H5''    U  29          H5''        U  29  13.576  11.387  18.495
  299    H4'    U  29           H4'        U  29  15.385  12.681  19.574
  300    H3'    U  29           H3'        U  29  15.620  11.596  16.774
  301    H2'    U  29          H2''        U  29  17.831  12.245  16.526
  302   HO2'    U  29          H2'         U  29  17.375  14.426  17.240
  303    H1'    U  29           H1'        U  29  18.719  11.955  19.141
  304    H3     U  29           H3         U  29  21.212   9.188  16.517
  305    H5     U  29           H5         U  29  17.486   7.252  16.841
  306    H6     U  29           H6         U  29  16.638   9.222  17.975
  307    H5'    A  30           H5'        A  30  16.778  16.221  16.091
  308   H5''    A  30          H5''        A  30  16.678  16.203  14.320
  309    H4'    A  30           H4'        A  30  19.009  16.631  15.558
  310    H3'    A  30           H3'        A  30  18.379  14.934  13.121
  311    H2'    A  30          H2''        A  30  20.670  14.494  12.854
  312   HO2'    A  30          H2'         A  30  22.222  15.783  13.561
  313    H1'    A  30           H1'        A  30  21.229  14.147  15.552
  314    H8     A  30           H8         A  30  18.003  12.342  14.671
  315    H61    A  30           H61        A  30  21.496   7.936  12.128
  316    H62    A  30           H62        A  30  19.934   8.305  12.823
  317    H2     A  30           H2         A  30  24.107  11.495  12.924
  318    H5'    C  31           H5'        C  31  20.928  18.541  11.236
  319   H5''    C  31          H5''        C  31  20.601  18.328   9.505
  320    H4'    C  31           H4'        C  31  23.077  18.081  10.449
  321    H3'    C  31           H3'        C  31  21.537  16.556   8.354
  322    H2'    C  31          H2''        C  31  23.190  14.929   8.105
  323   HO2'    C  31          H2'         C  31  25.349  15.293   8.704
  324    H1'    C  31           H1'        C  31  24.168  14.842  10.691
  325    H41    C  31           H41        C  31  20.601   9.662   9.495
  326    H42    C  31           H42        C  31  19.181  10.530  10.035
  327    H5     C  31           H5         C  31  19.252  12.820  10.791
  328    H6     C  31           H6         C  31  20.631  14.836  10.956
  329    H5'    A  32           H5'        A  32  25.124  17.615   6.014
  330   H5''    A  32          H5''        A  32  24.548  18.310   4.486
  331    H4'    A  32           H4'        A  32  26.016  16.420   3.980
  332    H3'    A  32           H3'        A  32  23.041  16.207   3.548
  333    H2'    A  32          H2''        A  32  23.128  13.973   2.954
  334   HO2'    A  32          H2'         A  32  25.889  14.381   2.394
  335    H1'    A  32           H1'        A  32  25.322  13.171   4.495
  336    H8     A  32           H8         A  32  22.480  15.017   6.322
  337    H61    A  32           H61        A  32  19.732   9.494   6.717
  338    H62    A  32           H62        A  32  19.748  11.135   7.323
  339    H2     A  32           H2         A  32  23.400   9.048   4.172
  340    H5'    C  33           H5'        C  33  25.236  15.148  -0.791
  341   H5''    C  33          H5''        C  33  23.783  15.087  -1.807
  342    H4'    C  33           H4'        C  33  25.370  12.948  -1.551
  343    H3'    C  33           H3'        C  33  22.349  13.165  -1.587
  344    H2'    C  33          H2''        C  33  22.174  10.801  -1.464
  345   HO2'    C  33          H2'         C  33  24.990  10.717  -1.906
  346    H1'    C  33           H1'        C  33  24.102  10.481   0.472
  347    H41    C  33           H41        C  33  18.358  10.778   3.273
  348    H42    C  33           H42        C  33  18.465  12.521   3.309
  349    H5     C  33           H5         C  33  20.389  13.732   2.487
  350    H6     C  33           H6         C  33  22.449  13.566   1.172
  351    H5'    A  34           H5'        A  34  23.496  10.753  -4.437
  352   H5''    A  34          H5''        A  34  23.099  10.847  -6.164
  353    H4'    A  34           H4'        A  34  22.498   8.625  -5.488
  354    H3'    A  34           H3'        A  34  20.359  10.664  -5.917
  355    H2'    A  34          H2''        A  34  18.677   9.545  -4.836
  356   HO2'    A  34          H2'         A  34  20.014   7.125  -5.523
  357    H1'    A  34           H1'        A  34  20.181   7.747  -3.225
  358    H8     A  34           H8         A  34  20.622  11.510  -2.589
  359    H61    A  34           H61        A  34  15.992  10.897   1.457
  360    H62    A  34           H62        A  34  17.320  11.908   0.937
  361    H2     A  34           H2         A  34  16.354   7.058  -0.833
  362    H5'    C  35           H5'        C  35  17.099  10.727  -8.807
  363   H5''    C  35          H5''        C  35  18.203  11.198  -7.499
  364    H4'    C  35           H4'        C  35  16.654   8.694  -7.013
  365    H3'    C  35           H3'        C  35  15.297  10.926  -8.104
  366    H2'    C  35          H2''        C  35  15.307  12.372  -6.347
  367   HO2'    C  35          H2'         C  35  13.638  10.379  -5.184
  368    H1'    C  35           H1'        C  35  15.613  10.311  -4.199
  369    H41    C  35           H41        C  35  17.692  15.750  -1.577
  370    H42    C  35           H42        C  35  19.172  15.613  -2.499
  371    H5     C  35           H5         C  35  19.527  13.929  -4.183
  372    H6     C  35           H6         C  35  18.552  12.002  -5.336
  373    H5'    U  36           H5'        U  36  16.026   5.844  -8.185
  374   H5''    U  36          H5''        U  36  14.654   5.780  -9.313
  375    H4'    U  36           H4'        U  36  14.648   3.626  -8.288
  376    H3'    U  36           H3'        U  36  12.701   5.684  -7.399
  377    H2'    U  36          H2''        U  36  12.107   4.759  -5.371
  378   HO2'    U  36          H2'         U  36  13.055   2.261  -6.358
  379    H1'    U  36           H1'        U  36  14.422   3.471  -4.610
  380    H3     U  36           H3         U  36  12.775   7.389  -2.324
  381    H5     U  36           H5         U  36  16.423   8.207  -4.261
  382    H6     U  36           H6         U  36  16.224   6.071  -5.394
  383    H5'    A  37           H5'        A  37   8.926   3.081  -8.413
  384   H5''    A  37          H5''        A  37   8.086   4.531  -8.998
  385    H4'    A  37           H4'        A  37   7.324   3.336  -6.737
  386    H3'    A  37           H3'        A  37   7.601   6.262  -7.464
  387    H2'    A  37          H2''        A  37   6.945   6.941  -5.328
  388   HO2'    A  37          H2'         A  37   5.152   5.579  -5.080
  389    H1'    A  37           H1'        A  37   8.315   5.004  -3.891
  390    H8     A  37           H8         A  37  10.761   6.122  -6.465
  391    H61    A  37           H61        A  37  11.489  11.355  -3.260
  392    H62    A  37           H62        A  37  12.159  10.319  -4.501
  393    H2     A  37           H2         A  37   7.766   9.329  -1.790
  394    H5'    C  38           H5'        C  38   3.342   4.962  -7.100
  395   H5''    C  38          H5''        C  38   2.083   5.742  -8.078
  396    H4'    C  38           H4'        C  38   1.640   5.975  -5.631
  397    H3'    C  38           H3'        C  38   2.170   8.285  -7.487
  398    H2'    C  38          H2''        C  38   2.197   9.868  -5.792
  399   HO2'    C  38          H2'         C  38   0.203   9.288  -4.880
  400    H1'    C  38           H1'        C  38   3.242   8.320  -3.714
  401    H41    C  38           H41        C  38   7.686  12.401  -5.903
  402    H42    C  38           H42        C  38   8.286  11.126  -6.941
  403    H5     C  38           H5         C  38   7.079   9.080  -7.336
  404    H6     C  38           H6         C  38   5.176   7.708  -6.640
  405    H5'    A  39           H5'        A  39  -2.312   9.491  -6.874
  406   H5''    A  39          H5''        A  39  -2.438  10.593  -8.260
  407    H4'    A  39           H4'        A  39  -2.235  11.515  -5.731
  408    H3'    A  39           H3'        A  39  -1.004  12.494  -8.338
  409    H2'    A  39          H2''        A  39   0.168  14.182  -7.196
  410   HO2'    A  39          H2'         A  39  -1.831  13.908  -5.188
  411    H1'    A  39           H1'        A  39   0.415  12.858  -4.729
  412    H8     A  39           H8         A  39   1.884  10.869  -7.596
  413    H61    A  39           H61        A  39   6.812  14.586  -7.315
  414    H62    A  39           H62        A  39   6.194  13.059  -7.904
  415    H2     A  39           H2         A  39   3.626  16.306  -4.670
  416    H5'    A  40           H5'        A  40  -3.607  14.970  -5.984
  417   H5''    A  40          H5''        A  40  -4.902  15.900  -6.768
  418    H4'    A  40           H4'        A  40  -4.082  17.280  -4.970
  419    H3'    A  40           H3'        A  40  -3.377  17.918  -7.804
  420    H2'    A  40          H2''        A  40  -1.642  19.358  -7.370
  421   HO2'    A  40          H2'         A  40  -2.851  20.822  -6.175
  422    H1'    A  40           H1'        A  40  -0.822  18.511  -4.829
  423    H8     A  40           H8         A  40  -1.018  15.974  -7.749
  424    H61    A  40           H61        A  40   4.875  17.471  -8.846
  425    H62    A  40           H62        A  40   3.594  16.330  -9.186
  426    H2     A  40           H2         A  40   3.326  20.186  -5.626
  427    H5'    A  41           H5'        A  41  -5.218  22.161  -6.525
  428   H5''    A  41          H5''        A  41  -5.408  22.887  -8.133
  429    H4'    A  41           H4'        A  41  -3.606  23.845  -6.391
  430    H3'    A  41           H3'        A  41  -3.356  23.303  -9.365
  431    H2'    A  41          H2''        A  41  -1.218  24.277  -9.359
  432   HO2'    A  41          H2'         A  41  -1.990  25.387  -6.861
  433    H1'    A  41           H1'        A  41  -0.469  23.207  -6.867
  434    H8     A  41           H8         A  41  -2.096  20.653  -9.185
  435    H61    A  41           H61        A  41   3.477  19.982 -11.779
  436    H62    A  41           H62        A  41   1.876  19.296 -11.612
  437    H2     A  41           H2         A  41   3.711  23.362  -8.839
  438    H5'    U  42           H5'        U  42  -2.509  27.374  -8.306
  439   H5''    U  42          H5''        U  42  -3.160  28.614  -9.400
  440    H4'    U  42           H4'        U  42  -0.752  29.034  -8.931
  441    H3'    U  42           H3'        U  42  -1.727  28.072 -11.640
  442    H2'    U  42          H2''        U  42   0.399  27.939 -12.536
  443   HO2'    U  42          H2'         U  42   1.113  29.856 -10.567
  444    H1'    U  42           H1'        U  42   1.803  27.431 -10.132
  445    H3     U  42           H3         U  42   3.028  23.966 -12.764
  446    H5     U  42           H5         U  42  -1.028  23.225 -11.914
  447    H6     U  42           H6         U  42  -1.172  25.453 -10.987
  448    H5'    U  43           H5'        U  43   0.872  31.394 -13.125
  449   H5''    U  43          H5''        U  43   0.248  31.613 -14.772
  450    H4'    U  43           H4'        U  43   2.627  30.459 -14.346
  451    H3'    U  43           H3'        U  43   0.407  29.933 -16.322
  452    H2'    U  43          H2''        U  43   1.250  27.904 -17.016
  453   HO2'    U  43          H2'         U  43   3.801  28.961 -16.325
  454    H1'    U  43           H1'        U  43   2.888  27.285 -14.762
  455    H3     U  43           H3         U  43   0.695  23.408 -15.484
  456    H5     U  43           H5         U  43  -2.363  26.093 -14.387
  457    H6     U  43           H6         U  43  -0.723  27.879 -14.430
  458    H5'    A  44           H5'        A  44   3.654  33.089 -18.980
  459   H5''    A  44          H5''        A  44   2.797  32.966 -20.530
  460    H4'    A  44           H4'        A  44   5.410  32.449 -20.379
  461    H3'    A  44           H3'        A  44   3.149  31.269 -21.950
  462    H2'    A  44          H2''        A  44   4.272  29.366 -22.615
  463   HO2'    A  44          H2'         A  44   6.028  30.422 -23.553
  464    H1'    A  44           H1'        A  44   6.029  29.008 -20.479
  465    H8     A  44           H8         A  44   2.715  29.293 -18.859
  466    H61    A  44           H61        A  44   1.330  23.658 -20.971
  467    H62    A  44           H62        A  44   0.896  24.919 -19.839
  468    H2     A  44           H2         A  44   5.142  24.970 -22.927
  469    H5'    A  45           H5'        A  45   6.017  31.907 -25.727
  470   H5''    A  45          H5''        A  45   4.696  31.983 -26.910
  471    H4'    A  45           H4'        A  45   6.442  29.973 -26.970
  472    H3'    A  45           H3'        A  45   3.458  30.083 -27.367
  473    H2'    A  45          H2''        A  45   3.232  27.780 -27.482
  474   HO2'    A  45          H2'         A  45   4.762  27.371 -29.064
  475    H1'    A  45           H1'        A  45   5.284  27.035 -25.734
  476    H8     A  45           H8         A  45   2.970  29.658 -24.244
  477    H61    A  45           H61        A  45  -0.906  25.023 -22.932
  478    H62    A  45           H62        A  45  -0.487  26.686 -22.590
  479    H2     A  45           H2         A  45   2.362  23.408 -25.544
  480    H5'    G  46           H5'        G  46   5.014  28.929 -31.952
  481   H5''    G  46          H5''        G  46   3.464  29.083 -32.803
  482    H4'    G  46           H4'        G  46   4.715  26.729 -32.685
  483    H3'    G  46           H3'        G  46   1.808  27.497 -32.453
  484    H2'    G  46          H2''        G  46   1.127  25.312 -31.984
  485   HO2'    G  46          H2'         G  46   2.572  23.522 -32.277
  486    H1'    G  46           H1'        G  46   3.229  24.578 -30.355
  487    H8     G  46           H8         G  46   2.340  28.032 -29.247
  488    H1     G  46           H1         G  46  -2.125  23.720 -27.647
  489    H21    G  46           H21        G  46  -1.711  21.797 -28.650
  490    H22    G  46           H22        G  46  -0.460  21.626 -29.860
  491    H5'    C  47           H5'        C  47   2.017  23.705 -34.237
  492   H5''    C  47          H5''        C  47   1.685  23.976 -35.960
  493    H4'    C  47           H4'        C  47   0.597  21.900 -35.370
  494    H3'    C  47           H3'        C  47  -1.051  24.386 -35.715
  495    H2'    C  47          H2''        C  47  -3.039  23.396 -35.078
  496   HO2'    C  47          H2'         C  47  -1.754  20.896 -35.507
  497    H1'    C  47           H1'        C  47  -2.041  21.652 -33.120
  498    H41    C  47           H41        C  47  -4.412  26.425 -29.683
  499    H42    C  47           H42        C  47  -3.093  27.468 -30.156
  500    H5     C  47           H5         C  47  -1.517  26.891 -31.888
  501    H6     C  47           H6         C  47  -0.742  25.110 -33.379
  502    H5'    C  48           H5'        C  48  -3.675  21.672 -37.112
  503   H5''    C  48          H5''        C  48  -4.445  22.269 -38.594
  504    H4'    C  48           H4'        C  48  -6.092  21.941 -36.715
  505    H3'    C  48           H3'        C  48  -5.437  24.672 -37.858
  506   HO3'    C  48          H3T         C  48  -7.553  24.303 -38.793
  507    H2'    C  48          H2''        C  48  -6.862  25.729 -36.396
  508   HO2'    C  48          H2'         C  48  -8.783  24.943 -35.842
  509    H1'    C  48           H1'        C  48  -6.830  23.714 -34.357
  510    H41    C  48           H41        C  48  -4.633  29.070 -31.713
  511    H42    C  48           H42        C  48  -3.246  29.076 -32.781
  512    H5     C  48           H5         C  48  -2.966  27.510 -34.587
  513    H6     C  48           H6         C  48  -3.892  25.530 -35.693
  Start of MODEL   11
    1    H5'    G   1           H5'        G   1  -9.633  31.372 -24.960
    2   H5''    G   1          H5''        G   1  -9.571  29.803 -24.131
    3    H4'    G   1           H4'        G   1 -11.261  29.772 -25.958
    4    H3'    G   1           H3'        G   1  -8.777  28.085 -25.931
    5    H2'    G   1          H2''        G   1  -8.960  27.387 -28.138
    6   HO2'    G   1          H2'         G   1 -11.736  27.989 -28.042
    7    H1'    G   1           H1'        G   1 -10.406  29.508 -29.246
    8    H8     G   1           H8         G   1  -7.532  31.301 -27.965
    9    H1     G   1           H1         G   1  -5.709  27.243 -32.584
   10    H21    G   1           H21        G   1  -7.271  25.721 -32.922
   11    H22    G   1           H22        G   1  -8.816  25.765 -32.102
   12   HO5'    G   1          H5T         G   1  -7.863  30.117 -26.293
   13    H5'    G   2           H5'        G   2 -11.646  24.096 -25.217
   14   H5''    G   2          H5''        G   2 -10.292  23.307 -24.382
   15    H4'    G   2           H4'        G   2 -11.212  22.335 -26.693
   16    H3'    G   2           H3'        G   2  -8.495  22.573 -25.461
   17    H2'    G   2          H2''        G   2  -7.289  22.268 -27.383
   18   HO2'    G   2          H2'         G   2  -7.736  20.522 -28.436
   19    H1'    G   2           H1'        G   2  -9.107  23.113 -29.336
   20    H8     G   2           H8         G   2  -8.520  25.802 -26.746
   21    H1     G   2           H1         G   2  -3.691  25.179 -30.911
   22    H21    G   2           H21        G   2  -3.979  23.361 -32.131
   23    H22    G   2           H22        G   2  -5.248  22.205 -31.796
   24    H5'    C   3           H5'        C   3  -8.446  18.322 -27.772
   25   H5''    C   3          H5''        C   3  -7.628  17.409 -26.490
   26    H4'    C   3           H4'        C   3  -6.562  17.150 -28.773
   27    H3'    C   3           H3'        C   3  -5.198  18.202 -26.301
   28    H2'    C   3          H2''        C   3  -3.250  18.769 -27.413
   29   HO2'    C   3          H2'         C   3  -4.038  16.866 -29.374
   30    H1'    C   3           H1'        C   3  -4.296  19.306 -29.963
   31    H41    C   3           H41        C   3  -2.392  24.847 -27.450
   32    H42    C   3           H42        C   3  -3.738  24.834 -26.336
   33    H5     C   3           H5         C   3  -5.405  23.094 -26.311
   34    H6     C   3           H6         C   3  -6.017  20.889 -27.190
   35    H5'    U   4           H5'        U   4  -2.162  15.477 -28.044
   36   H5''    U   4          H5''        U   4  -1.122  15.030 -26.678
   37    H4'    U   4           H4'        U   4  -0.178  16.562 -28.638
   38    H3'    U   4           H3'        U   4   0.191  16.610 -25.653
   39    H2'    U   4          H2''        U   4   1.176  18.680 -25.614
   40   HO2'    U   4          H2'         U   4   2.048  18.184 -28.278
   41    H1'    U   4           H1'        U   4   0.237  19.702 -28.109
   42    H3     U   4           H3         U   4  -0.147  23.034 -25.035
   43    H5     U   4           H5         U   4  -3.140  20.269 -23.958
   44    H6     U   4           H6         U   4  -2.272  18.765 -25.654
   45    H5'    U   5           H5'        U   5   4.074  17.296 -27.940
   46   H5''    U   5          H5''        U   5   5.299  16.272 -27.164
   47    H4'    U   5           H4'        U   5   6.238  18.505 -27.558
   48    H3'    U   5           H3'        U   5   5.664  17.475 -24.798
   49    H2'    U   5          H2''        U   5   5.962  19.489 -23.738
   50   HO2'    U   5          H2'         U   5   8.139  19.642 -24.505
   51    H1'    U   5           H1'        U   5   5.547  21.270 -25.926
   52    H3     U   5           H3         U   5   2.961  23.093 -22.724
   53    H5     U   5           H5         U   5   1.229  19.303 -23.330
   54    H6     U   5           H6         U   5   3.040  18.794 -24.865
   55    H5'    G   6           H5'        G   6   8.657  17.582 -21.565
   56   H5''    G   6          H5''        G   6   7.211  18.267 -22.338
   57    H4'    G   6           H4'        G   6   9.623  20.049 -22.111
   58    H3'    G   6           H3'        G   6   8.140  18.782 -19.842
   59    H2'    G   6          H2''        G   6   7.392  20.728 -18.886
   60   HO2'    G   6          H2'         G   6   9.037  21.935 -18.370
   61    H1'    G   6           H1'        G   6   7.482  22.488 -21.096
   62    H8     G   6           H8         G   6   5.260  19.421 -21.570
   63    H1     G   6           H1         G   6   2.525  24.099 -18.142
   64    H21    G   6           H21        G   6   3.998  25.677 -17.698
   65    H22    G   6           H22        G   6   5.696  25.504 -18.080
   66    H5'    A   7           H5'        A   7  11.415  21.659 -18.482
   67   H5''    A   7          H5''        A   7  12.296  20.917 -17.131
   68    H4'    A   7           H4'        A   7  11.732  23.319 -16.693
   69    H3'    A   7           H3'        A   7  10.763  20.985 -15.077
   70    H2'    A   7          H2''        A   7   9.223  22.174 -13.856
   71   HO2'    A   7          H2'         A   7   9.720  24.026 -12.972
   72    H1'    A   7           H1'        A   7   8.757  24.348 -15.612
   73    H8     A   7           H8         A   7   8.000  20.789 -16.872
   74    H61    A   7           H61        A   7   2.422  21.535 -14.310
   75    H62    A   7           H62        A   7   3.427  20.498 -15.299
   76    H2     A   7           H2         A   7   4.963  25.048 -13.167
   77    H5'    U   8           H5'        U   8  11.944  24.465 -12.526
   78   H5''    U   8          H5''        U   8  12.993  23.862 -11.228
   79    H4'    U   8           H4'        U   8  11.347  25.380 -10.252
   80    H3'    U   8           H3'        U   8  11.219  22.419  -9.756
   81    H2'    U   8          H2''        U   8   9.155  22.467  -8.749
   82   HO2'    U   8          H2'         U   8   9.277  23.731  -7.060
   83    H1'    U   8           H1'        U   8   8.128  24.881  -9.841
   84    H3     U   8           H3         U   8   4.705  22.097 -10.716
   85    H5     U   8           H5         U   8   7.949  20.269 -12.691
   86    H6     U   8           H6         U   8   9.402  21.957 -11.723
   87    H5'    U   9           H5'        U   9  11.232  24.470  -5.468
   88   H5''    U   9          H5''        U   9  11.773  23.158  -4.403
   89    H4'    U   9           H4'        U   9   9.433  24.213  -3.941
   90    H3'    U   9           H3'        U   9  10.279  21.335  -4.111
   91    H2'    U   9          H2''        U   9   8.146  20.488  -4.137
   92   HO2'    U   9          H2'         U   9   7.318  22.850  -2.776
   93    H1'    U   9           H1'        U   9   6.724  22.757  -5.095
   94    H3     U   9           H3         U   9   5.200  19.348  -7.627
   95    H5     U   9           H5         U   9   9.274  19.600  -8.671
   96    H6     U   9           H6         U   9   9.542  21.300  -6.960
   97    H5'    G  10           H5'        G  10   7.540  22.195  -0.778
   98   H5''    G  10          H5''        G  10   8.244  21.616   0.744
   99    H4'    G  10           H4'        G  10   5.834  21.105   0.686
  100    H3'    G  10           H3'        G  10   7.920  18.934   0.543
  101    H2'    G  10          H2''        G  10   6.359  17.241   0.259
  102   HO2'    G  10          H2'         G  10   4.368  19.047   1.203
  103    H1'    G  10           H1'        G  10   4.446  18.635  -1.219
  104    H8     G  10           H8         G  10   7.877  19.174  -2.694
  105    H1     G  10           H1         G  10   5.469  13.367  -3.965
  106    H21    G  10           H21        G  10   3.625  13.044  -2.800
  107    H22    G  10           H22        G  10   3.089  14.168  -1.572
  108    H5'    U  11           H5'        U  11   5.450  17.360   3.759
  109   H5''    U  11          H5''        U  11   6.498  16.296   4.716
  110    H4'    U  11           H4'        U  11   4.565  15.267   3.208
  111    H3'    U  11           H3'        U  11   7.397  14.393   3.747
  112    H2'    U  11          H2''        U  11   7.390  12.781   2.117
  113   HO2'    U  11          H2'         U  11   4.581  12.637   2.531
  114    H1'    U  11           H1'        U  11   5.291  13.806   0.466
  115    H3     U  11           H3         U  11   8.837  12.362  -2.075
  116    H5     U  11           H5         U  11   9.955  16.155  -0.618
  117    H6     U  11           H6         U  11   7.997  16.114   0.812
  118    H5'    A  12           H5'        A  12   4.844  10.590   5.794
  119   H5''    A  12          H5''        A  12   6.259   9.778   6.490
  120    H4'    A  12           H4'        A  12   4.745   8.560   4.656
  121    H3'    A  12           H3'        A  12   7.733   8.618   5.104
  122    H2'    A  12          H2''        A  12   8.165   7.388   3.175
  123   HO2'    A  12          H2'         A  12   6.646   6.072   2.193
  124    H1'    A  12           H1'        A  12   6.119   8.372   1.567
  125    H8     A  12           H8         A  12   7.968  11.251   3.177
  126    H61    A  12           H61        A  12  12.456  10.347  -0.976
  127    H62    A  12           H62        A  12  11.772  11.468   0.180
  128    H2     A  12           H2         A  12   9.551   6.944  -1.303
  129    H5'    U  13           H5'        U  13   7.029   4.913   3.761
  130   H5''    U  13          H5''        U  13   7.695   3.679   4.848
  131    H4'    U  13           H4'        U  13   8.551   3.231   2.624
  132    H3'    U  13           H3'        U  13  10.439   4.500   4.625
  133    H2'    U  13          H2''        U  13  12.180   4.493   3.070
  134   HO2'    U  13          H2'         U  13  10.634   2.555   1.677
  135    H1'    U  13           H1'        U  13  10.653   5.001   0.781
  136    H3     U  13           H3         U  13  13.511   8.520   1.070
  137    H5     U  13           H5         U  13  10.943   9.033   4.350
  138    H6     U  13           H6         U  13   9.926   6.905   3.828
  139    H5'    G  14           H5'        G  14  12.606   0.814   3.748
  140   H5''    G  14          H5''        G  14  13.951   0.720   4.901
  141    H4'    G  14           H4'        G  14  14.333   1.522   2.368
  142    H3'    G  14           H3'        G  14  15.554   2.415   4.986
  143    H2'    G  14          H2''        G  14  16.638   4.190   4.002
  144   HO2'    G  14          H2'         G  14  17.505   4.110   1.976
  145    H1'    G  14           H1'        G  14  14.965   4.442   1.678
  146    H8     G  14           H8         G  14  13.067   5.414   4.751
  147    H1     G  14           H1         G  14  17.316   9.833   2.858
  148    H21    G  14           H21        G  14  18.683   8.974   1.360
  149    H22    G  14           H22        G  14  18.673   7.271   0.960
  150    H5'    U  15           H5'        U  15  18.586   1.480   1.601
  151   H5''    U  15          H5''        U  15  19.898   0.579   2.388
  152    H4'    U  15           H4'        U  15  20.822   2.251   0.818
  153    H3'    U  15           H3'        U  15  21.193   2.442   3.798
  154    H2'    U  15          H2''        U  15  22.210   4.523   3.721
  155   HO2'    U  15          H2'         U  15  23.733   3.811   2.088
  156    H1'    U  15           H1'        U  15  20.914   5.617   1.516
  157    H3     U  15           H3         U  15  20.011   8.333   5.059
  158    H5     U  15           H5         U  15  17.622   4.931   5.717
  159    H6     U  15           H6         U  15  18.730   3.868   3.840
  160    H5'    G  16           H5'        G  16  25.702   2.955   2.701
  161   H5''    G  16          H5''        G  16  26.349   2.405   4.259
  162    H4'    G  16           H4'        G  16  26.634   4.942   3.497
  163    H3'    G  16           H3'        G  16  26.002   3.694   6.172
  164    H2'    G  16          H2''        G  16  25.537   5.708   7.163
  165   HO2'    G  16          H2'         G  16  27.471   6.684   5.367
  166    H1'    G  16           H1'        G  16  24.913   7.226   4.828
  167    H8     G  16           H8         G  16  22.491   4.398   5.520
  168    H1     G  16           H1         G  16  21.480   9.595   9.127
  169    H21    G  16           H21        G  16  23.105  11.056   8.816
  170    H22    G  16           H22        G  16  24.545  10.668   7.903
  171    H5'    U  17           H5'        U  17  29.691   6.769   7.059
  172   H5''    U  17          H5''        U  17  30.155   6.115   8.640
  173    H4'    U  17           H4'        U  17  29.325   8.642   8.400
  174    H3'    U  17           H3'        U  17  28.843   6.541  10.513
  175    H2'    U  17          H2''        U  17  27.229   7.766  11.578
  176   HO2'    U  17          H2'         U  17  28.513  10.098  10.564
  177    H1'    U  17           H1'        U  17  26.516   9.525   9.426
  178    H3     U  17           H3         U  17  22.745   8.289  11.671
  179    H5     U  17           H5         U  17  23.862   4.863   9.485
  180    H6     U  17           H6         U  17  25.919   5.999   8.885
  181    H5'    A  18           H5'        A  18  31.237  10.559  12.974
  182   H5''    A  18          H5''        A  18  31.143   9.722  14.536
  183    H4'    A  18           H4'        A  18  30.134  12.193  14.217
  184    H3'    A  18           H3'        A  18  29.067   9.797  15.727
  185    H2'    A  18          H2''        A  18  27.246  11.105  16.517
  186   HO2'    A  18          H2'         A  18  27.154  13.378  16.027
  187    H1'    A  18           H1'        A  18  26.660  12.206  14.054
  188    H8     A  18           H8         A  18  27.591   8.820  13.056
  189    H61    A  18           H61        A  18  22.447   6.643  15.692
  190    H62    A  18           H62        A  18  23.708   6.324  14.522
  191    H2     A  18           H2         A  18  22.992  10.896  17.009
  192    H5'    A  19           H5'        A  19  28.595  12.869  18.189
  193   H5''    A  19          H5''        A  19  29.471  12.737  19.727
  194    H4'    A  19           H4'        A  19  27.182  13.435  20.203
  195    H3'    A  19           H3'        A  19  28.131  10.668  20.896
  196    H2'    A  19          H2''        A  19  26.046   9.879  21.480
  197   HO2'    A  19          H2'         A  19  25.730  11.623  22.998
  198    H1'    A  19           H1'        A  19  24.425  11.528  19.879
  199    H8     A  19           H8         A  19  26.984   9.659  17.797
  200    H61    A  19           H61        A  19  23.240   4.758  18.138
  201    H62    A  19           H62        A  19  24.621   5.460  17.325
  202    H2     A  19           H2         A  19  21.605   7.949  20.831
  203    H5'    A  20           H5'        A  20  26.386  11.967  25.099
  204   H5''    A  20          H5''        A  20  27.202  10.753  26.103
  205    H4'    A  20           H4'        A  20  24.552  10.720  25.819
  206    H3'    A  20           H3'        A  20  26.611   8.522  25.942
  207    H2'    A  20          H2''        A  20  25.107   6.866  25.367
  208   HO2'    A  20          H2'         A  20  23.081   8.595  26.367
  209    H1'    A  20           H1'        A  20  23.247   8.414  23.903
  210    H8     A  20           H8         A  20  26.876   8.448  22.655
  211    H61    A  20           H61        A  20  25.482   3.247  19.622
  212    H62    A  20           H62        A  20  26.642   4.544  19.797
  213    H2     A  20           H2         A  20  22.003   4.294  22.250
  214    H5'    U  21           H5'        U  21  23.526   6.827  28.834
  215   H5''    U  21          H5''        U  21  24.520   5.662  29.730
  216    H4'    U  21           H4'        U  21  22.634   4.819  28.033
  217    H3'    U  21           H3'        U  21  25.433   3.824  28.613
  218    H2'    U  21          H2''        U  21  25.406   2.319  26.832
  219   HO2'    U  21          H2'         U  21  23.579   1.285  26.172
  220    H1'    U  21           H1'        U  21  23.513   3.598  25.186
  221    H3     U  21           H3         U  21  27.143   2.698  22.578
  222    H5     U  21           H5         U  21  28.514   5.635  25.272
  223    H6     U  21           H6         U  21  26.345   5.571  26.343
  224    H5'    U  22           H5'        U  22  22.504   0.661  28.638
  225   H5''    U  22          H5''        U  22  22.588  -0.379  30.074
  226    H4'    U  22           H4'        U  22  22.323  -1.743  28.021
  227    H3'    U  22           H3'        U  22  24.878  -1.758  29.645
  228    H2'    U  22          H2''        U  22  26.052  -2.977  28.120
  229   HO2'    U  22          H2'         U  22  24.881  -4.839  28.226
  230    H1'    U  22           H1'        U  22  24.325  -2.558  25.849
  231    H3     U  22           H3         U  22  28.997  -2.559  25.083
  232    H5     U  22           H5         U  22  27.587   1.403  25.344
  233    H6     U  22           H6         U  22  25.530   0.532  26.301
  234    H5'    A  23           H5'        A  23  26.878  -4.636  30.993
  235   H5''    A  23          H5''        A  23  26.879  -4.193  29.276
  236    H4'    A  23           H4'        A  23  28.312  -6.246  29.989
  237    H3'    A  23           H3'        A  23  26.824  -5.594  27.649
  238    H2'    A  23          H2''        A  23  25.258  -7.262  27.637
  239   HO2'    A  23          H2'         A  23  27.667  -8.563  27.034
  240    H1'    A  23           H1'        A  23  26.414  -9.202  29.478
  241    H8     A  23           H8         A  23  24.155  -6.677  30.953
  242    H61    A  23           H61        A  23  19.290  -9.764  28.701
  243    H62    A  23           H62        A  23  19.804  -8.404  29.675
  244    H2     A  23           H2         A  23  23.014 -11.553  26.957
  245    H5'    A  24           H5'        A  24  29.979  -6.756  24.392
  246   H5''    A  24          H5''        A  24  28.949  -5.715  23.391
  247    H4'    A  24           H4'        A  24  28.662  -8.528  23.876
  248    H3'    A  24           H3'        A  24  27.316  -6.288  22.406
  249    H2'    A  24          H2''        A  24  25.239  -7.246  22.462
  250   HO2'    A  24          H2'         A  24  26.129  -9.900  22.484
  251    H1'    A  24           H1'        A  24  25.890  -9.367  24.402
  252    H8     A  24           H8         A  24  25.282  -6.066  25.966
  253    H61    A  24           H61        A  24  19.218  -7.234  25.625
  254    H62    A  24           H62        A  24  20.445  -6.171  26.279
  255    H2     A  24           H2         A  24  21.381 -10.316  23.183
  256    H5'    U  25           H5'        U  25  27.001  -5.956  18.373
  257   H5''    U  25          H5''        U  25  26.460  -6.734  19.872
  258    H4'    U  25           H4'        U  25  25.826  -7.412  17.104
  259    H3'    U  25           H3'        U  25  24.565  -7.221  19.550
  260    H2'    U  25          H2''        U  25  25.307  -9.210  20.537
  261   HO2'    U  25          H2'         U  25  23.286 -10.162  18.770
  262    H1'    U  25           H1'        U  25  25.291 -10.706  17.952
  263    H3     U  25           H3         U  25  27.629 -14.152  19.570
  264    H5     U  25           H5         U  25  28.860 -10.979  22.053
  265    H6     U  25           H6         U  25  27.412  -9.505  20.786
  266    H5'    U  26           H5'        U  26  23.589  -7.710  21.091
  267   H5''    U  26          H5''        U  26  21.924  -8.304  20.995
  268    H4'    U  26           H4'        U  26  21.442  -6.891  22.733
  269    H3'    U  26           H3'        U  26  21.826  -5.178  20.325
  270    H2'    U  26          H2''        U  26  22.491  -3.276  21.390
  271   HO2'    U  26          H2'         U  26  20.998  -4.127  23.661
  272    H1'    U  26           H1'        U  26  23.321  -4.282  23.888
  273    H3     U  26           H3         U  26  26.861  -1.749  22.829
  274    H5     U  26           H5         U  26  26.777  -4.595  19.734
  275    H6     U  26           H6         U  26  24.717  -5.466  20.645
  276    H5'    C  27           H5'        C  27  17.298  -3.953  21.963
  277   H5''    C  27          H5''        C  27  16.708  -2.915  20.649
  278    H4'    C  27           H4'        C  27  16.967  -1.833  23.014
  279    H3'    C  27           H3'        C  27  18.266  -0.874  20.422
  280    H2'    C  27          H2''        C  27  19.211   0.948  21.512
  281   HO2'    C  27          H2'         C  27  17.733   2.077  22.516
  282    H1'    C  27           H1'        C  27  19.298  -0.265  24.093
  283    H41    C  27           H41        C  27  25.389   0.630  22.517
  284    H42    C  27           H42        C  27  25.220  -0.371  21.092
  285    H5     C  27           H5         C  27  23.106  -1.247  20.345
  286    H6     C  27           H6         C  27  20.720  -1.467  20.870
  287    H5'    U  28           H5'        U  28  14.331   1.914  20.953
  288   H5''    U  28          H5''        U  28  14.189   2.941  19.512
  289    H4'    U  28           H4'        U  28  14.659   4.093  21.828
  290    H3'    U  28           H3'        U  28  16.114   4.464  19.197
  291    H2'    U  28          H2''        U  28  17.496   6.097  20.120
  292   HO2'    U  28          H2'         U  28  16.802   7.433  21.589
  293    H1'    U  28           H1'        U  28  17.898   4.844  22.562
  294    H3     U  28           H3         U  28  21.578   5.347  19.737
  295    H5     U  28           H5         U  28  19.755   1.698  18.715
  296    H6     U  28           H6         U  28  17.927   2.257  20.187
  297    H5'    U  29           H5'        U  29  14.986   8.305  21.066
  298   H5''    U  29          H5''        U  29  14.030   9.200  19.869
  299    H4'    U  29           H4'        U  29  15.525  10.766  21.002
  300    H3'    U  29           H3'        U  29  16.053   9.979  18.135
  301    H2'    U  29          H2''        U  29  18.004  11.270  18.017
  302   HO2'    U  29          H2'         U  29  17.270  13.178  18.901
  303    H1'    U  29           H1'        U  29  18.991  10.767  20.531
  304    H3     U  29           H3         U  29  21.668   8.895  17.285
  305    H5     U  29           H5         U  29  18.572   6.113  17.920
  306    H6     U  29           H6         U  29  17.457   7.770  19.294
  307    H5'    A  30           H5'        A  30  15.939  14.356  17.296
  308   H5''    A  30          H5''        A  30  15.830  14.341  15.527
  309    H4'    A  30           H4'        A  30  18.128  14.937  16.772
  310    H3'    A  30           H3'        A  30  17.635  13.237  14.306
  311    H2'    A  30          H2''        A  30  19.967  13.049  14.017
  312   HO2'    A  30          H2'         A  30  21.157  14.708  14.487
  313    H1'    A  30           H1'        A  30  20.530  12.628  16.699
  314    H8     A  30           H8         A  30  17.782  10.293  16.469
  315    H61    A  30           H61        A  30  20.875   6.897  12.342
  316    H62    A  30           H62        A  30  19.517   6.942  13.444
  317    H2     A  30           H2         A  30  23.088  10.758  12.900
  318    H5'    C  31           H5'        C  31  19.039  17.449  12.380
  319   H5''    C  31          H5''        C  31  18.804  17.231  10.635
  320    H4'    C  31           H4'        C  31  21.256  17.452  11.655
  321    H3'    C  31           H3'        C  31  20.106  15.744   9.452
  322    H2'    C  31          H2''        C  31  22.086  14.483   9.204
  323   HO2'    C  31          H2'         C  31  23.615  16.047   9.045
  324    H1'    C  31           H1'        C  31  22.867  14.323  11.811
  325    H41    C  31           H41        C  31  19.782   9.004   9.900
  326    H42    C  31           H42        C  31  18.351   9.606  10.704
  327    H5     C  31           H5         C  31  18.285  11.730  11.847
  328    H6     C  31           H6         C  31  19.474  13.832  12.239
  329    H5'    A  32           H5'        A  32  22.929  18.234   6.532
  330   H5''    A  32          H5''        A  32  21.787  18.308   5.174
  331    H4'    A  32           H4'        A  32  24.003  17.032   4.769
  332    H3'    A  32           H3'        A  32  21.171  16.188   4.236
  333    H2'    A  32          H2''        A  32  21.696  13.995   3.713
  334   HO2'    A  32          H2'         A  32  23.290  14.523   2.163
  335    H1'    A  32           H1'        A  32  23.886  13.597   5.372
  336    H8     A  32           H8         A  32  21.210  15.054   7.529
  337    H61    A  32           H61        A  32  18.410   9.546   7.397
  338    H62    A  32           H62        A  32  18.540  11.069   8.245
  339    H2     A  32           H2         A  32  21.672   9.528   4.319
  340    H5'    C  33           H5'        C  33  23.071  16.161  -0.149
  341   H5''    C  33          H5''        C  33  21.665  15.925  -1.204
  342    H4'    C  33           H4'        C  33  23.501  14.000  -0.913
  343    H3'    C  33           H3'        C  33  20.481  13.871  -1.054
  344    H2'    C  33          H2''        C  33  20.532  11.516  -0.880
  345   HO2'    C  33          H2'         C  33  23.359  11.655  -1.207
  346    H1'    C  33           H1'        C  33  22.430  11.398   1.109
  347    H41    C  33           H41        C  33  16.558  11.221   3.680
  348    H42    C  33           H42        C  33  16.600  12.957   3.849
  349    H5     C  33           H5         C  33  18.512  14.292   3.195
  350    H6     C  33           H6         C  33  20.611  14.297   1.934
  351    H5'    A  34           H5'        A  34  21.905  11.449  -3.792
  352   H5''    A  34          H5''        A  34  21.579  11.578  -5.532
  353    H4'    A  34           H4'        A  34  21.120   9.293  -4.972
  354    H3'    A  34           H3'        A  34  18.849  11.180  -5.403
  355    H2'    A  34          H2''        A  34  17.211   9.891  -4.449
  356   HO2'    A  34          H2'         A  34  17.034   7.794  -4.840
  357    H1'    A  34           H1'        A  34  18.748   8.217  -2.765
  358    H8     A  34           H8         A  34  19.030  11.990  -2.142
  359    H61    A  34           H61        A  34  14.273  11.237   1.732
  360    H62    A  34           H62        A  34  15.584  12.292   1.254
  361    H2     A  34           H2         A  34  14.829   7.416  -0.547
  362    H5'    C  35           H5'        C  35  16.522  10.323  -8.892
  363   H5''    C  35          H5''        C  35  15.953  11.902  -8.315
  364    H4'    C  35           H4'        C  35  15.613   9.180  -7.077
  365    H3'    C  35           H3'        C  35  14.002  11.182  -8.262
  366    H2'    C  35          H2''        C  35  13.788  12.645  -6.504
  367   HO2'    C  35          H2'         C  35  11.791  11.318  -6.528
  368    H1'    C  35           H1'        C  35  14.228  10.593  -4.363
  369    H41    C  35           H41        C  35  15.258  16.344  -1.691
  370    H42    C  35           H42        C  35  16.936  16.173  -2.154
  371    H5     C  35           H5         C  35  17.714  14.475  -3.676
  372    H6     C  35           H6         C  35  17.097  12.462  -4.925
  373    H5'    U  36           H5'        U  36  14.850   5.752  -8.023
  374   H5''    U  36          H5''        U  36  13.489   5.739  -9.165
  375    H4'    U  36           H4'        U  36  13.257   3.690  -7.959
  376    H3'    U  36           H3'        U  36  11.506   5.998  -7.274
  377    H2'    U  36          H2''        U  36  10.759   5.246  -5.221
  378   HO2'    U  36          H2'         U  36  10.007   3.244  -5.903
  379    H1'    U  36           H1'        U  36  12.938   3.837  -4.305
  380    H3     U  36           H3         U  36  11.594   7.919  -2.202
  381    H5     U  36           H5         U  36  15.181   8.519  -4.327
  382    H6     U  36           H6         U  36  14.865   6.342  -5.347
  383    H5'    A  37           H5'        A  37   7.581   3.640  -8.198
  384   H5''    A  37          H5''        A  37   6.776   5.109  -8.782
  385    H4'    A  37           H4'        A  37   6.064   3.993  -6.464
  386    H3'    A  37           H3'        A  37   6.422   6.892  -7.260
  387    H2'    A  37          H2''        A  37   5.856   7.627  -5.120
  388   HO2'    A  37          H2'         A  37   4.044   6.439  -4.678
  389    H1'    A  37           H1'        A  37   7.186   5.663  -3.692
  390    H8     A  37           H8         A  37   9.626   6.663  -6.316
  391    H61    A  37           H61        A  37  10.530  11.956  -3.257
  392    H62    A  37           H62        A  37  11.144  10.883  -4.494
  393    H2     A  37           H2         A  37   6.800  10.050  -1.660
  394    H5'    C  38           H5'        C  38   2.335   5.716  -6.366
  395   H5''    C  38          H5''        C  38   0.953   6.280  -7.327
  396    H4'    C  38           H4'        C  38   0.469   6.661  -4.962
  397    H3'    C  38           H3'        C  38   1.021   8.949  -6.832
  398    H2'    C  38          H2''        C  38   1.060  10.561  -5.166
  399   HO2'    C  38          H2'         C  38  -0.117  10.450  -3.349
  400    H1'    C  38           H1'        C  38   2.090   9.062  -3.055
  401    H41    C  38           H41        C  38   6.667  12.927  -5.348
  402    H42    C  38           H42        C  38   7.200  11.620  -6.381
  403    H5     C  38           H5         C  38   5.910   9.623  -6.738
  404    H6     C  38           H6         C  38   3.963   8.333  -6.007
  405    H5'    A  39           H5'        A  39  -3.306  10.339  -6.189
  406   H5''    A  39          H5''        A  39  -3.433  11.387  -7.616
  407    H4'    A  39           H4'        A  39  -3.048  12.402  -5.145
  408    H3'    A  39           H3'        A  39  -1.868  13.183  -7.843
  409    H2'    A  39          H2''        A  39  -0.546  14.830  -6.827
  410   HO2'    A  39          H2'         A  39  -2.409  14.811  -4.670
  411    H1'    A  39           H1'        A  39  -0.376  13.625  -4.273
  412    H8     A  39           H8         A  39   1.083  11.426  -6.968
  413    H61    A  39           H61        A  39   6.079  15.062  -6.916
  414    H62    A  39           H62        A  39   5.420  13.527  -7.433
  415    H2     A  39           H2         A  39   2.912  17.023  -4.421
  416    H5'    A  40           H5'        A  40  -3.998  15.980  -5.331
  417   H5''    A  40          H5''        A  40  -5.272  16.927  -6.126
  418    H4'    A  40           H4'        A  40  -4.313  18.362  -4.436
  419    H3'    A  40           H3'        A  40  -3.711  18.798  -7.332
  420    H2'    A  40          H2''        A  40  -1.883  20.158  -7.071
  421   HO2'    A  40          H2'         A  40  -2.503  21.863  -5.982
  422    H1'    A  40           H1'        A  40  -0.998  19.444  -4.511
  423    H8     A  40           H8         A  40  -1.426  16.707  -7.213
  424    H61    A  40           H61        A  40   4.494  17.808  -8.607
  425    H62    A  40           H62        A  40   3.145  16.714  -8.820
  426    H2     A  40           H2         A  40   3.178  20.861  -5.594
  427    H5'    A  41           H5'        A  41  -5.282  23.209  -6.290
  428   H5''    A  41          H5''        A  41  -5.498  23.823  -7.940
  429    H4'    A  41           H4'        A  41  -3.568  24.792  -6.341
  430    H3'    A  41           H3'        A  41  -3.472  24.027  -9.275
  431    H2'    A  41          H2''        A  41  -1.288  24.879  -9.417
  432   HO2'    A  41          H2'         A  41  -1.892  26.208  -6.979
  433    H1'    A  41           H1'        A  41  -0.515  23.969  -6.860
  434    H8     A  41           H8         A  41  -2.295  21.328  -8.960
  435    H61    A  41           H61        A  41   3.207  20.196 -11.549
  436    H62    A  41           H62        A  41   1.579  19.600 -11.311
  437    H2     A  41           H2         A  41   3.631  23.795  -8.906
  438    H5'    U  42           H5'        U  42  -2.129  28.077  -8.372
  439   H5''    U  42          H5''        U  42  -2.779  29.272  -9.513
  440    H4'    U  42           H4'        U  42  -0.347  29.645  -9.165
  441    H3'    U  42           H3'        U  42  -1.452  28.535 -11.762
  442    H2'    U  42          H2''        U  42   0.635  28.279 -12.729
  443   HO2'    U  42          H2'         U  42   2.307  29.591 -12.349
  444    H1'    U  42           H1'        U  42   2.106  27.813 -10.372
  445    H3     U  42           H3         U  42   2.975  24.064 -12.716
  446    H5     U  42           H5         U  42  -1.141  23.783 -11.890
  447    H6     U  42           H6         U  42  -1.074  26.072 -11.116
  448    H5'    U  43           H5'        U  43   1.168  31.808 -13.462
  449   H5''    U  43          H5''        U  43   0.531  31.966 -15.111
  450    H4'    U  43           H4'        U  43   2.927  30.860 -14.667
  451    H3'    U  43           H3'        U  43   0.700  30.243 -16.605
  452    H2'    U  43          H2''        U  43   1.542  28.189 -17.223
  453   HO2'    U  43          H2'         U  43   4.045  29.418 -16.745
  454    H1'    U  43           H1'        U  43   3.220  27.667 -14.976
  455    H3     U  43           H3         U  43   1.052  23.744 -15.475
  456    H5     U  43           H5         U  43  -2.041  26.469 -14.597
  457    H6     U  43           H6         U  43  -0.404  28.257 -14.679
  458    H5'    A  44           H5'        A  44   4.492  32.785 -19.131
  459   H5''    A  44          H5''        A  44   3.718  32.796 -20.728
  460    H4'    A  44           H4'        A  44   6.280  32.181 -20.532
  461    H3'    A  44           H3'        A  44   4.039  31.050 -22.171
  462    H2'    A  44          H2''        A  44   5.187  29.159 -22.869
  463   HO2'    A  44          H2'         A  44   7.014  30.235 -23.650
  464    H1'    A  44           H1'        A  44   6.760  28.661 -20.653
  465    H8     A  44           H8         A  44   3.421  29.208 -19.165
  466    H61    A  44           H61        A  44   1.595  23.776 -21.465
  467    H62    A  44           H62        A  44   1.243  25.045 -20.313
  468    H2     A  44           H2         A  44   5.558  24.795 -23.298
  469    H5'    A  45           H5'        A  45   6.702  31.519 -25.750
  470   H5''    A  45          H5''        A  45   5.477  31.679 -27.022
  471    H4'    A  45           H4'        A  45   6.915  29.443 -26.798
  472    H3'    A  45           H3'        A  45   3.985  29.885 -27.376
  473    H2'    A  45          H2''        A  45   3.548  27.609 -27.419
  474   HO2'    A  45          H2'         A  45   5.278  27.208 -28.949
  475    H1'    A  45           H1'        A  45   5.561  26.798 -25.580
  476    H8     A  45           H8         A  45   3.484  29.167 -23.690
  477    H61    A  45           H61        A  45  -0.946  24.868 -23.393
  478    H62    A  45           H62        A  45  -0.338  26.357 -22.706
  479    H2     A  45           H2         A  45   2.127  23.492 -26.354
  480    H5'    G  46           H5'        G  46   6.027  29.103 -31.925
  481   H5''    G  46          H5''        G  46   4.612  29.226 -32.988
  482    H4'    G  46           H4'        G  46   5.948  26.941 -32.843
  483    H3'    G  46           H3'        G  46   2.999  27.540 -32.886
  484    H2'    G  46          H2''        G  46   2.382  25.304 -32.578
  485   HO2'    G  46          H2'         G  46   5.084  24.630 -33.191
  486    H1'    G  46           H1'        G  46   4.302  24.620 -30.722
  487    H8     G  46           H8         G  46   3.299  27.983 -29.585
  488    H1     G  46           H1         G  46  -1.403  23.712 -28.730
  489    H21    G  46           H21        G  46  -1.014  21.904 -29.935
  490    H22    G  46           H22        G  46   0.487  21.662 -30.799
  491    H5'    C  47           H5'        C  47   3.478  23.904 -34.856
  492   H5''    C  47          H5''        C  47   3.248  24.217 -36.588
  493    H4'    C  47           H4'        C  47   2.131  22.124 -36.101
  494    H3'    C  47           H3'        C  47   0.544  24.619 -36.575
  495    H2'    C  47          H2''        C  47  -1.504  23.719 -35.993
  496   HO2'    C  47          H2'         C  47  -1.983  21.580 -36.096
  497    H1'    C  47           H1'        C  47  -0.691  21.976 -33.967
  498    H41    C  47           H41        C  47  -2.706  26.839 -30.466
  499    H42    C  47           H42        C  47  -1.465  27.892 -31.106
  500    H5     C  47           H5         C  47   0.191  27.147 -32.696
  501    H6     C  47           H6         C  47   0.816  25.354 -34.240
  502    H5'    C  48           H5'        C  48  -2.067  21.753 -38.256
  503   H5''    C  48          H5''        C  48  -2.766  22.472 -39.721
  504    H4'    C  48           H4'        C  48  -4.473  21.970 -37.901
  505    H3'    C  48           H3'        C  48  -3.881  24.732 -38.982
  506   HO3'    C  48          H3T         C  48  -6.168  23.046 -39.237
  507    H2'    C  48          H2''        C  48  -5.374  25.736 -37.557
  508   HO2'    C  48          H2'         C  48  -7.280  24.849 -37.869
  509    H1'    C  48           H1'        C  48  -5.316  23.730 -35.501
  510    H41    C  48           H41        C  48  -3.134  29.025 -32.751
  511    H42    C  48           H42        C  48  -1.745  29.054 -33.814
  512    H5     C  48           H5         C  48  -1.399  27.454 -35.577
  513    H6     C  48           H6         C  48  -2.341  25.524 -36.753
  Start of MODEL   12
    1    H5'    G   1           H5'        G   1  -9.997  31.080 -22.324
    2   H5''    G   1          H5''        G   1  -9.620  29.491 -21.626
    3    H4'    G   1           H4'        G   1 -11.326  29.325 -23.458
    4    H3'    G   1           H3'        G   1  -8.587  28.072 -23.567
    5    H2'    G   1          H2''        G   1  -8.763  27.451 -25.782
    6   HO2'    G   1          H2'         G   1 -11.581  27.438 -25.382
    7    H1'    G   1           H1'        G   1 -10.691  29.319 -26.662
    8    H8     G   1           H8         G   1  -7.870  31.415 -25.649
    9    H1     G   1           H1         G   1  -6.269  27.762 -30.675
   10    H21    G   1           H21        G   1  -7.790  26.194 -30.988
   11    H22    G   1           H22        G   1  -9.127  25.954 -29.886
   12   HO5'    G   1          H5T         G   1  -8.079  30.497 -23.752
   13    H5'    G   2           H5'        G   2 -10.822  23.606 -21.969
   14   H5''    G   2          H5''        G   2  -9.163  22.981 -21.970
   15    H4'    G   2           H4'        G   2 -11.085  21.793 -23.389
   16    H3'    G   2           H3'        G   2  -8.154  22.208 -23.789
   17    H2'    G   2          H2''        G   2  -8.120  21.661 -26.052
   18   HO2'    G   2          H2'         G   2  -9.264  19.714 -25.890
   19    H1'    G   2           H1'        G   2 -10.469  22.745 -26.894
   20    H8     G   2           H8         G   2  -9.387  25.466 -24.764
   21    H1     G   2           H1         G   2  -5.076  24.569 -29.419
   22    H21    G   2           H21        G   2  -5.450  22.644 -30.436
   23    H22    G   2           H22        G   2  -6.638  21.497 -29.861
   24    H5'    C   3           H5'        C   3  -8.301  17.519 -24.979
   25   H5''    C   3          H5''        C   3  -6.820  17.105 -24.092
   26    H4'    C   3           H4'        C   3  -6.923  16.594 -26.663
   27    H3'    C   3           H3'        C   3  -4.774  17.796 -24.953
   28    H2'    C   3          H2''        C   3  -3.456  18.532 -26.705
   29   HO2'    C   3          H2'         C   3  -4.814  16.634 -28.336
   30    H1'    C   3           H1'        C   3  -5.385  19.065 -28.628
   31    H41    C   3           H41        C   3  -3.160  24.533 -26.126
   32    H42    C   3           H42        C   3  -4.457  24.492 -24.955
   33    H5     C   3           H5         C   3  -6.083  22.717 -24.858
   34    H6     C   3           H6         C   3  -6.708  20.519 -25.743
   35    H5'    U   4           H5'        U   4  -2.431  16.110 -27.657
   36   H5''    U   4          H5''        U   4  -1.120  15.192 -26.892
   37    H4'    U   4           H4'        U   4  -0.256  17.070 -28.298
   38    H3'    U   4           H3'        U   4   0.140  16.838 -25.326
   39    H2'    U   4          H2''        U   4   0.990  18.949 -25.075
   40   HO2'    U   4          H2'         U   4   2.404  19.831 -26.467
   41    H1'    U   4           H1'        U   4  -0.012  20.158 -27.459
   42    H3     U   4           H3         U   4  -0.614  23.192 -24.140
   43    H5     U   4           H5         U   4  -3.393  20.146 -23.274
   44    H6     U   4           H6         U   4  -2.420  18.835 -25.068
   45    H5'    U   5           H5'        U   5   3.952  17.920 -27.654
   46   H5''    U   5          H5''        U   5   5.271  16.967 -26.946
   47    H4'    U   5           H4'        U   5   6.010  19.291 -27.260
   48    H3'    U   5           H3'        U   5   5.612  18.082 -24.543
   49    H2'    U   5          H2''        U   5   5.776  20.061 -23.388
   50   HO2'    U   5          H2'         U   5   7.881  20.496 -24.120
   51    H1'    U   5           H1'        U   5   5.130  21.906 -25.458
   52    H3     U   5           H3         U   5   2.479  23.307 -22.100
   53    H5     U   5           H5         U   5   1.075  19.417 -22.890
   54    H6     U   5           H6         U   5   2.897  19.153 -24.472
   55    H5'    G   6           H5'        G   6   8.741  18.494 -21.379
   56   H5''    G   6          H5''        G   6   7.188  18.962 -22.101
   57    H4'    G   6           H4'        G   6   9.316  21.073 -22.022
   58    H3'    G   6           H3'        G   6   8.217  19.628 -19.646
   59    H2'    G   6          H2''        G   6   7.244  21.446 -18.648
   60   HO2'    G   6          H2'         G   6   9.170  23.070 -19.977
   61    H1'    G   6           H1'        G   6   6.942  23.186 -20.860
   62    H8     G   6           H8         G   6   5.076  19.904 -21.258
   63    H1     G   6           H1         G   6   2.103  24.081 -17.405
   64    H21    G   6           H21        G   6   3.415  25.804 -16.997
   65    H22    G   6           H22        G   6   5.085  25.850 -17.511
   66    H5'    A   7           H5'        A   7  11.133  23.018 -18.394
   67   H5''    A   7          H5''        A   7  12.185  22.292 -17.162
   68    H4'    A   7           H4'        A   7  11.416  24.538 -16.446
   69    H3'    A   7           H3'        A   7  10.673  21.989 -15.059
   70    H2'    A   7          H2''        A   7   9.055  22.908 -13.707
   71   HO2'    A   7          H2'         A   7  10.229  25.475 -14.056
   72    H1'    A   7           H1'        A   7   8.293  25.136 -15.251
   73    H8     A   7           H8         A   7   8.097  21.611 -16.814
   74    H61    A   7           H61        A   7   2.414  21.335 -14.400
   75    H62    A   7           H62        A   7   3.536  20.602 -15.524
   76    H2     A   7           H2         A   7   4.355  25.113 -12.961
   77    H5'    U   8           H5'        U   8  11.462  25.233 -12.131
   78   H5''    U   8          H5''        U   8  12.558  24.603 -10.886
   79    H4'    U   8           H4'        U   8  10.706  25.777  -9.794
   80    H3'    U   8           H3'        U   8  10.983  22.789  -9.638
   81    H2'    U   8          H2''        U   8   8.923  22.443  -8.678
   82   HO2'    U   8          H2'         U   8   9.270  25.042  -7.600
   83    H1'    U   8           H1'        U   8   7.586  24.804  -9.524
   84    H3     U   8           H3         U   8   4.578  21.715 -10.800
   85    H5     U   8           H5         U   8   8.059  20.570 -12.881
   86    H6     U   8           H6         U   8   9.264  22.309 -11.687
   87    H5'    U   9           H5'        U   9  10.255  24.476  -5.492
   88   H5''    U   9          H5''        U   9  11.130  23.472  -4.320
   89    H4'    U   9           H4'        U   9   8.676  23.725  -3.788
   90    H3'    U   9           H3'        U   9  10.114  21.135  -4.301
   91    H2'    U   9          H2''        U   9   8.207  19.857  -4.389
   92   HO2'    U   9          H2'         U   9   7.072  21.811  -2.665
   93    H1'    U   9           H1'        U   9   6.305  21.871  -5.052
   94    H3     U   9           H3         U   9   5.335  18.628  -8.011
   95    H5     U   9           H5         U   9   9.328  19.604  -8.935
   96    H6     U   9           H6         U   9   9.325  21.124  -7.045
   97    H5'    G  10           H5'        G  10   7.448  21.129  -0.823
   98   H5''    G  10          H5''        G  10   8.241  20.470   0.621
   99    H4'    G  10           H4'        G  10   5.926  19.618   0.439
  100    H3'    G  10           H3'        G  10   8.325  17.821   0.102
  101    H2'    G  10          H2''        G  10   7.030  15.951  -0.377
  102   HO2'    G  10          H2'         G  10   5.472  15.691   1.018
  103    H1'    G  10           H1'        G  10   4.946  17.203  -1.749
  104    H8     G  10           H8         G  10   8.296  18.375  -3.059
  105    H1     G  10           H1         G  10   6.756  12.458  -4.999
  106    H21    G  10           H21        G  10   5.037  11.706  -3.839
  107    H22    G  10           H22        G  10   4.143  12.723  -2.731
  108    H5'    U  11           H5'        U  11   6.376  16.189   3.883
  109   H5''    U  11          H5''        U  11   7.540  15.113   4.680
  110    H4'    U  11           H4'        U  11   5.402  14.115   3.438
  111    H3'    U  11           H3'        U  11   8.274  13.191   3.577
  112    H2'    U  11          H2''        U  11   7.913  11.455   2.078
  113   HO2'    U  11          H2'         U  11   6.079  10.638   3.229
  114    H1'    U  11           H1'        U  11   5.922  12.657   0.500
  115    H3     U  11           H3         U  11   9.533  11.275  -2.017
  116    H5     U  11           H5         U  11  10.538  15.090  -0.536
  117    H6     U  11           H6         U  11   8.577  14.985   0.887
  118    H5'    A  12           H5'        A  12   6.459   9.563   5.735
  119   H5''    A  12          H5''        A  12   7.916   8.777   6.374
  120    H4'    A  12           H4'        A  12   6.640   7.778   4.248
  121    H3'    A  12           H3'        A  12   9.584   8.053   4.888
  122    H2'    A  12          H2''        A  12  10.215   7.236   2.807
  123   HO2'    A  12          H2'         A  12   7.589   6.149   2.608
  124    H1'    A  12           H1'        A  12   8.044   8.180   1.308
  125    H8     A  12           H8         A  12   9.634  11.049   3.182
  126    H61    A  12           H61        A  12  14.223  10.892  -0.958
  127    H62    A  12           H62        A  12  13.435  11.848   0.277
  128    H2     A  12           H2         A  12  11.604   7.317  -1.650
  129    H5'    U  13           H5'        U  13   9.140   4.645   2.866
  130   H5''    U  13          H5''        U  13   9.709   3.232   3.773
  131    H4'    U  13           H4'        U  13  10.685   3.030   1.596
  132    H3'    U  13           H3'        U  13  12.513   4.160   3.732
  133    H2'    U  13          H2''        U  13  14.278   4.282   2.206
  134   HO2'    U  13          H2'         U  13  13.904   2.098   1.418
  135    H1'    U  13           H1'        U  13  12.757   4.947  -0.057
  136    H3     U  13           H3         U  13  15.554   8.478   0.435
  137    H5     U  13           H5         U  13  13.148   8.634   3.871
  138    H6     U  13           H6         U  13  12.103   6.570   3.178
  139    H5'    G  14           H5'        G  14  14.675   0.515   2.742
  140   H5''    G  14          H5''        G  14  15.976   0.344   3.935
  141    H4'    G  14           H4'        G  14  16.460   1.273   1.469
  142    H3'    G  14           H3'        G  14  17.580   2.053   4.171
  143    H2'    G  14          H2''        G  14  18.754   3.818   3.266
  144   HO2'    G  14          H2'         G  14  19.963   3.498   1.587
  145    H1'    G  14           H1'        G  14  17.145   4.177   0.907
  146    H8     G  14           H8         G  14  15.237   5.102   4.008
  147    H1     G  14           H1         G  14  19.520   9.508   2.153
  148    H21    G  14           H21        G  14  20.864   8.653   0.629
  149    H22    G  14           H22        G  14  20.832   6.955   0.208
  150    H5'    U  15           H5'        U  15  20.904   1.344   1.150
  151   H5''    U  15          H5''        U  15  21.970   0.175   1.954
  152    H4'    U  15           H4'        U  15  23.418   1.806   0.937
  153    H3'    U  15           H3'        U  15  22.973   1.936   3.908
  154    H2'    U  15          H2''        U  15  24.051   3.958   4.184
  155   HO2'    U  15          H2'         U  15  25.390   3.426   1.728
  156    H1'    U  15           H1'        U  15  23.594   5.113   1.671
  157    H3     U  15           H3         U  15  21.863   8.159   4.510
  158    H5     U  15           H5         U  15  19.377   4.801   5.049
  159    H6     U  15           H6         U  15  20.844   3.558   3.568
  160    H5'    G  16           H5'        G  16  27.727   2.255   3.634
  161   H5''    G  16          H5''        G  16  28.090   1.834   5.317
  162    H4'    G  16           H4'        G  16  28.668   4.258   4.381
  163    H3'    G  16           H3'        G  16  27.548   3.327   7.023
  164    H2'    G  16          H2''        G  16  27.057   5.448   7.734
  165   HO2'    G  16          H2'         G  16  29.420   6.026   6.415
  166    H1'    G  16           H1'        G  16  26.951   6.761   5.189
  167    H8     G  16           H8         G  16  24.347   4.072   6.120
  168    H1     G  16           H1         G  16  22.965  10.002   8.134
  169    H21    G  16           H21        G  16  24.674  11.343   7.739
  170    H22    G  16           H22        G  16  26.211  10.749   7.153
  171    H5'    U  17           H5'        U  17  31.601   6.069   8.332
  172   H5''    U  17          H5''        U  17  31.616   5.410   9.979
  173    H4'    U  17           H4'        U  17  31.403   8.036   9.574
  174    H3'    U  17           H3'        U  17  30.096   6.172  11.550
  175    H2'    U  17          H2''        U  17  28.580   7.732  12.280
  176   HO2'    U  17          H2'         U  17  30.595   9.616  11.628
  177    H1'    U  17           H1'        U  17  28.604   9.486  10.023
  178    H3     U  17           H3         U  17  24.293   8.907  11.363
  179    H5     U  17           H5         U  17  25.337   5.256   9.533
  180    H6     U  17           H6         U  17  27.623   6.058   9.395
  181    H5'    A  18           H5'        A  18  32.454   9.945  14.238
  182   H5''    A  18          H5''        A  18  32.149   9.144  15.790
  183    H4'    A  18           H4'        A  18  31.376  11.656  15.419
  184    H3'    A  18           H3'        A  18  29.911   9.333  16.693
  185    H2'    A  18          H2''        A  18  28.093  10.728  17.223
  186   HO2'    A  18          H2'         A  18  28.228  12.882  17.390
  187    H1'    A  18           H1'        A  18  28.054  12.126  14.832
  188    H8     A  18           H8         A  18  28.655   8.482  14.072
  189    H61    A  18           H61        A  18  22.622   7.544  15.019
  190    H62    A  18           H62        A  18  24.136   6.809  14.540
  191    H2     A  18           H2         A  18  23.611  11.699  16.404
  192    H5'    A  19           H5'        A  19  29.629  12.400  19.413
  193   H5''    A  19          H5''        A  19  30.089  11.946  21.066
  194    H4'    A  19           H4'        A  19  27.863  12.986  21.094
  195    H3'    A  19           H3'        A  19  28.249  10.056  21.664
  196    H2'    A  19          H2''        A  19  25.996   9.580  21.719
  197   HO2'    A  19          H2'         A  19  24.665  10.817  22.773
  198    H1'    A  19           H1'        A  19  25.028  11.603  20.015
  199    H8     A  19           H8         A  19  27.706   9.319  18.507
  200    H61    A  19           H61        A  19  23.133   5.339  17.311
  201    H62    A  19           H62        A  19  24.777   5.792  16.926
  202    H2     A  19           H2         A  19  21.461   8.665  19.806
  203    H5'    A  20           H5'        A  20  25.414  11.597  24.704
  204   H5''    A  20          H5''        A  20  25.899  10.893  26.258
  205    H4'    A  20           H4'        A  20  23.505  10.474  25.854
  206    H3'    A  20           H3'        A  20  25.515   8.219  25.813
  207    H2'    A  20          H2''        A  20  23.926   6.646  25.184
  208   HO2'    A  20          H2'         A  20  21.936   8.429  26.171
  209    H1'    A  20           H1'        A  20  22.177   8.304  23.754
  210    H8     A  20           H8         A  20  25.967   8.106  22.932
  211    H61    A  20           H61        A  20  24.413   3.559  19.047
  212    H62    A  20           H62        A  20  25.729   4.508  19.701
  213    H2     A  20           H2         A  20  20.746   4.739  21.342
  214    H5'    U  21           H5'        U  21  22.407   6.570  28.618
  215   H5''    U  21          H5''        U  21  23.291   5.302  29.489
  216    H4'    U  21           H4'        U  21  21.369   4.642  27.785
  217    H3'    U  21           H3'        U  21  24.100   3.447  28.277
  218    H2'    U  21          H2''        U  21  23.956   2.034  26.425
  219   HO2'    U  21          H2'         U  21  22.267   0.800  26.540
  220    H1'    U  21           H1'        U  21  22.056   3.475  24.908
  221    H3     U  21           H3         U  21  25.469   2.421  22.069
  222    H5     U  21           H5         U  21  27.171   5.183  24.760
  223    H6     U  21           H6         U  21  25.071   5.214  25.957
  224    H5'    U  22           H5'        U  22  20.676   1.150  28.820
  225   H5''    U  22          H5''        U  22  20.215   0.219  30.260
  226    H4'    U  22           H4'        U  22  19.612  -1.178  28.422
  227    H3'    U  22           H3'        U  22  22.101  -1.801  29.941
  228    H2'    U  22          H2''        U  22  23.110  -3.099  28.368
  229   HO2'    U  22          H2'         U  22  20.585  -3.864  27.323
  230    H1'    U  22           H1'        U  22  21.636  -2.423  26.043
  231    H3     U  22           H3         U  22  25.845  -2.242  24.455
  232    H5     U  22           H5         U  22  25.902   0.532  27.626
  233    H6     U  22           H6         U  22  23.601  -0.068  28.107
  234    H5'    A  23           H5'        A  23  23.500  -4.988  31.221
  235   H5''    A  23          H5''        A  23  23.616  -4.312  29.587
  236    H4'    A  23           H4'        A  23  24.799  -6.552  29.932
  237    H3'    A  23           H3'        A  23  23.140  -5.578  27.786
  238    H2'    A  23          H2''        A  23  21.559  -7.219  27.668
  239   HO2'    A  23          H2'         A  23  22.173  -9.057  26.651
  240    H1'    A  23           H1'        A  23  22.646  -9.287  29.390
  241    H8     A  23           H8         A  23  20.695  -6.609  31.046
  242    H61    A  23           H61        A  23  15.474  -9.287  29.089
  243    H62    A  23           H62        A  23  16.149  -7.950  29.992
  244    H2     A  23           H2         A  23  18.928 -11.310  27.062
  245    H5'    A  24           H5'        A  24  25.991  -6.656  24.266
  246   H5''    A  24          H5''        A  24  24.999  -5.507  23.348
  247    H4'    A  24           H4'        A  24  24.500  -8.295  23.791
  248    H3'    A  24           H3'        A  24  23.276  -5.902  22.463
  249    H2'    A  24          H2''        A  24  21.120  -6.660  22.619
  250   HO2'    A  24          H2'         A  24  21.876  -9.377  22.483
  251    H1'    A  24           H1'        A  24  21.649  -8.870  24.483
  252    H8     A  24           H8         A  24  21.577  -5.572  26.147
  253    H61    A  24           H61        A  24  15.407  -5.972  26.264
  254    H62    A  24           H62        A  24  16.799  -5.060  26.803
  255    H2     A  24           H2         A  24  16.968  -9.164  23.523
  256    H5'    U  25           H5'        U  25  22.855  -5.153  18.611
  257   H5''    U  25          H5''        U  25  22.264  -5.957  20.077
  258    H4'    U  25           H4'        U  25  21.306  -6.203  17.344
  259    H3'    U  25           H3'        U  25  20.284  -6.118  19.889
  260    H2'    U  25          H2''        U  25  20.857  -8.279  20.611
  261   HO2'    U  25          H2'         U  25  18.775  -8.667  20.815
  262    H1'    U  25           H1'        U  25  20.317  -9.484  17.928
  263    H3     U  25           H3         U  25  22.335 -13.366  18.856
  264    H5     U  25           H5         U  25  24.186 -10.712  21.555
  265    H6     U  25           H6         U  25  22.840  -8.923  20.624
  266    H5'    U  26           H5'        U  26  19.371  -6.414  21.536
  267   H5''    U  26          H5''        U  26  17.648  -6.817  21.440
  268    H4'    U  26           H4'        U  26  17.384  -5.462  23.279
  269    H3'    U  26           H3'        U  26  17.799  -3.696  20.907
  270    H2'    U  26          H2''        U  26  18.658  -1.880  21.995
  271   HO2'    U  26          H2'         U  26  17.328  -2.709  24.371
  272    H1'    U  26           H1'        U  26  19.612  -3.022  24.367
  273    H3     U  26           H3         U  26  23.291  -0.881  22.956
  274    H5     U  26           H5         U  26  22.624  -3.723  19.925
  275    H6     U  26           H6         U  26  20.576  -4.361  21.032
  276    H5'    C  27           H5'        C  27  14.008  -1.149  22.279
  277   H5''    C  27          H5''        C  27  13.892  -0.257  20.749
  278    H4'    C  27           H4'        C  27  14.855   0.865  23.040
  279    H3'    C  27           H3'        C  27  15.750   1.139  20.119
  280    H2'    C  27          H2''        C  27  17.450   2.610  20.758
  281   HO2'    C  27          H2'         C  27  15.909   3.182  23.090
  282    H1'    C  27           H1'        C  27  17.703   1.650  23.416
  283    H41    C  27           H41        C  27  23.233   0.664  20.419
  284    H42    C  27           H42        C  27  22.471  -0.403  19.262
  285    H5     C  27           H5         C  27  20.087  -0.735  19.155
  286    H6     C  27           H6         C  27  17.941  -0.249  20.233
  287    H5'    U  28           H5'        U  28  13.079   5.194  20.838
  288   H5''    U  28          H5''        U  28  13.134   6.063  19.293
  289    H4'    U  28           H4'        U  28  14.278   7.091  21.489
  290    H3'    U  28           H3'        U  28  15.281   6.953  18.626
  291    H2'    U  28          H2''        U  28  17.176   8.179  19.203
  292   HO2'    U  28          H2'         U  28  17.073   9.741  20.604
  293    H1'    U  28           H1'        U  28  17.547   6.992  21.719
  294    H3     U  28           H3         U  28  21.092   6.331  18.836
  295    H5     U  28           H5         U  28  18.266   3.351  17.917
  296    H6     U  28           H6         U  28  16.700   4.456  19.391
  297    H5'    U  29           H5'        U  29  15.443  11.015  19.958
  298   H5''    U  29          H5''        U  29  14.644  12.101  18.805
  299    H4'    U  29           H4'        U  29  16.771  13.108  19.407
  300    H3'    U  29           H3'        U  29  16.446  11.846  16.688
  301    H2'    U  29          H2''        U  29  18.664  12.133  16.114
  302   HO2'    U  29          H2'         U  29  19.602  13.969  16.492
  303    H1'    U  29           H1'        U  29  19.829  12.007  18.665
  304    H3     U  29           H3         U  29  21.955   8.872  16.184
  305    H5     U  29           H5         U  29  18.081   7.301  16.696
  306    H6     U  29           H6         U  29  17.439   9.400  17.729
  307    H5'    A  30           H5'        A  30  18.034  16.489  15.884
  308   H5''    A  30          H5''        A  30  17.857  16.474  14.120
  309    H4'    A  30           H4'        A  30  20.244  16.869  15.244
  310    H3'    A  30           H3'        A  30  19.482  15.159  12.856
  311    H2'    A  30          H2''        A  30  21.760  14.693  12.484
  312   HO2'    A  30          H2'         A  30  22.735  16.654  12.742
  313    H1'    A  30           H1'        A  30  22.407  14.285  15.146
  314    H8     A  30           H8         A  30  19.037  12.701  14.325
  315    H61    A  30           H61        A  30  22.185   8.074  11.732
  316    H62    A  30           H62        A  30  20.664   8.541  12.461
  317    H2     A  30           H2         A  30  25.041  11.445  12.489
  318    H5'    C  31           H5'        C  31  21.853  18.634  10.804
  319   H5''    C  31          H5''        C  31  21.487  18.442   9.079
  320    H4'    C  31           H4'        C  31  23.949  18.019   9.979
  321    H3'    C  31           H3'        C  31  22.268  16.555   7.945
  322    H2'    C  31          H2''        C  31  23.855  14.868   7.668
  323   HO2'    C  31          H2'         C  31  25.632  16.170   7.254
  324    H1'    C  31           H1'        C  31  24.895  14.791  10.235
  325    H41    C  31           H41        C  31  21.222   9.673   9.064
  326    H42    C  31           H42        C  31  19.825  10.559   9.630
  327    H5     C  31           H5         C  31  19.945  12.843  10.409
  328    H6     C  31           H6         C  31  21.363  14.831  10.579
  329    H5'    A  32           H5'        A  32  25.913  17.540   5.619
  330   H5''    A  32          H5''        A  32  25.386  18.278   4.094
  331    H4'    A  32           H4'        A  32  26.867  16.424   3.555
  332    H3'    A  32           H3'        A  32  23.900  16.154   3.085
  333    H2'    A  32          H2''        A  32  24.056  13.937   2.418
  334   HO2'    A  32          H2'         A  32  25.743  13.132   1.373
  335    H1'    A  32           H1'        A  32  26.135  13.109   4.060
  336    H8     A  32           H8         A  32  23.348  15.092   5.811
  337    H61    A  32           H61        A  32  20.317   9.716   6.153
  338    H62    A  32           H62        A  32  20.405  11.355   6.759
  339    H2     A  32           H2         A  32  24.002   9.086   3.672
  340    H5'    C  33           H5'        C  33  25.774  15.365  -1.288
  341   H5''    C  33          H5''        C  33  24.293  15.328  -2.263
  342    H4'    C  33           H4'        C  33  25.823  13.145  -1.982
  343    H3'    C  33           H3'        C  33  22.806  13.450  -1.988
  344    H2'    C  33          H2''        C  33  22.574  11.098  -1.805
  345   HO2'    C  33          H2'         C  33  25.375  10.887  -2.288
  346    H1'    C  33           H1'        C  33  24.583  10.749   0.053
  347    H41    C  33           H41        C  33  18.912  10.959   3.005
  348    H42    C  33           H42        C  33  19.017  12.700   3.086
  349    H5     C  33           H5         C  33  20.924  13.937   2.252
  350    H6     C  33           H6         C  33  22.944  13.810   0.871
  351    H5'    A  34           H5'        A  34  23.829  11.181  -5.105
  352   H5''    A  34          H5''        A  34  23.268  11.324  -6.783
  353    H4'    A  34           H4'        A  34  22.581   9.140  -6.029
  354    H3'    A  34           H3'        A  34  20.545  11.328  -6.259
  355    H2'    A  34          H2''        A  34  18.891  10.240  -5.106
  356   HO2'    A  34          H2'         A  34  19.339   8.399  -6.758
  357    H1'    A  34           H1'        A  34  20.466   8.329  -3.679
  358    H8     A  34           H8         A  34  21.017  12.030  -2.846
  359    H61    A  34           H61        A  34  16.535  11.277   1.349
  360    H62    A  34           H62        A  34  17.866  12.290   0.835
  361    H2     A  34           H2         A  34  16.701   7.586  -1.195
  362    H5'    C  35           H5'        C  35  17.290  11.112  -9.056
  363   H5''    C  35          H5''        C  35  17.368  12.684  -8.235
  364    H4'    C  35           H4'        C  35  16.516   9.998  -7.117
  365    H3'    C  35           H3'        C  35  15.248  12.364  -8.016
  366    H2'    C  35          H2''        C  35  15.543  13.732  -6.228
  367   HO2'    C  35          H2'         C  35  14.068  13.249  -4.465
  368    H1'    C  35           H1'        C  35  15.848  11.534  -4.204
  369    H41    C  35           H41        C  35  18.430  16.806  -1.596
  370    H42    C  35           H42        C  35  19.936  16.383  -2.380
  371    H5     C  35           H5         C  35  20.114  14.653  -4.045
  372    H6     C  35           H6         C  35  18.924  12.863  -5.216
  373    H5'    U  36           H5'        U  36  16.521   8.402  -8.770
  374   H5''    U  36          H5''        U  36  15.174   8.087  -9.887
  375    H4'    U  36           H4'        U  36  16.072   5.918  -9.469
  376    H3'    U  36           H3'        U  36  13.593   6.781  -8.096
  377    H2'    U  36          H2''        U  36  13.582   5.271  -6.356
  378   HO2'    U  36          H2'         U  36  15.161   3.636  -8.059
  379    H1'    U  36           H1'        U  36  16.271   4.822  -5.936
  380    H3     U  36           H3         U  36  13.286   7.508  -3.045
  381    H5     U  36           H5         U  36  16.785   9.542  -4.207
  382    H6     U  36           H6         U  36  17.230   7.750  -5.774
  383    H5'    A  37           H5'        A  37  10.579   3.514  -9.346
  384   H5''    A  37          H5''        A  37   9.560   4.867  -9.876
  385    H4'    A  37           H4'        A  37   8.894   3.429  -7.733
  386    H3'    A  37           H3'        A  37   8.793   6.412  -8.239
  387    H2'    A  37          H2''        A  37   7.943   6.817  -6.099
  388   HO2'    A  37          H2'         A  37   7.491   4.012  -5.857
  389    H1'    A  37           H1'        A  37   9.521   4.980  -4.739
  390    H8     A  37           H8         A  37  11.862   6.654  -7.102
  391    H61    A  37           H61        A  37  11.722  11.642  -3.468
  392    H62    A  37           H62        A  37  12.639  10.768  -4.674
  393    H2     A  37           H2         A  37   8.316   8.971  -2.290
  394    H5'    C  38           H5'        C  38   4.679   4.564  -8.266
  395   H5''    C  38          H5''        C  38   3.407   5.330  -9.239
  396    H4'    C  38           H4'        C  38   2.844   5.253  -6.792
  397    H3'    C  38           H3'        C  38   3.154   7.763  -8.422
  398    H2'    C  38          H2''        C  38   2.936   9.187  -6.604
  399   HO2'    C  38          H2'         C  38   1.736   7.014  -5.212
  400    H1'    C  38           H1'        C  38   4.100   7.604  -4.618
  401    H41    C  38           H41        C  38   8.112  12.316  -6.342
  402    H42    C  38           H42        C  38   8.889  11.192  -7.434
  403    H5     C  38           H5         C  38   7.940   9.058  -8.012
  404    H6     C  38           H6         C  38   6.183   7.436  -7.492
  405    H5'    A  39           H5'        A  39  -1.420   8.431  -7.882
  406   H5''    A  39          H5''        A  39  -1.632   9.616  -9.188
  407    H4'    A  39           H4'        A  39  -1.559  10.361  -6.593
  408    H3'    A  39           H3'        A  39  -0.397  11.649  -9.096
  409    H2'    A  39          H2''        A  39   0.598  13.348  -7.811
  410   HO2'    A  39          H2'         A  39  -0.251  14.049  -5.889
  411    H1'    A  39           H1'        A  39   0.920  11.881  -5.437
  412    H8     A  39           H8         A  39   2.651  10.237  -8.366
  413    H61    A  39           H61        A  39   7.146  14.436  -7.766
  414    H62    A  39           H62        A  39   6.700  12.894  -8.462
  415    H2     A  39           H2         A  39   3.745  15.654  -5.108
  416    H5'    A  40           H5'        A  40  -3.344  13.661  -6.733
  417   H5''    A  40          H5''        A  40  -4.719  14.517  -7.461
  418    H4'    A  40           H4'        A  40  -4.026  15.854  -5.581
  419    H3'    A  40           H3'        A  40  -3.361  16.725  -8.364
  420    H2'    A  40          H2''        A  40  -1.768  18.282  -7.818
  421   HO2'    A  40          H2'         A  40  -3.130  19.557  -6.563
  422    H1'    A  40           H1'        A  40  -0.925  17.364  -5.301
  423    H8     A  40           H8         A  40  -0.774  15.008  -8.366
  424    H61    A  40           H61        A  40   4.993  17.106  -9.109
  425    H62    A  40           H62        A  40   3.797  15.952  -9.655
  426    H2     A  40           H2         A  40   3.045  19.504  -5.855
  427    H5'    A  41           H5'        A  41  -5.608  20.689  -6.872
  428   H5''    A  41          H5''        A  41  -5.843  21.493  -8.436
  429    H4'    A  41           H4'        A  41  -4.155  22.497  -6.604
  430    H3'    A  41           H3'        A  41  -3.819  22.174  -9.602
  431    H2'    A  41          H2''        A  41  -1.786  23.342  -9.492
  432   HO2'    A  41          H2'         A  41  -2.616  24.175  -6.899
  433    H1'    A  41           H1'        A  41  -0.987  22.203  -7.039
  434    H8     A  41           H8         A  41  -2.269  19.646  -9.560
  435    H61    A  41           H61        A  41   3.425  19.699 -11.975
  436    H62    A  41           H62        A  41   1.878  18.882 -11.948
  437    H2     A  41           H2         A  41   3.207  22.921  -8.862
  438    H5'    U  42           H5'        U  42  -3.473  26.186  -8.188
  439   H5''    U  42          H5''        U  42  -4.260  27.464  -9.138
  440    H4'    U  42           H4'        U  42  -1.956  28.156  -8.570
  441    H3'    U  42           H3'        U  42  -2.685  27.303 -11.391
  442    H2'    U  42          H2''        U  42  -0.529  27.553 -12.188
  443   HO2'    U  42          H2'         U  42   0.754  29.132 -11.580
  444    H1'    U  42           H1'        U  42   0.840  27.001  -9.781
  445    H3     U  42           H3         U  42   2.583  23.938 -12.606
  446    H5     U  42           H5         U  42  -1.394  22.675 -12.068
  447    H6     U  42           H6         U  42  -1.843  24.779 -10.966
  448    H5'    U  43           H5'        U  43  -0.574  31.076 -12.484
  449   H5''    U  43          H5''        U  43  -1.146  31.337 -14.144
  450    H4'    U  43           H4'        U  43   1.350  30.496 -13.671
  451    H3'    U  43           H3'        U  43  -0.678  29.835 -15.800
  452    H2'    U  43          H2''        U  43   0.457  27.989 -16.588
  453   HO2'    U  43          H2'         U  43   2.815  29.288 -15.663
  454    H1'    U  43           H1'        U  43   2.048  27.394 -14.303
  455    H3     U  43           H3         U  43   0.348  23.365 -15.431
  456    H5     U  43           H5         U  43  -3.042  25.593 -14.289
  457    H6     U  43           H6         U  43  -1.619  27.548 -14.109
  458    H5'    A  44           H5'        A  44   2.946  32.976 -18.078
  459   H5''    A  44          H5''        A  44   2.137  32.904 -19.656
  460    H4'    A  44           H4'        A  44   4.777  32.587 -19.478
  461    H3'    A  44           H3'        A  44   2.651  31.341 -21.179
  462    H2'    A  44          H2''        A  44   3.943  29.585 -21.952
  463   HO2'    A  44          H2'         A  44   6.076  29.724 -22.299
  464    H1'    A  44           H1'        A  44   5.619  29.158 -19.787
  465    H8     A  44           H8         A  44   2.292  29.220 -18.203
  466    H61    A  44           H61        A  44   1.108  23.700 -20.697
  467    H62    A  44           H62        A  44   0.502  24.964 -19.651
  468    H2     A  44           H2         A  44   4.812  25.325 -22.629
  469    H5'    A  45           H5'        A  45   5.308  32.210 -24.840
  470   H5''    A  45          H5''        A  45   3.994  32.319 -26.028
  471    H4'    A  45           H4'        A  45   5.683  30.253 -26.060
  472    H3'    A  45           H3'        A  45   2.706  30.447 -26.482
  473    H2'    A  45          H2''        A  45   2.412  28.158 -26.570
  474   HO2'    A  45          H2'         A  45   4.268  28.086 -28.172
  475    H1'    A  45           H1'        A  45   4.547  27.375 -24.888
  476    H8     A  45           H8         A  45   2.334  29.774 -23.058
  477    H61    A  45           H61        A  45  -1.580  25.067 -22.146
  478    H62    A  45           H62        A  45  -1.083  26.649 -21.590
  479    H2     A  45           H2         A  45   1.365  23.852 -25.305
  480    H5'    G  46           H5'        G  46   4.789  28.975 -31.080
  481   H5''    G  46          H5''        G  46   3.233  29.066 -31.928
  482    H4'    G  46           H4'        G  46   4.718  26.851 -32.059
  483    H3'    G  46           H3'        G  46   1.757  27.328 -31.839
  484    H2'    G  46          H2''        G  46   1.226  25.082 -31.498
  485   HO2'    G  46          H2'         G  46   2.853  23.422 -31.846
  486    H1'    G  46           H1'        G  46   3.321  24.372 -29.874
  487    H8     G  46           H8         G  46   2.426  27.679 -28.519
  488    H1     G  46           H1         G  46  -2.205  23.389 -27.443
  489    H21    G  46           H21        G  46  -1.842  21.566 -28.632
  490    H22    G  46           H22        G  46  -0.560  21.462 -29.817
  491    H5'    C  47           H5'        C  47   2.045  23.689 -33.706
  492   H5''    C  47          H5''        C  47   1.754  23.994 -35.430
  493    H4'    C  47           H4'        C  47   0.611  21.935 -34.924
  494    H3'    C  47           H3'        C  47  -0.995  24.458 -35.179
  495    H2'    C  47          H2''        C  47  -3.001  23.477 -34.585
  496   HO2'    C  47          H2'         C  47  -3.425  21.325 -34.757
  497    H1'    C  47           H1'        C  47  -2.037  21.661 -32.677
  498    H41    C  47           H41        C  47  -4.134  26.297 -28.916
  499    H42    C  47           H42        C  47  -2.968  27.424 -29.563
  500    H5     C  47           H5         C  47  -1.335  26.815 -31.227
  501    H6     C  47           H6         C  47  -0.666  25.098 -32.838
  502    H5'    C  48           H5'        C  48  -3.611  21.835 -36.807
  503   H5''    C  48          H5''        C  48  -4.376  22.537 -38.246
  504    H4'    C  48           H4'        C  48  -6.037  22.084 -36.417
  505    H3'    C  48           H3'        C  48  -5.363  24.874 -37.361
  506   HO3'    C  48          H3T         C  48  -6.610  24.057 -38.868
  507    H2'    C  48          H2''        C  48  -6.774  25.857 -35.836
  508   HO2'    C  48          H2'         C  48  -8.214  23.413 -35.947
  509    H1'    C  48           H1'        C  48  -6.718  23.758 -33.883
  510    H41    C  48           H41        C  48  -4.206  28.855 -31.031
  511    H42    C  48           H42        C  48  -2.965  28.992 -32.257
  512    H5     C  48           H5         C  48  -2.722  27.411 -34.059
  513    H6     C  48           H6         C  48  -3.760  25.525 -35.228