*HEADER    RNA                                     25-FEB-10   2KUR              
*TITLE     SOLUTION STRUCTURE OF K10 TLS RNA (AU MUTANT IN UPPER HELIX)          
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: K10 TLS RNA;                                               
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 ENGINEERED: YES;                                                     
*COMPND   5 MUTATION: YES;                                                       
*COMPND   6 OTHER_DETAILS: THE WILD-TYPE SEQUENCE OF K10 TLS RNA IS              
*COMPND   7 GGCUUGAUUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAAUUAAGCC  THE MUTATIONS IN   
*COMPND   8 THE AU MUTANT IN UPPER HELIX RNA ARE: U15A, A32U                     
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES;                                                      
*SOURCE   3 ORGANISM_SCIENTIFIC: DROSOPHILA MELANOGASTER;                        
*SOURCE   4 ORGANISM_COMMON: FRUIT FLY;                                          
*SOURCE   5 ORGANISM_TAXID: 7227;                                                
*SOURCE   6 OTHER_DETAILS: PREPARED BY IN VITRO TRANSCRIPTION USING T7 RNA       
*SOURCE   7 POLYMERASE                                                           
*KEYWDS    RNA TRANSPORT, RNA HAIRPIN, RNA                                       
*EXPDTA    SOLUTION NMR                                                          
*NUMMDL    10                                                                    
*AUTHOR    S.L.BULLOCK, I.RINGEL, D.ISH-HOROWICZ, P.J.LUKAVSKY                   
*REVDAT   1   19-MAY-10 2KUR    0                                                


{NOE-D2O}
assign (residue 1 and name h2'') (residue 2 and name h8) 1.8 0.4 1.2
assign (residue 2 and name h2'') (residue 3 and name h6) 1.8 0.4 1.2
assign (residue 3 and name h2'') (residue 4 and name h6) 1.8 0.4 1.2
assign (residue 4 and name h2'') (residue 5 and name h6) 1.8 0.4 1.2
assign (residue 5 and name h2'') (residue 6 and name h8) 1.8 0.4 1.2
assign (residue 7 and name h2'') (residue 8 and name h6) 1.8 0.4 1.2
assign (residue 8 and name h2'') (residue 9 and name h6) 1.8 0.4 1.2
assign (residue 9 and name h2'') (residue 10 and name h8) 1.8 0.4 1.2
assign (residue 10 and name h2'') (residue 11 and name h6) 1.8 0.4 1.2
assign (residue 11 and name h2'') (residue 12 and name h8) 1.8 0.4 1.2
assign (residue 12 and name h2'') (residue 13 and name h6) 1.8 0.4 1.2
assign (residue 13 and name h1') (residue 12 and name h2) 1.8 0.4 1.2
assign (residue 13 and name h2'') (residue 14 and name h6) 1.8 0.4 1.2
assign (residue 17 and name h2'') (residue 18 and name h8) 1.8 0.4 1.2
assign (residue 18 and name h2'') (residue 19 and name h8) 1.8 0.4 1.2
assign (residue 19 and name h2'') (residue 20 and name h8) 1.8 0.4 1.2
assign (residue 20 and name h2'') (residue 21 and name h6) 1.8 0.4 1.2
assign (residue 21 and name h2'') (residue 22 and name h6) 1.8 0.4 1.2
assign (residue 26 and name h2'') (residue 27 and name h6) 1.8 0.4 1.2
assign (residue 29 and name h2'') (residue 30 and name h8) 1.8 0.4 1.2
assign (residue 30 and name h1') (residue 18 and name h2) 1.8 0.4 1.2
assign (residue 36 and name h2'') (residue 37 and name h8) 1.8 0.4 1.2
assign (residue 37 and name h2'') (residue 38 and name h6) 1.8 0.4 1.2
assign (residue 38 and name h2'') (residue 39 and name h8) 1.8 0.4 1.2
assign (residue 40 and name h2'') (residue 41 and name h8) 1.8 0.4 1.2
assign (residue 41 and name h2'') (residue 42 and name h6) 1.8 0.4 1.2
assign (residue 42 and name h2'') (residue 43 and name h6) 1.8 0.4 1.2
assign (residue 42 and name h3') (residue 42 and name h6) 1.8 0.4 1.2
assign (residue 43 and name h2'') (residue 44 and name h8) 1.8 0.4 1.2
assign (residue 46 and name h2'') (residue 47 and name h6) 1.8 0.4 1.2
assign (residue 47 and name h2'') (residue 48 and name h6) 1.8 0.4 1.2
assign (residue 1 and name h3') (residue 1 and name h8) 1.8 0 2.2
assign (residue 2 and name h3') (residue 2 and name h8) 1.8 0 2.2
assign (residue 2 and name h3') (residue 3 and name h6) 1.8 0 2.2
assign (residue 4 and name h3') (residue 4 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 5 and name h6) 1.8 0 2.2
assign (residue 5 and name h3') (residue 6 and name h8) 1.8 0 2.2
assign (residue 6 and name h1') (residue 44 and name h2) 1.8 0 2.2
assign (residue 6 and name h2'') (residue 7 and name h8) 1.8 0 2.2
assign (residue 6 and name h3') (residue 6 and name h8) 1.8 0 2.2
assign (residue 6 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 7 and name h3') (residue 7 and name h8) 1.8 0 2.2
assign (residue 7 and name h3') (residue 8 and name h6) 1.8 0 2.2
assign (residue 8 and name h3') (residue 8 and name h6) 1.8 0 2.2
assign (residue 8 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 9 and name h3') (residue 9 and name h6) 1.8 0 2.2
assign (residue 10 and name h3') (residue 10 and name h8) 1.8 0 2.2
assign (residue 11 and name h3') (residue 11 and name h6) 1.8 0 2.2
assign (residue 12 and name h1') (residue 37 and name h2) 1.8 0 2.2
assign (residue 12 and name h3') (residue 12 and name h8) 1.8 0 2.2
assign (residue 12 and name h3') (residue 13 and name h6) 1.8 0 2.2
assign (residue 13 and name h3') (residue 13 and name h6) 1.8 0 2.2
assign (residue 13 and name h3') (residue 14 and name h6) 1.8 0 2.2
assign (residue 14 and name h3') (residue 14 and name h6) 1.8 0 2.2
assign (residue 17 and name h1') (residue 31 and name h2) 1.8 0 2.2
assign (residue 17 and name h3') (residue 17 and name h6) 1.8 0 2.2
assign (residue 17 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 18 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 18 and name h3') (residue 18 and name h8) 1.8 0 2.2
assign (residue 18 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 19 and name h1') (residue 18 and name h2) 1.8 0 2.2
assign (residue 19 and name h3') (residue 19 and name h8) 1.8 0 2.2
assign (residue 20 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 21 and name h1') (residue 20 and name h2) 1.8 0 2.2
assign (residue 21 and name h2'') (residue 21 and name h6) 1.8 0 2.2
assign (residue 21 and name h3') (residue 21 and name h6) 1.8 0 2.2
assign (residue 22 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 22 and name h3') (residue 22 and name h6) 1.8 0 2.2
assign (residue 23 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 23 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h2'') (residue 24 and name h8) 1.8 0 2.2
assign (residue 24 and name h3') (residue 24 and name h8) 1.8 0 2.2
assign (residue 25 and name h2'') (residue 25 and name h6) 1.8 0 2.2
assign (residue 25 and name h3') (residue 25 and name h6) 1.8 0 2.2
assign (residue 26 and name h2'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h3') (residue 26 and name h6) 1.8 0 2.2
assign (residue 26 and name h5'') (residue 26 and name h6) 1.8 0 2.2
assign (residue 27 and name h3') (residue 27 and name h6) 1.8 0 2.2
assign (residue 28 and name h2'') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h1') (residue 19 and name h2) 1.8 0 2.2
assign (residue 29 and name h3') (residue 29 and name h6) 1.8 0 2.2
assign (residue 29 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 30 and name h8) 1.8 0 2.2
assign (residue 30 and name h3') (residue 31 and name h8) 1.8 0 2.2
assign (residue 31 and name h1') (residue 30 and name h2) 1.8 0 2.2
assign (residue 31 and name h3') (residue 31 and name h8) 1.8 0 2.2
assign (residue 34 and name h3') (residue 34 and name h8) 1.8 0 2.2
assign (residue 35 and name h2'') (residue 35 and name h6) 1.8 0 2.2
assign (residue 35 and name h3') (residue 35 and name h6) 1.8 0 2.2
assign (residue 36 and name h3') (residue 36 and name h6) 1.8 0 2.2
assign (residue 36 and name h5) (residue 35 and name h1') 1.8 0 2.2
assign (residue 37 and name h3') (residue 37 and name h8) 1.8 0 2.2
assign (residue 37 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 38 and name h1') (residue 37 and name h2) 1.8 0 2.2
assign (residue 38 and name h3') (residue 38 and name h6) 1.8 0 2.2
assign (residue 39 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 39 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 40 and name h8) 1.8 0 2.2
assign (residue 40 and name h3') (residue 41 and name h8) 1.8 0 2.2
assign (residue 41 and name h3') (residue 41 and name h8) 1.8 0 2.2
assign (residue 41 and name h3') (residue 42 and name h6) 1.8 0 2.2
assign (residue 42 and name h3') (residue 43 and name h6) 1.8 0 2.2
assign (residue 43 and name h1') (residue 7 and name h2) 1.8 0 2.2
assign (residue 43 and name h3') (residue 43 and name h6) 1.8 0 2.2
assign (residue 44 and name h2'') (residue 45 and name h8) 1.8 0 2.2
assign (residue 44 and name h3') (residue 44 and name h8) 1.8 0 2.2
assign (residue 45 and name h1') (residue 44 and name h2) 1.8 0 2.2
assign (residue 45 and name h2'') (residue 46 and name h8) 1.8 0 2.2
assign (residue 45 and name h3') (residue 45 and name h8) 1.8 0 2.2
assign (residue 46 and name h3') (residue 46 and name h8) 1.8 0 2.2
assign (residue 46 and name h3') (residue 47 and name h6) 1.8 0 2.2
assign (residue 48 and name h3') (residue 48 and name h6) 1.8 0 2.2
assign (residue 1 and name h1') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 1 and name h2'') (residue 1 and name h8) 1.8 0 3.2
assign (residue 1 and name h3') (residue 2 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 2 and name h8) 1.8 0 3.2
assign (residue 2 and name h1') (residue 3 and name h6) 1.8 0 3.2
assign (residue 2 and name h2'') (residue 3 and name h1') 1.8 0 3.2
assign (residue 2 and name h2'') (residue 3 and name h5) 1.8 0 3.2
assign (residue 2 and name h3') (residue 3 and name h5) 1.8 0 3.2
assign (residue 3 and name h1') (residue 3 and name h6) 1.8 0 3.2
assign (residue 3 and name h1') (residue 4 and name h6) 1.8 0 3.2
assign (residue 3 and name h3') (residue 4 and name h5) 1.8 0 3.2
assign (residue 3 and name h5) (residue 4 and name h5) 1.8 0 3.2
assign (residue 3 and name h6) (residue 4 and name h6) 1.8 0 3.2
assign (residue 4 and name h1') (residue 4 and name h6) 1.8 0 3.2
assign (residue 4 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 4 and name h5) (residue 5 and name h5) 1.8 0 3.2
assign (residue 5 and name h1') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h1') (residue 6 and name h8) 1.8 0 3.2
assign (residue 5 and name h1') (residue 45 and name h2) 1.8 0 3.2
assign (residue 5 and name h2'') (residue 6 and name h1') 1.8 0 3.2
assign (residue 5 and name h5) (residue 4 and name h6) 1.8 0 3.2
assign (residue 6 and name h1') (residue 6 and name h8) 1.8 0 3.2
assign (residue 6 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 6 and name h8) (residue 5 and name h6) 1.8 0 3.2
assign (residue 7 and name h1') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h1') (residue 8 and name h6) 1.8 0 3.2
assign (residue 7 and name h2'') (residue 7 and name h8) 1.8 0 3.2
assign (residue 7 and name h2'') (residue 8 and name h1') 1.8 0 3.2
assign (residue 7 and name h2'') (residue 8 and name h5) 1.8 0 3.2
assign (residue 7 and name h3') (residue 8 and name h5) 1.8 0 3.2
assign (residue 7 and name h5'') (residue 7 and name h8) 1.8 0 3.2
assign (residue 8 and name h1') (residue 7 and name h2) 1.8 0 3.2
assign (residue 8 and name h1') (residue 8 and name h6) 1.8 0 3.2
assign (residue 8 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 8 and name h6) 1.8 0 3.2
assign (residue 8 and name h2'') (residue 9 and name h5) 1.8 0 3.2
assign (residue 8 and name h5) (residue 9 and name h5) 1.8 0 3.2
assign (residue 9 and name h1') (residue 9 and name h6) 1.8 0 3.2
assign (residue 9 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 9 and name h1') (residue 41 and name h2) 1.8 0 3.2
assign (residue 10 and name h1') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 10 and name h1') (residue 39 and name h2) 1.8 0 3.2
assign (residue 10 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 10 and name h8) 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h1') 1.8 0 3.2
assign (residue 10 and name h2'') (residue 11 and name h5) 1.8 0 3.2
assign (residue 10 and name h3') (residue 11 and name h5) 1.8 0 3.2
assign (residue 10 and name h5'') (residue 10 and name h8) 1.8 0 3.2
assign (residue 11 and name h1') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 11 and name h2'') (residue 11 and name h6) 1.8 0 3.2
assign (residue 11 and name h5) (residue 10 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 12 and name h2) (residue 37 and name h2) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 12 and name h8) 1.8 0 3.2
assign (residue 12 and name h2'') (residue 13 and name h5) 1.8 0 3.2
assign (residue 12 and name h3') (residue 13 and name h5) 1.8 0 3.2
assign (residue 12 and name h5'') (residue 12 and name h8) 1.8 0 3.2
assign (residue 13 and name h1') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h1') (residue 14 and name h6) 1.8 0 3.2
assign (residue 13 and name h2'') (residue 13 and name h6) 1.8 0 3.2
assign (residue 13 and name h2'') (residue 14 and name h5) 1.8 0 3.2
assign (residue 13 and name h3') (residue 13 and name h5) 1.8 0 3.2
assign (residue 13 and name h3') (residue 14 and name h5) 1.8 0 3.2
assign (residue 13 and name h5) (residue 12 and name h8) 1.8 0 3.2
assign (residue 13 and name h5) (residue 14 and name h5) 1.8 0 3.2
assign (residue 14 and name h1') (residue 14 and name h6) 1.8 0 3.2
assign (residue 14 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 14 and name h5) (residue 13 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 17 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 17 and name h6) (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h1') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 18 and name h2) (residue 19 and name h2) 1.8 0 3.2
assign (residue 18 and name h4') (residue 18 and name h8) 1.8 0 3.2
assign (residue 18 and name h5'') (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 19 and name h8) 1.8 0 3.2
assign (residue 19 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 18 and name h8) 1.8 0 3.2
assign (residue 19 and name h8) (residue 20 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 20 and name h8) 1.8 0 3.2
assign (residue 20 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h1') 1.8 0 3.2
assign (residue 20 and name h2'') (residue 21 and name h5) 1.8 0 3.2
assign (residue 20 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h1') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h1') 1.8 0 3.2
assign (residue 21 and name h2'') (residue 22 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 21 and name h5) 1.8 0 3.2
assign (residue 21 and name h3') (residue 22 and name h6) 1.8 0 3.2
assign (residue 21 and name h5) (residue 20 and name h8) 1.8 0 3.2
assign (residue 21 and name h5') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h5'') (residue 21 and name h6) 1.8 0 3.2
assign (residue 21 and name h6) (residue 20 and name h8) 1.8 0 3.2
assign (residue 22 and name h1') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 22 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 22 and name h4') (residue 22 and name h6) 1.8 0 3.2
assign (residue 23 and name h1') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h2) (residue 24 and name h2) 1.8 0 3.2
assign (residue 23 and name h2'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h3') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 23 and name h8) 1.8 0 3.2
assign (residue 23 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 23 and name h5'') (residue 23 and name h8) 1.8 0 3.2
assign (residue 24 and name h1') (residue 23 and name h2) 1.8 0 3.2
assign (residue 24 and name h1') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h5'') (residue 24 and name h8) 1.8 0 3.2
assign (residue 24 and name h8) (residue 23 and name h8) 1.8 0 3.2
assign (residue 25 and name h1') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h4') (residue 26 and name h5) 1.8 0 3.2
assign (residue 25 and name h5') (residue 24 and name h3') 1.8 0 3.2
assign (residue 25 and name h5') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5'') (residue 25 and name h6) 1.8 0 3.2
assign (residue 25 and name h5'') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h1') (residue 22 and name h1') 1.8 0 3.2
assign (residue 26 and name h1') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 26 and name h4') (residue 24 and name h8) 1.8 0 3.2
assign (residue 26 and name h4') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 26 and name h5') (residue 26 and name h6) 1.8 0 3.2
assign (residue 26 and name h5'') (residue 25 and name h1') 1.8 0 3.2
assign (residue 27 and name h1') (residue 27 and name h6) 1.8 0 3.2
assign (residue 27 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 27 and name h5) 1.8 0 3.2
assign (residue 27 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 27 and name h3') (residue 28 and name h5) 1.8 0 3.2
assign (residue 28 and name h1') (residue 20 and name h2) 1.8 0 3.2
assign (residue 28 and name h1') (residue 28 and name h6) 1.8 0 3.2
assign (residue 28 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 28 and name h2'') (residue 28 and name h5) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h5) 1.8 0 3.2
assign (residue 28 and name h5) (residue 27 and name h6) 1.8 0 3.2
assign (residue 28 and name h6) (residue 20 and name h2) 1.8 0 3.2
assign (residue 29 and name h1') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 29 and name h5) (residue 28 and name h6) 1.8 0 3.2
assign (residue 29 and name h5'') (residue 29 and name h6) 1.8 0 3.2
assign (residue 29 and name h6) (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 30 and name h8) 1.8 0 3.2
assign (residue 30 and name h1') (residue 31 and name h8) 1.8 0 3.2
assign (residue 30 and name h2) (residue 18 and name h2) 1.8 0 3.2
assign (residue 30 and name h5'') (residue 30 and name h8) 1.8 0 3.2
assign (residue 31 and name h1') (residue 31 and name h8) 1.8 0 3.2
assign (residue 34 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 36 and name h5) 1.8 0 3.2
assign (residue 34 and name h3') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 35 and name h1') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h1') (residue 36 and name h6) 1.8 0 3.2
assign (residue 35 and name h2'') (residue 36 and name h6) 1.8 0 3.2
assign (residue 35 and name h4') (residue 36 and name h5) 1.8 0 3.2
assign (residue 36 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 36 and name h2'') (residue 36 and name h6) 1.8 0 3.2
assign (residue 36 and name h5) (residue 34 and name h1') 1.8 0 3.2
assign (residue 37 and name h1') (residue 12 and name h2) 1.8 0 3.2
assign (residue 37 and name h1') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 37 and name h8) 1.8 0 3.2
assign (residue 37 and name h2'') (residue 38 and name h1') 1.8 0 3.2
assign (residue 37 and name h2'') (residue 38 and name h5) 1.8 0 3.2
assign (residue 37 and name h3') (residue 38 and name h5) 1.8 0 3.2
assign (residue 38 and name h1') (residue 38 and name h6) 1.8 0 3.2
assign (residue 38 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 38 and name h2'') (residue 38 and name h6) 1.8 0 3.2
assign (residue 39 and name h1') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 39 and name h5'') (residue 39 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 39 and name h2) 1.8 0 3.2
assign (residue 40 and name h1') (residue 40 and name h8) 1.8 0 3.2
assign (residue 40 and name h1') (residue 41 and name h8) 1.8 0 3.2
assign (residue 40 and name h2'') (residue 41 and name h1') 1.8 0 3.2
assign (residue 40 and name h8) (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h1') (residue 40 and name h2) 1.8 0 3.2
assign (residue 41 and name h1') (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 41 and name h2'') (residue 41 and name h8) 1.8 0 3.2
assign (residue 41 and name h2'') (residue 42 and name h5) 1.8 0 3.2
assign (residue 42 and name h1') (residue 42 and name h6) 1.8 0 3.2
assign (residue 42 and name h1') (residue 43 and name h6) 1.8 0 3.2
assign (residue 42 and name h2'') (residue 42 and name h6) 1.8 0 3.2
assign (residue 42 and name h3') (residue 42 and name h5) 1.8 0 3.2
assign (residue 42 and name h3') (residue 43 and name h5) 1.8 0 3.2
assign (residue 42 and name h5) (residue 41 and name h1') 1.8 0 3.2
assign (residue 42 and name h5) (residue 43 and name h5) 1.8 0 3.2
assign (residue 43 and name h1') (residue 43 and name h6) 1.8 0 3.2
assign (residue 43 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 43 and name h2'') (residue 43 and name h6) 1.8 0 3.2
assign (residue 43 and name h3') (residue 44 and name h8) 1.8 0 3.2
assign (residue 43 and name h5) (residue 42 and name h6) 1.8 0 3.2
assign (residue 43 and name h5') (residue 43 and name h6) 1.8 0 3.2
assign (residue 43 and name h5'') (residue 43 and name h6) 1.8 0 3.2
assign (residue 44 and name h1') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h1') (residue 45 and name h8) 1.8 0 3.2
assign (residue 44 and name h2) (residue 45 and name h2) 1.8 0 3.2
assign (residue 44 and name h2'') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h3') (residue 45 and name h8) 1.8 0 3.2
assign (residue 44 and name h4') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h5') (residue 44 and name h8) 1.8 0 3.2
assign (residue 44 and name h5'') (residue 44 and name h8) 1.8 0 3.2
assign (residue 45 and name h1') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h1') (residue 46 and name h8) 1.8 0 3.2
assign (residue 45 and name h2) (residue 5 and name h6) 1.8 0 3.2
assign (residue 45 and name h2'') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h3') (residue 46 and name h8) 1.8 0 3.2
assign (residue 45 and name h4') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h5') (residue 45 and name h8) 1.8 0 3.2
assign (residue 45 and name h5'') (residue 45 and name h8) 1.8 0 3.2
assign (residue 46 and name h1') (residue 45 and name h2) 1.8 0 3.2
assign (residue 46 and name h1') (residue 46 and name h8) 1.8 0 3.2
assign (residue 46 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 46 and name h2'') (residue 47 and name h5) 1.8 0 3.2
assign (residue 46 and name h5') (residue 46 and name h8) 1.8 0 3.2
assign (residue 46 and name h5'') (residue 46 and name h8) 1.8 0 3.2
assign (residue 47 and name h1') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 47 and name h4') (residue 47 and name h6) 1.8 0 3.2
assign (residue 47 and name h5) (residue 48 and name h5) 1.8 0 3.2
assign (residue 47 and name h5'') (residue 47 and name h6) 1.8 0 3.2
assign (residue 48 and name h1') (residue 48 and name h6) 1.8 0 3.2
assign (residue 48 and name h2'') (residue 48 and name h6) 1.8 0 3.2
assign (residue 1 and name h1') (residue 2 and name h1') 1.8 0 4.7
assign (residue 1 and name h2'') (residue 2 and name h1') 1.8 0 4.7
assign (residue 1 and name h4') (residue 1 and name h8) 1.8 0 4.7
assign (residue 1 and name h5') (residue 1 and name h8) 1.8 0 4.7
assign (residue 1 and name h5'') (residue 1 and name h8) 1.8 0 4.7
assign (residue 2 and name h8) (residue 1 and name h8) 1.8 0 4.7
assign (residue 2 and name h8) (residue 3 and name h6) 1.8 0 4.7
assign (residue 3 and name h1') (residue 2 and name h1') 1.8 0 4.7
assign (residue 3 and name h2'') (residue 4 and name h5) 1.8 0 4.7
assign (residue 3 and name h3') (residue 3 and name h5) 1.8 0 4.7
assign (residue 3 and name h5) (residue 2 and name h1') 1.8 0 4.7
assign (residue 3 and name h5) (residue 2 and name h8) 1.8 0 4.7
assign (residue 3 and name h5) (residue 3 and name h1') 1.8 0 4.7
assign (residue 3 and name h5) (residue 4 and name h6) 1.8 0 4.7
assign (residue 4 and name h5) (residue 3 and name h1') 1.8 0 4.7
assign (residue 4 and name h5) (residue 3 and name h6) 1.8 0 4.7
assign (residue 4 and name h5) (residue 4 and name h1') 1.8 0 4.7
assign (residue 5 and name h1') (residue 44 and name h2) 1.8 0 4.7
assign (residue 5 and name h5) (residue 5 and name h1') 1.8 0 4.7
assign (residue 6 and name h1') (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h1') 1.8 0 4.7
assign (residue 8 and name h1') (residue 9 and name h5) 1.8 0 4.7
assign (residue 8 and name h2'') (residue 8 and name h5) 1.8 0 4.7
assign (residue 8 and name h3') (residue 8 and name h5) 1.8 0 4.7
assign (residue 8 and name h5) (residue 7 and name h1') 1.8 0 4.7
assign (residue 8 and name h5) (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h5) (residue 8 and name h1') 1.8 0 4.7
assign (residue 8 and name h5) (residue 9 and name h6) 1.8 0 4.7
assign (residue 8 and name h6) (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h6) (residue 9 and name h6) 1.8 0 4.7
assign (residue 9 and name h5) (residue 8 and name h6) 1.8 0 4.7
assign (residue 9 and name h5) (residue 9 and name h1') 1.8 0 4.7
assign (residue 10 and name h8) (residue 9 and name h6) 1.8 0 4.7
assign (residue 11 and name h1') (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 11 and name h2'') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h3') (residue 11 and name h5) 1.8 0 4.7
assign (residue 11 and name h5) (residue 10 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 11 and name h1') 1.8 0 4.7
assign (residue 11 and name h5) (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h1') (residue 12 and name h2) 1.8 0 4.7
assign (residue 12 and name h2) (residue 13 and name h6) 1.8 0 4.7
assign (residue 12 and name h2'') (residue 13 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 12 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 14 and name h1') 1.8 0 4.7
assign (residue 13 and name h1') (residue 14 and name h5) 1.8 0 4.7
assign (residue 13 and name h2'') (residue 13 and name h5) 1.8 0 4.7
assign (residue 13 and name h5) (residue 12 and name h1') 1.8 0 4.7
assign (residue 13 and name h5) (residue 13 and name h1') 1.8 0 4.7
assign (residue 13 and name h6) (residue 12 and name h8) 1.8 0 4.7
assign (residue 13 and name h6) (residue 14 and name h6) 1.8 0 4.7
assign (residue 14 and name h5) (residue 34 and name h2) 1.8 0 4.7
assign (residue 17 and name h1') (residue 18 and name h1') 1.8 0 4.7
assign (residue 17 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 17 and name h5) (residue 18 and name h8) 1.8 0 4.7
assign (residue 18 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 18 and name h2) (residue 19 and name h8) 1.8 0 4.7
assign (residue 19 and name h1') (residue 19 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h2) 1.8 0 4.7
assign (residue 19 and name h2) (residue 20 and name h8) 1.8 0 4.7
assign (residue 19 and name h2) (residue 29 and name h6) 1.8 0 4.7
assign (residue 21 and name h1') (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h1') 1.8 0 4.7
assign (residue 21 and name h1') (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h2'') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h4') (residue 21 and name h5) 1.8 0 4.7
assign (residue 21 and name h5) (residue 20 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 21 and name h1') 1.8 0 4.7
assign (residue 21 and name h5) (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h6) (residue 22 and name h6) 1.8 0 4.7
assign (residue 22 and name h1') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h3') (residue 22 and name h5) 1.8 0 4.7
assign (residue 22 and name h4') (residue 23 and name h8) 1.8 0 4.7
assign (residue 22 and name h5) (residue 21 and name h6) 1.8 0 4.7
assign (residue 23 and name h1') (residue 23 and name h2) 1.8 0 4.7
assign (residue 23 and name h1') (residue 24 and name h1') 1.8 0 4.7
assign (residue 23 and name h3') (residue 24 and name h1') 1.8 0 4.7
assign (residue 24 and name h1') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h2'') (residue 25 and name h1') 1.8 0 4.7
assign (residue 24 and name h3') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h5) 1.8 0 4.7
assign (residue 24 and name h3') (residue 26 and name h6) 1.8 0 4.7
assign (residue 24 and name h4') (residue 24 and name h8) 1.8 0 4.7
assign (residue 24 and name h4') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h1') (residue 24 and name h2) 1.8 0 4.7
assign (residue 25 and name h1') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h4') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 25 and name h5'') (residue 24 and name h3') 1.8 0 4.7
assign (residue 25 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h5) 1.8 0 4.7
assign (residue 26 and name h1') (residue 27 and name h6) 1.8 0 4.7
assign (residue 26 and name h2'') (residue 26 and name h5) 1.8 0 4.7
assign (residue 26 and name h5) (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h5) (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h5') (residue 25 and name h1') 1.8 0 4.7
assign (residue 26 and name h6) (residue 24 and name h8) 1.8 0 4.7
assign (residue 27 and name h1') (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 27 and name h5) (residue 28 and name h6) 1.8 0 4.7
assign (residue 27 and name h6) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h1') (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h1') (residue 28 and name h5) 1.8 0 4.7
assign (residue 28 and name h5) (residue 20 and name h2) 1.8 0 4.7
assign (residue 28 and name h5) (residue 27 and name h1') 1.8 0 4.7
assign (residue 28 and name h5) (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h1') (residue 18 and name h2) 1.8 0 4.7
assign (residue 29 and name h1') (residue 28 and name h1') 1.8 0 4.7
assign (residue 29 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 29 and name h5) (residue 28 and name h5) 1.8 0 4.7
assign (residue 29 and name h5) (residue 30 and name h8) 1.8 0 4.7
assign (residue 30 and name h1') (residue 30 and name h2) 1.8 0 4.7
assign (residue 30 and name h2) (residue 31 and name h8) 1.8 0 4.7
assign (residue 31 and name h1') (residue 30 and name h1') 1.8 0 4.7
assign (residue 31 and name h8) (residue 30 and name h8) 1.8 0 4.7
assign (residue 34 and name h1') (residue 34 and name h2) 1.8 0 4.7
assign (residue 34 and name h1') (residue 35 and name h6) 1.8 0 4.7
assign (residue 34 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 34 and name h2'') (residue 36 and name h6) 1.8 0 4.7
assign (residue 34 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h2'') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 35 and name h4') (residue 36 and name h6) 1.8 0 4.7
assign (residue 35 and name h6) (residue 36 and name h6) 1.8 0 4.7
assign (residue 36 and name h1') (residue 36 and name h6) 1.8 0 4.7
assign (residue 36 and name h3') (residue 36 and name h5) 1.8 0 4.7
assign (residue 36 and name h5) (residue 34 and name h2) 1.8 0 4.7
assign (residue 36 and name h6) (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h1') (residue 37 and name h2) 1.8 0 4.7
assign (residue 37 and name h3') (residue 38 and name h1') 1.8 0 4.7
assign (residue 37 and name h4') (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h5'') (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h1') (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h1') (residue 39 and name h1') 1.8 0 4.7
assign (residue 38 and name h2'') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h3') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h4') (residue 38 and name h5) 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h1') 1.8 0 4.7
assign (residue 38 and name h5) (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h5) (residue 39 and name h8) 1.8 0 4.7
assign (residue 38 and name h5'') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h6) (residue 37 and name h8) 1.8 0 4.7
assign (residue 38 and name h6) (residue 39 and name h8) 1.8 0 4.7
assign (residue 39 and name h2) (residue 40 and name h2) 1.8 0 4.7
assign (residue 40 and name h1') (residue 40 and name h2) 1.8 0 4.7
assign (residue 40 and name h1') (residue 41 and name h1') 1.8 0 4.7
assign (residue 42 and name h1') (residue 41 and name h1') 1.8 0 4.7
assign (residue 42 and name h1') (residue 43 and name h5) 1.8 0 4.7
assign (residue 42 and name h5) (residue 7 and name h2) 1.8 0 4.7
assign (residue 42 and name h5) (residue 41 and name h8) 1.8 0 4.7
assign (residue 42 and name h5) (residue 42 and name h1') 1.8 0 4.7
assign (residue 42 and name h5) (residue 43 and name h6) 1.8 0 4.7
assign (residue 42 and name h6) (residue 7 and name h2) 1.8 0 4.7
assign (residue 42 and name h6) (residue 41 and name h8) 1.8 0 4.7
assign (residue 42 and name h6) (residue 43 and name h6) 1.8 0 4.7
assign (residue 44 and name h2) (residue 6 and name h8) 1.8 0 4.7
assign (residue 44 and name h2) (residue 45 and name h8) 1.8 0 4.7
assign (residue 45 and name h1') (residue 45 and name h2) 1.8 0 4.7
assign (residue 45 and name h8) (residue 44 and name h8) 1.8 0 4.7
assign (residue 46 and name h8) (residue 45 and name h2) 1.8 0 4.7
assign (residue 46 and name h8) (residue 45 and name h8) 1.8 0 4.7
assign (residue 46 and name h8) (residue 47 and name h6) 1.8 0 4.7
assign (residue 47 and name h1') (residue 48 and name h1') 1.8 0 4.7
assign (residue 47 and name h2'') (residue 47 and name h5) 1.8 0 4.7
assign (residue 47 and name h5) (residue 46 and name h1') 1.8 0 4.7
assign (residue 47 and name h5) (residue 46 and name h8) 1.8 0 4.7
assign (residue 14 and name h2'') (residue 15 and name h8) 1.8 0.4 1.2
assign (residue 15 and name h2'') (residue 16 and name h6) 1.8 0.4 1.2
assign (residue 16 and name h2'') (residue 17 and name h6) 1.8 0.4 1.2
assign (residue 31 and name h2'') (residue 32 and name h6) 1.8 0.4 1.2
assign (residue 32 and name h2'') (residue 33 and name h8) 1.8 0.4 1.2
assign (residue 33 and name h2'') (residue 34 and name h8) 1.8 0.4 1.2
assign (residue 14 and name h3') (residue 15 and name h8) 1.8 0 2.2
assign (residue 15 and name h3') (residue 15 and name h8) 1.8 0 2.2
assign (residue 16 and name h1') (residue 15 and name h2) 1.8 0 2.2
assign (residue 16 and name h3') (residue 16 and name h6) 1.8 0 2.2
assign (residue 16 and name h3') (residue 17 and name h6) 1.8 0 2.2
assign (residue 17 and name h3') (residue 17 and name h6) 1.8 0 2.2
assign (residue 31 and name h3') (residue 32 and name h6) 1.8 0 2.2
assign (residue 32 and name h3') (residue 32 and name h6) 1.8 0 2.2
assign (residue 33 and name h1') (residue 15 and name h2) 1.8 0 2.2
assign (residue 33 and name h3') (residue 33 and name h8) 1.8 0 2.2
assign (residue 14 and name h1') (residue 15 and name h8) 1.8 0 3.2
assign (residue 14 and name h1') (residue 34 and name h2) 1.8 0 3.2
assign (residue 15 and name h1') (residue 15 and name h8) 1.8 0 3.2
assign (residue 15 and name h1') (residue 16 and name h6) 1.8 0 3.2
assign (residue 15 and name h1') (residue 33 and name h2) 1.8 0 3.2
assign (residue 15 and name h2'') (residue 16 and name h5) 1.8 0 3.2
assign (residue 15 and name h3') (residue 16 and name h5) 1.8 0 3.2
assign (residue 15 and name h3') (residue 16 and name h6) 1.8 0 3.2
assign (residue 16 and name h1') (residue 16 and name h6) 1.8 0 3.2
assign (residue 16 and name h1') (residue 17 and name h6) 1.8 0 3.2
assign (residue 16 and name h3') (residue 16 and name h5) 1.8 0 3.2
assign (residue 16 and name h5) (residue 15 and name h1') 1.8 0 3.2
assign (residue 16 and name h5) (residue 17 and name h5) 1.8 0 3.2
assign (residue 31 and name h1') (residue 32 and name h6) 1.8 0 3.2
assign (residue 31 and name h2'') (residue 32 and name h1') 1.8 0 3.2
assign (residue 31 and name h2'') (residue 32 and name h5) 1.8 0 3.2
assign (residue 32 and name h1') (residue 31 and name h2) 1.8 0 3.2
assign (residue 32 and name h1') (residue 32 and name h6) 1.8 0 3.2
assign (residue 32 and name h1') (residue 33 and name h8) 1.8 0 3.2
assign (residue 32 and name h2'') (residue 32 and name h6) 1.8 0 3.2
assign (residue 33 and name h1') (residue 33 and name h8) 1.8 0 3.2
assign (residue 33 and name h1') (residue 34 and name h8) 1.8 0 3.2
assign (residue 33 and name h3') (residue 34 and name h8) 1.8 0 3.2
assign (residue 34 and name h1') (residue 33 and name h2) 1.8 0 3.2
assign (residue 14 and name h1') (residue 15 and name h1') 1.8 0 4.7
assign (residue 14 and name h2'') (residue 15 and name h1') 1.8 0 4.7
assign (residue 14 and name h6) (residue 15 and name h8) 1.8 0 4.7
assign (residue 15 and name h1') (residue 15 and name h2) 1.8 0 4.7
assign (residue 15 and name h2'') (residue 15 and name h8) 1.8 0 4.7
assign (residue 15 and name h2'') (residue 16 and name h1') 1.8 0 4.7
assign (residue 15 and name h4') (residue 15 and name h8) 1.8 0 4.7
assign (residue 15 and name h5') (residue 15 and name h8) 1.8 0 4.7
assign (residue 15 and name h5'') (residue 15 and name h8) 1.8 0 4.7
assign (residue 16 and name h1') (residue 15 and name h1') 1.8 0 4.7
assign (residue 16 and name h1') (residue 17 and name h5) 1.8 0 4.7
assign (residue 16 and name h2'') (residue 16 and name h6) 1.8 0 4.7
assign (residue 16 and name h2'') (residue 17 and name h1') 1.8 0 4.7
assign (residue 16 and name h5) (residue 15 and name h2) 1.8 0 4.7
assign (residue 16 and name h5) (residue 15 and name h8) 1.8 0 4.7
assign (residue 16 and name h5) (residue 16 and name h1') 1.8 0 4.7
assign (residue 16 and name h6) (residue 15 and name h8) 1.8 0 4.7
assign (residue 17 and name h2'') (residue 17 and name h6) 1.8 0 4.7
assign (residue 17 and name h5) (residue 16 and name h6) 1.8 0 4.7
assign (residue 31 and name h3') (residue 32 and name h1') 1.8 0 4.7
assign (residue 31 and name h3') (residue 32 and name h5) 1.8 0 4.7
assign (residue 32 and name h5) (residue 31 and name h1') 1.8 0 4.7
assign (residue 32 and name h5) (residue 31 and name h8) 1.8 0 4.7
assign (residue 32 and name h5) (residue 32 and name h1') 1.8 0 4.7
assign (residue 32 and name h5) (residue 33 and name h8) 1.8 0 4.7
assign (residue 32 and name h5'') (residue 32 and name h6) 1.8 0 4.7
assign (residue 32 and name h6) (residue 31 and name h8) 1.8 0 4.7
assign (residue 32 and name h6) (residue 33 and name h8) 1.8 0 4.7
assign (residue 33 and name h1') (residue 33 and name h2) 1.8 0 4.7
assign (residue 33 and name h2) (residue 15 and name h2) 1.8 0 4.7
assign (residue 33 and name h2) (residue 34 and name h2) 1.8 0 4.7
assign (residue 34 and name h8) (residue 33 and name h8) 1.8 0 4.7
assign (residue 2 and name h2'') (residue 3 and name h6) 1.8 0.4 1.2
assign (residue 27 and name h2'') (residue 28 and name h6) 1.8 0.4 1.2
assign (residue 30 and name h2'') (residue 31 and name h8) 1.8 0.4 1.2
assign (residue 39 and name h2'') (residue 40 and name h8) 1.8 0.4 1.2
assign (residue 3 and name h3') (residue 3 and name h6) 1.8 0 2.2
assign (residue 3 and name h3') (residue 4 and name h6) 1.8 0 2.2
assign (residue 20 and name h2'') (residue 20 and name h8) 1.8 0 2.2
assign (residue 20 and name h3') (residue 20 and name h8) 1.8 0 2.2
assign (residue 20 and name h3') (residue 21 and name h6) 1.8 0 2.2
assign (residue 25 and name h4') (residue 26 and name h6) 1.8 0 2.2
assign (residue 27 and name h2'') (residue 27 and name h6) 1.8 0 2.2
assign (residue 28 and name h3') (residue 28 and name h6) 1.8 0 2.2
assign (residue 28 and name h3') (residue 29 and name h6) 1.8 0 2.2
assign (residue 38 and name h3') (residue 39 and name h8) 1.8 0 2.2
assign (residue 47 and name h3') (residue 47 and name h6) 1.8 0 2.2
assign (residue 2 and name h4') (residue 2 and name h8) 1.8 0 3.2
assign (residue 3 and name h4') (residue 3 and name h6) 1.8 0 3.2
assign (residue 4 and name h4') (residue 4 and name h6) 1.8 0 3.2
assign (residue 5 and name h3') (residue 5 and name h5) 1.8 0 3.2
assign (residue 5 and name h2'') (residue 5 and name h6) 1.8 0 3.2
assign (residue 5 and name h4') (residue 5 and name h6) 1.8 0 3.2
assign (residue 22 and name h5') (residue 22 and name h6) 1.8 0 3.2
assign (residue 22 and name h5'') (residue 22 and name h6) 1.8 0 3.2
assign (residue 25 and name h3') (residue 26 and name h6) 1.8 0 3.2
assign (residue 27 and name h4') (residue 27 and name h6) 1.8 0 3.2
assign (residue 28 and name h4') (residue 28 and name h6) 1.8 0 3.2
assign (residue 34 and name h2'') (residue 35 and name h6) 1.8 0 3.2
assign (residue 35 and name h4') (residue 35 and name h6) 1.8 0 3.2
assign (residue 36 and name h4') (residue 36 and name h6) 1.8 0 3.2
assign (residue 38 and name h4') (residue 38 and name h6) 1.8 0 3.2
assign (residue 39 and name h4') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h5') (residue 39 and name h8) 1.8 0 3.2
assign (residue 39 and name h4') (residue 40 and name h8) 1.8 0 3.2
assign (residue 40 and name h4') (residue 40 and name h8) 1.8 0 3.2
assign (residue 41 and name h4') (residue 41 and name h8) 1.8 0 3.2
assign (residue 43 and name h4') (residue 43 and name h6) 1.8 0 3.2
assign (residue 46 and name h4') (residue 46 and name h8) 1.8 0 3.2
assign (residue 47 and name h4') (residue 47 and name h6) 1.8 0 3.2
assign (residue 48 and name h4') (residue 48 and name h6) 1.8 0 3.2
assign (residue 2 and name h5') (residue 2 and name h8) 1.8 0 4.7
assign (residue 2 and name h5'') (residue 2 and name h8) 1.8 0 4.7
assign (residue 4 and name h4') (residue 5 and name h6) 1.8 0 4.7
assign (residue 6 and name h4') (residue 6 and name h8) 1.8 0 4.7
assign (residue 6 and name h5') (residue 6 and name h8) 1.8 0 4.7
assign (residue 6 and name h5'') (residue 6 and name h8) 1.8 0 4.7
assign (residue 6 and name h4') (residue 7 and name h8) 1.8 0 4.7
assign (residue 7 and name h4') (residue 7 and name h8) 1.8 0 4.7
assign (residue 7 and name h5') (residue 7 and name h8) 1.8 0 4.7
assign (residue 8 and name h4') (residue 8 and name h6) 1.8 0 4.7
assign (residue 8 and name h4') (residue 9 and name h6) 1.8 0 4.7
assign (residue 9 and name h4') (residue 9 and name h6) 1.8 0 4.7
assign (residue 10 and name h4') (residue 10 and name h8) 1.8 0 4.7
assign (residue 10 and name h5') (residue 10 and name h8) 1.8 0 4.7
assign (residue 11 and name h4') (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h4') (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h5') (residue 12 and name h8) 1.8 0 4.7
assign (residue 12 and name h4') (residue 13 and name h6) 1.8 0 4.7
assign (residue 13 and name h4') (residue 13 and name h6) 1.8 0 4.7
assign (residue 13 and name h4') (residue 14 and name h6) 1.8 0 4.7
assign (residue 14 and name h4') (residue 14 and name h6) 1.8 0 4.7
assign (residue 17 and name h4') (residue 17 and name h6) 1.8 0 4.7
assign (residue 17 and name h4') (residue 18 and name h8) 1.8 0 4.7
assign (residue 18 and name h4') (residue 18 and name h8) 1.8 0 4.7
assign (residue 18 and name h5') (residue 18 and name h8) 1.8 0 4.7
assign (residue 19 and name h4') (residue 19 and name h8) 1.8 0 4.7
assign (residue 20 and name h4') (residue 21 and name h6) 1.8 0 4.7
assign (residue 21 and name h4') (residue 21 and name h6) 1.8 0 4.7
assign (residue 21 and name h3') (residue 22 and name h5) 1.8 0 4.7
assign (residue 21 and name h4') (residue 22 and name h6) 1.8 0 4.7
assign (residue 23 and name h5') (residue 23 and name h8) 1.8 0 4.7
assign (residue 25 and name h2'') (residue 24 and name h3') 1.8 0 4.7
assign (residue 24 and name h5') (residue 24 and name h8) 1.8 0 4.7
assign (residue 26 and name h4') (residue 25 and name h3') 1.8 0 4.7
assign (residue 24 and name h2'') (residue 25 and name h6) 1.8 0 4.7
assign (residue 24 and name h4') (residue 25 and name h6) 1.8 0 4.7
assign (residue 25 and name h3') (residue 26 and name h4') 1.8 0 4.7
assign (residue 25 and name h3') (residue 26 and name h5) 1.8 0 4.7
assign (residue 25 and name h5') (residue 26 and name h5) 1.8 0 4.7
assign (residue 25 and name h5'') (residue 26 and name h5) 1.8 0 4.7
assign (residue 24 and name h2'') (residue 26 and name h6) 1.8 0 4.7
assign (residue 25 and name h5') (residue 26 and name h6) 1.8 0 4.7
assign (residue 27 and name h3') (residue 27 and name h5) 1.8 0 4.7
assign (residue 26 and name h4') (residue 27 and name h6) 1.8 0 4.7
assign (residue 27 and name h5') (residue 27 and name h6) 1.8 0 4.7
assign (residue 27 and name h5'') (residue 27 and name h6) 1.8 0 4.7
assign (residue 28 and name h3') (residue 28 and name h5) 1.8 0 4.7
assign (residue 28 and name h4') (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h4') (residue 29 and name h6) 1.8 0 4.7
assign (residue 29 and name h5') (residue 29 and name h6) 1.8 0 4.7
assign (residue 30 and name h4') (residue 30 and name h8) 1.8 0 4.7
assign (residue 30 and name h5') (residue 30 and name h8) 1.8 0 4.7
assign (residue 31 and name h4') (residue 31 and name h8) 1.8 0 4.7
assign (residue 34 and name h4') (residue 34 and name h8) 1.8 0 4.7
assign (residue 36 and name h2'') (residue 36 and name h5) 1.8 0 4.7
assign (residue 36 and name h4') (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h5') (residue 37 and name h8) 1.8 0 4.7
assign (residue 37 and name h4') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h5') (residue 38 and name h6) 1.8 0 4.7
assign (residue 38 and name h4') (residue 39 and name h8) 1.8 0 4.7
assign (residue 40 and name h5') (residue 40 and name h8) 1.8 0 4.7
assign (residue 40 and name h5'') (residue 40 and name h8) 1.8 0 4.7
assign (residue 41 and name h3') (residue 42 and name h5) 1.8 0 4.7
assign (residue 42 and name h2'') (residue 42 and name h5) 1.8 0 4.7
assign (residue 41 and name h4') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h4') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h5') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h5'') (residue 42 and name h6) 1.8 0 4.7
assign (residue 42 and name h4') (residue 43 and name h6) 1.8 0 4.7
assign (residue 43 and name h4') (residue 44 and name h8) 1.8 0 4.7
assign (residue 44 and name h4') (residue 45 and name h8) 1.8 0 4.7
assign (residue 45 and name h4') (residue 46 and name h8) 1.8 0 4.7
assign (residue 46 and name h2'') (residue 46 and name h8) 1.8 0 4.7
assign (residue 46 and name h3') (residue 47 and name h5) 1.8 0 4.7
assign (residue 47 and name h3') (residue 47 and name h5) 1.8 0 4.7
assign (residue 47 and name h5') (residue 47 and name h6) 1.8 0 4.7
assign (residue 47 and name h5'') (residue 47 and name h6) 1.8 0 4.7
assign (residue 48 and name h2'') (residue 48 and name h5) 1.8 0 4.7
assign (residue 47 and name h4') (residue 48 and name h6) 1.8 0 4.7
assign (residue 48 and name h5') (residue 48 and name h6) 1.8 0 4.7
assign (residue 48 and name h5'') (residue 48 and name h6) 1.8 0 4.7
{NOE-H2O}
assign (residue 3 and name h41) (residue 46 and name h1) 1.8 0 1.7
assign (residue 3 and name h42) (residue 46 and name h1) 1.8 0 1.7
assign (residue 18 and name h2) (residue 29 and name h3) 1.8 0 1.7
assign (residue 30 and name h2) (residue 17 and name h3) 1.8 0 1.7
assign (residue 37 and name h2) (residue 11 and name h3) 1.8 0 1.7
assign (residue 38 and name h41) (residue 10 and name h1) 1.8 0 1.7
assign (residue 38 and name h42) (residue 10 and name h1) 1.8 0 1.7
assign (residue 40 and name h2) (residue 9 and name h3) 1.8 0 1.7
assign (residue 41 and name h2) (residue 8 and name h3) 1.8 0 1.7
assign (residue 44 and name h2) (residue 5 and name h3) 1.8 0 1.7
assign (residue 45 and name h2) (residue 4 and name h3) 1.8 0 1.7
assign (residue 47 and name h41) (residue 2 and name h1) 1.8 0 1.7
assign (residue 47 and name h42) (residue 2 and name h1) 1.8 0 1.7
assign (residue 7 and name h2) (residue 42 and name h3) 1.8 0 2.7
assign (residue 12 and name h2) (residue 36 and name h3) 1.8 0 2.7
assign (residue 19 and name h2) (residue 28 and name h3) 1.8 0 2.7
assign (residue 31 and name h2) (residue 17 and name h3) 1.8 0 2.7
assign (residue 34 and name h2) (residue 13 and name h3) 1.8 0 2.7
assign (residue 45 and name h2) (residue 5 and name h3) 1.8 0 2.7
assign (residue 2 and name h1) (residue 46 and name h1) 1.8 0 4.2
assign (residue 3 and name h5) (residue 46 and name h1) 1.8 0 4.2
assign (residue 4 and name h1') (residue 46 and name h1) 1.8 0 4.2
assign (residue 5 and name h1') (residue 4 and name h3) 1.8 0 4.2
assign (residue 5 and name h3) (residue 4 and name h3) 1.8 0 4.2
assign (residue 6 and name h1') (residue 5 and name h3) 1.8 0 4.2
assign (residue 6 and name h22) (residue 43 and name h3) 1.8 0 4.2
assign (residue 6 and name h8) (residue 5 and name h3) 1.8 0 4.2
assign (residue 7 and name h2) (residue 6 and name h1) 1.8 0 4.2
assign (residue 8 and name h1') (residue 42 and name h3) 1.8 0 4.2
assign (residue 9 and name h1') (residue 8 and name h3) 1.8 0 4.2
assign (residue 11 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 11 and name h3) (residue 10 and name h1) 1.8 0 4.2
assign (residue 18 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 18 and name h8) (residue 17 and name h3) 1.8 0 4.2
assign (residue 19 and name h1') (residue 29 and name h3) 1.8 0 4.2
assign (residue 31 and name h1') (residue 17 and name h3) 1.8 0 4.2
assign (residue 38 and name h5) (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h1') (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h2) (residue 10 and name h1) 1.8 0 4.2
assign (residue 39 and name h8) (residue 10 and name h1) 1.8 0 4.2
assign (residue 44 and name h8) (residue 6 and name h1) 1.8 0 4.2
assign (residue 46 and name h1) (residue 4 and name h3) 1.8 0 4.2
assign (residue 47 and name h1') (residue 46 and name h1) 1.8 0 4.2
assign (residue 47 and name h5) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h1') (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h41) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h5) (residue 2 and name h1) 1.8 0 4.2
assign (residue 48 and name h5) (residue 47 and name h41) 1.8 0 4.2
assign (residue 48 and name h6) (residue 2 and name h1) 1.8 0 4.2
assign (residue 3 and name h41) (residue 4 and name h3) 3.5 0 3.0
assign (residue 3 and name h42) (residue 4 and name h3) 3.5 0 3.0
assign (residue 3 and name h5) (residue 2 and name h1) 3.5 0 3.0
assign (residue 4 and name h5) (residue 3 and name h41) 3.5 0 3.0
assign (residue 4 and name h6) (residue 46 and name h1) 3.5 0 3.0
assign (residue 5 and name h1') (residue 5 and name h3) 3.5 0 3.0
assign (residue 6 and name h22) (residue 42 and name h3) 3.5 0 3.0
assign (residue 7 and name h8) (residue 6 and name h1) 3.5 0 3.0
assign (residue 10 and name h8) (residue 9 and name h3) 3.5 0 3.0
assign (residue 17 and name h1') (residue 17 and name h3) 3.5 0 3.0
assign (residue 37 and name h2) (residue 10 and name h1) 3.5 0 3.0
assign (residue 39 and name h2) (residue 9 and name h3) 3.5 0 3.0
assign (residue 43 and name h1') (residue 6 and name h1) 3.5 0 3.0
assign (residue 44 and name h2) (residue 4 and name h3) 3.5 0 3.0
assign (residue 44 and name h2) (residue 6 and name h1) 3.5 0 3.0
assign (residue 45 and name h1') (residue 5 and name h3) 3.5 0 3.0
assign (residue 45 and name h2) (residue 46 and name h1) 3.5 0 3.0
assign (residue 47 and name h5) (residue 46 and name h1) 3.5 0 3.0
assign (residue 47 and name h6) (residue 2 and name h1) 3.5 0 3.0
assign (residue 15 and name h2) (residue 32 and name h3) 1.8 0 1.7
assign (residue 31 and name h2) (residue 16 and name h3) 1.8 0 1.7
assign (residue 33 and name h2) (residue 14 and name h3) 1.8 0 1.7
assign (residue 32 and name h3) (residue 16 and name h3) 1.8 0 2.7
assign (residue 15 and name h2) (residue 14 and name h3) 1.8 0 4.2
assign (residue 15 and name h2) (residue 16 and name h3) 1.8 0 4.2
assign (residue 16 and name h1') (residue 32 and name h3) 1.8 0 4.2
assign (residue 16 and name h5) (residue 32 and name h3) 1.8 0 4.2
assign (residue 17 and name h3) (residue 16 and name h3) 1.8 0 4.2
assign (residue 17 and name h5) (residue 16 and name h3) 1.8 0 4.2
assign (residue 30 and name h2) (residue 16 and name h3) 1.8 0 4.2
assign (residue 32 and name h1') (residue 16 and name h3) 1.8 0 4.2
assign (residue 32 and name h5) (residue 16 and name h3) 1.8 0 4.2
assign (residue 33 and name h1') (residue 32 and name h3) 1.8 0 4.2
assign (residue 33 and name h2) (residue 32 and name h3) 1.8 0 4.2
assign (residue 17 and name h1') (residue 16 and name h3) 3.0 0 3.5
assign (residue 32 and name h1') (residue 32 and name h3) 3.0 0 3.5
{hydrogen bonds}
assign (residue 1 and name n1) (residue 48 and name n3) 2.8 0.2 0.2
assign (residue 2 and name n1) (residue 47 and name n3) 2.8 0.2 0.2
assign (residue 46 and name n1) (residue 3 and name n3) 2.8 0.2 0.2
assign (residue 4 and name n3) (residue 45 and name n1) 2.8 0.2 0.2
assign (residue 5 and name n3) (residue 44 and name n1) 2.8 0.2 0.2
assign (residue 42 and name n3) (residue 7 and name n1) 2.8 0.2 0.2
assign (residue 8 and name n3) (residue 41 and name n1) 2.8 0.2 0.2
assign (residue 9 and name n3) (residue 40 and name n1) 2.8 0.2 0.2
assign (residue 10 and name n1) (residue 38 and name n3) 2.8 0.2 0.2
assign (residue 11 and name n3) (residue 37 and name n1) 2.8 0.2 0.2
assign (residue 13 and name n3) (residue 34 and name n1) 2.8 0.2 0.2
assign (residue 14 and name n3) (residue 33 and name n1) 2.8 0.2 0.2
assign (residue 32 and name n3) (residue 15 and name n1) 2.8 0.2 0.2
assign (residue 16 and name n3) (residue 31 and name n1) 2.8 0.2 0.2
assign (residue 17 and name n3) (residue 30 and name n1) 2.8 0.2 0.2
assign (residue 29 and name n3) (residue 18 and name n1) 2.8 0.2 0.2
assign (residue 28 and name n3) (residue 19 and name n1) 2.8 0.2 0.2
{torsion angles}
assign (residue 1 and name c4') (residue 1 and name o4')
       (residue 1 and name c1') (residue 1 and name c2') 2 0 15 2
assign (residue 1 and name o4') (residue 1 and name c1')
       (residue 1 and name c2') (residue 1 and name c3') 2 -22 15 2
assign (residue 1 and name c1') (residue 1 and name c2')
       (residue 1 and name c3') (residue 1 and name c4') 2 36 15 2
assign (residue 1 and name c2') (residue 1 and name c3')
       (residue 1 and name c4') (residue 1 and name o4') 2 -36 15 2

assign (residue 2 and name c4') (residue 2 and name o4')
       (residue 2 and name c1') (residue 2 and name c2') 2 0 15 2
assign (residue 2 and name o4') (residue 2 and name c1') 
       (residue 2 and name c2') (residue 2 and name c3') 2 -22 15 2
assign (residue 2 and name c1') (residue 2 and name c2') 
       (residue 2 and name c3') (residue 2 and name c4') 2 36 15 2
assign (residue 2 and name c2') (residue 2 and name c3') 
       (residue 2 and name c4') (residue 2 and name o4') 2 -36 15 2

assign (residue 3 and name c4') (residue 3 and name o4') 
       (residue 3 and name c1') (residue 3 and name c2') 2 0 15 2
assign (residue 3 and name o4') (residue 3 and name c1') 
       (residue 3 and name c2') (residue 3 and name c3') 2 -22 15 2
assign (residue 3 and name c1') (residue 3 and name c2') 
       (residue 3 and name c3') (residue 3 and name c4') 2 36 15 2
assign (residue 3 and name c2') (residue 3 and name c3') 
       (residue 3 and name c4') (residue 3 and name o4') 2 -36 15 2

assign (residue 4 and name c4') (residue 4 and name o4') 
       (residue 4 and name c1') (residue 4 and name c2') 2 0 15 2
assign (residue 4 and name o4') (residue 4 and name c1') 
       (residue 4 and name c2') (residue 4 and name c3') 2 -22 15 2
assign (residue 4 and name c1') (residue 4 and name c2') 
       (residue 4 and name c3') (residue 4 and name c4') 2 36 15 2
assign (residue 4 and name c2') (residue 4 and name c3') 
       (residue 4 and name c4') (residue 4 and name o4') 2 -36 15 2

assign (residue 5 and name c4') (residue 5 and name o4') 
       (residue 5 and name c1') (residue 5 and name c2') 2 0 15 2
assign (residue 5 and name o4') (residue 5 and name c1') 
       (residue 5 and name c2') (residue 5 and name c3') 2 -22 15 2
assign (residue 5 and name c1') (residue 5 and name c2') 
       (residue 5 and name c3') (residue 5 and name c4') 2 36 15 2
assign (residue 5 and name c2') (residue 5 and name c3') 
       (residue 5 and name c4') (residue 5 and name o4') 2 -36 15 2

assign (residue 6 and name c4') (residue 6 and name o4')
       (residue 6 and name c1') (residue 6 and name c2') 2 0 15 2
assign (residue 6 and name o4') (residue 6 and name c1')
       (residue 6 and name c2') (residue 6 and name c3') 2 -22 15 2
assign (residue 6 and name c1') (residue 6 and name c2')
       (residue 6 and name c3') (residue 6 and name c4') 2 36 15 2
assign (residue 6 and name c2') (residue 6 and name c3')
       (residue 6 and name c4') (residue 6 and name o4') 2 -36 15 2

assign (residue 7 and name c4') (residue 7 and name o4')
       (residue 7 and name c1') (residue 7 and name c2') 2 0 15 2
assign (residue 7 and name o4') (residue 7 and name c1')
       (residue 7 and name c2') (residue 7 and name c3') 2 -22 15 2
assign (residue 7 and name c1') (residue 7 and name c2')
       (residue 7 and name c3') (residue 7 and name c4') 2 36 15 2
assign (residue 7 and name c2') (residue 7 and name c3')
       (residue 7 and name c4') (residue 7 and name o4') 2 -36 15 2

assign (residue 8 and name c4') (residue 8 and name o4')
       (residue 8 and name c1') (residue 8 and name c2') 2 0 15 2
assign (residue 8 and name o4') (residue 8 and name c1') 
       (residue 8 and name c2') (residue 8 and name c3') 2 -22 15 2
assign (residue 8 and name c1') (residue 8 and name c2') 
       (residue 8 and name c3') (residue 8 and name c4') 2 36 15 2
assign (residue 8 and name c2') (residue 8 and name c3') 
       (residue 8 and name c4') (residue 8 and name o4') 2 -36 15 2

assign (residue 9 and name c4') (residue 9 and name o4')
       (residue 9 and name c1') (residue 9 and name c2') 2 0 15 2
assign (residue 9 and name o4') (residue 9 and name c1') 
       (residue 9 and name c2') (residue 9 and name c3') 2 -22 15 2
assign (residue 9 and name c1') (residue 9 and name c2') 
       (residue 9 and name c3') (residue 9 and name c4') 2 36 15 2
assign (residue 9 and name c2') (residue 9 and name c3') 
       (residue 9 and name c4') (residue 9 and name o4') 2 -36 15 2

assign (residue 10 and name c4') (residue 10 and name o4') 
       (residue 10 and name c1') (residue 10 and name c2') 2 0 15 2 
assign (residue 10 and name o4') (residue 10 and name c1') 
       (residue 10 and name c2') (residue 10 and name c3')  2 -22 15 2
assign (residue 10 and name c1') (residue 10 and name c2') 
       (residue 10 and name c3') (residue 10 and name c4') 2 36 15 2
assign (residue 10 and name c2') (residue 10 and name c3') 
       (residue 10 and name c4') (residue 10 and name o4') 2 -36 15 2

assign (residue 11 and name c4') (residue 11 and name o4')
       (residue 11 and name c1') (residue 11 and name c2') 2 0 15 2
assign (residue 11 and name o4') (residue 11 and name c1')
       (residue 11 and name c2') (residue 11 and name c3')  2 -22 15 2
assign (residue 11 and name c1') (residue 11 and name c2')
       (residue 11 and name c3') (residue 11 and name c4') 2 36 15 2
assign (residue 11 and name c2') (residue 11 and name c3')
       (residue 11 and name c4') (residue 11 and name o4') 2 -36 15 2

assign (residue 12 and name c4') (residue 12 and name o4') 
       (residue 12 and name c1') (residue 12 and name c2') 2 0 15 2 
assign (residue 12 and name o4') (residue 12 and name c1') 
       (residue 12 and name c2') (residue 12 and name c3')  2 -22 15 2
assign (residue 12 and name c1') (residue 12 and name c2') 
       (residue 12 and name c3') (residue 12 and name c4') 2 36 15 2
assign (residue 12 and name c2') (residue 12 and name c3') 
       (residue 12 and name c4') (residue 12 and name o4') 2 -36 15 2

assign (residue 13 and name c4') (residue 13 and name o4')
       (residue 13 and name c1') (residue 13 and name c2') 2 0 15 2
assign (residue 13 and name o4') (residue 13 and name c1')
       (residue 13 and name c2') (residue 13 and name c3') 2 -22 15 2
assign (residue 13 and name c1') (residue 13 and name c2')
       (residue 13 and name c3') (residue 13 and name c4') 2 36 15 2
assign (residue 13 and name c2') (residue 13 and name c3')
       (residue 13 and name c4') (residue 13 and name o4') 2 -36 15 2

assign (residue 14 and name c4') (residue 14 and name o4')
       (residue 14 and name c1') (residue 14 and name c2') 2 0 15 2
assign (residue 14 and name o4') (residue 14 and name c1')
       (residue 14 and name c2') (residue 14 and name c3') 2 -22 15 2
assign (residue 14 and name c1') (residue 14 and name c2')
       (residue 14 and name c3') (residue 14 and name c4') 2 36 15 2
assign (residue 14 and name c2') (residue 14 and name c3')
       (residue 14 and name c4') (residue 14 and name o4') 2 -36 15 2

assign (residue 15 and name c4') (residue 15 and name o4')
       (residue 15 and name c1') (residue 15 and name c2') 2 0 15 2
assign (residue 15 and name o4') (residue 15 and name c1')
       (residue 15 and name c2') (residue 15 and name c3') 2 -22 15 2
assign (residue 15 and name c1') (residue 15 and name c2')
       (residue 15 and name c3') (residue 15 and name c4') 2 36 15 2
assign (residue 15 and name c2') (residue 15 and name c3')
       (residue 15 and name c4') (residue 15 and name o4') 2 -36 15 2

assign (residue 16 and name c4') (residue 16 and name o4')
       (residue 16 and name c1') (residue 16 and name c2') 2 0 15 2
assign (residue 16 and name o4') (residue 16 and name c1')
       (residue 16 and name c2') (residue 16 and name c3') 2 -22 15 2
assign (residue 16 and name c1') (residue 16 and name c2')
       (residue 16 and name c3') (residue 16 and name c4') 2 36 15 2
assign (residue 16 and name c2') (residue 16 and name c3')
       (residue 16 and name c4') (residue 16 and name o4') 2 -36 15 2

assign (residue 17 and name c4') (residue 17 and name o4')
       (residue 17 and name c1') (residue 17 and name c2') 2 0 15 2
assign (residue 17 and name o4') (residue 17 and name c1')
       (residue 17 and name c2') (residue 17 and name c3') 2 -22 15 2
assign (residue 17 and name c1') (residue 17 and name c2')
       (residue 17 and name c3') (residue 17 and name c4') 2 36 15 2
assign (residue 17 and name c2') (residue 17 and name c3')
       (residue 17 and name c4') (residue 17 and name o4') 2 -36 15 2

assign (residue 18 and name c4') (residue 18 and name o4')
       (residue 18 and name c1') (residue 18 and name c2') 2 0 15 2
assign (residue 18 and name o4') (residue 18 and name c1')
       (residue 18 and name c2') (residue 18 and name c3') 2 -22 15 2
assign (residue 18 and name c1') (residue 18 and name c2')
       (residue 18 and name c3') (residue 18 and name c4') 2 36 15 2
assign (residue 18 and name c2') (residue 18 and name c3')
       (residue 18 and name c4') (residue 18 and name o4') 2 -36 15 2

assign (residue 19 and name c4') (residue 19 and name o4')
       (residue 19 and name c1') (residue 19 and name c2') 2 0 15 2
assign (residue 19 and name o4') (residue 19 and name c1')
       (residue 19 and name c2') (residue 19 and name c3') 2 -22 15 2
assign (residue 19 and name c1') (residue 19 and name c2')
       (residue 19 and name c3') (residue 19 and name c4') 2 36 15 2
assign (residue 19 and name c2') (residue 19 and name c3')
       (residue 19 and name c4') (residue 19 and name o4') 2 -36 15 2

assign (residue 20 and name c4') (residue 20 and name o4')
       (residue 20 and name c1') (residue 20 and name c2') 2 0 15 2
assign (residue 20 and name o4') (residue 20 and name c1')
       (residue 20 and name c2') (residue 20 and name c3') 2 -22 15 2
assign (residue 20 and name c1') (residue 20 and name c2')
       (residue 20 and name c3') (residue 20 and name c4') 2 36 15 2
assign (residue 20 and name c2') (residue 20 and name c3')
       (residue 20 and name c4') (residue 20 and name o4') 2 -36 15 2

assign (residue 21 and name c4') (residue 21 and name o4')
       (residue 21 and name c1') (residue 21 and name c2') 2 0 15 2
assign (residue 21 and name o4') (residue 21 and name c1')
       (residue 21 and name c2') (residue 21 and name c3') 2 -22 15 2
assign (residue 21 and name c1') (residue 21 and name c2')
       (residue 21 and name c3') (residue 21 and name c4') 2 36 15 2
assign (residue 21 and name c2') (residue 21 and name c3')
       (residue 21 and name c4') (residue 21 and name o4') 2 -36 15 2

assign (residue 26 and name c4') (residue 26 and name o4') 
       (residue 26 and name c1') (residue 26 and name c2') 2 0 15 2
assign (residue 26 and name o4') (residue 26 and name c1') 
       (residue 26 and name c2') (residue 26 and name c3') 2 -22 15 2
assign (residue 26 and name c1') (residue 26 and name c2') 
       (residue 26 and name c3') (residue 26 and name c4') 2 36 15 2
assign (residue 26 and name c2') (residue 26 and name c3') 
       (residue 26 and name c4') (residue 26 and name o4') 2 -36 15 2

assign (residue 27 and name c4') (residue 27 and name o4')
       (residue 27 and name c1') (residue 27 and name c2') 2 0 15 2
assign (residue 27 and name o4') (residue 27 and name c1')
       (residue 27 and name c2') (residue 27 and name c3') 2 -22 15 2
assign (residue 27 and name c1') (residue 27 and name c2')
       (residue 27 and name c3') (residue 27 and name c4') 2 36 15 2
assign (residue 27 and name c2') (residue 27 and name c3')
       (residue 27 and name c4') (residue 27 and name o4') 2 -36 15 2

assign (residue 28 and name c4') (residue 28 and name o4') 
       (residue 28 and name c1') (residue 28 and name c2') 2 0 15 2
assign (residue 28 and name o4') (residue 28 and name c1') 
       (residue 28 and name c2') (residue 28 and name c3') 2 -22 15 2
assign (residue 28 and name c1') (residue 28 and name c2') 
       (residue 28 and name c3') (residue 28 and name c4') 2 36 15 2
assign (residue 28 and name c2') (residue 28 and name c3') 
       (residue 28 and name c4') (residue 28 and name o4') 2 -36 15 2

assign (residue 29 and name c4') (residue 29 and name o4')
       (residue 29 and name c1') (residue 29 and name c2') 2 0 15 2
assign (residue 29 and name o4') (residue 29 and name c1')
       (residue 29 and name c2') (residue 29 and name c3') 2 -22 15 2
assign (residue 29 and name c1') (residue 29 and name c2')
       (residue 29 and name c3') (residue 29 and name c4') 2 36 15 2
assign (residue 29 and name c2') (residue 29 and name c3')
       (residue 29 and name c4') (residue 29 and name o4') 2 -36 15 2

assign (residue 30 and name c4') (residue 30 and name o4')
       (residue 30 and name c1') (residue 30 and name c2') 2 0 15 2
assign (residue 30 and name o4') (residue 30 and name c1')
       (residue 30 and name c2') (residue 30 and name c3') 2 -22 15 2
assign (residue 30 and name c1') (residue 30 and name c2')
       (residue 30 and name c3') (residue 30 and name c4') 2 36 15 2
assign (residue 30 and name c2') (residue 30 and name c3')
       (residue 30 and name c4') (residue 30 and name o4') 2 -36 15 2

assign (residue 31 and name c4') (residue 31 and name o4')
       (residue 31 and name c1') (residue 31 and name c2') 2 0 15 2
assign (residue 31 and name o4') (residue 31 and name c1')
       (residue 31 and name c2') (residue 31 and name c3') 2 -22 15 2
assign (residue 31 and name c1') (residue 31 and name c2')
       (residue 31 and name c3') (residue 31 and name c4') 2 36 15 2
assign (residue 31 and name c2') (residue 31 and name c3')
       (residue 31 and name c4') (residue 31 and name o4') 2 -36 15 2

assign (residue 32 and name c4') (residue 32 and name o4')
       (residue 32 and name c1') (residue 32 and name c2') 2 0 15 2
assign (residue 32 and name o4') (residue 32 and name c1')
       (residue 32 and name c2') (residue 32 and name c3') 2 -22 15 2
assign (residue 32 and name c1') (residue 32 and name c2')
       (residue 32 and name c3') (residue 32 and name c4') 2 36 15 2
assign (residue 32 and name c2') (residue 32 and name c3')
       (residue 32 and name c4') (residue 32 and name o4') 2 -36 15 2

assign (residue 33 and name c4') (residue 33 and name o4')
       (residue 33 and name c1') (residue 33 and name c2') 2 0 15 2
assign (residue 33 and name o4') (residue 33 and name c1')
       (residue 33 and name c2') (residue 33 and name c3') 2 -22 15 2
assign (residue 33 and name c1') (residue 33 and name c2')
       (residue 33 and name c3') (residue 33 and name c4') 2 36 15 2
assign (residue 33 and name c2') (residue 33 and name c3')
       (residue 33 and name c4') (residue 33 and name o4') 2 -36 15 2

assign (residue 34 and name c4') (residue 34 and name o4')
       (residue 34 and name c1') (residue 34 and name c2') 2 0 15 2
assign (residue 34 and name o4') (residue 34 and name c1')
       (residue 34 and name c2') (residue 34 and name c3') 2 -22 15 2
assign (residue 34 and name c1') (residue 34 and name c2')
       (residue 34 and name c3') (residue 34 and name c4') 2 36 15 2
assign (residue 34 and name c2') (residue 34 and name c3')
       (residue 34 and name c4') (residue 34 and name o4') 2 -36 15 2

assign (residue 36 and name c4') (residue 36 and name o4')
       (residue 36 and name c1') (residue 36 and name c2') 2 0 15 2
assign (residue 36 and name o4') (residue 36 and name c1')
       (residue 36 and name c2') (residue 36 and name c3') 2 -22 15 2
assign (residue 36 and name c1') (residue 36 and name c2')
       (residue 36 and name c3') (residue 36 and name c4') 2 36 15 2
assign (residue 36 and name c2') (residue 36 and name c3')
       (residue 36 and name c4') (residue 36 and name o4') 2 -36 15 2

assign (residue 37 and name c4') (residue 37 and name o4')
       (residue 37 and name c1') (residue 37 and name c2') 2 0 15 2
assign (residue 37 and name o4') (residue 37 and name c1')
       (residue 37 and name c2') (residue 37 and name c3') 2 -22 15 2
assign (residue 37 and name c1') (residue 37 and name c2')
       (residue 37 and name c3') (residue 37 and name c4') 2 36 15 2
assign (residue 37 and name c2') (residue 37 and name c3')
       (residue 37 and name c4') (residue 37 and name o4') 2 -36 15 2

assign (residue 38 and name c4') (residue 38 and name o4')
       (residue 38 and name c1') (residue 38 and name c2') 2 0 15 2
assign (residue 38 and name o4') (residue 38 and name c1')
       (residue 38 and name c2') (residue 38 and name c3') 2 -22 15 2
assign (residue 38 and name c1') (residue 38 and name c2')
       (residue 38 and name c3') (residue 38 and name c4') 2 36 15 2
assign (residue 38 and name c2') (residue 38 and name c3')
       (residue 38 and name c4') (residue 38 and name o4') 2 -36 15 2

assign (residue 39 and name c4') (residue 39 and name o4')
       (residue 39 and name c1') (residue 39 and name c2') 2 0 15 2
assign (residue 39 and name o4') (residue 39 and name c1')
       (residue 39 and name c2') (residue 39 and name c3') 2 -22 15 2
assign (residue 39 and name c1') (residue 39 and name c2')
       (residue 39 and name c3') (residue 39 and name c4') 2 36 15 2
assign (residue 39 and name c2') (residue 39 and name c3')
       (residue 39 and name c4') (residue 39 and name o4') 2 -36 15 2

assign (residue 40 and name c4') (residue 40 and name o4')
       (residue 40 and name c1') (residue 40 and name c2') 2 0 15 2
assign (residue 40 and name o4') (residue 40 and name c1')
       (residue 40 and name c2') (residue 40 and name c3') 2 -22 15 2
assign (residue 40 and name c1') (residue 40 and name c2')
       (residue 40 and name c3') (residue 40 and name c4') 2 36 15 2
assign (residue 40 and name c2') (residue 40 and name c3')
       (residue 40 and name c4') (residue 40 and name o4') 2 -36 15 2

assign (residue 41 and name c4') (residue 41 and name o4')
       (residue 41 and name c1') (residue 41 and name c2') 2 0 15 2
assign (residue 41 and name o4') (residue 41 and name c1')
       (residue 41 and name c2') (residue 41 and name c3') 2 -22 15 2
assign (residue 41 and name c1') (residue 41 and name c2')
       (residue 41 and name c3') (residue 41 and name c4') 2 36 15 2
assign (residue 41 and name c2') (residue 41 and name c3')
       (residue 41 and name c4') (residue 41 and name o4') 2 -36 15 2

assign (residue 42 and name c4') (residue 42 and name o4')
       (residue 42 and name c1') (residue 42 and name c2') 2 0 15 2
assign (residue 42 and name o4') (residue 42 and name c1')
       (residue 42 and name c2') (residue 42 and name c3') 2 -22 15 2
assign (residue 42 and name c1') (residue 42 and name c2')
       (residue 42 and name c3') (residue 42 and name c4') 2 36 15 2
assign (residue 42 and name c2') (residue 42 and name c3')
       (residue 42 and name c4') (residue 42 and name o4') 2 -36 15 2

assign (residue 43 and name c4') (residue 43 and name o4')
       (residue 43 and name c1') (residue 43 and name c2') 2 0 15 2
assign (residue 43 and name o4') (residue 43 and name c1')
       (residue 43 and name c2') (residue 43 and name c3') 2 -22 15 2
assign (residue 43 and name c1') (residue 43 and name c2')
       (residue 43 and name c3') (residue 43 and name c4') 2 36 15 2
assign (residue 43 and name c2') (residue 43 and name c3')
       (residue 43 and name c4') (residue 43 and name o4') 2 -36 15 2

assign (residue 44 and name c4') (residue 44 and name o4')
       (residue 44 and name c1') (residue 44 and name c2') 2 0 15 2
assign (residue 44 and name o4') (residue 44 and name c1')
       (residue 44 and name c2') (residue 44 and name c3') 2 -22 15 2
assign (residue 44 and name c1') (residue 44 and name c2')
       (residue 44 and name c3') (residue 44 and name c4') 2 36 15 2
assign (residue 44 and name c2') (residue 44 and name c3')
       (residue 44 and name c4') (residue 44 and name o4') 2 -36 15 2

assign (residue 45 and name c4') (residue 45 and name o4')
       (residue 45 and name c1') (residue 45 and name c2') 2 0 15 2
assign (residue 45 and name o4') (residue 45 and name c1')
       (residue 45 and name c2') (residue 45 and name c3') 2 -22 15 2
assign (residue 45 and name c1') (residue 45 and name c2')
       (residue 45 and name c3') (residue 45 and name c4') 2 36 15 2
assign (residue 45 and name c2') (residue 45 and name c3')
       (residue 45 and name c4') (residue 45 and name o4') 2 -36 15 2

assign (residue 46 and name c4') (residue 46 and name o4')
       (residue 46 and name c1') (residue 46 and name c2') 2 0 15 2
assign (residue 46 and name o4') (residue 46 and name c1')
       (residue 46 and name c2') (residue 46 and name c3') 2 -22 15 2
assign (residue 46 and name c1') (residue 46 and name c2')
       (residue 46 and name c3') (residue 46 and name c4') 2 36 15 2
assign (residue 46 and name c2') (residue 46 and name c3')
       (residue 46 and name c4') (residue 46 and name o4') 2 -36 15 2

assign (residue 47 and name c4') (residue 47 and name o4')
       (residue 47 and name c1') (residue 47 and name c2') 2 0 15 2
assign (residue 47 and name o4') (residue 47 and name c1')
       (residue 47 and name c2') (residue 47 and name c3') 2 -22 15 2
assign (residue 47 and name c1') (residue 47 and name c2')
       (residue 47 and name c3') (residue 47 and name c4') 2 36 15 2
assign (residue 47 and name c2') (residue 47 and name c3')
       (residue 47 and name c4') (residue 47 and name o4') 2 -36 15 2

assign (residue 48 and name c4') (residue 48 and name o4')
       (residue 48 and name c1') (residue 48 and name c2') 2 0 15 2
assign (residue 48 and name o4') (residue 48 and name c1')
       (residue 48 and name c2') (residue 48 and name c3') 2 -22 15 2
assign (residue 48 and name c1') (residue 48 and name c2')
       (residue 48 and name c3') (residue 48 and name c4') 2 36 15 2
assign (residue 48 and name c2') (residue 48 and name c3')
       (residue 48 and name c4') (residue 48 and name o4') 2 -36 15 2
assign (residue 25 and name c4') (residue 25 and name o4')
       (residue 25 and name c1') (residue 25 and name c2') 2 -18 15 2
assign (residue 25 and name o4') (residue 25 and name c1')
       (residue 25 and name c2') (residue 25 and name c3') 2 34 15 2
assign (residue 25 and name c1') (residue 25 and name c2')
       (residue 25 and name c3') (residue 25 and name c4') 2 -37 15 2
assign (residue 25 and name c2') (residue 25 and name c3')
       (residue 25 and name c4') (residue 25 and name o4') 2 26 15 2

assign (residue 35 and name c4') (residue 35 and name o4')
       (residue 35 and name c1') (residue 35 and name c2') 2 -18 15 2
assign (residue 35 and name o4') (residue 35 and name c1')
       (residue 35 and name c2') (residue 35 and name c3') 2 34 15 2
assign (residue 35 and name c1') (residue 35 and name c2')
       (residue 35 and name c3') (residue 35 and name c4') 2 -37 15 2
assign (residue 35 and name c2') (residue 35 and name c3')
       (residue 35 and name c4') (residue 35 and name o4') 2 26 15 2

assign (residue 2 and name p) (residue 2 and name o5')
        (residue 2 and name c5') (residue 2 and name c4') 2 170 30 2
assign (residue 3 and name p) (residue 3 and name o5')
        (residue 3 and name c5') (residue 3 and name c4') 2 170 30 2
assign (residue 4 and name p) (residue 4 and name o5')
        (residue 4 and name c5') (residue 4 and name c4') 2 170 30 2
assign (residue 5 and name p) (residue 5 and name o5')
        (residue 5 and name c5') (residue 5 and name c4') 2 170 30 2
assign (residue 6 and name p) (residue 6 and name o5')
        (residue 6 and name c5') (residue 6 and name c4') 2 170 30 2
assign (residue 7 and name p) (residue 7 and name o5')
        (residue 7 and name c5') (residue 7 and name c4') 2 170 30 2
assign (residue 8 and name p) (residue 8 and name o5')
        (residue 8 and name c5') (residue 8 and name c4') 2 170 30 2
assign (residue 9 and name p) (residue 9 and name o5')
        (residue 9 and name c5') (residue 9 and name c4') 2 170 30 2
assign (residue 10 and name p) (residue 10 and name o5')
        (residue 10 and name c5') (residue 10 and name c4') 2 170 30 2
assign (residue 11 and name p) (residue 11 and name o5')
        (residue 11 and name c5') (residue 11 and name c4') 2 170 30 2
assign (residue 12 and name p) (residue 12 and name o5')
        (residue 12 and name c5') (residue 12 and name c4') 2 170 30 2
assign (residue 13 and name p) (residue 13 and name o5')
        (residue 13 and name c5') (residue 13 and name c4') 2 170 30 2
assign (residue 14 and name p) (residue 14 and name o5')
        (residue 14 and name c5') (residue 14 and name c4') 2 170 30 2
assign (residue 15 and name p) (residue 15 and name o5')
        (residue 15 and name c5') (residue 15 and name c4') 2 170 30 2
assign (residue 16 and name p) (residue 16 and name o5')
        (residue 16 and name c5') (residue 16 and name c4') 2 170 30 2
assign (residue 17 and name p) (residue 17 and name o5')
        (residue 17 and name c5') (residue 17 and name c4') 2 170 30 2
assign (residue 18 and name p) (residue 18 and name o5')
        (residue 18 and name c5') (residue 18 and name c4') 2 170 30 2
assign (residue 19 and name p) (residue 19 and name o5')
        (residue 19 and name c5') (residue 19 and name c4') 2 170 30 2
assign (residue 20 and name p) (residue 20 and name o5')
        (residue 20 and name c5') (residue 20 and name c4') 2 170 30 2
assign (residue 21 and name p) (residue 21 and name o5')
        (residue 21 and name c5') (residue 21 and name c4') 2 170 30 2
assign (residue 22 and name p) (residue 22 and name o5')
        (residue 22 and name c5') (residue 22 and name c4') 2 170 30 2
assign (residue 23 and name p) (residue 23 and name o5')
        (residue 23 and name c5') (residue 23 and name c4') 2 170 60 2
assign (residue 24 and name p) (residue 24 and name o5')
        (residue 24 and name c5') (residue 24 and name c4') 2 170 60 2
assign (residue 25 and name p) (residue 25 and name o5')
        (residue 25 and name c5') (residue 25 and name c4') 2 170 60 2
assign (residue 26 and name p) (residue 26 and name o5')
        (residue 26 and name c5') (residue 26 and name c4') 2 170 60 2
assign (residue 27 and name p) (residue 27 and name o5')
        (residue 27 and name c5') (residue 27 and name c4') 2 170 30 2
assign (residue 28 and name p) (residue 28 and name o5')
        (residue 28 and name c5') (residue 28 and name c4') 2 170 30 2
assign (residue 29 and name p) (residue 29 and name o5')
        (residue 29 and name c5') (residue 29 and name c4') 2 170 30 2
assign (residue 30 and name p) (residue 30 and name o5')
        (residue 30 and name c5') (residue 30 and name c4') 2 170 30 2
assign (residue 31 and name p) (residue 31 and name o5')
        (residue 31 and name c5') (residue 31 and name c4') 2 170 30 2
assign (residue 32 and name p) (residue 32 and name o5')
        (residue 32 and name c5') (residue 32 and name c4') 2 170 30 2
assign (residue 33 and name p) (residue 33 and name o5')
        (residue 33 and name c5') (residue 33 and name c4') 2 170 30 2
assign (residue 34 and name p) (residue 34 and name o5')
        (residue 34 and name c5') (residue 34 and name c4') 2 170 30 2
assign (residue 35 and name p) (residue 35 and name o5')
        (residue 35 and name c5') (residue 35 and name c4') 2 170 60 2
assign (residue 36 and name p) (residue 36 and name o5')
        (residue 36 and name c5') (residue 36 and name c4') 2 170 30 2
assign (residue 37 and name p) (residue 37 and name o5')
        (residue 37 and name c5') (residue 37 and name c4') 2 170 30 2
assign (residue 38 and name p) (residue 38 and name o5')
        (residue 38 and name c5') (residue 38 and name c4') 2 170 30 2
assign (residue 39 and name p) (residue 39 and name o5')
        (residue 39 and name c5') (residue 39 and name c4') 2 170 30 2
assign (residue 40 and name p) (residue 40 and name o5')
        (residue 40 and name c5') (residue 40 and name c4') 2 170 30 2
assign (residue 41 and name p) (residue 41 and name o5')
        (residue 41 and name c5') (residue 41 and name c4') 2 170 30 2
assign (residue 42 and name p) (residue 42 and name o5')
        (residue 42 and name c5') (residue 42 and name c4') 2 170 30 2
assign (residue 43 and name p) (residue 43 and name o5')
        (residue 43 and name c5') (residue 43 and name c4') 2 170 30 2
assign (residue 44 and name p) (residue 44 and name o5')
        (residue 44 and name c5') (residue 44 and name c4') 2 170 30 2
assign (residue 45 and name p) (residue 45 and name o5')
        (residue 45 and name c5') (residue 45 and name c4') 2 170 30 2
assign (residue 46 and name p) (residue 46 and name o5')
        (residue 46 and name c5') (residue 46 and name c4') 2 170 30 2
assign (residue 47 and name p) (residue 47 and name o5')
        (residue 47 and name c5') (residue 47 and name c4') 2 170 30 2
assign (residue 48 and name p) (residue 48 and name o5')
        (residue 48 and name c5') (residue 48 and name c4') 2 170 30 2

assign (residue 1 and name o5') (residue 1 and name c5')
        (residue 1 and name c4') (residue 1 and name c3') 2 55 30 2
assign (residue 2 and name o5') (residue 2 and name c5')
        (residue 2 and name c4') (residue 2 and name c3') 2 55 30 2
assign (residue 3 and name o5') (residue 3 and name c5')
        (residue 3 and name c4') (residue 3 and name c3') 2 55 30 2
assign (residue 4 and name o5') (residue 4 and name c5')
        (residue 4 and name c4') (residue 4 and name c3') 2 55 30 2
assign (residue 5 and name o5') (residue 5 and name c5')
        (residue 5 and name c4') (residue 5 and name c3') 2 55 30 2
assign (residue 7 and name o5') (residue 7 and name c5')
        (residue 7 and name c4') (residue 7 and name c3') 2 55 30 2
assign (residue 8 and name o5') (residue 8 and name c5')
        (residue 8 and name c4') (residue 8 and name c3') 2 55 30 2
assign (residue 9 and name o5') (residue 9 and name c5')
        (residue 9 and name c4') (residue 9 and name c3') 2 55 30 2
assign (residue 10 and name o5') (residue 10 and name c5')
        (residue 10 and name c4') (residue 10 and name c3') 2 55 30 2
assign (residue 11 and name o5') (residue 11 and name c5')
        (residue 11 and name c4') (residue 11 and name c3') 2 55 30 2
assign (residue 12 and name o5') (residue 12 and name c5')
        (residue 12 and name c4') (residue 12 and name c3') 2 55 30 2
assign (residue 13 and name o5') (residue 13 and name c5')
        (residue 13 and name c4') (residue 13 and name c3') 2 55 30 2
assign (residue 14 and name o5') (residue 14 and name c5')
        (residue 14 and name c4') (residue 14 and name c3') 2 55 30 2
assign (residue 15 and name o5') (residue 15 and name c5')
        (residue 15 and name c4') (residue 15 and name c3') 2 55 30 2
assign (residue 16 and name o5') (residue 16 and name c5')
        (residue 16 and name c4') (residue 16 and name c3') 2 55 30 2
assign (residue 17 and name o5') (residue 17 and name c5')
        (residue 17 and name c4') (residue 17 and name c3') 2 55 30 2
assign (residue 18 and name o5') (residue 18 and name c5')
        (residue 18 and name c4') (residue 18 and name c3') 2 55 30 2
assign (residue 19 and name o5') (residue 19 and name c5')
        (residue 19 and name c4') (residue 19 and name c3') 2 55 30 2
assign (residue 20 and name o5') (residue 20 and name c5')
        (residue 20 and name c4') (residue 20 and name c3') 2 55 30 2
assign (residue 21 and name o5') (residue 21 and name c5')
        (residue 21 and name c4') (residue 21 and name c3') 2 55 30 2
assign (residue 22 and name o5') (residue 22 and name c5')
        (residue 22 and name c4') (residue 22 and name c3') 2 55 30 2
assign (residue 23 and name o5') (residue 23 and name c5')
        (residue 23 and name c4') (residue 23 and name c3') 2 55 60 2
assign (residue 24 and name o5') (residue 24 and name c5')
        (residue 24 and name c4') (residue 24 and name c3') 2 55 60 2

assign (residue 26 and name o5') (residue 26 and name c5')
        (residue 26 and name c4') (residue 26 and name c3') 2 55 60 2
assign (residue 27 and name o5') (residue 27 and name c5')
        (residue 27 and name c4') (residue 27 and name c3') 2 55 30 2
assign (residue 28 and name o5') (residue 28 and name c5')
        (residue 28 and name c4') (residue 28 and name c3') 2 55 30 2
assign (residue 29 and name o5') (residue 29 and name c5')
        (residue 29 and name c4') (residue 29 and name c3') 2 55 30 2
assign (residue 30 and name o5') (residue 30 and name c5')
        (residue 30 and name c4') (residue 30 and name c3') 2 55 30 2
assign (residue 31 and name o5') (residue 31 and name c5')
        (residue 31 and name c4') (residue 31 and name c3') 2 55 30 2
assign (residue 32 and name o5') (residue 32 and name c5')
        (residue 32 and name c4') (residue 32 and name c3') 2 55 30 2
assign (residue 33 and name o5') (residue 33 and name c5')
        (residue 33 and name c4') (residue 33 and name c3') 2 55 30 2
assign (residue 34 and name o5') (residue 34 and name c5')
        (residue 34 and name c4') (residue 34 and name c3') 2 55 30 2

assign (residue 36 and name o5') (residue 36 and name c5')
        (residue 36 and name c4') (residue 36 and name c3') 2 55 30 2
assign (residue 37 and name o5') (residue 37 and name c5')
        (residue 37 and name c4') (residue 37 and name c3') 2 55 30 2
assign (residue 38 and name o5') (residue 38 and name c5')
        (residue 38 and name c4') (residue 38 and name c3') 2 55 30 2
assign (residue 39 and name o5') (residue 39 and name c5')
        (residue 39 and name c4') (residue 39 and name c3') 2 55 30 2
assign (residue 40 and name o5') (residue 40 and name c5')
        (residue 40 and name c4') (residue 40 and name c3') 2 55 30 2
assign (residue 41 and name o5') (residue 41 and name c5')
        (residue 41 and name c4') (residue 41 and name c3') 2 55 30 2
assign (residue 42 and name o5') (residue 42 and name c5')
        (residue 42 and name c4') (residue 42 and name c3') 2 55 30 2
assign (residue 43 and name o5') (residue 43 and name c5')
        (residue 43 and name c4') (residue 43 and name c3') 2 55 30 2
assign (residue 44 and name o5') (residue 44 and name c5')
        (residue 44 and name c4') (residue 44 and name c3') 2 55 30 2
assign (residue 45 and name o5') (residue 45 and name c5')
        (residue 45 and name c4') (residue 45 and name c3') 2 55 30 2
assign (residue 46 and name o5') (residue 46 and name c5')
        (residue 46 and name c4') (residue 46 and name c3') 2 55 30 2
assign (residue 47 and name o5') (residue 47 and name c5')
        (residue 47 and name c4') (residue 47 and name c3') 2 55 30 2
assign (residue 48 and name o5') (residue 48 and name c5')
        (residue 48 and name c4') (residue 48 and name c3') 2 55 30 2
assign (residue 25 and name o5') (residue 25 and name c5')
        (residue 25 and name c4') (residue 25 and name c3') 2 155 60 2
assign (residue 35 and name o5') (residue 35 and name c5')
        (residue 35 and name c4') (residue 35 and name c3') 2 155 60 2

assign (residue 1 and name c4') (residue 1 and name c3')
        (residue 1 and name o3') (residue 2 and name p) 2 -155 30 2
assign (residue 2 and name c4') (residue 2 and name c3')
        (residue 2 and name o3') (residue 3 and name p) 2 -155 30 2
assign (residue 3 and name c4') (residue 3 and name c3')
        (residue 3 and name o3') (residue 4 and name p) 2 -155 30 2
assign (residue 4 and name c4') (residue 4 and name c3')
        (residue 4 and name o3') (residue 5 and name p) 2 -155 30 2
assign (residue 5 and name c4') (residue 5 and name c3')
        (residue 5 and name o3') (residue 6 and name p) 2 -155 30 2
assign (residue 6 and name c4') (residue 6 and name c3')
        (residue 6 and name o3') (residue 7 and name p) 2 -155 30 2
assign (residue 7 and name c4') (residue 7 and name c3')
        (residue 7 and name o3') (residue 8 and name p) 2 -155 30 2
assign (residue 8 and name c4') (residue 8 and name c3')
        (residue 8 and name o3') (residue 9 and name p) 2 -155 30 2
assign (residue 9 and name c4') (residue 9 and name c3')
        (residue 9 and name o3') (residue 10 and name p) 2 -155 30 2
assign (residue 10 and name c4') (residue 10 and name c3')
        (residue 10 and name o3') (residue 11 and name p) 2 -155 30 2
assign (residue 11 and name c4') (residue 11 and name c3')
        (residue 11 and name o3') (residue 12 and name p) 2 -155 30 2
assign (residue 12 and name c4') (residue 12 and name c3')
        (residue 12 and name o3') (residue 13 and name p) 2 -155 30 2
assign (residue 13 and name c4') (residue 13 and name c3')
        (residue 13 and name o3') (residue 14 and name p) 2 -155 30 2
assign (residue 14 and name c4') (residue 14 and name c3')
        (residue 14 and name o3') (residue 15 and name p) 2 -155 30 2
assign (residue 15 and name c4') (residue 15 and name c3')
        (residue 15 and name o3') (residue 16 and name p) 2 -155 30 2
assign (residue 17 and name c4') (residue 17 and name c3')
        (residue 17 and name o3') (residue 18 and name p) 2 -155 30 2
assign (residue 18 and name c4') (residue 18 and name c3')
        (residue 18 and name o3') (residue 19 and name p) 2 -155 30 2
assign (residue 19 and name c4') (residue 19 and name c3')
        (residue 19 and name o3') (residue 20 and name p) 2 -155 30 2
assign (residue 20 and name c4') (residue 20 and name c3')
        (residue 20 and name o3') (residue 21 and name p) 2 -155 30 2
assign (residue 21 and name c4') (residue 21 and name c3')
        (residue 21 and name o3') (residue 22 and name p) 2 -155 30 2
assign (residue 22 and name c4') (residue 22 and name c3')
        (residue 22 and name o3') (residue 23 and name p) 2 -155 30 2
assign (residue 23 and name c4') (residue 23 and name c3')
        (residue 23 and name o3') (residue 24 and name p) 2 -90 90 2
assign (residue 24 and name c4') (residue 24 and name c3')
        (residue 24 and name o3') (residue 25 and name p) 2 -90 90 2
assign (residue 25 and name c4') (residue 25 and name c3')
        (residue 25 and name o3') (residue 26 and name p) 2 -90 90 2
assign (residue 26 and name c4') (residue 26 and name c3')
        (residue 26 and name o3') (residue 27 and name p) 2 -90 90 2
assign (residue 27 and name c4') (residue 27 and name c3')
        (residue 27 and name o3') (residue 28 and name p) 2 -155 30 2
assign (residue 28 and name c4') (residue 28 and name c3')
        (residue 28 and name o3') (residue 29 and name p) 2 -155 30 2
assign (residue 29 and name c4') (residue 29 and name c3')
        (residue 29 and name o3') (residue 30 and name p) 2 -155 30 2
assign (residue 30 and name c4') (residue 30 and name c3')
        (residue 30 and name o3') (residue 31 and name p) 2 -155 30 2
assign (residue 31 and name c4') (residue 31 and name c3')
        (residue 31 and name o3') (residue 32 and name p) 2 -155 30 2
assign (residue 32 and name c4') (residue 32 and name c3')
        (residue 32 and name o3') (residue 33 and name p) 2 -155 30 2
assign (residue 33 and name c4') (residue 33 and name c3')
        (residue 33 and name o3') (residue 34 and name p) 2 -155 30 2
assign (residue 34 and name c4') (residue 34 and name c3')
        (residue 34 and name o3') (residue 35 and name p) 2 -155 30 2
assign (residue 35 and name c4') (residue 35 and name c3')
        (residue 35 and name o3') (residue 36 and name p) 2 -90 90 2
assign (residue 36 and name c4') (residue 36 and name c3')
        (residue 36 and name o3') (residue 37 and name p) 2 -155 30 2
assign (residue 37 and name c4') (residue 37 and name c3')
        (residue 37 and name o3') (residue 38 and name p) 2 -155 30 2
assign (residue 38 and name c4') (residue 38 and name c3')
        (residue 38 and name o3') (residue 39 and name p) 2 -155 30 2
assign (residue 39 and name c4') (residue 39 and name c3')
        (residue 39 and name o3') (residue 40 and name p) 2 -155 30 2
assign (residue 40 and name c4') (residue 40 and name c3')
        (residue 40 and name o3') (residue 41 and name p) 2 -155 30 2
assign (residue 41 and name c4') (residue 41 and name c3')
        (residue 41 and name o3') (residue 42 and name p) 2 -155 30 2
assign (residue 42 and name c4') (residue 42 and name c3')
        (residue 42 and name o3') (residue 43 and name p) 2 -155 30 2
assign (residue 43 and name c4') (residue 43 and name c3')
        (residue 43 and name o3') (residue 44 and name p) 2 -155 30 2
assign (residue 44 and name c4') (residue 44 and name c3')
        (residue 44 and name o3') (residue 45 and name p) 2 -155 30 2
assign (residue 45 and name c4') (residue 45 and name c3')
        (residue 45 and name o3') (residue 46 and name p) 2 -155 30 2
assign (residue 46 and name c4') (residue 46 and name c3')
        (residue 46 and name o3') (residue 47 and name p) 2 -155 30 2
assign (residue 47 and name c4') (residue 47 and name c3')
        (residue 47 and name o3') (residue 48 and name p) 2 -155 30 2
{RDCs}
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c8 )(residue 1 and name h8 ) 27.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 2 and name c8 )(residue 2 and name h8 ) 19.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 5 and name c5 )(residue 5 and name h5 ) 24.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 6 and name c8 )(residue 6 and name h8 ) 30.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 7 and name c8 )(residue 7 and name h8 ) 27.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 8 and name c5 )(residue 8 and name h5 ) 24.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 8 and name c6 )(residue 8 and name h6 ) 15.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 10 and name c8 )(residue 10 and name h8 ) 29.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 11 and name c5 )(residue 11 and name h5 ) 25.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c8 )(residue 12 and name h8 ) 22.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 15 and name c2 )(residue 15 and name h2 ) 23.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 15 and name c8 )(residue 15 and name h8 ) 17.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 16 and name c6 )(residue 16 and name h6 ) 21.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c2 )(residue 19 and name h2 ) 24.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 19 and name c8 )(residue 19 and name h8 ) 21.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c8 )(residue 20 and name h8 ) 18.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c5 )(residue 21 and name h5 ) 18.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c6 )(residue 21 and name h6 ) 18.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c5 )(residue 22 and name h5 ) 16.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c2 )(residue 23 and name h2 ) 17.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c8 )(residue 23 and name h8 ) 11.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c8 )(residue 24 and name h8 ) 11.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 26 and name c5 )(residue 26 and name h5 ) 7.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c5 )(residue 27 and name h5 ) 6.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 29 and name c6 )(residue 29 and name h6 ) 23.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c2 )(residue 31 and name h2 ) 26.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 33 and name c2 )(residue 33 and name h2 ) 31.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c2 )(residue 34 and name h2 ) 26.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c8 )(residue 34 and name h8 ) 16.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c2 )(residue 37 and name h2 ) 18.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c8 )(residue 37 and name h8 ) 21.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 38 and name c6 )(residue 38 and name h6 ) 30.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c2 )(residue 39 and name h2 ) 31.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c2 )(residue 40 and name h2 ) 23.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c8 )(residue 40 and name h8 ) 22.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c8 )(residue 41 and name h8 ) 23.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c5 )(residue 42 and name h5 ) 15.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c6 )(residue 42 and name h6 ) 22.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c6 )(residue 43 and name h6 ) 25.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c2 )(residue 44 and name h2 ) 27.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c8 )(residue 44 and name h8 ) 26.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 45 and name c2 )(residue 45 and name h2 ) 30.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c8 )(residue 46 and name h8 ) 23.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 47 and name c6 )(residue 47 and name h6 ) 13.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c6 )(residue 48 and name h6 ) 13.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 1 and name c4' )(residue 1 and name h4' ) 17.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 2 and name c1' )(residue 2 and name h1' ) -36.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 4 and name c1' )(residue 4 and name h1' ) -17.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 4 and name c3' )(residue 4 and name h3' ) 11.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 8 and name c1' )(residue 8 and name h1' ) -6.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 10 and name c3' )(residue 10 and name h3' ) 22.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 11 and name c1' )(residue 11 and name h1' ) -10.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c1' )(residue 12 and name h1' ) -27.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 12 and name c3' )(residue 12 and name h3' ) 21.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 13 and name c1' )(residue 13 and name h1' ) -32.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 13 and name c2' )(residue 13 and name h2'' ) 22.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 14 and name c3' )(residue 14 and name h3' ) 15.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 15 and name c1' )(residue 15 and name h1' ) -27.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 16 and name c1' )(residue 16 and name h1' ) -25.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 20 and name c3' )(residue 20 and name h3' ) 19.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c1' )(residue 21 and name h1' ) -15.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c2' )(residue 21 and name h2'' ) 16.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 21 and name c4' )(residue 21 and name h4' ) 22.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c1' )(residue 22 and name h1' ) -4.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 22 and name c4' )(residue 22 and name h4' ) 11.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c1' )(residue 23 and name h1' ) 3.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c2' )(residue 23 and name h2'' ) -12.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 23 and name c4' )(residue 23 and name h4' ) -7.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c1' )(residue 24 and name h1' ) 10.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c2' )(residue 24 and name h2'' ) -11.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c3' )(residue 24 and name h3' ) 12.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 24 and name c4' )(residue 24 and name h4' ) 13.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c3' )(residue 27 and name h3' ) 8.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 27 and name c4' )(residue 27 and name h4' ) 14.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c1' )(residue 28 and name h1' ) -28.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c3' )(residue 28 and name h3' ) 10.3 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 28 and name c4' )(residue 28 and name h4' ) 19.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 31 and name c3' )(residue 31 and name h3' ) 16.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 34 and name c2' )(residue 34 and name h2'' ) 1.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c2' )(residue 35 and name h2'' ) 5.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 35 and name c4' )(residue 35 and name h4' ) 1.9 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c1' )(residue 37 and name h1' ) -40.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 37 and name c3' )(residue 37 and name h3' ) 5.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c1' )(residue 39 and name h1' ) -27.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c2' )(residue 39 and name h2'' ) -1.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 39 and name c3' )(residue 39 and name h3' ) 4.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 40 and name c4' )(residue 40 and name h4' ) 16.0 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 41 and name c4' )(residue 41 and name h4' ) 25.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c1' )(residue 42 and name h1' ) -12.8 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c3' )(residue 42 and name h3' ) 5.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 42 and name c4' )(residue 42 and name h4' ) 17.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c3' )(residue 43 and name h3' ) 4.7 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 43 and name c4' )(residue 43 and name h4' ) 15.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c1' )(residue 44 and name h1' ) -1.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 44 and name c3' )(residue 44 and name h3' ) 16.5 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 46 and name c1' )(residue 46 and name h1' ) -11.6 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c1' )(residue 48 and name h1' ) 4.1 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c2' )(residue 48 and name h2'' ) 18.4 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c3' )(residue 48 and name h3' ) 18.2 2.5
assign (residue 500 and name OO)(residue 500 and name Z)(residue 500 and name X) (residue 500 and name Y)
(residue 48 and name c4' )(residue 48 and name h4' ) 23.6 2.5

  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1    H5'    G   1           H5'        G   1 -12.997 -29.323  29.373
    2   H5''    G   1          H5''        G   1 -13.497 -27.905  28.430
    3    H4'    G   1           H4'        G   1 -15.519 -29.034  29.113
    4    H3'    G   1           H3'        G   1 -14.709 -26.444  30.333
    5    H2'    G   1          H2''        G   1 -16.150 -26.491  32.152
    6   HO2'    G   1          H2'         G   1 -17.664 -28.568  30.941
    7    H1'    G   1           H1'        G   1 -16.208 -29.160  32.743
    8    H8     G   1           H8         G   1 -12.689 -29.178  32.483
    9    H1     G   1           H1         G   1 -14.301 -24.639  36.714
   10    H21    G   1           H21        G   1 -16.464 -24.223  36.597
   11    H22    G   1           H22        G   1 -17.493 -24.944  35.381
   12   HO5'    G   1          H5T         G   1 -13.303 -27.357  31.086
   13    H5'    G   2           H5'        G   2 -18.765 -25.138  29.524
   14   H5''    G   2          H5''        G   2 -18.642 -23.574  28.693
   15    H4'    G   2           H4'        G   2 -19.778 -23.449  30.955
   16    H3'    G   2           H3'        G   2 -17.375 -21.928  30.030
   17    H2'    G   2          H2''        G   2 -16.720 -21.169  32.095
   18   HO2'    G   2          H2'         G   2 -19.434 -21.454  32.894
   19    H1'    G   2           H1'        G   2 -17.804 -23.127  33.781
   20    H8     G   2           H8         G   2 -15.600 -24.809  31.263
   21    H1     G   2           H1         G   2 -12.270 -21.689  35.764
   22    H21    G   2           H21        G   2 -13.630 -20.416  36.958
   23    H22    G   2           H22        G   2 -15.308 -20.181  36.525
   24    H5'    C   3           H5'        C   3 -20.228 -18.446  32.035
   25   H5''    C   3          H5''        C   3 -19.865 -17.230  30.794
   26    H4'    C   3           H4'        C   3 -19.526 -16.442  33.196
   27    H3'    C   3           H3'        C   3 -17.516 -16.415  30.962
   28    H2'    C   3          H2''        C   3 -15.732 -15.835  32.300
   29   HO2'    C   3          H2'         C   3 -17.530 -14.858  34.272
   30    H1'    C   3           H1'        C   3 -16.569 -16.909  34.755
   31    H41    C   3           H41        C   3 -11.538 -20.241  32.680
   32    H42    C   3           H42        C   3 -12.584 -21.177  31.637
   33    H5     C   3           H5         C   3 -14.881 -20.590  31.215
   34    H6     C   3           H6         C   3 -16.731 -19.124  31.868
   35    H5'    U   4           H5'        U   4 -16.758 -11.833  32.246
   36   H5''    U   4          H5''        U   4 -16.089 -11.446  30.650
   37    H4'    U   4           H4'        U   4 -14.540 -11.384  32.824
   38    H3'    U   4           H3'        U   4 -14.004 -12.455  30.045
   39    H2'    U   4          H2''        U   4 -11.825 -13.053  30.645
   40   HO2'    U   4          H2'         U   4 -12.142 -11.516  33.023
   41    H1'    U   4           H1'        U   4 -12.409 -13.928  33.222
   42    H3     U   4           H3         U   4 -10.779 -17.394  30.722
   43    H5     U   4           H5         U   4 -14.775 -16.953  29.460
   44    H6     U   4           H6         U   4 -14.907 -14.935  30.798
   45    H5'    U   5           H5'        U   5 -10.873  -9.839  31.883
   46   H5''    U   5          H5''        U   5 -10.348  -8.649  30.675
   47    H4'    U   5           H4'        U   5  -8.422  -9.624  31.947
   48    H3'    U   5           H3'        U   5  -8.848  -9.796  28.994
   49    H2'    U   5          H2''        U   5  -7.286 -11.426  28.584
   50   HO2'    U   5          H2'         U   5  -5.337 -11.290  29.383
   51    H1'    U   5           H1'        U   5  -7.099 -12.655  31.123
   52    H3     U   5           H3         U   5  -7.764 -16.053  28.194
   53    H5     U   5           H5         U   5 -11.452 -14.020  28.270
   54    H6     U   5           H6         U   5 -10.400 -12.304  29.618
   55    H5'    G   6           H5'        G   6  -5.955  -8.720  25.994
   56   H5''    G   6          H5''        G   6  -6.835 -10.025  26.819
   57    H4'    G   6           H4'        G   6  -3.821 -10.042  26.940
   58    H3'    G   6           H3'        G   6  -5.537 -10.261  24.502
   59    H2'    G   6          H2''        G   6  -4.929 -12.393  23.921
   60   HO2'    G   6          H2'         G   6  -2.897 -12.950  23.848
   61    H1'    G   6           H1'        G   6  -4.070 -13.422  26.400
   62    H8     G   6           H8         G   6  -7.637 -12.290  26.688
   63    H1     G   6           H1         G   6  -7.038 -17.719  23.330
   64    H21    G   6           H21        G   6  -4.909 -18.120  22.910
   65    H22    G   6           H22        G   6  -3.651 -16.961  23.276
   66    H5'    A   7           H5'        A   7  -0.928 -10.243  22.852
   67   H5''    A   7          H5''        A   7  -1.199  -9.711  21.181
   68    H4'    A   7           H4'        A   7   0.023 -12.007  21.617
   69    H3'    A   7           H3'        A   7  -2.067 -11.166  19.646
   70    H2'    A   7          H2''        A   7  -2.696 -13.283  19.017
   71   HO2'    A   7          H2'         A   7  -1.243 -14.718  18.506
   72    H1'    A   7           H1'        A   7  -1.915 -14.773  21.280
   73    H8     A   7           H8         A   7  -4.408 -11.939  21.914
   74    H61    A   7           H61        A   7  -8.814 -16.040  20.500
   75    H62    A   7           H62        A   7  -8.485 -14.428  21.094
   76    H2     A   7           H2         A   7  -4.846 -17.847  19.459
   77    H5'    U   8           H5'        U   8   1.170 -13.789  17.434
   78   H5''    U   8          H5''        U   8   1.133 -13.211  15.757
   79    H4'    U   8           H4'        U   8   0.749 -15.747  16.142
   80    H3'    U   8           H3'        U   8  -0.800 -13.784  14.490
   81    H2'    U   8          H2''        U   8  -2.605 -15.164  14.111
   82   HO2'    U   8          H2'         U   8  -2.355 -17.194  13.584
   83    H1'    U   8           H1'        U   8  -2.483 -16.821  16.382
   84    H3     U   8           H3         U   8  -6.683 -15.167  16.563
   85    H5     U   8           H5         U   8  -4.255 -11.790  17.219
   86    H6     U   8           H6         U   8  -2.322 -13.162  16.724
   87    H5'    U   9           H5'        U   9  -0.360 -16.927  11.507
   88   H5''    U   9          H5''        U   9   0.008 -16.137   9.961
   89    H4'    U   9           H4'        U   9  -2.132 -17.402   9.846
   90    H3'    U   9           H3'        U   9  -1.937 -14.413   9.568
   91    H2'    U   9          H2''        U   9  -4.198 -14.056   9.667
   92   HO2'    U   9          H2'         U   9  -4.516 -16.678   8.603
   93    H1'    U   9           H1'        U   9  -5.007 -16.482  10.948
   94    H3     U   9           H3         U   9  -7.358 -13.492  13.310
   95    H5     U   9           H5         U   9  -3.385 -12.185  13.830
   96    H6     U   9           H6         U   9  -2.677 -13.938  12.309
   97    H5'    G  10           H5'        G  10  -3.999 -16.212   5.231
   98   H5''    G  10          H5''        G  10  -3.792 -14.698   4.330
   99    H4'    G  10           H4'        G  10  -6.187 -15.855   4.490
  100    H3'    G  10           H3'        G  10  -5.306 -12.976   4.595
  101    H2'    G  10          H2''        G  10  -7.409 -12.178   5.152
  102   HO2'    G  10          H2'         G  10  -8.843 -12.951   3.795
  103    H1'    G  10           H1'        G  10  -8.329 -14.308   6.691
  104    H8     G  10           H8         G  10  -4.935 -13.447   7.972
  105    H1     G  10           H1         G  10  -9.260  -8.914   9.336
  106    H21    G  10           H21        G  10 -11.127  -9.294   8.225
  107    H22    G  10           H22        G  10 -11.250 -10.546   7.010
  108    H5'    U  11           H5'        U  11  -8.551 -13.093   0.980
  109   H5''    U  11          H5''        U  11  -8.109 -11.600   0.131
  110    H4'    U  11           H4'        U  11 -10.558 -11.912   1.137
  111    H3'    U  11           H3'        U  11  -8.697  -9.542   1.019
  112    H2'    U  11          H2''        U  11 -10.086  -8.203   2.331
  113   HO2'    U  11          H2'         U  11 -12.223  -8.382   2.367
  114    H1'    U  11           H1'        U  11 -11.068 -10.138   4.059
  115    H3     U  11           H3         U  11  -8.616  -6.896   6.263
  116    H5     U  11           H5         U  11  -5.852  -9.815   5.001
  117    H6     U  11           H6         U  11  -7.613 -10.820   3.675
  118    H5'    A  12           H5'        A  12 -11.619  -7.331  -1.941
  119   H5''    A  12          H5''        A  12 -10.412  -6.106  -2.380
  120    H4'    A  12           H4'        A  12 -12.444  -5.529  -0.721
  121    H3'    A  12           H3'        A  12  -9.535  -4.691  -0.720
  122    H2'    A  12          H2''        A  12  -9.820  -3.449   1.264
  123   HO2'    A  12          H2'         A  12 -11.778  -2.855   2.061
  124    H1'    A  12           H1'        A  12 -11.249  -5.346   2.626
  125    H8     A  12           H8         A  12  -8.828  -7.438   0.755
  126    H61    A  12           H61        A  12  -4.392  -5.371   4.530
  127    H62    A  12           H62        A  12  -4.859  -6.645   3.425
  128    H2     A  12           H2         A  12  -8.037  -2.829   5.140
  129    H5'    U  13           H5'        U  13 -10.856  -0.346  -0.778
  130   H5''    U  13          H5''        U  13  -9.479   0.281  -1.705
  131    H4'    U  13           H4'        U  13  -9.782   0.926   0.858
  132    H3'    U  13           H3'        U  13  -7.339   0.230  -0.774
  133    H2'    U  13          H2''        U  13  -5.930   0.262   1.108
  134   HO2'    U  13          H2'         U  13  -6.186   1.669   2.656
  135    H1'    U  13           H1'        U  13  -7.682  -0.725   3.000
  136    H3     U  13           H3         U  13  -3.865  -3.281   2.256
  137    H5     U  13           H5         U  13  -6.862  -4.754  -0.313
  138    H6     U  13           H6         U  13  -8.208  -2.821   0.247
  139    H5'    U  14           H5'        U  14  -6.551   4.654   0.281
  140   H5''    U  14          H5''        U  14  -5.883   5.402  -1.184
  141    H4'    U  14           H4'        U  14  -4.314   5.595   0.746
  142    H3'    U  14           H3'        U  14  -3.717   4.013  -1.747
  143    H2'    U  14          H2''        U  14  -1.694   3.198  -0.947
  144   HO2'    U  14          H2'         U  14  -0.470   4.659  -0.070
  145    H1'    U  14           H1'        U  14  -2.359   2.888   1.723
  146    H3     U  14           H3         U  14  -1.378  -1.192  -0.111
  147    H5     U  14           H5         U  14  -5.335  -0.387  -1.301
  148    H6     U  14           H6         U  14  -5.087   1.846  -0.387
  149    H5'    A  15           H5'        A  15  -0.223   6.972  -1.720
  150   H5''    A  15          H5''        A  15   0.455   6.904  -3.359
  151    H4'    A  15           H4'        A  15   1.797   5.881  -1.297
  152    H3'    A  15           H3'        A  15   1.425   4.999  -4.146
  153    H2'    A  15          H2''        A  15   2.279   2.895  -3.826
  154   HO2'    A  15          H2'         A  15   3.790   4.040  -1.710
  155    H1'    A  15           H1'        A  15   1.857   2.603  -1.033
  156    H8     A  15           H8         A  15  -1.360   3.070  -2.992
  157    H61    A  15           H61        A  15  -1.061  -2.952  -4.320
  158    H62    A  15           H62        A  15  -2.033  -1.501  -4.418
  159    H2     A  15           H2         A  15   2.917  -1.696  -2.670
  160    H5'    U  16           H5'        U  16   6.280   4.780  -3.320
  161   H5''    U  16          H5''        U  16   6.786   4.967  -5.010
  162    H4'    U  16           H4'        U  16   7.617   2.866  -3.682
  163    H3'    U  16           H3'        U  16   6.474   3.116  -6.453
  164    H2'    U  16          H2''        U  16   6.268   0.847  -6.779
  165   HO2'    U  16          H2'         U  16   7.965  -0.310  -6.418
  166    H1'    U  16           H1'        U  16   6.009  -0.016  -4.105
  167    H3     U  16           H3         U  16   2.546  -1.823  -6.446
  168    H5     U  16           H5         U  16   1.536   2.239  -6.015
  169    H6     U  16           H6         U  16   3.785   2.648  -5.219
  170    H5'    U  17           H5'        U  17  10.484   0.555  -7.578
  171   H5''    U  17          H5''        U  17  10.543   1.208  -9.227
  172    H4'    U  17           H4'        U  17  10.221  -1.402  -8.839
  173    H3'    U  17           H3'        U  17   9.018   0.536 -10.796
  174    H2'    U  17          H2''        U  17   7.369  -0.882 -11.510
  175   HO2'    U  17          H2'         U  17   7.744  -2.934 -11.970
  176    H1'    U  17           H1'        U  17   7.235  -2.653  -9.289
  177    H3     U  17           H3         U  17   2.967  -1.580 -10.414
  178    H5     U  17           H5         U  17   4.504   1.927  -8.652
  179    H6     U  17           H6         U  17   6.693   0.878  -8.637
  180    H5'    A  18           H5'        A  18  10.232  -3.498 -12.845
  181   H5''    A  18          H5''        A  18  10.834  -3.007 -14.440
  182    H4'    A  18           H4'        A  18   9.189  -4.892 -14.577
  183    H3'    A  18           H3'        A  18   8.746  -2.174 -15.804
  184    H2'    A  18          H2''        A  18   6.580  -2.634 -16.423
  185   HO2'    A  18          H2'         A  18   6.406  -4.323 -17.642
  186    H1'    A  18           H1'        A  18   6.018  -4.731 -14.562
  187    H8     A  18           H8         A  18   6.755  -1.232 -13.185
  188    H61    A  18           H61        A  18   0.721  -0.126 -13.905
  189    H62    A  18           H62        A  18   2.200   0.414 -13.144
  190    H2     A  18           H2         A  18   1.642  -4.094 -15.787
  191    H5'    A  19           H5'        A  19   8.131  -5.229 -19.622
  192   H5''    A  19          H5''        A  19   8.300  -3.972 -20.862
  193    H4'    A  19           H4'        A  19   6.039  -5.361 -20.655
  194    H3'    A  19           H3'        A  19   6.588  -2.449 -21.205
  195    H2'    A  19          H2''        A  19   4.389  -1.825 -20.997
  196   HO2'    A  19          H2'         A  19   3.011  -2.854 -22.181
  197    H1'    A  19           H1'        A  19   3.443  -3.988 -19.393
  198    H8     A  19           H8         A  19   6.126  -1.590 -18.014
  199    H61    A  19           H61        A  19   1.387   1.775 -15.914
  200    H62    A  19           H62        A  19   3.126   1.595 -15.938
  201    H2     A  19           H2         A  19  -0.248  -1.389 -18.645
  202    H5'    A  20           H5'        A  20   3.443  -4.084 -24.274
  203   H5''    A  20          H5''        A  20   3.737  -3.114 -25.730
  204    H4'    A  20           H4'        A  20   1.331  -3.078 -25.002
  205    H3'    A  20           H3'        A  20   3.102  -0.638 -25.132
  206    H2'    A  20          H2''        A  20   1.454   0.762 -24.286
  207   HO2'    A  20          H2'         A  20  -0.124  -0.026 -25.838
  208    H1'    A  20           H1'        A  20   0.137  -1.060 -22.621
  209    H8     A  20           H8         A  20   3.993  -0.536 -22.466
  210    H61    A  20           H61        A  20   2.754   3.639 -18.083
  211    H62    A  20           H62        A  20   4.013   2.787 -18.948
  212    H2     A  20           H2         A  20  -1.139   2.222 -19.793
  213    H5'    U  21           H5'        U  21  -0.331   1.063 -27.462
  214   H5''    U  21          H5''        U  21   0.474   2.428 -28.259
  215    H4'    U  21           H4'        U  21  -1.224   2.848 -26.250
  216    H3'    U  21           H3'        U  21   1.357   4.135 -27.075
  217    H2'    U  21          H2''        U  21   1.721   5.232 -25.076
  218   HO2'    U  21          H2'         U  21   0.180   6.408 -24.293
  219    H1'    U  21           H1'        U  21   0.210   3.650 -23.314
  220    H3     U  21           H3         U  21   4.356   4.236 -21.507
  221    H5     U  21           H5         U  21   5.035   1.744 -24.836
  222    H6     U  21           H6         U  21   2.674   1.904 -25.353
  223    H5'    U  22           H5'        U  22  -1.539   7.389 -25.715
  224   H5''    U  22          H5''        U  22  -1.358   8.727 -26.868
  225    H4'    U  22           H4'        U  22  -1.151   9.393 -24.412
  226    H3'    U  22           H3'        U  22   0.620   9.973 -26.705
  227    H2'    U  22          H2''        U  22   2.618  10.019 -25.633
  228   HO2'    U  22          H2'         U  22   1.185  11.625 -23.796
  229    H1'    U  22           H1'        U  22   1.754   9.409 -22.925
  230    H3     U  22           H3         U  22   5.729   7.382 -22.543
  231    H5     U  22           H5         U  22   4.205   5.777 -26.129
  232    H6     U  22           H6         U  22   2.292   7.251 -25.902
  233    H5'    A  23           H5'        A  23   2.266  12.505 -28.205
  234   H5''    A  23          H5''        A  23   2.600  11.180 -27.078
  235    H4'    A  23           H4'        A  23   4.647  12.521 -27.808
  236    H3'    A  23           H3'        A  23   3.824  11.606 -25.186
  237    H2'    A  23          H2''        A  23   3.880  13.571 -24.009
  238   HO2'    A  23          H2'         A  23   6.591  13.315 -24.801
  239    H1'    A  23           H1'        A  23   5.207  15.373 -25.818
  240    H8     A  23           H8         A  23   1.545  14.984 -26.335
  241    H61    A  23           H61        A  23   0.561  18.644 -21.445
  242    H62    A  23           H62        A  23  -0.195  17.733 -22.733
  243    H2     A  23           H2         A  23   4.913  17.570 -21.523
  244    H5'    A  24           H5'        A  24   7.583  10.177 -22.987
  245   H5''    A  24          H5''        A  24   6.337   9.459 -21.949
  246    H4'    A  24           H4'        A  24   7.563  12.063 -21.732
  247    H3'    A  24           H3'        A  24   5.548  10.330 -20.298
  248    H2'    A  24          H2''        A  24   4.516  12.112 -19.270
  249   HO2'    A  24          H2'         A  24   6.905  13.645 -19.434
  250    H1'    A  24           H1'        A  24   5.496  14.198 -21.030
  251    H8     A  24           H8         A  24   3.056  12.202 -22.913
  252    H61    A  24           H61        A  24  -1.483  15.050 -19.840
  253    H62    A  24           H62        A  24  -1.103  13.913 -21.113
  254    H2     A  24           H2         A  24   2.380  15.931 -17.738
  255    H5'    U  25           H5'        U  25   5.035  10.704 -17.851
  256   H5''    U  25          H5''        U  25   6.145  12.018 -17.418
  257    H4'    U  25           H4'        U  25   5.300  10.179 -15.204
  258    H3'    U  25           H3'        U  25   3.348  11.104 -16.928
  259    H2'    U  25          H2''        U  25   3.605  13.403 -16.698
  260   HO2'    U  25          H2'         U  25   1.719  13.571 -15.765
  261    H1'    U  25           H1'        U  25   4.422  13.305 -13.835
  262    H3     U  25           H3         U  25   5.917  17.515 -13.992
  263    H5     U  25           H5         U  25   6.598  16.165 -17.926
  264    H6     U  25           H6         U  25   5.686  14.015 -17.278
  265    H5'    U  26           H5'        U  26   1.898  12.190 -17.625
  266   H5''    U  26          H5''        U  26   0.356  12.241 -16.750
  267    H4'    U  26           H4'        U  26  -0.292  12.311 -19.051
  268    H3'    U  26           H3'        U  26  -0.476   9.724 -17.594
  269    H2'    U  26          H2''        U  26  -0.496   8.306 -19.389
  270   HO2'    U  26          H2'         U  26  -1.548  10.441 -20.954
  271    H1'    U  26           H1'        U  26   0.752   9.845 -21.370
  272    H3     U  26           H3         U  26   2.880   5.800 -20.953
  273    H5     U  26           H5         U  26   4.503   8.250 -17.939
  274    H6     U  26           H6         U  26   2.793   9.890 -18.433
  275    H5'    C  27           H5'        C  27  -4.827   9.641 -18.820
  276   H5''    C  27          H5''        C  27  -5.613   8.953 -17.385
  277    H4'    C  27           H4'        C  27  -5.591   7.375 -19.350
  278    H3'    C  27           H3'        C  27  -4.292   6.881 -16.685
  279    H2'    C  27          H2''        C  27  -3.239   4.929 -17.336
  280   HO2'    C  27          H2'         C  27  -5.167   4.732 -19.423
  281    H1'    C  27           H1'        C  27  -2.935   5.451 -20.084
  282    H41    C  27           H41        C  27   2.924   5.595 -17.640
  283    H42    C  27           H42        C  27   2.434   6.690 -16.367
  284    H5     C  27           H5         C  27   0.145   7.356 -16.023
  285    H6     C  27           H6         C  27  -2.107   7.355 -16.980
  286    H5'    U  28           H5'        U  28  -8.340   3.662 -16.657
  287   H5''    U  28          H5''        U  28  -7.843   2.556 -15.360
  288    H4'    U  28           H4'        U  28  -8.185   1.699 -17.899
  289    H3'    U  28           H3'        U  28  -6.122   0.990 -15.797
  290    H2'    U  28          H2''        U  28  -5.113  -0.560 -17.261
  291   HO2'    U  28          H2'         U  28  -6.193  -1.566 -18.772
  292    H1'    U  28           H1'        U  28  -5.154   1.097 -19.473
  293    H3     U  28           H3         U  28  -0.897   0.515 -17.792
  294    H5     U  28           H5         U  28  -2.640   3.539 -15.448
  295    H6     U  28           H6         U  28  -4.745   3.103 -16.546
  296    H5'    U  29           H5'        U  29  -7.482  -2.674 -17.331
  297   H5''    U  29          H5''        U  29  -7.916  -3.816 -16.043
  298    H4'    U  29           H4'        U  29  -6.353  -4.874 -17.642
  299    H3'    U  29           H3'        U  29  -5.599  -4.268 -14.791
  300    H2'    U  29          H2''        U  29  -3.385  -4.908 -15.056
  301   HO2'    U  29          H2'         U  29  -4.429  -6.500 -17.116
  302    H1'    U  29           H1'        U  29  -2.976  -4.136 -17.689
  303    H3     U  29           H3         U  29  -0.080  -1.789 -15.056
  304    H5     U  29           H5         U  29  -3.798   0.112 -14.504
  305    H6     U  29           H6         U  29  -4.829  -1.687 -15.760
  306    H5'    A  30           H5'        A  30  -4.046  -8.515 -15.250
  307   H5''    A  30          H5''        A  30  -4.013  -9.068 -13.566
  308    H4'    A  30           H4'        A  30  -1.747  -8.763 -14.919
  309    H3'    A  30           H3'        A  30  -2.488  -8.090 -12.071
  310    H2'    A  30          H2''        A  30  -0.521  -6.976 -11.681
  311   HO2'    A  30          H2'         A  30   0.858  -8.680 -12.042
  312    H1'    A  30           H1'        A  30   0.187  -6.383 -14.397
  313    H8     A  30           H8         A  30  -2.889  -4.497 -13.335
  314    H61    A  30           H61        A  30   0.880  -0.525 -10.469
  315    H62    A  30           H62        A  30  -0.743  -0.798 -11.062
  316    H2     A  30           H2         A  30   3.290  -4.118 -11.659
  317    H5'    A  31           H5'        A  31   1.520 -11.323 -11.327
  318   H5''    A  31          H5''        A  31   0.878 -11.572  -9.692
  319    H4'    A  31           H4'        A  31   3.375 -10.730 -10.029
  320    H3'    A  31           H3'        A  31   1.228  -9.953  -8.065
  321    H2'    A  31          H2''        A  31   2.433  -8.188  -7.187
  322   HO2'    A  31          H2'         A  31   4.794  -9.342  -8.282
  323    H1'    A  31           H1'        A  31   3.903  -7.444  -9.451
  324    H8     A  31           H8         A  31   0.145  -7.693 -10.054
  325    H61    A  31           H61        A  31  -0.221  -1.955  -7.783
  326    H62    A  31           H62        A  31  -1.045  -3.186  -8.713
  327    H2     A  31           H2         A  31   3.953  -3.452  -7.121
  328    H5'    U  32           H5'        U  32   5.137 -10.709  -5.503
  329   H5''    U  32          H5''        U  32   4.457 -11.011  -3.893
  330    H4'    U  32           H4'        U  32   6.091  -8.950  -4.292
  331    H3'    U  32           H3'        U  32   3.586  -9.281  -2.658
  332    H2'    U  32          H2''        U  32   3.316  -7.040  -2.268
  333   HO2'    U  32          H2'         U  32   4.936  -5.786  -1.663
  334    H1'    U  32           H1'        U  32   4.890  -5.992  -4.413
  335    H3     U  32           H3         U  32   1.106  -3.477  -4.175
  336    H5     U  32           H5         U  32  -0.157  -7.159  -5.789
  337    H6     U  32           H6         U  32   2.050  -8.049  -5.322
  338    H5'    A  33           H5'        A  33   7.222  -7.360  -0.046
  339   H5''    A  33          H5''        A  33   6.786  -7.857   1.601
  340    H4'    A  33           H4'        A  33   7.319  -5.363   1.287
  341    H3'    A  33           H3'        A  33   4.922  -6.641   2.547
  342    H2'    A  33          H2''        A  33   3.634  -4.743   2.620
  343   HO2'    A  33          H2'         A  33   6.094  -3.328   2.740
  344    H1'    A  33           H1'        A  33   4.814  -3.216   0.554
  345    H8     A  33           H8         A  33   3.404  -6.652  -0.395
  346    H61    A  33           H61        A  33  -1.968  -3.722  -1.273
  347    H62    A  33           H62        A  33  -1.133  -5.256  -1.377
  348    H2     A  33           H2         A  33   0.869  -0.870   0.709
  349    H5'    A  34           H5'        A  34   6.125  -3.077   5.111
  350   H5''    A  34          H5''        A  34   6.065  -3.670   6.783
  351    H4'    A  34           H4'        A  34   4.811  -1.529   6.513
  352    H3'    A  34           H3'        A  34   3.629  -4.138   7.369
  353    H2'    A  34          H2''        A  34   1.429  -3.551   7.059
  354   HO2'    A  34          H2'         A  34   0.678  -1.456   7.437
  355    H1'    A  34           H1'        A  34   1.685  -1.393   5.255
  356    H8     A  34           H8         A  34   2.824  -5.052   4.553
  357    H61    A  34           H61        A  34  -2.622  -5.654   1.693
  358    H62    A  34           H62        A  34  -1.027  -6.341   1.904
  359    H2     A  34           H2         A  34  -2.540  -1.647   3.708
  360    H5'    C  35           H5'        C  35   1.323  -1.622   9.878
  361   H5''    C  35          H5''        C  35   0.791  -2.645  11.227
  362    H4'    C  35           H4'        C  35  -0.820  -1.991   9.115
  363    H3'    C  35           H3'        C  35  -0.795  -3.822  11.322
  364    H2'    C  35          H2''        C  35  -0.369  -5.754  10.116
  365   HO2'    C  35          H2'         C  35  -2.217  -6.777   9.928
  366    H1'    C  35           H1'        C  35  -1.688  -4.761   7.620
  367    H41    C  35           H41        C  35   1.742  -9.529   5.200
  368    H42    C  35           H42        C  35   3.070  -9.208   6.293
  369    H5     C  35           H5         C  35   3.028  -7.454   7.942
  370    H6     C  35           H6         C  35   1.694  -5.649   8.923
  371    H5'    U  36           H5'        U  36  -2.419  -1.355  11.803
  372   H5''    U  36          H5''        U  36  -3.261  -1.193  13.358
  373    H4'    U  36           H4'        U  36  -3.807   0.883  12.504
  374    H3'    U  36           H3'        U  36  -5.746  -1.212  11.659
  375    H2'    U  36          H2''        U  36  -6.653  -0.100   9.854
  376   HO2'    U  36          H2'         U  36  -6.642   2.170   9.689
  377    H1'    U  36           H1'        U  36  -4.516   1.443   9.006
  378    H3     U  36           H3         U  36  -6.360  -2.094   6.309
  379    H5     U  36           H5         U  36  -2.454  -3.031   7.559
  380    H6     U  36           H6         U  36  -2.594  -1.233   9.163
  381    H5'    A  37           H5'        A  37  -9.699   0.813  13.457
  382   H5''    A  37          H5''        A  37 -10.089  -0.832  13.996
  383    H4'    A  37           H4'        A  37 -11.542   0.355  12.099
  384    H3'    A  37           H3'        A  37 -10.554  -2.482  12.414
  385    H2'    A  37          H2''        A  37 -11.403  -3.142  10.345
  386   HO2'    A  37          H2'         A  37 -13.097  -2.239   9.415
  387    H1'    A  37           H1'        A  37 -10.737  -0.907   8.900
  388    H8     A  37           H8         A  37  -7.743  -1.449  11.031
  389    H61    A  37           H61        A  37  -6.297  -6.358   7.585
  390    H62    A  37           H62        A  37  -5.688  -5.140   8.684
  391    H2     A  37           H2         A  37 -10.485  -5.120   6.543
  392    H5'    C  38           H5'        C  38 -14.481  -2.589  11.271
  393   H5''    C  38          H5''        C  38 -15.613  -3.363  12.397
  394    H4'    C  38           H4'        C  38 -16.166  -4.179  10.192
  395    H3'    C  38           H3'        C  38 -14.712  -5.981  12.108
  396    H2'    C  38          H2''        C  38 -14.334  -7.665  10.550
  397   HO2'    C  38          H2'         C  38 -16.180  -8.118   9.590
  398    H1'    C  38           H1'        C  38 -13.944  -6.152   8.278
  399    H41    C  38           H41        C  38  -8.228  -7.947  10.545
  400    H42    C  38           H42        C  38  -8.188  -6.508  11.539
  401    H5     C  38           H5         C  38 -10.107  -5.098  11.881
  402    H6     C  38           H6         C  38 -12.399  -4.622  11.170
  403    H5'    A  39           H5'        A  39 -18.218  -8.888  11.790
  404   H5''    A  39          H5''        A  39 -17.807  -9.910  13.181
  405    H4'    A  39           H4'        A  39 -17.299 -10.715  10.673
  406    H3'    A  39           H3'        A  39 -15.667 -10.969  13.207
  407    H2'    A  39          H2''        A  39 -13.997 -12.136  12.052
  408   HO2'    A  39          H2'         A  39 -14.969 -13.638  10.854
  409    H1'    A  39           H1'        A  39 -14.142 -10.628   9.685
  410    H8     A  39           H8         A  39 -14.015  -8.157  12.472
  411    H61    A  39           H61        A  39  -8.014  -9.482  13.142
  412    H62    A  39           H62        A  39  -9.272  -8.311  13.467
  413    H2     A  39           H2         A  39  -9.822 -12.560  10.428
  414    H5'    A  40           H5'        A  40 -17.724 -14.858  11.905
  415   H5''    A  40          H5''        A  40 -17.891 -16.172  13.086
  416    H4'    A  40           H4'        A  40 -16.587 -16.836  11.028
  417    H3'    A  40           H3'        A  40 -15.644 -16.924  13.869
  418    H2'    A  40          H2''        A  40 -13.416 -17.198  13.409
  419   HO2'    A  40          H2'         A  40 -13.508 -19.108  12.337
  420    H1'    A  40           H1'        A  40 -13.275 -16.170  10.778
  421    H8     A  40           H8         A  40 -14.519 -13.794  13.526
  422    H61    A  40           H61        A  40  -8.563 -12.413  14.442
  423    H62    A  40           H62        A  40 -10.216 -11.942  14.770
  424    H2     A  40           H2         A  40  -8.775 -15.810  11.515
  425    H5'    A  41           H5'        A  41 -14.514 -21.557  12.805
  426   H5''    A  41          H5''        A  41 -14.638 -22.068  14.499
  427    H4'    A  41           H4'        A  41 -12.315 -22.239  13.217
  428    H3'    A  41           H3'        A  41 -13.064 -21.485  16.021
  429    H2'    A  41          H2''        A  41 -11.047 -20.529  16.551
  430   HO2'    A  41          H2'         A  41  -9.916 -22.483  16.212
  431    H1'    A  41           H1'        A  41 -10.030 -20.028  13.931
  432    H8     A  41           H8         A  41 -13.184 -18.197  15.201
  433    H61    A  41           H61        A  41  -9.265 -13.787  17.059
  434    H62    A  41           H62        A  41 -10.941 -14.187  16.758
  435    H2     A  41           H2         A  41  -6.849 -17.258  15.559
  436    H5'    U  42           H5'        U  42  -9.657 -24.807  15.511
  437   H5''    U  42          H5''        U  42  -9.568 -25.759  17.007
  438    H4'    U  42           H4'        U  42  -7.311 -24.904  16.139
  439    H3'    U  42           H3'        U  42  -8.541 -24.253  18.833
  440    H2'    U  42          H2''        U  42  -6.753 -22.906  19.457
  441   HO2'    U  42          H2'         U  42  -5.280 -24.333  17.492
  442    H1'    U  42           H1'        U  42  -6.102 -21.940  16.896
  443    H3     U  42           H3         U  42  -7.063 -18.143  19.148
  444    H5     U  42           H5         U  42 -10.766 -20.131  18.915
  445    H6     U  42           H6         U  42  -9.614 -22.040  17.984
  446    H5'    U  43           H5'        U  43  -4.581 -25.152  19.805
  447   H5''    U  43          H5''        U  43  -4.478 -25.908  21.408
  448    H4'    U  43           H4'        U  43  -3.339 -23.652  21.282
  449    H3'    U  43           H3'        U  43  -5.662 -24.347  23.076
  450    H2'    U  43          H2''        U  43  -5.899 -22.188  23.890
  451   HO2'    U  43          H2'         U  43  -3.211 -21.737  23.059
  452    H1'    U  43           H1'        U  43  -4.958 -20.770  21.647
  453    H3     U  43           H3         U  43  -9.067 -18.995  22.076
  454    H5     U  43           H5         U  43  -9.861 -23.086  21.450
  455    H6     U  43           H6         U  43  -7.469 -23.487  21.466
  456    H5'    A  44           H5'        A  44  -1.056 -23.871  25.977
  457   H5''    A  44          H5''        A  44  -2.001 -24.134  27.456
  458    H4'    A  44           H4'        A  44  -0.127 -22.244  27.378
  459    H3'    A  44           H3'        A  44  -2.878 -22.334  28.597
  460    H2'    A  44          H2''        A  44  -2.865 -20.084  29.202
  461   HO2'    A  44          H2'         A  44  -0.093 -20.440  29.178
  462    H1'    A  44           H1'        A  44  -1.499 -19.044  27.030
  463    H8     A  44           H8         A  44  -3.924 -21.240  25.365
  464    H61    A  44           H61        A  44  -8.481 -17.426  27.034
  465    H62    A  44           H62        A  44  -8.015 -18.735  25.971
  466    H2     A  44           H2         A  44  -4.764 -16.182  29.212
  467    H5'    A  45           H5'        A  45  -0.604 -20.804  31.963
  468   H5''    A  45          H5''        A  45  -1.307 -21.470  33.450
  469    H4'    A  45           H4'        A  45  -1.446 -18.903  33.136
  470    H3'    A  45           H3'        A  45  -3.611 -20.862  33.854
  471    H2'    A  45          H2''        A  45  -5.331 -19.375  33.575
  472   HO2'    A  45          H2'         A  45  -4.240 -17.968  35.188
  473    H1'    A  45           H1'        A  45  -4.055 -17.467  31.880
  474    H8     A  45           H8         A  45  -4.409 -20.790  30.157
  475    H61    A  45           H61        A  45 -10.347 -19.386  29.171
  476    H62    A  45           H62        A  45  -9.008 -20.397  28.676
  477    H2     A  45           H2         A  45  -8.658 -16.355  32.015
  478    H5'    G  46           H5'        G  46  -2.812 -18.623  38.369
  479   H5''    G  46          H5''        G  46  -4.003 -19.562  39.290
  480    H4'    G  46           H4'        G  46  -4.246 -16.909  39.027
  481    H3'    G  46           H3'        G  46  -6.218 -19.171  39.127
  482    H2'    G  46          H2''        G  46  -8.037 -17.911  38.421
  483   HO2'    G  46          H2'         G  46  -7.539 -16.223  40.009
  484    H1'    G  46           H1'        G  46  -6.789 -16.168  36.667
  485    H8     G  46           H8         G  46  -5.436 -19.513  35.782
  486    H1     G  46           H1         G  46 -11.567 -18.832  34.050
  487    H21    G  46           H21        G  46 -12.421 -17.025  34.984
  488    H22    G  46           H22        G  46 -11.547 -16.083  36.170
  489    H5'    C  47           H5'        C  47  -8.252 -16.984  42.624
  490   H5''    C  47          H5''        C  47  -8.969 -18.395  43.426
  491    H4'    C  47           H4'        C  47 -10.508 -16.650  42.121
  492    H3'    C  47           H3'        C  47 -10.573 -19.642  42.403
  493    H2'    C  47          H2''        C  47 -12.066 -19.981  40.699
  494   HO2'    C  47          H2'         C  47 -13.862 -18.887  40.626
  495    H1'    C  47           H1'        C  47 -11.718 -17.547  39.251
  496    H41    C  47           H41        C  47 -10.427 -22.411  35.352
  497    H42    C  47           H42        C  47  -8.857 -22.608  36.092
  498    H5     C  47           H5         C  47  -8.067 -21.203  37.892
  499    H6     C  47           H6         C  47  -8.723 -19.532  39.563
  500    H5'    C  48           H5'        C  48 -15.014 -18.300  42.354
  501   H5''    C  48          H5''        C  48 -15.541 -19.021  43.888
  502    H4'    C  48           H4'        C  48 -17.174 -19.648  42.205
  503    H3'    C  48           H3'        C  48 -15.194 -21.704  43.149
  504   HO3'    C  48          H3T         C  48 -18.001 -21.285  43.399
  505    H2'    C  48          H2''        C  48 -15.860 -23.300  41.635
  506   HO2'    C  48          H2'         C  48 -17.965 -23.239  40.663
  507    H1'    C  48           H1'        C  48 -16.795 -21.592  39.577
  508    H41    C  48           H41        C  48 -11.597 -24.528  37.353
  509    H42    C  48           H42        C  48 -10.584 -23.673  38.495
  510    H5     C  48           H5         C  48 -11.468 -22.311  40.269
  511    H6     C  48           H6         C  48 -13.493 -21.316  41.221
  Start of MODEL    2
    1    H5'    G   1           H5'        G   1 -13.942 -27.193  29.690
    2   H5''    G   1          H5''        G   1 -14.308 -25.657  28.880
    3    H4'    G   1           H4'        G   1 -16.404 -26.538  29.712
    4    H3'    G   1           H3'        G   1 -15.109 -24.157  30.943
    5    H2'    G   1          H2''        G   1 -16.356 -24.100  32.900
    6   HO2'    G   1          H2'         G   1 -18.415 -24.770  33.036
    7    H1'    G   1           H1'        G   1 -16.764 -26.761  33.381
    8    H8     G   1           H8         G   1 -13.323 -27.264  32.760
    9    H1     G   1           H1         G   1 -13.850 -22.845  37.373
   10    H21    G   1           H21        G   1 -15.929 -22.120  37.503
   11    H22    G   1           H22        G   1 -17.148 -22.566  36.329
   12   HO5'    G   1          H5T         G   1 -12.725 -26.156  31.018
   13    H5'    G   2           H5'        G   2 -19.035 -22.227  30.516
   14   H5''    G   2          H5''        G   2 -18.717 -20.660  29.746
   15    H4'    G   2           H4'        G   2 -19.693 -20.487  32.081
   16    H3'    G   2           H3'        G   2 -17.150 -19.289  31.061
   17    H2'    G   2          H2''        G   2 -16.279 -18.714  33.110
   18   HO2'    G   2          H2'         G   2 -17.716 -17.448  34.042
   19    H1'    G   2           H1'        G   2 -17.467 -20.616  34.775
   20    H8     G   2           H8         G   2 -15.785 -22.439  31.973
   21    H1     G   2           H1         G   2 -11.625 -20.109  36.256
   22    H21    G   2           H21        G   2 -12.663 -18.729  37.638
   23    H22    G   2           H22        G   2 -14.322 -18.231  37.390
   24    H5'    C   3           H5'        C   3 -19.301 -14.833  32.159
   25   H5''    C   3          H5''        C   3 -18.253 -14.097  30.931
   26    H4'    C   3           H4'        C   3 -18.130 -13.293  33.469
   27    H3'    C   3           H3'        C   3 -16.040 -13.726  31.351
   28    H2'    C   3          H2''        C   3 -14.250 -13.515  32.795
   29   HO2'    C   3          H2'         C   3 -14.253 -12.218  34.550
   30    H1'    C   3           H1'        C   3 -15.414 -14.433  35.170
   31    H41    C   3           H41        C   3 -11.187 -18.772  33.154
   32    H42    C   3           H42        C   3 -12.344 -19.375  31.991
   33    H5     C   3           H5         C   3 -14.552 -18.452  31.732
   34    H6     C   3           H6         C   3 -16.056 -16.632  32.385
   35    H5'    U   4           H5'        U   4 -14.374  -9.391  32.215
   36   H5''    U   4          H5''        U   4 -13.706  -9.260  30.577
   37    H4'    U   4           H4'        U   4 -12.090  -9.426  32.693
   38    H3'    U   4           H3'        U   4 -11.943 -10.692  29.952
   39    H2'    U   4          H2''        U   4 -10.021 -11.876  30.485
   40   HO2'    U   4          H2'         U   4  -9.686 -10.051  32.642
   41    H1'    U   4           H1'        U   4 -10.574 -12.361  33.182
   42    H3     U   4           H3         U   4  -9.977 -16.311  30.960
   43    H5     U   4           H5         U   4 -13.893 -15.096  29.983
   44    H6     U   4           H6         U   4 -13.438 -12.978  31.073
   45    H5'    U   5           H5'        U   5  -8.069  -9.165  31.460
   46   H5''    U   5          H5''        U   5  -7.453  -8.041  30.233
   47    H4'    U   5           H4'        U   5  -5.610  -9.433  31.079
   48    H3'    U   5           H3'        U   5  -6.640  -9.583  28.279
   49    H2'    U   5          H2''        U   5  -5.613 -11.554  27.708
   50   HO2'    U   5          H2'         U   5  -3.642 -11.004  29.688
   51    H1'    U   5           H1'        U   5  -5.190 -12.707  30.259
   52    H3     U   5           H3         U   5  -7.217 -16.054  28.007
   53    H5     U   5           H5         U   5 -10.211 -13.111  28.359
   54    H6     U   5           H6         U   5  -8.539 -11.613  29.268
   55    H5'    G   6           H5'        G   6  -4.203  -9.066  24.657
   56   H5''    G   6          H5''        G   6  -5.238 -10.024  25.738
   57    H4'    G   6           H4'        G   6  -2.351 -10.840  25.356
   58    H3'    G   6           H3'        G   6  -4.564 -10.840  23.342
   59    H2'    G   6          H2''        G   6  -4.611 -13.105  22.996
   60   HO2'    G   6          H2'         G   6  -2.475 -13.220  22.267
   61    H1'    G   6           H1'        G   6  -3.423 -14.043  25.392
   62    H8     G   6           H8         G   6  -6.612 -12.086  26.005
   63    H1     G   6           H1         G   6  -7.641 -18.065  23.929
   64    H21    G   6           H21        G   6  -5.739 -18.991  23.307
   65    H22    G   6           H22        G   6  -4.230 -18.108  23.283
   66    H5'    A   7           H5'        A   7  -0.469 -12.445  21.789
   67   H5''    A   7          H5''        A   7  -0.264 -11.872  20.121
   68    H4'    A   7           H4'        A   7   0.355 -14.296  20.416
   69    H3'    A   7           H3'        A   7  -1.730 -13.195  18.573
   70    H2'    A   7          H2''        A   7  -2.730 -15.202  18.079
   71   HO2'    A   7          H2'         A   7  -0.219 -16.391  18.680
   72    H1'    A   7           H1'        A   7  -2.068 -16.718  20.350
   73    H8     A   7           H8         A   7  -3.925 -13.497  21.160
   74    H61    A   7           H61        A   7  -9.131 -16.559  19.850
   75    H62    A   7           H62        A   7  -8.451 -15.146  20.628
   76    H2     A   7           H2         A   7  -5.665 -19.136  18.652
   77    H5'    U   8           H5'        U   8   0.582 -16.471  16.446
   78   H5''    U   8          H5''        U   8   0.769 -15.967  14.754
   79    H4'    U   8           H4'        U   8  -0.228 -18.278  15.035
   80    H3'    U   8           H3'        U   8  -1.466 -15.952  13.594
   81    H2'    U   8          H2''        U   8  -3.521 -16.943  13.317
   82   HO2'    U   8          H2'         U   8  -2.355 -19.515  13.625
   83    H1'    U   8           H1'        U   8  -3.469 -18.804  15.464
   84    H3     U   8           H3         U   8  -7.429 -16.721  16.070
   85    H5     U   8           H5         U   8  -4.594 -13.673  16.708
   86    H6     U   8           H6         U   8  -2.868 -15.213  15.988
   87    H5'    U   9           H5'        U   9  -2.093 -19.071  10.861
   88   H5''    U   9          H5''        U   9  -1.565 -18.609   9.231
   89    H4'    U   9           H4'        U   9  -3.885 -19.249   9.048
   90    H3'    U   9           H3'        U   9  -3.184 -16.321   8.975
   91    H2'    U   9          H2''        U   9  -5.360 -15.609   9.111
   92   HO2'    U   9          H2'         U   9  -5.979 -16.670   7.189
   93    H1'    U   9           H1'        U   9  -6.540 -17.952  10.252
   94    H3     U   9           H3         U   9  -8.379 -14.907  12.950
   95    H5     U   9           H5         U   9  -4.265 -14.028  13.240
   96    H6     U   9           H6         U   9  -3.844 -15.773  11.606
   97    H5'    G  10           H5'        G  10  -5.554 -17.504   4.696
   98   H5''    G  10          H5''        G  10  -5.232 -16.006   3.803
   99    H4'    G  10           H4'        G  10  -7.731 -16.861   4.139
  100    H3'    G  10           H3'        G  10  -6.513 -14.102   4.266
  101    H2'    G  10          H2''        G  10  -8.499 -13.114   4.934
  102   HO2'    G  10          H2'         G  10  -9.946 -13.774   3.463
  103    H1'    G  10           H1'        G  10  -9.566 -15.234   6.424
  104    H8     G  10           H8         G  10  -6.088 -14.590   7.640
  105    H1     G  10           H1         G  10 -10.176  -9.936   9.310
  106    H21    G  10           H21        G  10 -12.086 -10.192   8.236
  107    H22    G  10           H22        G  10 -12.297 -11.393   6.981
  108    H5'    U  11           H5'        U  11  -9.825 -13.784   0.759
  109   H5''    U  11          H5''        U  11  -9.318 -12.284  -0.043
  110    H4'    U  11           H4'        U  11 -11.731 -12.475   1.077
  111    H3'    U  11           H3'        U  11  -9.711 -10.233   0.990
  112    H2'    U  11          H2''        U  11 -10.975  -8.870   2.402
  113   HO2'    U  11          H2'         U  11 -12.950  -9.208   1.228
  114    H1'    U  11           H1'        U  11 -11.998 -10.834   4.084
  115    H3     U  11           H3         U  11  -9.305  -7.830   6.329
  116    H5     U  11           H5         U  11  -6.750 -10.839   4.855
  117    H6     U  11           H6         U  11  -8.605 -11.682   3.542
  118    H5'    A  12           H5'        A  12 -12.638  -7.685  -1.569
  119   H5''    A  12          H5''        A  12 -11.419  -6.478  -2.019
  120    H4'    A  12           H4'        A  12 -13.271  -5.950  -0.153
  121    H3'    A  12           H3'        A  12 -10.323  -5.255  -0.291
  122    H2'    A  12          H2''        A  12 -10.473  -4.097   1.760
  123   HO2'    A  12          H2'         A  12 -12.518  -3.087   1.312
  124    H1'    A  12           H1'        A  12 -11.927  -6.016   3.079
  125    H8     A  12           H8         A  12  -9.598  -8.061   1.037
  126    H61    A  12           H61        A  12  -4.962  -6.154   4.655
  127    H62    A  12           H62        A  12  -5.488  -7.376   3.519
  128    H2     A  12           H2         A  12  -8.566  -3.646   5.571
  129    H5'    U  13           H5'        U  13 -11.629  -0.911  -0.177
  130   H5''    U  13          H5''        U  13 -10.274  -0.180  -1.055
  131    H4'    U  13           H4'        U  13 -10.603   0.295   1.538
  132    H3'    U  13           H3'        U  13  -8.127  -0.240  -0.109
  133    H2'    U  13          H2''        U  13  -6.740  -0.251   1.793
  134   HO2'    U  13          H2'         U  13  -7.490   1.726   2.643
  135    H1'    U  13           H1'        U  13  -8.495  -1.370   3.609
  136    H3     U  13           H3         U  13  -4.548  -3.735   2.818
  137    H5     U  13           H5         U  13  -7.450  -5.227   0.153
  138    H6     U  13           H6         U  13  -8.888  -3.384   0.780
  139    H5'    U  14           H5'        U  14  -6.937   3.525   1.390
  140   H5''    U  14          H5''        U  14  -6.449   4.605   0.068
  141    H4'    U  14           H4'        U  14  -4.525   4.301   1.524
  142    H3'    U  14           H3'        U  14  -4.598   2.937  -1.162
  143    H2'    U  14          H2''        U  14  -2.611   1.792  -0.818
  144   HO2'    U  14          H2'         U  14  -1.311   3.497  -0.196
  145    H1'    U  14           H1'        U  14  -2.812   1.354   1.921
  146    H3     U  14           H3         U  14  -2.631  -2.717  -0.105
  147    H5     U  14           H5         U  14  -6.516  -1.319  -0.939
  148    H6     U  14           H6         U  14  -5.897   0.804   0.061
  149    H5'    A  15           H5'        A  15  -1.166   6.289  -1.297
  150   H5''    A  15          H5''        A  15  -0.479   6.339  -2.933
  151    H4'    A  15           H4'        A  15   0.994   5.513  -0.865
  152    H3'    A  15           H3'        A  15   0.795   4.661  -3.734
  153    H2'    A  15          H2''        A  15   1.919   2.675  -3.469
  154   HO2'    A  15          H2'         A  15   3.178   3.854  -1.207
  155    H1'    A  15           H1'        A  15   1.438   2.155  -0.739
  156    H8     A  15           H8         A  15  -1.749   2.550  -2.780
  157    H61    A  15           H61        A  15  -0.981  -3.313  -4.543
  158    H62    A  15           H62        A  15  -2.137  -2.016  -4.339
  159    H2     A  15           H2         A  15   2.808  -1.954  -2.573
  160    H5'    U  16           H5'        U  16   5.360   4.836  -2.495
  161   H5''    U  16          H5''        U  16   6.165   5.287  -4.011
  162    H4'    U  16           H4'        U  16   7.075   3.186  -2.858
  163    H3'    U  16           H3'        U  16   6.105   3.457  -5.693
  164    H2'    U  16          H2''        U  16   6.221   1.198  -6.142
  165   HO2'    U  16          H2'         U  16   7.741  -0.124  -5.308
  166    H1'    U  16           H1'        U  16   5.862   0.168  -3.539
  167    H3     U  16           H3         U  16   2.787  -1.930  -6.140
  168    H5     U  16           H5         U  16   1.323   1.995  -5.751
  169    H6     U  16           H6         U  16   3.457   2.626  -4.796
  170    H5'    U  17           H5'        U  17  10.119   1.359  -6.352
  171   H5''    U  17          H5''        U  17  10.611   2.009  -7.928
  172    H4'    U  17           H4'        U  17  10.255  -0.554  -7.771
  173    H3'    U  17           H3'        U  17   9.157   1.401  -9.782
  174    H2'    U  17          H2''        U  17   7.722  -0.108 -10.737
  175   HO2'    U  17          H2'         U  17   9.517  -2.146  -9.886
  176    H1'    U  17           H1'        U  17   7.514  -1.980  -8.590
  177    H3     U  17           H3         U  17   3.321  -1.363 -10.207
  178    H5     U  17           H5         U  17   4.224   2.252  -8.235
  179    H6     U  17           H6         U  17   6.500   1.455  -7.964
  180    H5'    A  18           H5'        A  18  10.851  -2.442 -11.655
  181   H5''    A  18          H5''        A  18  11.722  -1.941 -13.117
  182    H4'    A  18           H4'        A  18  10.291  -3.896 -13.600
  183    H3'    A  18           H3'        A  18   9.712  -1.179 -14.776
  184    H2'    A  18          H2''        A  18   7.723  -1.847 -15.716
  185   HO2'    A  18          H2'         A  18   9.162  -3.882 -16.480
  186    H1'    A  18           H1'        A  18   7.149  -4.069 -14.016
  187    H8     A  18           H8         A  18   7.317  -0.561 -12.473
  188    H61    A  18           H61        A  18   1.346  -0.063 -13.984
  189    H62    A  18           H62        A  18   2.685   0.677 -13.135
  190    H2     A  18           H2         A  18   2.933  -3.844 -15.808
  191    H5'    A  19           H5'        A  19   9.847  -4.189 -18.559
  192   H5''    A  19          H5''        A  19  10.156  -2.986 -19.825
  193    H4'    A  19           H4'        A  19   7.992  -4.479 -19.977
  194    H3'    A  19           H3'        A  19   8.372  -1.518 -20.406
  195    H2'    A  19          H2''        A  19   6.116  -1.108 -20.602
  196   HO2'    A  19          H2'         A  19   5.015  -2.270 -21.945
  197    H1'    A  19           H1'        A  19   5.130  -3.374 -19.165
  198    H8     A  19           H8         A  19   7.268  -0.849 -17.234
  199    H61    A  19           H61        A  19   2.005   2.214 -16.204
  200    H62    A  19           H62        A  19   3.708   2.104 -15.823
  201    H2     A  19           H2         A  19   1.144  -1.091 -19.116
  202    H5'    A  20           H5'        A  20   6.143  -2.936 -24.477
  203   H5''    A  20          H5''        A  20   6.478  -1.474 -25.424
  204    H4'    A  20           H4'        A  20   3.972  -2.158 -24.855
  205    H3'    A  20           H3'        A  20   5.367   0.519 -24.868
  206    H2'    A  20          H2''        A  20   3.525   1.629 -24.012
  207   HO2'    A  20          H2'         A  20   1.660   1.249 -24.870
  208    H1'    A  20           H1'        A  20   2.396  -0.478 -22.520
  209    H8     A  20           H8         A  20   6.082   0.566 -21.928
  210    H61    A  20           H61        A  20   3.826   4.557 -17.786
  211    H62    A  20           H62        A  20   5.264   3.751 -18.371
  212    H2     A  20           H2         A  20   0.363   2.682 -19.933
  213    H5'    U  21           H5'        U  21   1.874   1.571 -27.488
  214   H5''    U  21          H5''        U  21   2.428   3.047 -28.301
  215    H4'    U  21           H4'        U  21   0.550   3.200 -26.439
  216    H3'    U  21           H3'        U  21   2.919   4.919 -27.091
  217    H2'    U  21          H2''        U  21   2.906   6.102 -25.111
  218   HO2'    U  21          H2'         U  21   0.119   5.548 -25.035
  219    H1'    U  21           H1'        U  21   1.574   4.289 -23.418
  220    H3     U  21           H3         U  21   5.369   5.565 -21.264
  221    H5     U  21           H5         U  21   6.766   3.253 -24.499
  222    H6     U  21           H6         U  21   4.472   3.042 -25.253
  223    H5'    U  22           H5'        U  22  -0.642   7.524 -26.185
  224   H5''    U  22          H5''        U  22  -0.685   8.857 -27.358
  225    H4'    U  22           H4'        U  22  -0.858   9.609 -24.944
  226    H3'    U  22           H3'        U  22   1.059  10.482 -27.035
  227    H2'    U  22          H2''        U  22   2.797  11.074 -25.701
  228   HO2'    U  22          H2'         U  22   0.836  12.144 -23.942
  229    H1'    U  22           H1'        U  22   1.809  10.218 -23.129
  230    H3     U  22           H3         U  22   6.078   9.080 -22.379
  231    H5     U  22           H5         U  22   5.255   7.233 -26.076
  232    H6     U  22           H6         U  22   3.061   8.266 -26.032
  233    H5'    A  23           H5'        A  23   2.350  13.334 -28.400
  234   H5''    A  23          H5''        A  23   2.826  12.164 -27.157
  235    H4'    A  23           H4'        A  23   4.538  14.008 -27.651
  236    H3'    A  23           H3'        A  23   3.578  12.915 -25.136
  237    H2'    A  23          H2''        A  23   2.980  14.833 -24.038
  238   HO2'    A  23          H2'         A  23   5.719  15.457 -24.531
  239    H1'    A  23           H1'        A  23   4.000  16.911 -25.752
  240    H8     A  23           H8         A  23   0.702  15.588 -26.767
  241    H61    A  23           H61        A  23  -1.947  18.667 -22.101
  242    H62    A  23           H62        A  23  -2.227  17.680 -23.518
  243    H2     A  23           H2         A  23   2.494  18.788 -21.500
  244    H5'    A  24           H5'        A  24   7.444  12.080 -22.703
  245   H5''    A  24          H5''        A  24   6.286  11.163 -21.721
  246    H4'    A  24           H4'        A  24   7.031  13.938 -21.473
  247    H3'    A  24           H3'        A  24   5.268  11.884 -20.140
  248    H2'    A  24          H2''        A  24   3.844  13.443 -19.231
  249   HO2'    A  24          H2'         A  24   6.047  15.253 -19.168
  250    H1'    A  24           H1'        A  24   4.543  15.677 -20.935
  251    H8     A  24           H8         A  24   2.673  13.226 -22.944
  252    H61    A  24           H61        A  24  -2.538  15.166 -20.244
  253    H62    A  24           H62        A  24  -1.855  14.144 -21.490
  254    H2     A  24           H2         A  24   0.927  16.834 -17.936
  255    H5'    U  25           H5'        U  25   4.479  12.076 -17.750
  256   H5''    U  25          H5''        U  25   5.184  13.639 -17.291
  257    H4'    U  25           H4'        U  25   4.612  11.665 -15.094
  258    H3'    U  25           H3'        U  25   2.654  12.175 -16.983
  259    H2'    U  25          H2''        U  25   2.384  14.468 -16.752
  260   HO2'    U  25          H2'         U  25   1.088  13.559 -14.384
  261    H1'    U  25           H1'        U  25   3.014  14.556 -13.846
  262    H3     U  25           H3         U  25   3.724  18.969 -13.977
  263    H5     U  25           H5         U  25   4.736  17.771 -17.888
  264    H6     U  25           H6         U  25   4.247  15.485 -17.246
  265    H5'    U  26           H5'        U  26   1.042  13.009 -17.722
  266   H5''    U  26          H5''        U  26  -0.556  12.715 -17.012
  267    H4'    U  26           H4'        U  26  -0.948  12.767 -19.378
  268    H3'    U  26           H3'        U  26  -0.839  10.142 -17.981
  269    H2'    U  26          H2''        U  26  -0.429   8.800 -19.790
  270   HO2'    U  26          H2'         U  26  -2.198   9.186 -20.998
  271    H1'    U  26           H1'        U  26   0.746  10.589 -21.597
  272    H3     U  26           H3         U  26   3.451   6.924 -20.973
  273    H5     U  26           H5         U  26   4.341   9.558 -17.811
  274    H6     U  26           H6         U  26   2.443  10.906 -18.478
  275    H5'    C  27           H5'        C  27  -5.036   9.443 -19.547
  276   H5''    C  27          H5''        C  27  -5.797   8.578 -18.196
  277    H4'    C  27           H4'        C  27  -5.327   7.103 -20.194
  278    H3'    C  27           H3'        C  27  -4.195   6.740 -17.431
  279    H2'    C  27          H2''        C  27  -2.808   4.986 -18.036
  280   HO2'    C  27          H2'         C  27  -3.229   3.700 -19.899
  281    H1'    C  27           H1'        C  27  -2.363   5.671 -20.732
  282    H41    C  27           H41        C  27   3.180   6.547 -17.754
  283    H42    C  27           H42        C  27   2.432   7.540 -16.523
  284    H5     C  27           H5         C  27   0.050   7.875 -16.380
  285    H6     C  27           H6         C  27  -2.087   7.587 -17.539
  286    H5'    U  28           H5'        U  28  -7.681   2.961 -17.852
  287   H5''    U  28          H5''        U  28  -7.160   1.891 -16.535
  288    H4'    U  28           H4'        U  28  -7.129   1.079 -19.108
  289    H3'    U  28           H3'        U  28  -5.181   0.612 -16.834
  290    H2'    U  28          H2''        U  28  -3.844  -0.746 -18.224
  291   HO2'    U  28          H2'         U  28  -4.540  -1.663 -20.067
  292    H1'    U  28           H1'        U  28  -3.930   0.943 -20.408
  293    H3     U  28           H3         U  28   0.175   0.773 -18.253
  294    H5     U  28           H5         U  28  -2.109   3.633 -16.184
  295    H6     U  28           H6         U  28  -4.020   2.987 -17.508
  296    H5'    U  29           H5'        U  29  -6.253  -3.344 -18.207
  297   H5''    U  29          H5''        U  29  -6.429  -4.491 -16.865
  298    H4'    U  29           H4'        U  29  -4.731  -5.206 -18.600
  299    H3'    U  29           H3'        U  29  -4.219  -4.768 -15.671
  300    H2'    U  29          H2''        U  29  -1.922  -5.005 -15.831
  301   HO2'    U  29          H2'         U  29  -2.400  -6.386 -18.270
  302    H1'    U  29           H1'        U  29  -1.493  -4.020 -18.398
  303    H3     U  29           H3         U  29   0.900  -1.635 -15.280
  304    H5     U  29           H5         U  29  -2.973   0.019 -15.236
  305    H6     U  29           H6         U  29  -3.701  -1.817 -16.643
  306    H5'    A  30           H5'        A  30  -1.913  -8.219 -16.581
  307   H5''    A  30          H5''        A  30  -2.148  -9.422 -15.299
  308    H4'    A  30           H4'        A  30   0.264  -8.826 -15.622
  309    H3'    A  30           H3'        A  30  -1.271  -8.318 -13.074
  310    H2'    A  30          H2''        A  30   0.444  -7.146 -12.097
  311   HO2'    A  30          H2'         A  30   2.056  -8.561 -12.009
  312    H1'    A  30           H1'        A  30   1.858  -6.370 -14.466
  313    H8     A  30           H8         A  30  -1.636  -4.890 -14.017
  314    H61    A  30           H61        A  30   1.113  -0.493 -10.655
  315    H62    A  30           H62        A  30  -0.405  -1.058 -11.313
  316    H2     A  30           H2         A  30   4.109  -3.746 -11.413
  317    H5'    A  31           H5'        A  31   2.607 -11.206 -11.642
  318   H5''    A  31          H5''        A  31   1.877 -11.610 -10.076
  319    H4'    A  31           H4'        A  31   4.261 -10.429 -10.188
  320    H3'    A  31           H3'        A  31   1.901 -10.044  -8.352
  321    H2'    A  31          H2''        A  31   2.808  -8.195  -7.321
  322   HO2'    A  31          H2'         A  31   5.345  -9.170  -8.164
  323    H1'    A  31           H1'        A  31   4.428  -7.237  -9.426
  324    H8     A  31           H8         A  31   0.727  -7.613 -10.281
  325    H61    A  31           H61        A  31  -0.031  -2.024  -7.749
  326    H62    A  31           H62        A  31  -0.738  -3.235  -8.795
  327    H2     A  31           H2         A  31   4.160  -3.378  -6.907
  328    H5'    U  32           H5'        U  32   5.694 -10.796  -5.566
  329   H5''    U  32          H5''        U  32   4.948 -11.191  -4.005
  330    H4'    U  32           H4'        U  32   6.526  -9.062  -4.239
  331    H3'    U  32           H3'        U  32   3.955  -9.534  -2.744
  332    H2'    U  32          H2''        U  32   3.637  -7.316  -2.237
  333   HO2'    U  32          H2'         U  32   6.462  -7.205  -2.252
  334    H1'    U  32           H1'        U  32   5.238  -6.142  -4.293
  335    H3     U  32           H3         U  32   1.352  -3.774  -4.093
  336    H5     U  32           H5         U  32   0.298  -7.420  -5.921
  337    H6     U  32           H6         U  32   2.517  -8.250  -5.401
  338    H5'    A  33           H5'        A  33   6.898  -7.417  -0.158
  339   H5''    A  33          H5''        A  33   6.798  -8.049   1.497
  340    H4'    A  33           H4'        A  33   6.633  -5.538   1.389
  341    H3'    A  33           H3'        A  33   4.549  -7.396   2.493
  342    H2'    A  33          H2''        A  33   2.908  -5.803   2.672
  343   HO2'    A  33          H2'         A  33   4.937  -3.813   2.853
  344    H1'    A  33           H1'        A  33   3.872  -3.885   0.798
  345    H8     A  33           H8         A  33   2.889  -7.418  -0.402
  346    H61    A  33           H61        A  33  -2.797  -5.096  -1.129
  347    H62    A  33           H62        A  33  -1.729  -6.428  -1.512
  348    H2     A  33           H2         A  33  -0.269  -1.986   0.883
  349    H5'    A  34           H5'        A  34   5.471  -3.832   5.130
  350   H5''    A  34          H5''        A  34   5.651  -4.396   6.804
  351    H4'    A  34           H4'        A  34   4.311  -2.349   6.801
  352    H3'    A  34           H3'        A  34   3.148  -5.020   7.485
  353    H2'    A  34          H2''        A  34   0.941  -4.382   7.358
  354   HO2'    A  34          H2'         A  34   0.239  -2.337   7.942
  355    H1'    A  34           H1'        A  34   1.132  -2.117   5.684
  356    H8     A  34           H8         A  34   2.234  -5.721   4.696
  357    H61    A  34           H61        A  34  -3.300  -6.089   1.963
  358    H62    A  34           H62        A  34  -1.716  -6.819   2.107
  359    H2     A  34           H2         A  34  -3.145  -2.266   4.302
  360    H5'    C  35           H5'        C  35   1.203  -2.325  10.222
  361   H5''    C  35          H5''        C  35   0.754  -3.219  11.686
  362    H4'    C  35           H4'        C  35  -1.078  -2.338   9.878
  363    H3'    C  35           H3'        C  35  -0.938  -4.136  12.088
  364    H2'    C  35          H2''        C  35  -1.082  -6.123  10.932
  365   HO2'    C  35          H2'         C  35  -3.181  -5.924  11.870
  366    H1'    C  35           H1'        C  35  -2.597  -5.013   8.620
  367    H41    C  35           H41        C  35  -0.361 -10.488   6.284
  368    H42    C  35           H42        C  35   1.273 -10.064   6.745
  369    H5     C  35           H5         C  35   1.793  -8.158   8.127
  370    H6     C  35           H6         C  35   0.902  -6.121   9.154
  371    H5'    U  36           H5'        U  36  -3.120  -0.387  11.832
  372   H5''    U  36          H5''        U  36  -4.235   0.146  13.107
  373    H4'    U  36           H4'        U  36  -5.421   0.992  11.326
  374    H3'    U  36           H3'        U  36  -6.069  -1.924  11.663
  375    H2'    U  36          H2''        U  36  -7.059  -2.142   9.611
  376   HO2'    U  36          H2'         U  36  -8.475  -0.727   8.883
  377    H1'    U  36           H1'        U  36  -5.886   0.113   8.291
  378    H3     U  36           H3         U  36  -6.176  -3.926   5.885
  379    H5     U  36           H5         U  36  -2.301  -3.551   7.476
  380    H6     U  36           H6         U  36  -3.124  -1.804   8.932
  381    H5'    A  37           H5'        A  37 -10.522  -0.251  13.519
  382   H5''    A  37          H5''        A  37 -10.925  -1.898  14.039
  383    H4'    A  37           H4'        A  37 -12.439  -0.628  12.244
  384    H3'    A  37           H3'        A  37 -11.519  -3.496  12.455
  385    H2'    A  37          H2''        A  37 -12.498  -4.092  10.419
  386   HO2'    A  37          H2'         A  37 -14.159  -3.053   9.527
  387    H1'    A  37           H1'        A  37 -11.794  -1.869   8.978
  388    H8     A  37           H8         A  37  -8.786  -2.562  11.073
  389    H61    A  37           H61        A  37  -7.532  -7.393   7.448
  390    H62    A  37           H62        A  37  -6.875  -6.238   8.586
  391    H2     A  37           H2         A  37 -11.685  -5.986   6.490
  392    H5'    C  38           H5'        C  38 -15.356  -3.566  11.470
  393   H5''    C  38          H5''        C  38 -16.520  -4.317  12.580
  394    H4'    C  38           H4'        C  38 -17.054  -5.159  10.390
  395    H3'    C  38           H3'        C  38 -15.563  -6.961  12.287
  396    H2'    C  38          H2''        C  38 -15.243  -8.640  10.709
  397   HO2'    C  38          H2'         C  38 -17.251  -7.402   9.117
  398    H1'    C  38           H1'        C  38 -14.890  -7.097   8.446
  399    H41    C  38           H41        C  38  -9.104  -8.958  10.426
  400    H42    C  38           H42        C  38  -9.119  -7.733  11.673
  401    H5     C  38           H5         C  38 -10.951  -6.207  11.991
  402    H6     C  38           H6         C  38 -13.246  -5.663  11.342
  403    H5'    A  39           H5'        A  39 -19.176  -9.791  11.981
  404   H5''    A  39          H5''        A  39 -18.765 -10.888  13.314
  405    H4'    A  39           H4'        A  39 -18.383 -11.604  10.754
  406    H3'    A  39           H3'        A  39 -16.671 -12.056  13.208
  407    H2'    A  39          H2''        A  39 -15.127 -13.264  11.924
  408   HO2'    A  39          H2'         A  39 -15.629 -14.335  10.135
  409    H1'    A  39           H1'        A  39 -15.302 -11.642   9.630
  410    H8     A  39           H8         A  39 -14.865  -9.334  12.529
  411    H61    A  39           H61        A  39  -8.921 -11.017  12.739
  412    H62    A  39           H62        A  39 -10.088  -9.800  13.205
  413    H2     A  39           H2         A  39 -11.067 -13.843   9.997
  414    H5'    A  40           H5'        A  40 -18.942 -15.867  11.939
  415   H5''    A  40          H5''        A  40 -19.019 -17.186  13.125
  416    H4'    A  40           H4'        A  40 -17.806 -17.775  10.963
  417    H3'    A  40           H3'        A  40 -16.776 -17.969  13.775
  418    H2'    A  40          H2''        A  40 -14.569 -18.247  13.226
  419   HO2'    A  40          H2'         A  40 -14.814 -20.141  12.087
  420    H1'    A  40           H1'        A  40 -14.521 -17.136  10.622
  421    H8     A  40           H8         A  40 -15.609 -14.819  13.483
  422    H61    A  40           H61        A  40  -9.600 -13.510  14.123
  423    H62    A  40           H62        A  40 -11.211 -13.202  14.734
  424    H2     A  40           H2         A  40  -9.989 -16.898  11.203
  425    H5'    A  41           H5'        A  41 -15.865 -22.605  12.664
  426   H5''    A  41          H5''        A  41 -15.870 -23.129  14.359
  427    H4'    A  41           H4'        A  41 -13.644 -23.280  12.900
  428    H3'    A  41           H3'        A  41 -14.168 -22.561  15.773
  429    H2'    A  41          H2''        A  41 -12.073 -21.697  16.144
  430   HO2'    A  41          H2'         A  41 -11.214 -23.536  14.156
  431    H1'    A  41           H1'        A  41 -11.296 -21.167  13.450
  432    H8     A  41           H8         A  41 -14.223 -19.187  14.972
  433    H61    A  41           H61        A  41  -9.909 -15.139  16.785
  434    H62    A  41           H62        A  41 -11.623 -15.405  16.552
  435    H2     A  41           H2         A  41  -7.828 -18.711  15.043
  436    H5'    U  42           H5'        U  42 -10.571 -25.703  15.164
  437   H5''    U  42          H5''        U  42 -10.462 -26.571  16.709
  438    H4'    U  42           H4'        U  42  -8.256 -25.546  15.841
  439    H3'    U  42           H3'        U  42  -9.583 -24.957  18.510
  440    H2'    U  42          H2''        U  42  -7.917 -23.468  19.126
  441   HO2'    U  42          H2'         U  42  -5.840 -23.490  18.079
  442    H1'    U  42           H1'        U  42  -7.241 -22.572  16.527
  443    H3     U  42           H3         U  42  -8.290 -18.755  18.722
  444    H5     U  42           H5         U  42 -11.955 -20.812  18.454
  445    H6     U  42           H6         U  42 -10.759 -22.704  17.544
  446    H5'    U  43           H5'        U  43  -5.556 -25.460  19.494
  447   H5''    U  43          H5''        U  43  -5.402 -26.307  21.046
  448    H4'    U  43           H4'        U  43  -4.374 -24.005  21.067
  449    H3'    U  43           H3'        U  43  -6.660 -24.909  22.815
  450    H2'    U  43          H2''        U  43  -7.063 -22.816  23.687
  451   HO2'    U  43          H2'         U  43  -5.412 -21.267  23.934
  452    H1'    U  43           H1'        U  43  -5.903 -21.241  21.599
  453    H3     U  43           H3         U  43  -9.867 -19.160  21.998
  454    H5     U  43           H5         U  43 -10.961 -23.126  21.083
  455    H6     U  43           H6         U  43  -8.612 -23.723  21.158
  456    H5'    A  44           H5'        A  44  -2.358 -25.377  25.856
  457   H5''    A  44          H5''        A  44  -3.247 -25.581  27.378
  458    H4'    A  44           H4'        A  44  -1.222 -23.855  27.218
  459    H3'    A  44           H3'        A  44  -3.904 -23.734  28.585
  460    H2'    A  44          H2''        A  44  -3.652 -21.514  29.227
  461   HO2'    A  44          H2'         A  44  -1.798 -20.785  29.889
  462    H1'    A  44           H1'        A  44  -2.271 -20.561  27.024
  463    H8     A  44           H8         A  44  -5.309 -22.766  26.170
  464    H61    A  44           H61        A  44  -8.754 -17.698  26.980
  465    H62    A  44           H62        A  44  -8.733 -19.348  26.399
  466    H2     A  44           H2         A  44  -4.546 -16.720  28.180
  467    H5'    A  45           H5'        A  45  -0.910 -22.115  31.321
  468   H5''    A  45          H5''        A  45  -1.289 -22.595  32.987
  469    H4'    A  45           H4'        A  45  -1.080 -20.082  32.624
  470    H3'    A  45           H3'        A  45  -3.443 -21.561  33.760
  471    H2'    A  45          H2''        A  45  -4.840 -19.744  33.724
  472   HO2'    A  45          H2'         A  45  -2.501 -18.140  33.984
  473    H1'    A  45           H1'        A  45  -3.486 -18.145  31.777
  474    H8     A  45           H8         A  45  -4.975 -21.454  30.564
  475    H61    A  45           H61        A  45 -10.295 -18.379  29.883
  476    H62    A  45           H62        A  45  -9.411 -19.831  29.470
  477    H2     A  45           H2         A  45  -7.395 -15.684  31.989
  478    H5'    G  46           H5'        G  46  -1.730 -18.488  37.713
  479   H5''    G  46          H5''        G  46  -2.868 -19.283  38.816
  480    H4'    G  46           H4'        G  46  -2.822 -16.625  38.598
  481    H3'    G  46           H3'        G  46  -5.024 -18.628  38.972
  482    H2'    G  46          H2''        G  46  -6.754 -17.149  38.531
  483   HO2'    G  46          H2'         G  46  -6.645 -14.992  38.916
  484    H1'    G  46           H1'        G  46  -5.551 -15.493  36.659
  485    H8     G  46           H8         G  46  -4.836 -19.042  35.676
  486    H1     G  46           H1         G  46 -10.851 -17.261  34.389
  487    H21    G  46           H21        G  46 -11.286 -15.315  35.336
  488    H22    G  46           H22        G  46 -10.164 -14.534  36.426
  489    H5'    C  47           H5'        C  47  -6.281 -16.258  42.721
  490   H5''    C  47          H5''        C  47  -7.045 -17.594  43.604
  491    H4'    C  47           H4'        C  47  -8.531 -15.645  42.560
  492    H3'    C  47           H3'        C  47  -8.911 -18.615  42.805
  493    H2'    C  47          H2''        C  47 -10.645 -18.738  41.311
  494   HO2'    C  47          H2'         C  47 -11.258 -16.048  42.013
  495    H1'    C  47           H1'        C  47 -10.225 -16.312  39.867
  496    H41    C  47           H41        C  47  -9.965 -21.083  35.676
  497    H42    C  47           H42        C  47  -8.381 -21.539  36.254
  498    H5     C  47           H5         C  47  -7.241 -20.359  38.029
  499    H6     C  47           H6         C  47  -7.493 -18.695  39.812
  500    H5'    C  48           H5'        C  48 -13.108 -16.872  43.419
  501   H5''    C  48          H5''        C  48 -13.581 -17.673  44.930
  502    H4'    C  48           H4'        C  48 -15.356 -18.012  43.270
  503    H3'    C  48           H3'        C  48 -13.560 -20.306  44.046
  504   HO3'    C  48          H3T         C  48 -15.174 -19.419  45.476
  505    H2'    C  48          H2''        C  48 -14.490 -21.750  42.522
  506   HO2'    C  48          H2'         C  48 -16.817 -20.105  42.554
  507    H1'    C  48           H1'        C  48 -15.391 -19.824  40.625
  508    H41    C  48           H41        C  48 -10.913 -23.313  37.742
  509    H42    C  48           H42        C  48  -9.690 -22.724  38.847
  510    H5     C  48           H5         C  48 -10.192 -21.353  40.757
  511    H6     C  48           H6         C  48 -11.949 -20.130  41.948
  Start of MODEL    3
    1    H5'    G   1           H5'        G   1 -14.024 -31.212  30.490
    2   H5''    G   1          H5''        G   1 -14.600 -29.842  29.519
    3    H4'    G   1           H4'        G   1 -15.986 -30.187  31.586
    4    H3'    G   1           H3'        G   1 -14.363 -27.725  30.986
    5    H2'    G   1          H2''        G   1 -14.578 -26.820  33.076
    6   HO2'    G   1          H2'         G   1 -16.972 -26.947  32.733
    7    H1'    G   1           H1'        G   1 -15.263 -29.168  34.554
    8    H8     G   1           H8         G   1 -11.789 -29.627  33.417
    9    H1     G   1           H1         G   1 -12.231 -25.166  38.004
   10    H21    G   1           H21        G   1 -14.338 -24.548  38.253
   11    H22    G   1           H22        G   1 -15.651 -25.359  37.429
   12   HO5'    G   1          H5T         G   1 -12.649 -29.140  29.677
   13    H5'    G   2           H5'        G   2 -19.168 -25.767  30.652
   14   H5''    G   2          H5''        G   2 -18.527 -24.262  29.965
   15    H4'    G   2           H4'        G   2 -20.031 -24.223  32.172
   16    H3'    G   2           H3'        G   2 -17.669 -22.634  31.240
   17    H2'    G   2          H2''        G   2 -17.160 -21.709  33.293
   18   HO2'    G   2          H2'         G   2 -18.653 -21.039  34.649
   19    H1'    G   2           H1'        G   2 -18.013 -23.714  35.020
   20    H8     G   2           H8         G   2 -15.856 -25.255  32.359
   21    H1     G   2           H1         G   2 -12.474 -22.039  36.751
   22    H21    G   2           H21        G   2 -13.825 -20.829  38.011
   23    H22    G   2           H22        G   2 -15.531 -20.664  37.661
   24    H5'    C   3           H5'        C   3 -20.319 -19.210  33.190
   25   H5''    C   3          H5''        C   3 -20.218 -18.074  31.830
   26    H4'    C   3           H4'        C   3 -19.556 -17.030  34.017
   27    H3'    C   3           H3'        C   3 -17.790 -17.297  31.603
   28    H2'    C   3          H2''        C   3 -15.859 -16.637  32.670
   29   HO2'    C   3          H2'         C   3 -17.526 -15.310  34.555
   30    H1'    C   3           H1'        C   3 -16.438 -17.402  35.308
   31    H41    C   3           H41        C   3 -11.779 -21.180  33.145
   32    H42    C   3           H42        C   3 -12.939 -22.109  32.223
   33    H5     C   3           H5         C   3 -15.225 -21.419  31.917
   34    H6     C   3           H6         C   3 -16.946 -19.815  32.597
   35    H5'    U   4           H5'        U   4 -17.219 -12.599  32.413
   36   H5''    U   4          H5''        U   4 -16.537 -12.203  30.824
   37    H4'    U   4           H4'        U   4 -15.052 -11.994  33.038
   38    H3'    U   4           H3'        U   4 -14.392 -13.033  30.276
   39    H2'    U   4          H2''        U   4 -12.203 -13.547  30.908
   40   HO2'    U   4          H2'         U   4 -11.138 -12.546  32.482
   41    H1'    U   4           H1'        U   4 -12.763 -14.479  33.455
   42    H3     U   4           H3         U   4 -11.053 -17.833  30.850
   43    H5     U   4           H5         U   4 -15.091 -17.521  29.688
   44    H6     U   4           H6         U   4 -15.269 -15.536  31.070
   45    H5'    U   5           H5'        U   5 -11.365 -10.370  32.170
   46   H5''    U   5          H5''        U   5 -10.895  -9.130  30.990
   47    H4'    U   5           H4'        U   5  -8.921 -10.049  32.218
   48    H3'    U   5           H3'        U   5  -9.367 -10.208  29.266
   49    H2'    U   5          H2''        U   5  -7.740 -11.767  28.828
   50   HO2'    U   5          H2'         U   5  -6.010 -10.588  29.563
   51    H1'    U   5           H1'        U   5  -7.483 -13.011  31.355
   52    H3     U   5           H3         U   5  -8.026 -16.408  28.395
   53    H5     U   5           H5         U   5 -11.796 -14.534  28.524
   54    H6     U   5           H6         U   5 -10.805 -12.787  29.879
   55    H5'    G   6           H5'        G   6  -6.690  -8.966  26.199
   56   H5''    G   6          H5''        G   6  -7.516 -10.223  27.144
   57    H4'    G   6           H4'        G   6  -4.518 -10.226  27.243
   58    H3'    G   6           H3'        G   6  -6.172 -10.452  24.764
   59    H2'    G   6          H2''        G   6  -5.552 -12.588  24.206
   60   HO2'    G   6          H2'         G   6  -3.132 -12.053  25.601
   61    H1'    G   6           H1'        G   6  -4.770 -13.616  26.707
   62    H8     G   6           H8         G   6  -8.328 -12.476  26.950
   63    H1     G   6           H1         G   6  -7.713 -17.837  23.489
   64    H21    G   6           H21        G   6  -5.591 -18.213  23.034
   65    H22    G   6           H22        G   6  -4.314 -17.135  23.553
   66    H5'    A   7           H5'        A   7  -1.632 -10.312  22.897
   67   H5''    A   7          H5''        A   7  -2.072  -9.782  21.262
   68    H4'    A   7           H4'        A   7  -0.833 -12.108  21.631
   69    H3'    A   7           H3'        A   7  -2.993 -11.188  19.773
   70    H2'    A   7          H2''        A   7  -3.700 -13.280  19.145
   71   HO2'    A   7          H2'         A   7  -1.026 -14.058  19.671
   72    H1'    A   7           H1'        A   7  -2.859 -14.819  21.351
   73    H8     A   7           H8         A   7  -5.232 -11.954  22.200
   74    H61    A   7           H61        A   7  -9.834 -15.804  20.714
   75    H62    A   7           H62        A   7  -9.409 -14.336  21.564
   76    H2     A   7           H2         A   7  -5.967 -17.718  19.488
   77    H5'    U   8           H5'        U   8   0.059 -13.851  17.474
   78   H5''    U   8          H5''        U   8   0.061 -13.267  15.797
   79    H4'    U   8           H4'        U   8  -0.409 -15.782  16.140
   80    H3'    U   8           H3'        U   8  -1.919 -13.751  14.539
   81    H2'    U   8          H2''        U   8  -3.786 -15.047  14.190
   82   HO2'    U   8          H2'         U   8  -2.096 -17.307  14.551
   83    H1'    U   8           H1'        U   8  -3.658 -16.775  16.413
   84    H3     U   8           H3         U   8  -7.817 -15.043  16.738
   85    H5     U   8           H5         U   8  -5.306 -11.729  17.404
   86    H6     U   8           H6         U   8  -3.414 -13.125  16.820
   87    H5'    U   9           H5'        U   9  -1.924 -16.994  11.808
   88   H5''    U   9          H5''        U   9  -1.397 -16.427  10.211
   89    H4'    U   9           H4'        U   9  -3.613 -17.417   9.977
   90    H3'    U   9           H3'        U   9  -3.218 -14.445   9.758
   91    H2'    U   9          H2''        U   9  -5.450 -13.932   9.815
   92   HO2'    U   9          H2'         U   9  -5.824 -16.462   8.585
   93    H1'    U   9           H1'        U   9  -6.467 -16.311  11.027
   94    H3     U   9           H3         U   9  -8.615 -13.273  13.507
   95    H5     U   9           H5         U   9  -4.577 -12.153  13.962
   96    H6     U   9           H6         U   9  -3.981 -13.915  12.403
   97    H5'    G  10           H5'        G  10  -5.340 -15.960   5.395
   98   H5''    G  10          H5''        G  10  -5.017 -14.457   4.509
   99    H4'    G  10           H4'        G  10  -7.499 -15.405   4.694
  100    H3'    G  10           H3'        G  10  -6.365 -12.620   4.811
  101    H2'    G  10          H2''        G  10  -8.369 -11.635   5.439
  102   HO2'    G  10          H2'         G  10  -9.660 -13.992   4.494
  103    H1'    G  10           H1'        G  10  -9.433 -13.670   7.001
  104    H8     G  10           H8         G  10  -5.874 -13.160   8.066
  105    H1     G  10           H1         G  10  -9.702  -8.354   9.899
  106    H21    G  10           H21        G  10 -11.673  -8.547   8.924
  107    H22    G  10           H22        G  10 -11.987  -9.736   7.682
  108    H5'    U  11           H5'        U  11  -9.166 -12.331   0.978
  109   H5''    U  11          H5''        U  11  -8.645 -10.816   0.213
  110    H4'    U  11           H4'        U  11 -11.067 -11.024   1.322
  111    H3'    U  11           H3'        U  11  -9.042  -8.789   1.252
  112    H2'    U  11          H2''        U  11 -10.273  -7.439   2.704
  113   HO2'    U  11          H2'         U  11 -12.486  -9.112   2.076
  114    H1'    U  11           H1'        U  11 -11.292  -9.407   4.372
  115    H3     U  11           H3         U  11  -8.492  -6.424   6.538
  116    H5     U  11           H5         U  11  -6.043  -9.532   5.090
  117    H6     U  11           H6         U  11  -7.937 -10.346   3.816
  118    H5'    A  12           H5'        A  12 -11.965  -6.158  -1.225
  119   H5''    A  12          H5''        A  12 -10.721  -4.982  -1.694
  120    H4'    A  12           H4'        A  12 -12.526  -4.414   0.208
  121    H3'    A  12           H3'        A  12  -9.566  -3.793   0.003
  122    H2'    A  12          H2''        A  12  -9.624  -2.649   2.064
  123   HO2'    A  12          H2'         A  12 -12.464  -2.910   2.021
  124    H1'    A  12           H1'        A  12 -11.111  -4.522   3.412
  125    H8     A  12           H8         A  12  -8.908  -6.659   1.333
  126    H61    A  12           H61        A  12  -4.115  -4.896   4.815
  127    H62    A  12           H62        A  12  -4.716  -6.109   3.706
  128    H2     A  12           H2         A  12  -7.606  -2.258   5.812
  129    H5'    U  13           H5'        U  13 -10.483   0.607   0.143
  130   H5''    U  13          H5''        U  13  -9.127   1.162  -0.857
  131    H4'    U  13           H4'        U  13  -9.174   1.685   1.748
  132    H3'    U  13           H3'        U  13  -6.938   0.856  -0.102
  133    H2'    U  13          H2''        U  13  -5.397   0.648   1.653
  134   HO2'    U  13          H2'         U  13  -7.181   2.181   3.259
  135    H1'    U  13           H1'        U  13  -7.100  -0.249   3.643
  136    H3     U  13           H3         U  13  -3.603  -3.113   2.521
  137    H5     U  13           H5         U  13  -6.897  -4.179   0.119
  138    H6     U  13           H6         U  13  -8.016  -2.165   0.863
  139    H5'    U  14           H5'        U  14  -5.158   4.414   1.297
  140   H5''    U  14          H5''        U  14  -4.645   5.441  -0.057
  141    H4'    U  14           H4'        U  14  -2.664   4.880   1.236
  142    H3'    U  14           H3'        U  14  -3.122   3.547  -1.429
  143    H2'    U  14          H2''        U  14  -1.254   2.189  -1.239
  144   HO2'    U  14          H2'         U  14   0.256   3.777  -0.747
  145    H1'    U  14           H1'        U  14  -1.271   1.806   1.525
  146    H3     U  14           H3         U  14  -1.587  -2.289  -0.432
  147    H5     U  14           H5         U  14  -5.380  -0.558  -1.040
  148    H6     U  14           H6         U  14  -4.514   1.510  -0.115
  149    H5'    A  15           H5'        A  15   0.583   6.682  -1.896
  150   H5''    A  15          H5''        A  15   1.170   6.596  -3.568
  151    H4'    A  15           H4'        A  15   2.724   5.821  -1.541
  152    H3'    A  15           H3'        A  15   2.312   4.830  -4.337
  153    H2'    A  15          H2''        A  15   3.328   2.792  -4.037
  154   HO2'    A  15          H2'         A  15   5.267   2.891  -3.268
  155    H1'    A  15           H1'        A  15   2.948   2.394  -1.285
  156    H8     A  15           H8         A  15  -0.304   3.043  -3.155
  157    H61    A  15           H61        A  15  -0.177  -2.899  -4.822
  158    H62    A  15           H62        A  15  -1.194  -1.493  -4.596
  159    H2     A  15           H2         A  15   3.814  -1.869  -3.065
  160    H5'    U  16           H5'        U  16   6.989   4.786  -3.465
  161   H5''    U  16          H5''        U  16   7.662   5.116  -5.074
  162    H4'    U  16           H4'        U  16   8.538   3.005  -3.888
  163    H3'    U  16           H3'        U  16   7.387   3.261  -6.654
  164    H2'    U  16          H2''        U  16   7.312   0.990  -7.040
  165   HO2'    U  16          H2'         U  16   9.347   0.734  -5.070
  166    H1'    U  16           H1'        U  16   7.065   0.048  -4.395
  167    H3     U  16           H3         U  16   3.671  -1.844  -6.755
  168    H5     U  16           H5         U  16   2.513   2.172  -6.276
  169    H6     U  16           H6         U  16   4.750   2.655  -5.481
  170    H5'    U  17           H5'        U  17  11.301   0.913  -7.707
  171   H5''    U  17          H5''        U  17  11.551   1.564  -9.340
  172    H4'    U  17           H4'        U  17  11.145  -1.007  -9.086
  173    H3'    U  17           H3'        U  17   9.920   0.982 -10.986
  174    H2'    U  17          H2''        U  17   8.326  -0.468 -11.765
  175   HO2'    U  17          H2'         U  17   8.864  -2.398 -12.409
  176    H1'    U  17           H1'        U  17   8.273  -2.317  -9.587
  177    H3     U  17           H3         U  17   3.959  -1.530 -10.748
  178    H5     U  17           H5         U  17   5.222   2.054  -8.926
  179    H6     U  17           H6         U  17   7.479   1.163  -8.893
  180    H5'    A  18           H5'        A  18  11.255  -2.931 -12.994
  181   H5''    A  18          H5''        A  18  11.969  -2.478 -14.555
  182    H4'    A  18           H4'        A  18  10.414  -4.382 -14.832
  183    H3'    A  18           H3'        A  18   9.826  -1.659 -15.991
  184    H2'    A  18          H2''        A  18   7.719  -2.251 -16.696
  185   HO2'    A  18          H2'         A  18   8.885  -4.794 -17.004
  186    H1'    A  18           H1'        A  18   7.252  -4.432 -14.904
  187    H8     A  18           H8         A  18   7.694  -0.915 -13.439
  188    H61    A  18           H61        A  18   1.596  -0.295 -14.227
  189    H62    A  18           H62        A  18   3.056   0.477 -13.653
  190    H2     A  18           H2         A  18   2.880  -4.099 -16.233
  191    H5'    A  19           H5'        A  19   9.534  -4.652 -19.868
  192   H5''    A  19          H5''        A  19   9.650  -3.378 -21.096
  193    H4'    A  19           H4'        A  19   7.488  -4.924 -20.961
  194    H3'    A  19           H3'        A  19   7.834  -1.974 -21.477
  195    H2'    A  19          H2''        A  19   5.583  -1.530 -21.356
  196   HO2'    A  19          H2'         A  19   5.325  -4.153 -22.355
  197    H1'    A  19           H1'        A  19   4.765  -3.770 -19.784
  198    H8     A  19           H8         A  19   7.187  -1.197 -18.268
  199    H61    A  19           H61        A  19   2.136   1.901 -16.521
  200    H62    A  19           H62        A  19   3.852   1.691 -16.258
  201    H2     A  19           H2         A  19   0.856  -1.436 -19.234
  202    H5'    A  20           H5'        A  20   4.925  -3.789 -24.545
  203   H5''    A  20          H5''        A  20   5.186  -2.874 -26.042
  204    H4'    A  20           H4'        A  20   2.775  -2.931 -25.371
  205    H3'    A  20           H3'        A  20   4.416  -0.407 -25.537
  206    H2'    A  20          H2''        A  20   2.702   0.929 -24.736
  207   HO2'    A  20          H2'         A  20   1.010  -1.113 -25.719
  208    H1'    A  20           H1'        A  20   1.397  -0.940 -23.098
  209    H8     A  20           H8         A  20   5.204  -0.158 -22.793
  210    H61    A  20           H61        A  20   3.522   3.987 -18.536
  211    H62    A  20           H62        A  20   4.860   3.089 -19.217
  212    H2     A  20           H2         A  20  -0.203   2.267 -20.341
  213    H5'    U  21           H5'        U  21   0.938   1.066 -27.917
  214   H5''    U  21          H5''        U  21   1.673   2.463 -28.725
  215    H4'    U  21           H4'        U  21  -0.052   2.814 -26.726
  216    H3'    U  21           H3'        U  21   2.470   4.226 -27.540
  217    H2'    U  21          H2''        U  21   2.723   5.390 -25.553
  218   HO2'    U  21          H2'         U  21   1.027   6.539 -25.116
  219    H1'    U  21           H1'        U  21   1.328   3.710 -23.786
  220    H3     U  21           H3         U  21   5.414   4.493 -21.947
  221    H5     U  21           H5         U  21   6.258   2.094 -25.306
  222    H6     U  21           H6         U  21   3.896   2.142 -25.850
  223    H5'    U  22           H5'        U  22  -1.065   6.748 -26.971
  224   H5''    U  22          H5''        U  22  -1.407   8.041 -28.139
  225    H4'    U  22           H4'        U  22  -1.643   8.874 -25.814
  226    H3'    U  22           H3'        U  22   0.325   9.856 -27.815
  227    H2'    U  22          H2''        U  22   1.923  10.601 -26.388
  228   HO2'    U  22          H2'         U  22   0.691  12.393 -25.863
  229    H1'    U  22           H1'        U  22   0.818   9.723 -23.867
  230    H3     U  22           H3         U  22   5.157   9.118 -22.863
  231    H5     U  22           H5         U  22   4.714   6.981 -26.468
  232    H6     U  22           H6         U  22   2.414   7.739 -26.560
  233    H5'    A  23           H5'        A  23   1.473  12.671 -29.210
  234   H5''    A  23          H5''        A  23   1.982  11.586 -27.904
  235    H4'    A  23           H4'        A  23   3.588  13.519 -28.446
  236    H3'    A  23           H3'        A  23   2.678  12.436 -25.917
  237    H2'    A  23          H2''        A  23   1.890  14.331 -24.899
  238   HO2'    A  23          H2'         A  23   3.417  15.602 -24.024
  239    H1'    A  23           H1'        A  23   2.840  16.431 -26.642
  240    H8     A  23           H8         A  23  -0.362  14.932 -27.700
  241    H61    A  23           H61        A  23  -3.264  17.986 -23.170
  242    H62    A  23           H62        A  23  -3.464  16.973 -24.582
  243    H2     A  23           H2         A  23   1.150  18.324 -22.468
  244    H5'    A  24           H5'        A  24   6.563  12.255 -23.377
  245   H5''    A  24          H5''        A  24   5.577  11.191 -22.357
  246    H4'    A  24           H4'        A  24   5.857  14.047 -22.176
  247    H3'    A  24           H3'        A  24   4.437  11.775 -20.822
  248    H2'    A  24          H2''        A  24   2.699  13.058 -20.050
  249   HO2'    A  24          H2'         A  24   2.998  15.088 -19.184
  250    H1'    A  24           H1'        A  24   3.142  15.393 -21.743
  251    H8     A  24           H8         A  24   1.743  12.670 -23.738
  252    H61    A  24           H61        A  24  -3.824  13.935 -21.351
  253    H62    A  24           H62        A  24  -2.950  12.993 -22.540
  254    H2     A  24           H2         A  24  -0.726  16.063 -18.897
  255    H5'    U  25           H5'        U  25   5.061   9.807 -17.958
  256   H5''    U  25          H5''        U  25   4.256  11.236 -18.634
  257    H4'    U  25           H4'        U  25   4.280  10.255 -15.874
  258    H3'    U  25           H3'        U  25   2.470  11.239 -17.674
  259    H2'    U  25          H2''        U  25   3.130  13.492 -17.727
  260   HO2'    U  25          H2'         U  25   1.211  14.000 -16.967
  261    H1'    U  25           H1'        U  25   3.756  13.591 -14.809
  262    H3     U  25           H3         U  25   5.977  17.453 -15.142
  263    H5     U  25           H5         U  25   6.531  15.758 -18.960
  264    H6     U  25           H6         U  25   5.215  13.852 -18.239
  265    H5'    U  26           H5'        U  26   1.069  12.337 -18.513
  266   H5''    U  26          H5''        U  26  -0.419  12.572 -17.576
  267    H4'    U  26           H4'        U  26  -1.333  12.395 -19.718
  268    H3'    U  26           H3'        U  26  -1.126   9.797 -18.282
  269    H2'    U  26          H2''        U  26  -1.197   8.401 -20.094
  270   HO2'    U  26          H2'         U  26  -2.366   8.886 -21.959
  271    H1'    U  26           H1'        U  26  -0.284  10.073 -22.152
  272    H3     U  26           H3         U  26   2.297   6.323 -22.185
  273    H5     U  26           H5         U  26   3.798   8.636 -19.006
  274    H6     U  26           H6         U  26   1.920  10.134 -19.275
  275    H5'    C  27           H5'        C  27  -5.172   9.009 -19.555
  276   H5''    C  27          H5''        C  27  -5.949   8.180 -18.191
  277    H4'    C  27           H4'        C  27  -5.526   6.657 -20.149
  278    H3'    C  27           H3'        C  27  -4.346   6.336 -17.400
  279    H2'    C  27          H2''        C  27  -2.944   4.597 -17.987
  280   HO2'    C  27          H2'         C  27  -4.888   3.510 -18.984
  281    H1'    C  27           H1'        C  27  -2.569   5.196 -20.715
  282    H41    C  27           H41        C  27   3.062   6.322 -18.002
  283    H42    C  27           H42        C  27   2.331   7.289 -16.742
  284    H5     C  27           H5         C  27  -0.055   7.519 -16.487
  285    H6     C  27           H6         C  27  -2.229   7.132 -17.541
  286    H5'    U  28           H5'        U  28  -7.833   2.549 -17.685
  287   H5''    U  28          H5''        U  28  -7.286   1.504 -16.358
  288    H4'    U  28           H4'        U  28  -7.299   0.650 -18.920
  289    H3'    U  28           H3'        U  28  -5.314   0.215 -16.669
  290    H2'    U  28          H2''        U  28  -3.998  -1.158 -18.059
  291   HO2'    U  28          H2'         U  28  -4.729  -2.133 -19.849
  292    H1'    U  28           H1'        U  28  -4.143   0.490 -20.280
  293    H3     U  28           H3         U  28   0.051   0.419 -18.345
  294    H5     U  28           H5         U  28  -2.176   3.233 -16.152
  295    H6     U  28           H6         U  28  -4.145   2.540 -17.364
  296    H5'    U  29           H5'        U  29  -6.314  -3.725 -18.041
  297   H5''    U  29          H5''        U  29  -6.488  -4.874 -16.700
  298    H4'    U  29           H4'        U  29  -4.789  -5.610 -18.399
  299    H3'    U  29           H3'        U  29  -4.204  -5.038 -15.503
  300    H2'    U  29          H2''        U  29  -1.913  -5.293 -15.730
  301   HO2'    U  29          H2'         U  29  -0.989  -6.664 -17.117
  302    H1'    U  29           H1'        U  29  -1.587  -4.408 -18.352
  303    H3     U  29           H3         U  29   0.973  -1.868 -15.529
  304    H5     U  29           H5         U  29  -2.924  -0.310 -15.178
  305    H6     U  29           H6         U  29  -3.723  -2.190 -16.483
  306    H5'    A  30           H5'        A  30  -1.936  -8.524 -16.432
  307   H5''    A  30          H5''        A  30  -2.049  -9.675 -15.086
  308    H4'    A  30           H4'        A  30   0.320  -9.060 -15.643
  309    H3'    A  30           H3'        A  30  -0.994  -8.482 -12.986
  310    H2'    A  30          H2''        A  30   0.807  -7.295 -12.203
  311   HO2'    A  30          H2'         A  30   2.429  -8.694 -12.220
  312    H1'    A  30           H1'        A  30   1.993  -6.602 -14.724
  313    H8     A  30           H8         A  30  -1.411  -5.039 -13.984
  314    H61    A  30           H61        A  30   1.715  -0.670 -10.922
  315    H62    A  30           H62        A  30   0.155  -1.149 -11.553
  316    H2     A  30           H2         A  30   4.571  -3.976 -11.940
  317    H5'    A  31           H5'        A  31   2.989 -11.392 -11.727
  318   H5''    A  31          H5''        A  31   2.324 -11.693 -10.111
  319    H4'    A  31           H4'        A  31   4.733 -10.597 -10.393
  320    H3'    A  31           H3'        A  31   2.474 -10.026  -8.476
  321    H2'    A  31          H2''        A  31   3.520  -8.180  -7.570
  322   HO2'    A  31          H2'         A  31   5.522  -9.588  -7.339
  323    H1'    A  31           H1'        A  31   5.040  -7.379  -9.809
  324    H8     A  31           H8         A  31   1.283  -7.681 -10.427
  325    H61    A  31           H61        A  31   0.838  -1.963  -8.123
  326    H62    A  31           H62        A  31   0.035  -3.195  -9.070
  327    H2     A  31           H2         A  31   5.035  -3.404  -7.474
  328    H5'    U  32           H5'        U  32   6.312 -10.792  -5.776
  329   H5''    U  32          H5''        U  32   5.587 -11.111  -4.188
  330    H4'    U  32           H4'        U  32   7.215  -9.036  -4.527
  331    H3'    U  32           H3'        U  32   4.659  -9.377  -2.970
  332    H2'    U  32          H2''        U  32   4.425  -7.133  -2.534
  333   HO2'    U  32          H2'         U  32   7.257  -7.086  -2.639
  334    H1'    U  32           H1'        U  32   6.034  -6.090  -4.659
  335    H3     U  32           H3         U  32   2.254  -3.555  -4.454
  336    H5     U  32           H5         U  32   1.008  -7.210  -6.138
  337    H6     U  32           H6         U  32   3.203  -8.115  -5.644
  338    H5'    A  33           H5'        A  33   7.766  -7.353  -0.365
  339   H5''    A  33          H5''        A  33   7.546  -7.937   1.297
  340    H4'    A  33           H4'        A  33   7.542  -5.408   1.074
  341    H3'    A  33           H3'        A  33   5.386  -7.129   2.253
  342    H2'    A  33          H2''        A  33   3.804  -5.472   2.361
  343   HO2'    A  33          H2'         A  33   4.261  -3.565   3.161
  344    H1'    A  33           H1'        A  33   4.818  -3.676   0.399
  345    H8     A  33           H8         A  33   3.767  -7.226  -0.667
  346    H61    A  33           H61        A  33  -1.888  -4.846  -1.428
  347    H62    A  33           H62        A  33  -0.843  -6.206  -1.774
  348    H2     A  33           H2         A  33   0.699  -1.715   0.475
  349    H5'    A  34           H5'        A  34   6.488  -3.468   4.816
  350   H5''    A  34          H5''        A  34   6.566  -4.018   6.502
  351    H4'    A  34           H4'        A  34   5.354  -1.872   6.361
  352    H3'    A  34           H3'        A  34   4.083  -4.446   7.199
  353    H2'    A  34          H2''        A  34   1.903  -3.735   7.009
  354   HO2'    A  34          H2'         A  34   1.266  -1.661   7.527
  355    H1'    A  34           H1'        A  34   2.201  -1.544   5.247
  356    H8     A  34           H8         A  34   3.115  -5.221   4.361
  357    H61    A  34           H61        A  34  -2.516  -5.467   1.827
  358    H62    A  34           H62        A  34  -0.941  -6.226   1.896
  359    H2     A  34           H2         A  34  -2.131  -1.559   3.991
  360    H5'    C  35           H5'        C  35   2.195  -1.509   9.854
  361   H5''    C  35          H5''        C  35   1.764  -2.377  11.340
  362    H4'    C  35           H4'        C  35  -0.095  -1.483   9.566
  363    H3'    C  35           H3'        C  35   0.069  -3.264  11.789
  364    H2'    C  35          H2''        C  35  -0.117  -5.259  10.665
  365   HO2'    C  35          H2'         C  35  -2.320  -5.818  10.246
  366    H1'    C  35           H1'        C  35  -1.661  -4.182   8.356
  367    H41    C  35           H41        C  35   0.622  -9.586   5.922
  368    H42    C  35           H42        C  35   2.212  -9.275   6.580
  369    H5     C  35           H5         C  35   2.710  -7.387   7.991
  370    H6     C  35           H6         C  35   1.810  -5.353   9.017
  371    H5'    U  36           H5'        U  36  -1.972   0.217  11.999
  372   H5''    U  36          H5''        U  36  -2.988   0.649  13.390
  373    H4'    U  36           H4'        U  36  -4.037   1.984  11.828
  374    H3'    U  36           H3'        U  36  -5.137  -0.797  11.777
  375    H2'    U  36          H2''        U  36  -6.120  -0.660   9.717
  376   HO2'    U  36          H2'         U  36  -6.656   1.910  10.582
  377    H1'    U  36           H1'        U  36  -4.632   1.460   8.563
  378    H3     U  36           H3         U  36  -5.295  -2.510   6.074
  379    H5     U  36           H5         U  36  -1.395  -2.461   7.646
  380    H6     U  36           H6         U  36  -2.077  -0.696   9.146
  381    H5'    A  37           H5'        A  37  -9.434   1.232  13.620
  382   H5''    A  37          H5''        A  37  -9.884  -0.398  14.157
  383    H4'    A  37           H4'        A  37 -11.403   0.919  12.405
  384    H3'    A  37           H3'        A  37 -10.575  -1.977  12.598
  385    H2'    A  37          H2''        A  37 -11.613  -2.547  10.585
  386   HO2'    A  37          H2'         A  37 -13.255  -1.452   9.717
  387    H1'    A  37           H1'        A  37 -10.878  -0.355   9.120
  388    H8     A  37           H8         A  37  -7.832  -1.097  11.135
  389    H61    A  37           H61        A  37  -6.756  -5.929   7.454
  390    H62    A  37           H62        A  37  -6.137  -4.946   8.762
  391    H2     A  37           H2         A  37 -10.952  -4.524   6.701
  392    H5'    C  38           H5'        C  38 -14.912  -1.919  12.868
  393   H5''    C  38          H5''        C  38 -15.682  -3.189  13.842
  394    H4'    C  38           H4'        C  38 -16.200  -3.349  11.373
  395    H3'    C  38           H3'        C  38 -14.878  -5.465  13.052
  396    H2'    C  38          H2''        C  38 -14.405  -6.856  11.263
  397   HO2'    C  38          H2'         C  38 -15.799  -7.170   9.722
  398    H1'    C  38           H1'        C  38 -14.018  -4.967   9.256
  399    H41    C  38           H41        C  38  -8.371  -7.417  11.009
  400    H42    C  38           H42        C  38  -8.249  -6.210  12.268
  401    H5     C  38           H5         C  38  -9.950  -4.549  12.661
  402    H6     C  38           H6         C  38 -12.232  -3.849  12.117
  403    H5'    A  39           H5'        A  39 -18.927  -8.013  12.608
  404   H5''    A  39          H5''        A  39 -18.523  -9.160  13.899
  405    H4'    A  39           H4'        A  39 -18.460  -9.903  11.325
  406    H3'    A  39           H3'        A  39 -16.601 -10.532  13.622
  407    H2'    A  39          H2''        A  39 -15.289 -11.891  12.235
  408   HO2'    A  39          H2'         A  39 -16.772 -13.105  11.155
  409    H1'    A  39           H1'        A  39 -15.403 -10.235   9.983
  410    H8     A  39           H8         A  39 -14.739  -8.016  12.923
  411    H61    A  39           H61        A  39  -8.888 -10.003  12.844
  412    H62    A  39           H62        A  39  -9.969  -8.739  13.384
  413    H2     A  39           H2         A  39 -11.285 -12.640  10.124
  414    H5'    A  40           H5'        A  40 -19.091 -14.149  12.481
  415   H5''    A  40          H5''        A  40 -19.229 -15.459  13.671
  416    H4'    A  40           H4'        A  40 -18.050 -16.133  11.528
  417    H3'    A  40           H3'        A  40 -16.992 -16.306  14.328
  418    H2'    A  40          H2''        A  40 -14.801 -16.672  13.762
  419   HO2'    A  40          H2'         A  40 -15.075 -18.563  12.655
  420    H1'    A  40           H1'        A  40 -14.733 -15.595  11.149
  421    H8     A  40           H8         A  40 -15.763 -13.231  13.996
  422    H61    A  40           H61        A  40  -9.733 -12.016  14.589
  423    H62    A  40           H62        A  40 -11.334 -11.681  15.209
  424    H2     A  40           H2         A  40 -10.191 -15.421  11.699
  425    H5'    A  41           H5'        A  41 -16.190 -20.946  13.256
  426   H5''    A  41          H5''        A  41 -16.224 -21.478  14.948
  427    H4'    A  41           H4'        A  41 -13.987 -21.679  13.518
  428    H3'    A  41           H3'        A  41 -14.536 -20.960  16.381
  429    H2'    A  41          H2''        A  41 -12.451 -20.095  16.790
  430   HO2'    A  41          H2'         A  41 -10.586 -20.922  15.770
  431    H1'    A  41           H1'        A  41 -11.601 -19.587  14.107
  432    H8     A  41           H8         A  41 -14.556 -17.598  15.578
  433    H61    A  41           H61        A  41 -10.283 -13.444  17.235
  434    H62    A  41           H62        A  41 -11.990 -13.824  17.223
  435    H2     A  41           H2         A  41  -8.164 -17.084  15.693
  436    H5'    U  42           H5'        U  42 -11.276 -24.216  15.460
  437   H5''    U  42          H5''        U  42 -11.124 -25.339  16.828
  438    H4'    U  42           H4'        U  42  -8.890 -24.533  15.947
  439    H3'    U  42           H3'        U  42  -9.942 -23.935  18.727
  440    H2'    U  42          H2''        U  42  -8.050 -22.714  19.307
  441   HO2'    U  42          H2'         U  42  -6.074 -23.053  18.464
  442    H1'    U  42           H1'        U  42  -7.498 -21.653  16.764
  443    H3     U  42           H3         U  42  -8.177 -17.936  19.237
  444    H5     U  42           H5         U  42 -11.969 -19.757  19.122
  445    H6     U  42           H6         U  42 -10.951 -21.667  18.046
  446    H5'    U  43           H5'        U  43  -5.956 -25.102  19.350
  447   H5''    U  43          H5''        U  43  -5.773 -25.965  20.890
  448    H4'    U  43           H4'        U  43  -4.472 -23.804  20.805
  449    H3'    U  43           H3'        U  43  -6.703 -24.420  22.737
  450    H2'    U  43          H2''        U  43  -6.708 -22.300  23.675
  451   HO2'    U  43          H2'         U  43  -4.014 -22.193  22.796
  452    H1'    U  43           H1'        U  43  -5.794 -20.832  21.447
  453    H3     U  43           H3         U  43  -9.674 -18.704  22.219
  454    H5     U  43           H5         U  43 -10.896 -22.685  21.570
  455    H6     U  43           H6         U  43  -8.558 -23.304  21.377
  456    H5'    A  44           H5'        A  44  -1.954 -24.476  25.384
  457   H5''    A  44          H5''        A  44  -2.821 -24.757  26.907
  458    H4'    A  44           H4'        A  44  -0.857 -22.961  26.786
  459    H3'    A  44           H3'        A  44  -3.527 -22.970  28.178
  460    H2'    A  44          H2''        A  44  -3.347 -20.756  28.888
  461   HO2'    A  44          H2'         A  44  -1.508 -19.945  29.504
  462    H1'    A  44           H1'        A  44  -2.079 -19.685  26.671
  463    H8     A  44           H8         A  44  -4.730 -21.693  25.104
  464    H61    A  44           H61        A  44  -8.944 -17.707  27.208
  465    H62    A  44           H62        A  44  -8.621 -18.994  26.069
  466    H2     A  44           H2         A  44  -5.023 -16.735  29.158
  467    H5'    A  45           H5'        A  45  -1.029 -21.323  31.027
  468   H5''    A  45          H5''        A  45  -1.225 -22.083  32.620
  469    H4'    A  45           H4'        A  45  -1.585 -19.608  32.704
  470    H3'    A  45           H3'        A  45  -3.651 -21.678  33.377
  471    H2'    A  45          H2''        A  45  -5.418 -20.221  33.445
  472   HO2'    A  45          H2'         A  45  -4.285 -18.997  35.125
  473    H1'    A  45           H1'        A  45  -4.362 -18.078  31.890
  474    H8     A  45           H8         A  45  -4.821 -21.359  30.010
  475    H61    A  45           H61        A  45 -10.744 -19.746  29.301
  476    H62    A  45           H62        A  45  -9.461 -20.789  28.731
  477    H2     A  45           H2         A  45  -8.841 -16.829  32.128
  478    H5'    G  46           H5'        G  46  -2.425 -19.651  37.804
  479   H5''    G  46          H5''        G  46  -3.475 -20.542  38.923
  480    H4'    G  46           H4'        G  46  -3.758 -17.905  38.581
  481    H3'    G  46           H3'        G  46  -5.680 -20.157  39.058
  482    H2'    G  46          H2''        G  46  -7.587 -18.969  38.503
  483   HO2'    G  46          H2'         G  46  -6.065 -16.642  39.087
  484    H1'    G  46           H1'        G  46  -6.575 -17.221  36.585
  485    H8     G  46           H8         G  46  -5.424 -20.670  35.682
  486    H1     G  46           H1         G  46 -11.640 -19.716  34.449
  487    H21    G  46           H21        G  46 -12.315 -17.829  35.372
  488    H22    G  46           H22        G  46 -11.299 -16.904  36.455
  489    H5'    C  47           H5'        C  47  -7.439 -16.922  41.749
  490   H5''    C  47          H5''        C  47  -7.649 -17.798  43.278
  491    H4'    C  47           H4'        C  47  -9.763 -16.690  42.547
  492    H3'    C  47           H3'        C  47  -9.399 -19.651  42.856
  493    H2'    C  47          H2''        C  47 -11.376 -20.238  41.836
  494   HO2'    C  47          H2'         C  47 -13.218 -19.099  42.053
  495    H1'    C  47           H1'        C  47 -11.798 -17.989  40.191
  496    H41    C  47           H41        C  47 -10.682 -22.769  36.168
  497    H42    C  47           H42        C  47  -9.072 -22.998  36.807
  498    H5     C  47           H5         C  47  -8.130 -21.593  38.527
  499    H6     C  47           H6         C  47  -8.642 -19.918  40.240
  500    H5'    C  48           H5'        C  48 -13.437 -18.981  44.327
  501   H5''    C  48          H5''        C  48 -13.662 -20.054  45.722
  502    H4'    C  48           H4'        C  48 -15.306 -20.505  43.870
  503    H3'    C  48           H3'        C  48 -13.242 -22.495  44.805
  504   HO3'    C  48          H3T         C  48 -14.875 -22.168  46.241
  505    H2'    C  48          H2''        C  48 -13.832 -24.056  43.233
  506   HO2'    C  48          H2'         C  48 -15.972 -24.299  43.721
  507    H1'    C  48           H1'        C  48 -14.902 -22.250  41.280
  508    H41    C  48           H41        C  48  -9.920 -25.053  38.505
  509    H42    C  48           H42        C  48  -8.819 -24.352  39.672
  510    H5     C  48           H5         C  48  -9.548 -23.006  41.530
  511    H6     C  48           H6         C  48 -11.488 -22.056  42.687
  Start of MODEL    4
    1    H5'    G   1           H5'        G   1 -14.985 -27.500  28.570
    2   H5''    G   1          H5''        G   1 -15.303 -26.006  27.665
    3    H4'    G   1           H4'        G   1 -17.443 -26.787  28.445
    4    H3'    G   1           H3'        G   1 -16.146 -24.411  29.676
    5    H2'    G   1          H2''        G   1 -17.459 -24.286  31.585
    6   HO2'    G   1          H2'         G   1 -19.512 -24.351  31.141
    7    H1'    G   1           H1'        G   1 -17.939 -26.927  32.109
    8    H8     G   1           H8         G   1 -14.449 -27.417  31.531
    9    H1     G   1           H1         G   1 -15.134 -23.099  36.221
   10    H21    G   1           H21        G   1 -17.219 -22.385  36.303
   11    H22    G   1           H22        G   1 -18.422 -22.867  35.128
   12   HO5'    G   1          H5T         G   1 -13.708 -26.366  29.748
   13    H5'    G   2           H5'        G   2 -19.972 -22.464  29.108
   14   H5''    G   2          H5''        G   2 -19.648 -20.849  28.447
   15    H4'    G   2           H4'        G   2 -20.632 -20.878  30.805
   16    H3'    G   2           H3'        G   2 -18.151 -19.521  29.827
   17    H2'    G   2          H2''        G   2 -17.272 -19.055  31.893
   18   HO2'    G   2          H2'         G   2 -18.497 -18.050  33.250
   19    H1'    G   2           H1'        G   2 -18.486 -21.047  33.470
   20    H8     G   2           H8         G   2 -16.589 -22.737  30.740
   21    H1     G   2           H1         G   2 -12.755 -20.318  35.271
   22    H21    G   2           H21        G   2 -13.914 -18.992  36.608
   23    H22    G   2           H22        G   2 -15.570 -18.544  36.270
   24    H5'    C   3           H5'        C   3 -20.379 -15.292  31.766
   25   H5''    C   3          H5''        C   3 -19.431 -14.418  30.548
   26    H4'    C   3           H4'        C   3 -19.161 -13.831  33.127
   27    H3'    C   3           H3'        C   3 -17.169 -14.069  30.879
   28    H2'    C   3          H2''        C   3 -15.329 -13.893  32.262
   29   HO2'    C   3          H2'         C   3 -15.390 -12.221  33.519
   30    H1'    C   3           H1'        C   3 -16.397 -14.977  34.624
   31    H41    C   3           H41        C   3 -12.035 -19.038  32.354
   32    H42    C   3           H42        C   3 -13.155 -19.585  31.128
   33    H5     C   3           H5         C   3 -15.399 -18.733  30.927
   34    H6     C   3           H6         C   3 -16.971 -17.016  31.693
   35    H5'    U   4           H5'        U   4 -15.482  -9.844  32.223
   36   H5''    U   4          H5''        U   4 -14.841  -9.531  30.599
   37    H4'    U   4           H4'        U   4 -13.186  -9.893  32.658
   38    H3'    U   4           H3'        U   4 -13.061 -10.923  29.815
   39    H2'    U   4          H2''        U   4 -11.064 -12.035  30.236
   40   HO2'    U   4          H2'         U   4 -10.822 -10.420  32.570
   41    H1'    U   4           H1'        U   4 -11.605 -12.780  32.879
   42    H3     U   4           H3         U   4 -10.807 -16.486  30.314
   43    H5     U   4           H5         U   4 -14.754 -15.351  29.373
   44    H6     U   4           H6         U   4 -14.415 -13.330  30.670
   45    H5'    U   5           H5'        U   5  -9.309  -9.091  31.476
   46   H5''    U   5          H5''        U   5  -8.655  -7.981  30.255
   47    H4'    U   5           H4'        U   5  -6.857  -9.350  31.309
   48    H3'    U   5           H3'        U   5  -7.589  -9.389  28.411
   49    H2'    U   5          H2''        U   5  -6.436 -11.294  27.860
   50   HO2'    U   5          H2'         U   5  -4.415 -10.559  28.421
   51    H1'    U   5           H1'        U   5  -6.255 -12.570  30.379
   52    H3     U   5           H3         U   5  -7.861 -15.733  27.550
   53    H5     U   5           H5         U   5 -11.039 -12.996  27.949
   54    H6     U   5           H6         U   5  -9.542 -11.539  29.178
   55    H5'    G   6           H5'        G   6  -4.778  -8.840  25.116
   56   H5''    G   6          H5''        G   6  -5.902  -9.871  26.025
   57    H4'    G   6           H4'        G   6  -2.989 -10.653  25.945
   58    H3'    G   6           H3'        G   6  -4.878 -10.452  23.639
   59    H2'    G   6          H2''        G   6  -4.890 -12.676  23.085
   60   HO2'    G   6          H2'         G   6  -3.084 -14.015  23.392
   61    H1'    G   6           H1'        G   6  -4.122 -13.862  25.526
   62    H8     G   6           H8         G   6  -7.264 -11.808  25.929
   63    H1     G   6           H1         G   6  -8.287 -17.405  22.972
   64    H21    G   6           H21        G   6  -6.368 -18.367  22.476
   65    H22    G   6           H22        G   6  -4.831 -17.569  22.723
   66    H5'    A   7           H5'        A   7  -0.239 -11.435  21.821
   67   H5''    A   7          H5''        A   7  -0.545 -10.913  20.152
   68    H4'    A   7           H4'        A   7   0.496 -13.294  20.572
   69    H3'    A   7           H3'        A   7  -1.626 -12.317  18.702
   70    H2'    A   7          H2''        A   7  -2.474 -14.379  18.164
   71   HO2'    A   7          H2'         A   7   0.153 -15.305  18.676
   72    H1'    A   7           H1'        A   7  -1.706 -15.890  20.414
   73    H8     A   7           H8         A   7  -3.860 -12.922  21.349
   74    H61    A   7           H61        A   7  -8.749 -16.336  19.721
   75    H62    A   7           H62        A   7  -8.210 -14.939  20.626
   76    H2     A   7           H2         A   7  -5.044 -18.488  18.395
   77    H5'    U   8           H5'        U   8   1.055 -15.374  16.584
   78   H5''    U   8          H5''        U   8   1.264 -14.794  14.920
   79    H4'    U   8           H4'        U   8   0.513 -17.207  15.076
   80    H3'    U   8           H3'        U   8  -0.886 -14.973  13.648
   81    H2'    U   8          H2''        U   8  -2.839 -16.124  13.266
   82   HO2'    U   8          H2'         U   8  -1.333 -18.531  13.459
   83    H1'    U   8           H1'        U   8  -2.736 -18.026  15.360
   84    H3     U   8           H3         U   8  -6.831 -16.192  15.880
   85    H5     U   8           H5         U   8  -4.201 -13.016  16.733
   86    H6     U   8           H6         U   8  -2.365 -14.431  16.030
   87    H5'    U   9           H5'        U   9  -1.156 -18.058  10.677
   88   H5''    U   9          H5''        U   9  -0.643 -17.373   9.122
   89    H4'    U   9           H4'        U   9  -2.908 -18.250   8.871
   90    H3'    U   9           H3'        U   9  -2.392 -15.287   8.884
   91    H2'    U   9          H2''        U   9  -4.602 -14.699   9.023
   92   HO2'    U   9          H2'         U   9  -5.043 -15.832   7.024
   93    H1'    U   9           H1'        U   9  -5.680 -17.135  10.062
   94    H3     U   9           H3         U   9  -7.701 -14.256  12.818
   95    H5     U   9           H5         U   9  -3.631 -13.254  13.258
   96    H6     U   9           H6         U   9  -3.108 -14.908  11.562
   97    H5'    G  10           H5'        G  10  -4.533 -16.479   4.399
   98   H5''    G  10          H5''        G  10  -4.283 -14.897   3.634
   99    H4'    G  10           H4'        G  10  -6.720 -15.971   3.751
  100    H3'    G  10           H3'        G  10  -5.724 -13.147   4.098
  101    H2'    G  10          H2''        G  10  -7.800 -12.329   4.748
  102   HO2'    G  10          H2'         G  10  -9.433 -12.952   3.601
  103    H1'    G  10           H1'        G  10  -8.722 -14.506   6.185
  104    H8     G  10           H8         G  10  -5.219 -13.942   7.332
  105    H1     G  10           H1         G  10  -9.172  -9.282   9.269
  106    H21    G  10           H21        G  10 -11.060  -9.373   8.134
  107    H22    G  10           H22        G  10 -11.430 -10.689   7.041
  108    H5'    U  11           H5'        U  11  -8.888 -12.549   0.623
  109   H5''    U  11          H5''        U  11  -8.345 -11.001  -0.055
  110    H4'    U  11           H4'        U  11 -10.732 -11.209   1.117
  111    H3'    U  11           H3'        U  11  -8.634  -9.042   1.145
  112    H2'    U  11          H2''        U  11  -9.752  -7.775   2.743
  113   HO2'    U  11          H2'         U  11 -12.087  -9.289   2.137
  114    H1'    U  11           H1'        U  11 -10.879  -9.838   4.245
  115    H3     U  11           H3         U  11  -8.058  -7.168   6.740
  116    H5     U  11           H5         U  11  -5.643 -10.153   5.008
  117    H6     U  11           H6         U  11  -7.527 -10.777   3.613
  118    H5'    A  12           H5'        A  12 -11.621  -6.240  -1.129
  119   H5''    A  12          H5''        A  12 -10.397  -5.036  -1.580
  120    H4'    A  12           H4'        A  12 -12.160  -4.544   0.376
  121    H3'    A  12           H3'        A  12  -9.203  -3.927   0.150
  122    H2'    A  12          H2''        A  12  -9.224  -2.862   2.254
  123   HO2'    A  12          H2'         A  12 -10.958  -1.707   2.599
  124    H1'    A  12           H1'        A  12 -10.696  -4.782   3.549
  125    H8     A  12           H8         A  12  -8.525  -6.814   1.318
  126    H61    A  12           H61        A  12  -3.715  -5.360   4.917
  127    H62    A  12           H62        A  12  -4.327  -6.476   3.716
  128    H2     A  12           H2         A  12  -7.174  -2.756   6.098
  129    H5'    U  13           H5'        U  13 -10.271   0.270   0.533
  130   H5''    U  13          H5''        U  13  -9.032   1.104  -0.426
  131    H4'    U  13           H4'        U  13  -8.947   1.380   2.160
  132    H3'    U  13           H3'        U  13  -6.737   0.673   0.234
  133    H2'    U  13          H2''        U  13  -5.181   0.296   1.949
  134   HO2'    U  13          H2'         U  13  -5.446   2.247   3.031
  135    H1'    U  13           H1'        U  13  -6.866  -0.696   3.902
  136    H3     U  13           H3         U  13  -3.459  -3.572   2.597
  137    H5     U  13           H5         U  13  -6.714  -4.329   0.033
  138    H6     U  13           H6         U  13  -7.799  -2.357   0.931
  139    H5'    U  14           H5'        U  14  -5.106   4.764   1.607
  140   H5''    U  14          H5''        U  14  -4.498   5.476   0.099
  141    H4'    U  14           H4'        U  14  -2.690   5.163   1.809
  142    H3'    U  14           H3'        U  14  -2.758   3.784  -0.871
  143    H2'    U  14          H2''        U  14  -0.839   2.544  -0.451
  144   HO2'    U  14          H2'         U  14  -0.292   4.464   1.575
  145    H1'    U  14           H1'        U  14  -1.181   2.111   2.272
  146    H3     U  14           H3         U  14  -1.157  -1.927   0.145
  147    H5     U  14           H5         U  14  -4.990  -0.353  -0.607
  148    H6     U  14           H6         U  14  -4.264   1.727   0.408
  149    H5'    A  15           H5'        A  15   0.992   6.550  -1.040
  150   H5''    A  15          H5''        A  15   1.596   6.564  -2.709
  151    H4'    A  15           H4'        A  15   2.963   5.328  -0.778
  152    H3'    A  15           H3'        A  15   2.446   4.689  -3.669
  153    H2'    A  15          H2''        A  15   3.196   2.527  -3.542
  154   HO2'    A  15          H2'         A  15   4.901   3.527  -1.521
  155    H1'    A  15           H1'        A  15   2.869   2.049  -0.757
  156    H8     A  15           H8         A  15  -0.390   2.792  -2.554
  157    H61    A  15           H61        A  15  -0.387  -3.116  -4.363
  158    H62    A  15           H62        A  15  -1.365  -1.685  -4.129
  159    H2     A  15           H2         A  15   3.662  -2.175  -2.685
  160    H5'    U  16           H5'        U  16   7.039   4.082  -2.669
  161   H5''    U  16          H5''        U  16   7.841   4.516  -4.191
  162    H4'    U  16           H4'        U  16   8.539   2.264  -3.227
  163    H3'    U  16           H3'        U  16   7.401   2.785  -5.964
  164    H2'    U  16          H2''        U  16   7.182   0.557  -6.500
  165   HO2'    U  16          H2'         U  16   9.229   0.059  -4.592
  166    H1'    U  16           H1'        U  16   6.911  -0.543  -3.911
  167    H3     U  16           H3         U  16   3.412  -2.141  -6.335
  168    H5     U  16           H5         U  16   2.473   1.907  -5.678
  169    H6     U  16           H6         U  16   4.721   2.228  -4.836
  170    H5'    U  17           H5'        U  17  11.115   0.179  -6.983
  171   H5''    U  17          H5''        U  17  11.570   0.881  -8.548
  172    H4'    U  17           H4'        U  17  11.014  -1.632  -8.553
  173    H3'    U  17           H3'        U  17   9.851   0.531 -10.300
  174    H2'    U  17          H2''        U  17   8.239  -0.826 -11.202
  175   HO2'    U  17          H2'         U  17  10.000  -3.001 -10.686
  176    H1'    U  17           H1'        U  17   8.141  -2.835  -9.169
  177    H3     U  17           H3         U  17   3.829  -1.974 -10.217
  178    H5     U  17           H5         U  17   5.148   1.565  -8.344
  179    H6     U  17           H6         U  17   7.394   0.647  -8.346
  180    H5'    A  18           H5'        A  18  11.216  -3.285 -12.514
  181   H5''    A  18          H5''        A  18  11.888  -2.773 -14.074
  182    H4'    A  18           H4'        A  18  10.355  -4.693 -14.374
  183    H3'    A  18           H3'        A  18   9.695  -1.950 -15.443
  184    H2'    A  18          H2''        A  18   7.592  -2.571 -16.134
  185   HO2'    A  18          H2'         A  18   8.614  -5.219 -16.326
  186    H1'    A  18           H1'        A  18   7.194  -4.796 -14.383
  187    H8     A  18           H8         A  18   7.613  -1.301 -12.859
  188    H61    A  18           H61        A  18   1.492  -0.754 -13.532
  189    H62    A  18           H62        A  18   2.952   0.026 -12.962
  190    H2     A  18           H2         A  18   2.797  -4.505 -15.623
  191    H5'    A  19           H5'        A  19   9.340  -4.773 -19.441
  192   H5''    A  19          H5''        A  19   9.417  -3.426 -20.592
  193    H4'    A  19           H4'        A  19   7.266  -4.990 -20.491
  194    H3'    A  19           H3'        A  19   7.570  -2.005 -20.824
  195    H2'    A  19          H2''        A  19   5.309  -1.618 -20.649
  196   HO2'    A  19          H2'         A  19   4.942  -4.281 -21.578
  197    H1'    A  19           H1'        A  19   4.576  -3.970 -19.202
  198    H8     A  19           H8         A  19   6.941  -1.442 -17.534
  199    H61    A  19           H61        A  19   1.828   1.461 -15.632
  200    H62    A  19           H62        A  19   3.547   1.267 -15.375
  201    H2     A  19           H2         A  19   0.617  -1.734 -18.539
  202    H5'    A  20           H5'        A  20   4.588  -3.607 -23.885
  203   H5''    A  20          H5''        A  20   4.839  -2.632 -25.346
  204    H4'    A  20           H4'        A  20   2.443  -2.658 -24.662
  205    H3'    A  20           H3'        A  20   4.128  -0.152 -24.625
  206    H2'    A  20          H2''        A  20   2.408   1.139 -23.751
  207   HO2'    A  20          H2'         A  20   0.942   0.077 -25.444
  208    H1'    A  20           H1'        A  20   1.112  -0.825 -22.229
  209    H8     A  20           H8         A  20   4.931  -0.113 -21.940
  210    H61    A  20           H61        A  20   3.375   3.654 -17.297
  211    H62    A  20           H62        A  20   4.693   3.027 -18.261
  212    H2     A  20           H2         A  20  -0.402   2.184 -19.215
  213    H5'    U  21           H5'        U  21   0.597   1.428 -26.947
  214   H5''    U  21          H5''        U  21   1.300   2.890 -27.664
  215    H4'    U  21           H4'        U  21  -0.492   3.076 -25.705
  216    H3'    U  21           H3'        U  21   2.010   4.619 -26.341
  217    H2'    U  21          H2''        U  21   2.078   5.725 -24.301
  218   HO2'    U  21          H2'         U  21   0.163   6.733 -24.254
  219    H1'    U  21           H1'        U  21   0.705   3.882 -22.688
  220    H3     U  21           H3         U  21   4.650   4.808 -20.612
  221    H5     U  21           H5         U  21   5.787   2.613 -24.026
  222    H6     U  21           H6         U  21   3.457   2.560 -24.686
  223    H5'    U  22           H5'        U  22  -1.657   6.856 -25.820
  224   H5''    U  22          H5''        U  22  -2.095   8.158 -26.944
  225    H4'    U  22           H4'        U  22  -2.514   8.882 -24.625
  226    H3'    U  22           H3'        U  22  -0.514  10.105 -26.446
  227    H2'    U  22          H2''        U  22   0.943  10.887 -24.892
  228   HO2'    U  22          H2'         U  22  -0.490  12.549 -24.382
  229    H1'    U  22           H1'        U  22  -0.239   9.818 -22.486
  230    H3     U  22           H3         U  22   4.059   9.461 -21.229
  231    H5     U  22           H5         U  22   3.997   7.489 -24.954
  232    H6     U  22           H6         U  22   1.661   8.100 -25.166
  233    H5'    A  23           H5'        A  23   0.500  13.080 -27.614
  234   H5''    A  23          H5''        A  23   1.010  11.968 -26.332
  235    H4'    A  23           H4'        A  23   2.491  14.037 -26.665
  236    H3'    A  23           H3'        A  23   1.489  12.772 -24.254
  237    H2'    A  23          H2''        A  23   0.509  14.561 -23.209
  238   HO2'    A  23          H2'         A  23   1.884  15.878 -22.179
  239    H1'    A  23           H1'        A  23   1.399  16.799 -24.807
  240    H8     A  23           H8         A  23  -1.592  15.105 -26.139
  241    H61    A  23           H61        A  23  -5.026  17.660 -21.673
  242    H62    A  23           H62        A  23  -5.052  16.809 -23.200
  243    H2     A  23           H2         A  23  -0.712  18.359 -20.680
  244    H5'    A  24           H5'        A  24   5.194  12.738 -21.471
  245   H5''    A  24          H5''        A  24   4.228  11.560 -20.564
  246    H4'    A  24           H4'        A  24   4.267  14.419 -20.264
  247    H3'    A  24           H3'        A  24   2.947  11.990 -19.092
  248    H2'    A  24          H2''        A  24   1.064  13.098 -18.397
  249   HO2'    A  24          H2'         A  24   1.140  15.121 -17.453
  250    H1'    A  24           H1'        A  24   1.421  15.528 -19.972
  251    H8     A  24           H8         A  24   0.400  12.781 -22.158
  252    H61    A  24           H61        A  24  -5.405  13.484 -20.139
  253    H62    A  24           H62        A  24  -4.372  12.645 -21.272
  254    H2     A  24           H2         A  24  -2.678  15.756 -17.390
  255    H5'    U  25           H5'        U  25   3.581   9.937 -16.243
  256   H5''    U  25          H5''        U  25   2.697  11.297 -16.961
  257    H4'    U  25           H4'        U  25   2.574  10.253 -14.236
  258    H3'    U  25           H3'        U  25   0.850  11.177 -16.148
  259    H2'    U  25          H2''        U  25   1.363  13.469 -16.082
  260   HO2'    U  25          H2'         U  25  -0.450  13.027 -13.938
  261    H1'    U  25           H1'        U  25   1.728  13.495 -13.116
  262    H3     U  25           H3         U  25   3.721  17.495 -13.096
  263    H5     U  25           H5         U  25   4.633  16.048 -16.946
  264    H6     U  25           H6         U  25   3.407  14.025 -16.410
  265    H5'    U  26           H5'        U  26  -0.594  12.141 -17.063
  266   H5''    U  26          H5''        U  26  -2.140  12.152 -16.194
  267    H4'    U  26           H4'        U  26  -2.912  12.006 -18.401
  268    H3'    U  26           H3'        U  26  -2.533   9.380 -17.056
  269    H2'    U  26          H2''        U  26  -2.357   8.060 -18.918
  270   HO2'    U  26          H2'         U  26  -4.019   8.211 -20.178
  271    H1'    U  26           H1'        U  26  -1.492   9.891 -20.853
  272    H3     U  26           H3         U  26   1.478   6.449 -20.858
  273    H5     U  26           H5         U  26   2.493   8.725 -17.467
  274    H6     U  26           H6         U  26   0.490  10.036 -17.811
  275    H5'    C  27           H5'        C  27  -6.264   8.143 -18.814
  276   H5''    C  27          H5''        C  27  -7.069   7.184 -17.556
  277    H4'    C  27           H4'        C  27  -6.308   5.793 -19.509
  278    H3'    C  27           H3'        C  27  -5.379   5.489 -16.667
  279    H2'    C  27          H2''        C  27  -3.724   3.947 -17.142
  280   HO2'    C  27          H2'         C  27  -5.176   3.359 -19.520
  281    H1'    C  27           H1'        C  27  -3.103   4.703 -19.775
  282    H41    C  27           H41        C  27   1.926   6.547 -16.359
  283    H42    C  27           H42        C  27   0.909   7.347 -15.181
  284    H5     C  27           H5         C  27  -1.497   7.203 -15.218
  285    H6     C  27           H6         C  27  -3.443   6.539 -16.542
  286    H5'    U  28           H5'        U  28  -8.315   1.326 -17.455
  287   H5''    U  28          H5''        U  28  -7.786   0.292 -16.114
  288    H4'    U  28           H4'        U  28  -7.431  -0.438 -18.688
  289    H3'    U  28           H3'        U  28  -5.648  -0.742 -16.256
  290    H2'    U  28          H2''        U  28  -4.051  -1.897 -17.544
  291   HO2'    U  28          H2'         U  28  -4.531  -3.000 -19.299
  292    H1'    U  28           H1'        U  28  -4.193  -0.195 -19.735
  293    H3     U  28           H3         U  28  -0.176   0.103 -17.480
  294    H5     U  28           H5         U  28  -2.849   2.584 -15.389
  295    H6     U  28           H6         U  28  -4.639   1.729 -16.768
  296    H5'    U  29           H5'        U  29  -5.874  -4.607 -18.089
  297   H5''    U  29          H5''        U  29  -6.288  -5.841 -16.881
  298    H4'    U  29           H4'        U  29  -4.334  -6.573 -18.193
  299    H3'    U  29           H3'        U  29  -4.133  -5.857 -15.276
  300    H2'    U  29          H2''        U  29  -1.826  -6.048 -15.201
  301   HO2'    U  29          H2'         U  29  -0.772  -7.542 -16.265
  302    H1'    U  29           H1'        U  29  -1.187  -5.226 -17.778
  303    H3     U  29           H3         U  29   0.853  -2.363 -14.882
  304    H5     U  29           H5         U  29  -3.201  -1.223 -14.802
  305    H6     U  29           H6         U  29  -3.708  -3.177 -16.146
  306    H5'    A  30           H5'        A  30  -1.777  -9.825 -15.536
  307   H5''    A  30          H5''        A  30  -1.846 -10.375 -13.852
  308    H4'    A  30           H4'        A  30   0.484  -9.729 -14.960
  309    H3'    A  30           H3'        A  30  -0.644  -9.188 -12.210
  310    H2'    A  30          H2''        A  30   1.106  -7.824 -11.626
  311   HO2'    A  30          H2'         A  30   2.878  -8.982 -11.746
  312    H1'    A  30           H1'        A  30   1.989  -7.116 -14.264
  313    H8     A  30           H8         A  30  -1.418  -5.712 -13.433
  314    H61    A  30           H61        A  30   1.522  -1.259 -10.311
  315    H62    A  30           H62        A  30   0.017  -1.725 -11.071
  316    H2     A  30           H2         A  30   4.522  -4.416 -11.395
  317    H5'    A  31           H5'        A  31   3.619 -11.856 -11.019
  318   H5''    A  31          H5''        A  31   2.919 -12.129  -9.412
  319    H4'    A  31           H4'        A  31   5.298 -10.960  -9.667
  320    H3'    A  31           H3'        A  31   2.968 -10.405  -7.830
  321    H2'    A  31          H2''        A  31   3.944  -8.505  -6.944
  322   HO2'    A  31          H2'         A  31   6.412  -9.614  -7.814
  323    H1'    A  31           H1'        A  31   5.426  -7.674  -9.180
  324    H8     A  31           H8         A  31   1.738  -8.253  -9.930
  325    H61    A  31           H61        A  31   0.762  -2.565  -7.708
  326    H62    A  31           H62        A  31   0.081  -3.885  -8.634
  327    H2     A  31           H2         A  31   5.010  -3.699  -6.823
  328    H5'    U  32           H5'        U  32   6.797 -10.512  -5.284
  329   H5''    U  32          H5''        U  32   6.257 -10.968  -3.656
  330    H4'    U  32           H4'        U  32   7.498  -8.681  -3.962
  331    H3'    U  32           H3'        U  32   4.980  -9.352  -2.450
  332    H2'    U  32          H2''        U  32   4.425  -7.160  -2.060
  333   HO2'    U  32          H2'         U  32   5.854  -5.909  -1.179
  334    H1'    U  32           H1'        U  32   5.950  -5.925  -4.144
  335    H3     U  32           H3         U  32   1.904  -3.855  -4.082
  336    H5     U  32           H5         U  32   1.121  -7.668  -5.692
  337    H6     U  32           H6         U  32   3.396  -8.300  -5.137
  338    H5'    A  33           H5'        A  33   8.185  -6.983   0.128
  339   H5''    A  33          H5''        A  33   7.927  -7.520   1.801
  340    H4'    A  33           H4'        A  33   8.057  -4.989   1.488
  341    H3'    A  33           H3'        A  33   5.890  -6.589   2.798
  342    H2'    A  33          H2''        A  33   4.345  -4.892   2.886
  343   HO2'    A  33          H2'         A  33   4.913  -2.748   3.194
  344    H1'    A  33           H1'        A  33   5.312  -3.199   0.826
  345    H8     A  33           H8         A  33   4.281  -6.746  -0.188
  346    H61    A  33           H61        A  33  -1.414  -4.440  -0.876
  347    H62    A  33           H62        A  33  -0.363  -5.799  -1.203
  348    H2     A  33           H2         A  33   1.126  -1.319   1.105
  349    H5'    A  34           H5'        A  34   6.144  -2.850   5.004
  350   H5''    A  34          H5''        A  34   6.704  -3.313   6.623
  351    H4'    A  34           H4'        A  34   4.942  -1.768   7.041
  352    H3'    A  34           H3'        A  34   4.284  -4.686   7.275
  353    H2'    A  34          H2''        A  34   2.005  -4.400   7.412
  354   HO2'    A  34          H2'         A  34   2.546  -1.770   8.356
  355    H1'    A  34           H1'        A  34   1.724  -1.949   6.039
  356    H8     A  34           H8         A  34   3.268  -5.337   4.815
  357    H61    A  34           H61        A  34  -2.036  -5.966   1.700
  358    H62    A  34           H62        A  34  -0.405  -6.572   1.894
  359    H2     A  34           H2         A  34  -2.300  -2.235   4.173
  360    H5'    C  35           H5'        C  35   2.083  -5.564  11.250
  361   H5''    C  35          H5''        C  35   1.727  -6.815  10.042
  362    H4'    C  35           H4'        C  35   0.737  -3.941   9.775
  363    H3'    C  35           H3'        C  35  -0.015  -5.936  11.688
  364    H2'    C  35          H2''        C  35  -1.166  -7.328  10.245
  365   HO2'    C  35          H2'         C  35  -3.365  -6.560   9.904
  366    H1'    C  35           H1'        C  35  -1.943  -5.220   8.324
  367    H41    C  35           H41        C  35  -2.902 -10.638   5.121
  368    H42    C  35           H42        C  35  -1.233 -11.106   5.357
  369    H5     C  35           H5         C  35   0.268  -9.922   6.828
  370    H6     C  35           H6         C  35   0.561  -7.915   8.209
  371    H5'    U  36           H5'        U  36  -0.918  -0.920  12.850
  372   H5''    U  36          H5''        U  36  -1.901  -1.026  14.326
  373    H4'    U  36           H4'        U  36  -3.148   0.495  13.037
  374    H3'    U  36           H3'        U  36  -4.019  -2.363  12.821
  375    H2'    U  36          H2''        U  36  -5.257  -2.113  10.920
  376   HO2'    U  36          H2'         U  36  -6.488  -0.412  12.184
  377    H1'    U  36           H1'        U  36  -4.178   0.329   9.916
  378    H3     U  36           H3         U  36  -4.941  -2.869   6.656
  379    H5     U  36           H5         U  36  -1.048  -3.506   8.122
  380    H6     U  36           H6         U  36  -1.570  -2.065   9.982
  381    H5'    A  37           H5'        A  37  -8.499  -0.116  14.454
  382   H5''    A  37          H5''        A  37  -9.044  -1.754  14.865
  383    H4'    A  37           H4'        A  37 -10.509  -0.199  13.266
  384    H3'    A  37           H3'        A  37  -9.882  -3.148  13.221
  385    H2'    A  37          H2''        A  37 -10.938  -3.499  11.173
  386   HO2'    A  37          H2'         A  37 -12.228  -1.045  11.728
  387    H1'    A  37           H1'        A  37 -10.116  -1.239   9.869
  388    H8     A  37           H8         A  37  -7.092  -2.266  11.757
  389    H61    A  37           H61        A  37  -6.280  -6.853   7.714
  390    H62    A  37           H62        A  37  -5.601  -5.996   9.080
  391    H2     A  37           H2         A  37 -10.420  -5.216   7.136
  392    H5'    C  38           H5'        C  38 -13.844  -2.794  12.136
  393   H5''    C  38          H5''        C  38 -14.938  -3.623  13.262
  394    H4'    C  38           H4'        C  38 -15.622  -4.214  11.008
  395    H3'    C  38           H3'        C  38 -14.212  -6.238  12.729
  396    H2'    C  38          H2''        C  38 -14.023  -7.821  11.038
  397   HO2'    C  38          H2'         C  38 -16.074  -7.960  10.289
  398    H1'    C  38           H1'        C  38 -13.651  -6.162   8.863
  399    H41    C  38           H41        C  38  -7.914  -8.448  10.489
  400    H42    C  38           H42        C  38  -7.833  -7.339  11.840
  401    H5     C  38           H5         C  38  -9.570  -5.752  12.338
  402    H6     C  38           H6         C  38 -11.858  -5.053  11.820
  403    H5'    A  39           H5'        A  39 -18.057  -8.795  12.330
  404   H5''    A  39          H5''        A  39 -17.692 -10.001  13.579
  405    H4'    A  39           H4'        A  39 -17.463 -10.595  10.973
  406    H3'    A  39           H3'        A  39 -15.693 -11.305  13.319
  407    H2'    A  39          H2''        A  39 -14.317 -12.572  11.916
  408   HO2'    A  39          H2'         A  39 -15.775 -13.768  10.762
  409    H1'    A  39           H1'        A  39 -14.452 -10.820   9.711
  410    H8     A  39           H8         A  39 -13.698  -8.756  12.742
  411    H61    A  39           H61        A  39  -7.884 -10.834  12.447
  412    H62    A  39           H62        A  39  -8.932  -9.580  13.069
  413    H2     A  39           H2         A  39 -10.380 -13.296   9.652
  414    H5'    A  40           H5'        A  40 -18.271 -15.002  12.063
  415   H5''    A  40          H5''        A  40 -18.228 -16.341  13.228
  416    H4'    A  40           H4'        A  40 -17.238 -16.838  10.905
  417    H3'    A  40           H3'        A  40 -16.030 -17.247  13.619
  418    H2'    A  40          H2''        A  40 -13.879 -17.593  12.899
  419   HO2'    A  40          H2'         A  40 -15.018 -18.507  10.460
  420    H1'    A  40           H1'        A  40 -13.922 -16.274  10.408
  421    H8     A  40           H8         A  40 -14.840 -14.130  13.446
  422    H61    A  40           H61        A  40  -8.772 -13.146  14.087
  423    H62    A  40           H62        A  40 -10.372 -12.670  14.610
  424    H2     A  40           H2         A  40  -9.350 -16.254  10.902
  425    H5'    A  41           H5'        A  41 -15.382 -21.815  12.307
  426   H5''    A  41          H5''        A  41 -15.326 -22.416  13.974
  427    H4'    A  41           H4'        A  41 -13.163 -22.528  12.422
  428    H3'    A  41           H3'        A  41 -13.566 -21.948  15.342
  429    H2'    A  41          H2''        A  41 -11.455 -21.110  15.677
  430   HO2'    A  41          H2'         A  41 -10.712 -22.915  13.626
  431    H1'    A  41           H1'        A  41 -10.768 -20.445  12.988
  432    H8     A  41           H8         A  41 -13.643 -18.515  14.646
  433    H61    A  41           H61        A  41  -9.269 -14.634  16.664
  434    H62    A  41           H62        A  41 -10.986 -14.868  16.428
  435    H2     A  41           H2         A  41  -7.241 -18.137  14.729
  436    H5'    U  42           H5'        U  42 -10.056 -24.919  14.301
  437   H5''    U  42          H5''        U  42  -9.892 -26.040  15.668
  438    H4'    U  42           H4'        U  42  -7.688 -25.013  14.930
  439    H3'    U  42           H3'        U  42  -8.949 -24.578  17.654
  440    H2'    U  42          H2''        U  42  -7.213 -23.211  18.362
  441   HO2'    U  42          H2'         U  42  -5.667 -24.447  16.319
  442    H1'    U  42           H1'        U  42  -6.556 -22.115  15.843
  443    H3     U  42           H3         U  42  -7.489 -18.457  18.332
  444    H5     U  42           H5         U  42 -11.202 -20.414  17.997
  445    H6     U  42           H6         U  42 -10.062 -22.259  16.923
  446    H5'    U  43           H5'        U  43  -5.019 -25.186  18.659
  447   H5''    U  43          H5''        U  43  -4.897 -26.062  20.197
  448    H4'    U  43           H4'        U  43  -3.987 -23.708  20.311
  449    H3'    U  43           H3'        U  43  -6.269 -24.807  21.934
  450    H2'    U  43          H2''        U  43  -6.859 -22.777  22.867
  451   HO2'    U  43          H2'         U  43  -4.311 -21.693  22.237
  452    H1'    U  43           H1'        U  43  -5.918 -21.045  20.840
  453    H3     U  43           H3         U  43 -10.204 -19.715  21.121
  454    H5     U  43           H5         U  43 -10.536 -23.781  20.063
  455    H6     U  43           H6         U  43  -8.124 -23.957  20.239
  456    H5'    A  44           H5'        A  44  -1.805 -24.208  24.945
  457   H5''    A  44          H5''        A  44  -2.702 -24.551  26.436
  458    H4'    A  44           H4'        A  44  -0.889 -22.618  26.404
  459    H3'    A  44           H3'        A  44  -3.647 -22.756  27.616
  460    H2'    A  44          H2''        A  44  -3.620 -20.534  28.289
  461   HO2'    A  44          H2'         A  44  -0.795 -20.515  27.925
  462    H1'    A  44           H1'        A  44  -2.098 -19.462  26.201
  463    H8     A  44           H8         A  44  -4.739 -21.295  24.407
  464    H61    A  44           H61        A  44  -8.866 -17.130  26.338
  465    H62    A  44           H62        A  44  -8.553 -18.435  25.216
  466    H2     A  44           H2         A  44  -5.016 -16.378  28.507
  467    H5'    A  45           H5'        A  45  -1.058 -21.022  30.672
  468   H5''    A  45          H5''        A  45  -1.469 -21.733  32.245
  469    H4'    A  45           H4'        A  45  -1.556 -19.190  32.179
  470    H3'    A  45           H3'        A  45  -3.768 -21.065  32.968
  471    H2'    A  45          H2''        A  45  -5.401 -19.459  33.001
  472   HO2'    A  45          H2'         A  45  -3.928 -18.261  34.558
  473    H1'    A  45           H1'        A  45  -4.183 -17.487  31.337
  474    H8     A  45           H8         A  45  -5.030 -20.824  29.676
  475    H61    A  45           H61        A  45 -10.731 -18.563  28.881
  476    H62    A  45           H62        A  45  -9.624 -19.855  28.476
  477    H2     A  45           H2         A  45  -8.450 -15.701  31.471
  478    H5'    G  46           H5'        G  46  -2.661 -18.483  37.325
  479   H5''    G  46          H5''        G  46  -3.821 -19.383  38.321
  480    H4'    G  46           H4'        G  46  -3.923 -16.715  38.169
  481    H3'    G  46           H3'        G  46  -6.020 -18.857  38.359
  482    H2'    G  46          H2''        G  46  -7.801 -17.461  37.861
  483   HO2'    G  46          H2'         G  46  -7.918 -15.456  38.552
  484    H1'    G  46           H1'        G  46  -6.570 -15.667  36.128
  485    H8     G  46           H8         G  46  -5.667 -19.124  35.001
  486    H1     G  46           H1         G  46 -11.722 -17.553  33.614
  487    H21    G  46           H21        G  46 -12.274 -15.682  34.646
  488    H22    G  46           H22        G  46 -11.226 -14.921  35.823
  489    H5'    C  47           H5'        C  47  -7.790 -16.301  41.923
  490   H5''    C  47          H5''        C  47  -8.514 -17.679  42.772
  491    H4'    C  47           H4'        C  47 -10.059 -15.787  41.710
  492    H3'    C  47           H3'        C  47 -10.313 -18.772  41.917
  493    H2'    C  47          H2''        C  47 -12.006 -18.955  40.381
  494   HO2'    C  47          H2'         C  47 -12.759 -16.271  40.953
  495    H1'    C  47           H1'        C  47 -11.655 -16.508  38.962
  496    H41    C  47           H41        C  47 -11.045 -21.237  34.759
  497    H42    C  47           H42        C  47  -9.477 -21.650  35.410
  498    H5     C  47           H5         C  47  -8.452 -20.444  37.234
  499    H6     C  47           H6         C  47  -8.833 -18.796  39.009
  500    H5'    C  48           H5'        C  48 -14.601 -17.161  42.435
  501   H5''    C  48          H5''        C  48 -15.100 -18.026  43.902
  502    H4'    C  48           H4'        C  48 -16.800 -18.354  42.152
  503    H3'    C  48           H3'        C  48 -14.979 -20.627  42.942
  504   HO3'    C  48          H3T         C  48 -16.645 -21.124  44.217
  505    H2'    C  48          H2''        C  48 -15.840 -22.049  41.355
  506   HO2'    C  48          H2'         C  48 -18.203 -20.473  41.502
  507    H1'    C  48           H1'        C  48 -16.744 -20.074  39.503
  508    H41    C  48           H41        C  48 -12.223 -23.483  36.580
  509    H42    C  48           H42        C  48 -11.006 -22.871  37.676
  510    H5     C  48           H5         C  48 -11.536 -21.571  39.631
  511    H6     C  48           H6         C  48 -13.312 -20.403  40.846
  Start of MODEL    5
    1    H5'    G   1           H5'        G   1 -13.666 -29.058  28.170
    2   H5''    G   1          H5''        G   1 -14.140 -27.567  27.331
    3    H4'    G   1           H4'        G   1 -16.186 -28.581  28.092
    4    H3'    G   1           H3'        G   1 -15.104 -26.157  29.439
    5    H2'    G   1          H2''        G   1 -16.410 -26.254  31.354
    6   HO2'    G   1          H2'         G   1 -18.435 -26.405  30.597
    7    H1'    G   1           H1'        G   1 -16.632 -28.952  31.739
    8    H8     G   1           H8         G   1 -13.150 -29.193  31.226
    9    H1     G   1           H1         G   1 -14.135 -24.925  35.907
   10    H21    G   1           H21        G   1 -16.254 -24.313  35.949
   11    H22    G   1           H22        G   1 -17.425 -24.901  34.790
   12   HO5'    G   1          H5T         G   1 -13.685 -27.268  30.028
   13    H5'    G   2           H5'        G   2 -19.159 -24.485  28.949
   14   H5''    G   2          H5''        G   2 -18.914 -22.874  28.245
   15    H4'    G   2           H4'        G   2 -19.983 -22.867  30.555
   16    H3'    G   2           H3'        G   2 -17.525 -21.431  29.646
   17    H2'    G   2          H2''        G   2 -16.752 -20.862  31.737
   18   HO2'    G   2          H2'         G   2 -18.247 -19.762  32.743
   19    H1'    G   2           H1'        G   2 -17.846 -22.896  33.309
   20    H8     G   2           H8         G   2 -15.923 -24.507  30.531
   21    H1     G   2           H1         G   2 -12.107 -21.964  35.010
   22    H21    G   2           H21        G   2 -13.294 -20.704  36.386
   23    H22    G   2           H22        G   2 -14.977 -20.327  36.088
   24    H5'    C   3           H5'        C   3 -19.862 -18.357  32.230
   25   H5''    C   3          H5''        C   3 -19.956 -16.976  31.119
   26    H4'    C   3           H4'        C   3 -19.219 -16.201  33.333
   27    H3'    C   3           H3'        C   3 -17.409 -16.177  30.938
   28    H2'    C   3          H2''        C   3 -15.495 -15.661  32.115
   29   HO2'    C   3          H2'         C   3 -17.294 -14.392  33.864
   30    H1'    C   3           H1'        C   3 -16.108 -16.774  34.610
   31    H41    C   3           H41        C   3 -11.535 -20.420  32.109
   32    H42    C   3           H42        C   3 -12.623 -21.001  30.871
   33    H5     C   3           H5         C   3 -14.934 -20.341  30.742
   34    H6     C   3           H6         C   3 -16.636 -18.809  31.612
   35    H5'    U   4           H5'        U   4 -16.607 -11.663  32.124
   36   H5''    U   4          H5''        U   4 -15.978 -11.203  30.531
   37    H4'    U   4           H4'        U   4 -14.365 -11.284  32.657
   38    H3'    U   4           H3'        U   4 -13.942 -12.194  29.804
   39    H2'    U   4          H2''        U   4 -11.767 -12.896  30.283
   40   HO2'    U   4          H2'         U   4 -11.991 -11.339  32.653
   41    H1'    U   4           H1'        U   4 -12.274 -13.917  32.817
   42    H3     U   4           H3         U   4 -10.869 -17.247  30.009
   43    H5     U   4           H5         U   4 -14.907 -16.616  28.986
   44    H6     U   4           H6         U   4 -14.917 -14.696  30.468
   45    H5'    U   5           H5'        U   5 -10.620  -9.793  31.622
   46   H5''    U   5          H5''        U   5 -10.144  -8.547  30.451
   47    H4'    U   5           H4'        U   5  -8.163  -9.644  31.513
   48    H3'    U   5           H3'        U   5  -8.809  -9.652  28.594
   49    H2'    U   5          H2''        U   5  -7.337 -11.306  27.991
   50   HO2'    U   5          H2'         U   5  -5.371 -10.796  28.505
   51    H1'    U   5           H1'        U   5  -7.004 -12.665  30.446
   52    H3     U   5           H3         U   5  -7.989 -15.888  27.409
   53    H5     U   5           H5         U   5 -11.590 -13.748  27.843
   54    H6     U   5           H6         U   5 -10.392 -12.142  29.206
   55    H5'    G   6           H5'        G   6  -5.873  -8.632  25.467
   56   H5''    G   6          H5''        G   6  -6.890  -9.837  26.282
   57    H4'    G   6           H4'        G   6  -3.907 -10.202  26.446
   58    H3'    G   6           H3'        G   6  -5.562 -10.151  23.956
   59    H2'    G   6          H2''        G   6  -5.195 -12.324  23.333
   60   HO2'    G   6          H2'         G   6  -2.942 -12.046  23.173
   61    H1'    G   6           H1'        G   6  -4.478 -13.494  25.806
   62    H8     G   6           H8         G   6  -7.941 -12.119  26.101
   63    H1     G   6           H1         G   6  -7.717 -17.381  22.441
   64    H21    G   6           H21        G   6  -5.630 -17.843  21.902
   65    H22    G   6           H22        G   6  -4.273 -16.982  22.595
   66    H5'    A   7           H5'        A   7  -0.767 -10.356  22.208
   67   H5''    A   7          H5''        A   7  -1.219  -9.783  20.590
   68    H4'    A   7           H4'        A   7   0.081 -12.086  20.882
   69    H3'    A   7           H3'        A   7  -2.089 -11.149  19.050
   70    H2'    A   7          H2''        A   7  -2.771 -13.228  18.352
   71   HO2'    A   7          H2'         A   7  -1.332 -14.583  17.661
   72    H1'    A   7           H1'        A   7  -1.957 -14.832  20.509
   73    H8     A   7           H8         A   7  -4.271 -11.950  21.458
   74    H61    A   7           H61        A   7  -8.954 -15.663  19.875
   75    H62    A   7           H62        A   7  -8.498 -14.217  20.749
   76    H2     A   7           H2         A   7  -5.132 -17.615  18.577
   77    H5'    U   8           H5'        U   8   0.912 -13.730  16.574
   78   H5''    U   8          H5''        U   8   0.846 -13.055  14.934
   79    H4'    U   8           H4'        U   8   0.348 -15.583  15.177
   80    H3'    U   8           H3'        U   8  -1.168 -13.449  13.724
   81    H2'    U   8          H2''        U   8  -3.072 -14.688  13.378
   82   HO2'    U   8          H2'         U   8  -1.451 -17.016  13.596
   83    H1'    U   8           H1'        U   8  -2.900 -16.535  15.502
   84    H3     U   8           H3         U   8  -7.027 -14.775  16.022
   85    H5     U   8           H5         U   8  -4.457 -11.530  16.797
   86    H6     U   8           H6         U   8  -2.597 -12.918  16.103
   87    H5'    U   9           H5'        U   9  -1.156 -16.573  10.594
   88   H5''    U   9          H5''        U   9  -0.803 -15.722   9.077
   89    H4'    U   9           H4'        U   9  -3.000 -16.895   8.979
   90    H3'    U   9           H3'        U   9  -2.659 -13.916   8.804
   91    H2'    U   9          H2''        U   9  -4.886 -13.429   9.029
   92   HO2'    U   9          H2'         U   9  -5.274 -15.897   7.701
   93    H1'    U   9           H1'        U   9  -5.798 -15.850  10.240
   94    H3     U   9           H3         U   9  -7.817 -12.866  12.898
   95    H5     U   9           H5         U   9  -3.750 -11.811  13.224
   96    H6     U   9           H6         U   9  -3.242 -13.515  11.572
   97    H5'    G  10           H5'        G  10  -5.056 -15.300   4.488
   98   H5''    G  10          H5''        G  10  -4.772 -13.744   3.684
   99    H4'    G  10           H4'        G  10  -7.246 -14.701   3.935
  100    H3'    G  10           H3'        G  10  -6.100 -11.927   4.179
  101    H2'    G  10          H2''        G  10  -8.087 -10.989   4.930
  102   HO2'    G  10          H2'         G  10  -9.456 -11.818   3.345
  103    H1'    G  10           H1'        G  10  -9.032 -13.077   6.470
  104    H8     G  10           H8         G  10  -5.390 -12.645   7.275
  105    H1     G  10           H1         G  10  -8.996  -7.879   9.597
  106    H21    G  10           H21        G  10 -11.040  -8.011   8.779
  107    H22    G  10           H22        G  10 -11.483  -9.171   7.547
  108    H5'    U  11           H5'        U  11  -9.619 -11.460   0.814
  109   H5''    U  11          H5''        U  11  -9.094  -9.937   0.072
  110    H4'    U  11           H4'        U  11 -11.495 -10.132   1.222
  111    H3'    U  11           H3'        U  11  -9.438  -7.931   1.158
  112    H2'    U  11          H2''        U  11 -10.588  -6.600   2.691
  113   HO2'    U  11          H2'         U  11 -12.868  -8.207   2.123
  114    H1'    U  11           H1'        U  11 -11.608  -8.585   4.334
  115    H3     U  11           H3         U  11  -8.655  -5.814   6.566
  116    H5     U  11           H5         U  11  -6.343  -8.892   4.854
  117    H6     U  11           H6         U  11  -8.295  -9.570   3.589
  118    H5'    A  12           H5'        A  12 -12.314  -5.159  -1.272
  119   H5''    A  12          H5''        A  12 -11.015  -4.039  -1.724
  120    H4'    A  12           H4'        A  12 -12.787  -3.411   0.192
  121    H3'    A  12           H3'        A  12  -9.811  -2.916  -0.054
  122    H2'    A  12          H2''        A  12  -9.734  -1.871   2.058
  123   HO2'    A  12          H2'         A  12 -11.701  -0.663   1.783
  124    H1'    A  12           H1'        A  12 -11.264  -3.711   3.391
  125    H8     A  12           H8         A  12  -9.331  -5.893   1.111
  126    H61    A  12           H61        A  12  -4.358  -4.854   4.626
  127    H62    A  12           H62        A  12  -5.084  -5.918   3.442
  128    H2     A  12           H2         A  12  -7.538  -1.923   5.815
  129    H5'    U  13           H5'        U  13 -10.750   1.402   0.485
  130   H5''    U  13          H5''        U  13  -9.464   2.150  -0.481
  131    H4'    U  13           H4'        U  13  -9.419   2.454   2.123
  132    H3'    U  13           H3'        U  13  -7.206   1.727   0.205
  133    H2'    U  13          H2''        U  13  -5.657   1.377   1.928
  134   HO2'    U  13          H2'         U  13  -5.645   2.528   3.721
  135    H1'    U  13           H1'        U  13  -7.359   0.403   3.883
  136    H3     U  13           H3         U  13  -3.935  -2.487   2.682
  137    H5     U  13           H5         U  13  -7.149  -3.289   0.078
  138    H6     U  13           H6         U  13  -8.247  -1.299   0.920
  139    H5'    U  14           H5'        U  14  -5.524   5.619   1.684
  140   H5''    U  14          H5''        U  14  -4.952   6.478   0.239
  141    H4'    U  14           H4'        U  14  -3.076   6.067   1.800
  142    H3'    U  14           H3'        U  14  -3.265   4.700  -0.884
  143    H2'    U  14          H2''        U  14  -1.350   3.433  -0.533
  144   HO2'    U  14          H2'         U  14  -0.698   5.252   1.560
  145    H1'    U  14           H1'        U  14  -1.607   2.993   2.196
  146    H3     U  14           H3         U  14  -1.737  -1.067   0.144
  147    H5     U  14           H5         U  14  -5.491   0.642  -0.706
  148    H6     U  14           H6         U  14  -4.714   2.701   0.316
  149    H5'    A  15           H5'        A  15   0.845   6.885  -0.794
  150   H5''    A  15          H5''        A  15   1.406   6.937  -2.476
  151    H4'    A  15           H4'        A  15   2.751   5.548  -0.639
  152    H3'    A  15           H3'        A  15   2.109   5.030  -3.534
  153    H2'    A  15          H2''        A  15   2.776   2.837  -3.486
  154   HO2'    A  15          H2'         A  15   4.510   2.128  -2.330
  155    H1'    A  15           H1'        A  15   2.551   2.335  -0.682
  156    H8     A  15           H8         A  15  -0.751   3.124  -2.381
  157    H61    A  15           H61        A  15  -0.895  -2.789  -4.162
  158    H62    A  15           H62        A  15  -1.852  -1.354  -3.872
  159    H2     A  15           H2         A  15   3.213  -1.910  -2.596
  160    H5'    U  16           H5'        U  16   6.717   4.300  -2.623
  161   H5''    U  16          H5''        U  16   7.514   4.725  -4.151
  162    H4'    U  16           H4'        U  16   8.196   2.466  -3.202
  163    H3'    U  16           H3'        U  16   7.025   3.001  -5.921
  164    H2'    U  16          H2''        U  16   6.738   0.786  -6.448
  165   HO2'    U  16          H2'         U  16   8.784   0.172  -4.569
  166    H1'    U  16           H1'        U  16   6.542  -0.322  -3.849
  167    H3     U  16           H3         U  16   2.985  -1.937  -6.162
  168    H5     U  16           H5         U  16   2.089   2.137  -5.586
  169    H6     U  16           H6         U  16   4.347   2.455  -4.773
  170    H5'    U  17           H5'        U  17  10.921   0.293  -6.900
  171   H5''    U  17          H5''        U  17  11.235   0.957  -8.514
  172    H4'    U  17           H4'        U  17  10.842  -1.612  -8.319
  173    H3'    U  17           H3'        U  17   9.645   0.392 -10.217
  174    H2'    U  17          H2''        U  17   8.067  -1.041 -11.047
  175   HO2'    U  17          H2'         U  17   9.000  -2.719 -11.907
  176    H1'    U  17           H1'        U  17   7.952  -2.924  -8.907
  177    H3     U  17           H3         U  17   3.652  -2.067 -10.047
  178    H5     U  17           H5         U  17   4.990   1.529  -8.305
  179    H6     U  17           H6         U  17   7.226   0.588  -8.244
  180    H5'    A  18           H5'        A  18  11.286  -3.503 -12.488
  181   H5''    A  18          H5''        A  18  11.681  -2.881 -14.101
  182    H4'    A  18           H4'        A  18  10.223  -4.973 -14.086
  183    H3'    A  18           H3'        A  18   9.540  -2.336 -15.388
  184    H2'    A  18          H2''        A  18   7.417  -3.010 -15.955
  185   HO2'    A  18          H2'         A  18   6.978  -4.965 -16.731
  186    H1'    A  18           H1'        A  18   7.080  -5.083 -14.010
  187    H8     A  18           H8         A  18   7.463  -1.515 -12.704
  188    H61    A  18           H61        A  18   1.371  -0.960 -13.584
  189    H62    A  18           H62        A  18   2.772  -0.289 -12.779
  190    H2     A  18           H2         A  18   2.691  -4.857 -15.380
  191    H5'    A  19           H5'        A  19   9.034  -5.731 -18.798
  192   H5''    A  19          H5''        A  19   9.308  -4.712 -20.224
  193    H4'    A  19           H4'        A  19   7.087  -6.040 -20.142
  194    H3'    A  19           H3'        A  19   7.506  -3.101 -20.671
  195    H2'    A  19          H2''        A  19   5.261  -2.610 -20.630
  196   HO2'    A  19          H2'         A  19   5.073  -5.132 -21.785
  197    H1'    A  19           H1'        A  19   4.339  -4.825 -19.076
  198    H8     A  19           H8         A  19   6.762  -2.228 -17.569
  199    H61    A  19           H61        A  19   1.678   0.813 -15.820
  200    H62    A  19           H62        A  19   3.397   0.622 -15.553
  201    H2     A  19           H2         A  19   0.436  -2.550 -18.514
  202    H5'    A  20           H5'        A  20   4.795  -4.779 -24.486
  203   H5''    A  20          H5''        A  20   5.068  -3.372 -25.531
  204    H4'    A  20           H4'        A  20   2.602  -4.017 -24.885
  205    H3'    A  20           H3'        A  20   3.972  -1.326 -24.892
  206    H2'    A  20          H2''        A  20   2.104  -0.244 -24.038
  207   HO2'    A  20          H2'         A  20   0.746  -1.386 -25.688
  208    H1'    A  20           H1'        A  20   1.085  -2.330 -22.467
  209    H8     A  20           H8         A  20   4.799  -1.252 -22.117
  210    H61    A  20           H61        A  20   2.772   2.710 -17.832
  211    H62    A  20           H62        A  20   4.181   1.960 -18.547
  212    H2     A  20           H2         A  20  -0.798   0.775 -19.727
  213    H5'    U  21           H5'        U  21   0.449  -0.195 -27.418
  214   H5''    U  21          H5''        U  21   1.018   1.302 -28.182
  215    H4'    U  21           H4'        U  21  -0.819   1.407 -26.271
  216    H3'    U  21           H3'        U  21   1.564   3.118 -26.906
  217    H2'    U  21          H2''        U  21   1.576   4.239 -24.895
  218   HO2'    U  21          H2'         U  21  -0.213   5.162 -24.344
  219    H1'    U  21           H1'        U  21   0.243   2.371 -23.249
  220    H3     U  21           H3         U  21   4.045   3.557 -21.053
  221    H5     U  21           H5         U  21   5.422   1.357 -24.373
  222    H6     U  21           H6         U  21   3.128   1.178 -25.124
  223    H5'    U  22           H5'        U  22  -2.081   5.992 -26.125
  224   H5''    U  22          H5''        U  22  -1.791   7.330 -27.254
  225    H4'    U  22           H4'        U  22  -2.145   7.933 -24.742
  226    H3'    U  22           H3'        U  22   0.051   8.797 -26.634
  227    H2'    U  22          H2''        U  22   1.407   9.601 -25.003
  228   HO2'    U  22          H2'         U  22   0.180  11.349 -24.481
  229    H1'    U  22           H1'        U  22  -0.047   8.515 -22.733
  230    H3     U  22           H3         U  22   4.582   8.963 -22.070
  231    H5     U  22           H5         U  22   3.742   5.067 -23.408
  232    H6     U  22           H6         U  22   1.548   5.864 -24.114
  233    H5'    A  23           H5'        A  23   1.457  11.653 -27.818
  234   H5''    A  23          H5''        A  23   1.922  10.699 -26.399
  235    H4'    A  23           H4'        A  23   3.343  12.810 -26.947
  236    H3'    A  23           H3'        A  23   2.509  11.569 -24.492
  237    H2'    A  23          H2''        A  23   1.367  13.295 -23.512
  238   HO2'    A  23          H2'         A  23   2.633  14.892 -22.595
  239    H1'    A  23           H1'        A  23   2.225  15.565 -25.123
  240    H8     A  23           H8         A  23  -0.808  13.884 -26.355
  241    H61    A  23           H61        A  23  -4.101  16.491 -21.814
  242    H62    A  23           H62        A  23  -4.176  15.641 -23.341
  243    H2     A  23           H2         A  23   0.244  17.160 -20.943
  244    H5'    A  24           H5'        A  24   6.544  11.516 -22.090
  245   H5''    A  24          H5''        A  24   5.640  10.344 -21.113
  246    H4'    A  24           H4'        A  24   5.760  13.189 -20.780
  247    H3'    A  24           H3'        A  24   4.421  10.789 -19.544
  248    H2'    A  24          H2''        A  24   2.694  12.009 -18.665
  249   HO2'    A  24          H2'         A  24   4.636  14.059 -18.299
  250    H1'    A  24           H1'        A  24   3.116  14.440 -20.237
  251    H8     A  24           H8         A  24   1.548  11.804 -22.289
  252    H61    A  24           H61        A  24  -3.866  13.078 -19.600
  253    H62    A  24           H62        A  24  -3.075  12.272 -20.937
  254    H2     A  24           H2         A  24  -0.643  15.181 -17.300
  255    H5'    U  25           H5'        U  25   3.725  10.607 -17.182
  256   H5''    U  25          H5''        U  25   4.258  12.210 -16.638
  257    H4'    U  25           H4'        U  25   4.048   9.993 -14.603
  258    H3'    U  25           H3'        U  25   1.934  10.526 -16.310
  259    H2'    U  25          H2''        U  25   1.488  12.746 -15.818
  260   HO2'    U  25          H2'         U  25  -0.318  12.492 -14.804
  261    H1'    U  25           H1'        U  25   2.325  12.608 -12.970
  262    H3     U  25           H3         U  25   2.781  17.048 -12.682
  263    H5     U  25           H5         U  25   3.432  16.330 -16.783
  264    H6     U  25           H6         U  25   3.151  13.962 -16.350
  265    H5'    U  26           H5'        U  26   0.267  11.281 -16.887
  266   H5''    U  26          H5''        U  26  -1.265  10.805 -16.131
  267    H4'    U  26           H4'        U  26  -1.767  11.073 -18.472
  268    H3'    U  26           H3'        U  26  -1.491   8.351 -17.304
  269    H2'    U  26          H2''        U  26  -1.129   7.174 -19.231
  270   HO2'    U  26          H2'         U  26  -2.205   7.560 -21.063
  271    H1'    U  26           H1'        U  26  -0.086   9.140 -20.934
  272    H3     U  26           H3         U  26   2.719   5.489 -20.627
  273    H5     U  26           H5         U  26   3.722   8.015 -17.409
  274    H6     U  26           H6         U  26   1.772   9.352 -17.926
  275    H5'    C  27           H5'        C  27  -5.773   7.693 -18.616
  276   H5''    C  27          H5''        C  27  -6.456   6.747 -17.278
  277    H4'    C  27           H4'        C  27  -6.062   5.392 -19.375
  278    H3'    C  27           H3'        C  27  -4.783   4.903 -16.690
  279    H2'    C  27          H2''        C  27  -3.392   3.226 -17.454
  280   HO2'    C  27          H2'         C  27  -5.237   2.858 -19.591
  281    H1'    C  27           H1'        C  27  -3.165   4.024 -20.158
  282    H41    C  27           H41        C  27   2.606   4.784 -17.607
  283    H42    C  27           H42        C  27   1.962   5.733 -16.286
  284    H5     C  27           H5         C  27  -0.400   6.044 -15.931
  285    H6     C  27           H6         C  27  -2.622   5.809 -16.927
  286    H5'    U  28           H5'        U  28  -8.280   1.147 -17.002
  287   H5''    U  28          H5''        U  28  -7.717   0.072 -15.706
  288    H4'    U  28           H4'        U  28  -7.718  -0.705 -18.297
  289    H3'    U  28           H3'        U  28  -5.746  -1.184 -16.044
  290    H2'    U  28          H2''        U  28  -4.354  -2.447 -17.458
  291   HO2'    U  28          H2'         U  28  -6.550  -2.466 -19.276
  292    H1'    U  28           H1'        U  28  -4.531  -0.734 -19.634
  293    H3     U  28           H3         U  28  -0.373  -0.709 -17.619
  294    H5     U  28           H5         U  28  -2.734   2.005 -15.448
  295    H6     U  28           H6         U  28  -4.656   1.250 -16.696
  296    H5'    U  29           H5'        U  29  -6.197  -4.965 -17.676
  297   H5''    U  29          H5''        U  29  -6.567  -6.182 -16.439
  298    H4'    U  29           H4'        U  29  -4.623  -6.902 -17.774
  299    H3'    U  29           H3'        U  29  -4.367  -6.124 -14.875
  300    H2'    U  29          H2''        U  29  -2.059  -6.302 -14.859
  301   HO2'    U  29          H2'         U  29  -2.389  -7.994 -17.114
  302    H1'    U  29           H1'        U  29  -1.510  -5.577 -17.499
  303    H3     U  29           H3         U  29   0.739  -2.727 -14.740
  304    H5     U  29           H5         U  29  -3.264  -1.426 -14.571
  305    H6     U  29           H6         U  29  -3.888  -3.393 -15.843
  306    H5'    A  30           H5'        A  30  -1.987 -10.108 -15.024
  307   H5''    A  30          H5''        A  30  -2.067 -10.575 -13.316
  308    H4'    A  30           H4'        A  30   0.270  -9.985 -14.441
  309    H3'    A  30           H3'        A  30  -0.871  -9.312 -11.726
  310    H2'    A  30          H2''        A  30   0.880  -7.924 -11.200
  311   HO2'    A  30          H2'         A  30   2.681  -9.016 -11.260
  312    H1'    A  30           H1'        A  30   1.777  -7.348 -13.867
  313    H8     A  30           H8         A  30  -1.631  -5.896 -13.113
  314    H61    A  30           H61        A  30   1.316  -1.303 -10.206
  315    H62    A  30           H62        A  30  -0.190  -1.805 -10.941
  316    H2     A  30           H2         A  30   4.311  -4.514 -11.136
  317    H5'    A  31           H5'        A  31   3.389 -11.893 -10.406
  318   H5''    A  31          H5''        A  31   2.692 -12.112  -8.789
  319    H4'    A  31           H4'        A  31   5.057 -10.923  -9.089
  320    H3'    A  31           H3'        A  31   2.721 -10.342  -7.272
  321    H2'    A  31          H2''        A  31   3.638  -8.378  -6.478
  322   HO2'    A  31          H2'         A  31   6.193  -9.252  -7.376
  323    H1'    A  31           H1'        A  31   5.159  -7.637  -8.727
  324    H8     A  31           H8         A  31   1.467  -8.239  -9.460
  325    H61    A  31           H61        A  31   0.511  -2.449  -7.510
  326    H62    A  31           H62        A  31  -0.188  -3.822  -8.337
  327    H2     A  31           H2         A  31   4.755  -3.555  -6.573
  328    H5'    U  32           H5'        U  32   6.538 -10.286  -4.516
  329   H5''    U  32          H5''        U  32   5.821 -10.583  -2.922
  330    H4'    U  32           H4'        U  32   7.125  -8.317  -3.399
  331    H3'    U  32           H3'        U  32   4.586  -8.907  -1.885
  332    H2'    U  32          H2''        U  32   4.010  -6.699  -1.664
  333   HO2'    U  32          H2'         U  32   5.489  -5.618  -0.647
  334    H1'    U  32           H1'        U  32   5.562  -5.609  -3.810
  335    H3     U  32           H3         U  32   1.485  -3.580  -3.880
  336    H5     U  32           H5         U  32   0.771  -7.472  -5.324
  337    H6     U  32           H6         U  32   3.046  -8.049  -4.712
  338    H5'    A  33           H5'        A  33   7.581  -6.197   0.511
  339   H5''    A  33          H5''        A  33   7.392  -6.696   2.204
  340    H4'    A  33           H4'        A  33   7.335  -4.190   1.882
  341    H3'    A  33           H3'        A  33   5.170  -5.880   3.093
  342    H2'    A  33          H2''        A  33   3.569  -4.239   3.079
  343   HO2'    A  33          H2'         A  33   4.063  -2.480   4.085
  344    H1'    A  33           H1'        A  33   4.660  -2.495   1.101
  345    H8     A  33           H8         A  33   3.595  -6.016   0.021
  346    H61    A  33           H61        A  33  -2.007  -3.574  -0.917
  347    H62    A  33           H62        A  33  -0.962  -4.938  -1.245
  348    H2     A  33           H2         A  33   0.523  -0.512   1.165
  349    H5'    A  34           H5'        A  34   5.806  -2.020   5.384
  350   H5''    A  34          H5''        A  34   6.117  -2.523   7.058
  351    H4'    A  34           H4'        A  34   4.621  -0.612   7.139
  352    H3'    A  34           H3'        A  34   3.683  -3.363   7.811
  353    H2'    A  34          H2''        A  34   1.432  -2.954   7.650
  354   HO2'    A  34          H2'         A  34   1.392  -1.447   9.317
  355    H1'    A  34           H1'        A  34   1.404  -0.604   6.067
  356    H8     A  34           H8         A  34   2.750  -4.124   5.034
  357    H61    A  34           H61        A  34  -2.623  -4.686   2.026
  358    H62    A  34           H62        A  34  -1.014  -5.342   2.226
  359    H2     A  34           H2         A  34  -2.727  -0.859   4.365
  360    H5'    C  35           H5'        C  35   0.732  -3.379  11.969
  361   H5''    C  35          H5''        C  35   1.633  -4.365  10.800
  362    H4'    C  35           H4'        C  35  -0.498  -2.414   9.847
  363    H3'    C  35           H3'        C  35  -0.885  -4.736  11.555
  364    H2'    C  35          H2''        C  35  -0.585  -6.312   9.849
  365   HO2'    C  35          H2'         C  35  -2.831  -6.449  10.226
  366    H1'    C  35           H1'        C  35  -1.528  -4.377   7.764
  367    H41    C  35           H41        C  35   1.022  -8.767   3.942
  368    H42    C  35           H42        C  35   2.258  -9.159   5.117
  369    H5     C  35           H5         C  35   2.458  -8.046   7.243
  370    H6     C  35           H6         C  35   1.461  -6.386   8.745
  371    H5'    U  36           H5'        U  36  -1.912  -2.374  12.667
  372   H5''    U  36          H5''        U  36  -2.780  -2.531  14.207
  373    H4'    U  36           H4'        U  36  -2.699  -0.218  14.099
  374    H3'    U  36           H3'        U  36  -5.107  -1.321  12.710
  375    H2'    U  36          H2''        U  36  -5.657   0.619  11.554
  376   HO2'    U  36          H2'         U  36  -4.014   1.973  13.439
  377    H1'    U  36           H1'        U  36  -3.167   1.580  10.947
  378    H3     U  36           H3         U  36  -6.141  -0.519   7.738
  379    H5     U  36           H5         U  36  -2.596  -2.739   8.199
  380    H6     U  36           H6         U  36  -2.087  -1.417  10.158
  381    H5'    A  37           H5'        A  37  -7.474   1.389  13.584
  382   H5''    A  37          H5''        A  37  -8.607   0.859  14.841
  383    H4'    A  37           H4'        A  37 -10.015   1.474  13.028
  384    H3'    A  37           H3'        A  37  -9.412  -1.485  13.189
  385    H2'    A  37          H2''        A  37 -10.674  -1.935  11.265
  386   HO2'    A  37          H2'         A  37 -11.686   0.717  11.504
  387    H1'    A  37           H1'        A  37  -9.806   0.191   9.760
  388    H8     A  37           H8         A  37  -6.764  -0.949  11.595
  389    H61    A  37           H61        A  37  -6.368  -5.671   7.650
  390    H62    A  37           H62        A  37  -5.574  -4.790   8.937
  391    H2     A  37           H2         A  37 -10.426  -3.811   7.176
  392    H5'    C  38           H5'        C  38 -13.611  -1.299  13.121
  393   H5''    C  38          H5''        C  38 -14.429  -2.357  14.288
  394    H4'    C  38           H4'        C  38 -15.152  -2.846  11.959
  395    H3'    C  38           H3'        C  38 -13.690  -4.779  13.722
  396    H2'    C  38          H2''        C  38 -13.225  -6.299  12.075
  397   HO2'    C  38          H2'         C  38 -15.517  -5.312  10.708
  398    H1'    C  38           H1'        C  38 -13.344  -4.654   9.782
  399    H41    C  38           H41        C  38  -7.431  -6.940  10.508
  400    H42    C  38           H42        C  38  -7.128  -5.801  11.797
  401    H5     C  38           H5         C  38  -8.765  -4.180  12.529
  402    H6     C  38           H6         C  38 -11.103  -3.483  12.360
  403    H5'    A  39           H5'        A  39 -17.807  -7.439  12.438
  404   H5''    A  39          H5''        A  39 -17.482  -8.704  13.639
  405    H4'    A  39           H4'        A  39 -17.623  -9.293  11.033
  406    H3'    A  39           H3'        A  39 -15.712 -10.257  13.166
  407    H2'    A  39          H2''        A  39 -14.678 -11.689  11.615
  408   HO2'    A  39          H2'         A  39 -16.128 -12.688  10.420
  409    H1'    A  39           H1'        A  39 -14.701  -9.879   9.489
  410    H8     A  39           H8         A  39 -13.671  -8.016  12.580
  411    H61    A  39           H61        A  39  -8.038 -10.459  11.877
  412    H62    A  39           H62        A  39  -8.969  -9.186  12.634
  413    H2     A  39           H2         A  39 -10.844 -12.627   9.136
  414    H5'    A  40           H5'        A  40 -18.371 -13.677  12.046
  415   H5''    A  40          H5''        A  40 -18.441 -15.014  13.210
  416    H4'    A  40           H4'        A  40 -17.291 -15.572  10.999
  417    H3'    A  40           H3'        A  40 -16.240 -15.886  13.788
  418    H2'    A  40          H2''        A  40 -14.044 -16.196  13.215
  419   HO2'    A  40          H2'         A  40 -14.973 -17.225  10.730
  420    H1'    A  40           H1'        A  40 -13.982 -15.012  10.644
  421    H8     A  40           H8         A  40 -14.987 -12.763  13.593
  422    H61    A  40           H61        A  40  -8.937 -11.711  14.306
  423    H62    A  40           H62        A  40 -10.549 -11.192  14.745
  424    H2     A  40           H2         A  40  -9.441 -14.891  11.180
  425    H5'    A  41           H5'        A  41 -15.404 -20.489  12.339
  426   H5''    A  41          H5''        A  41 -15.435 -21.124  13.995
  427    H4'    A  41           H4'        A  41 -13.218 -21.299  12.538
  428    H3'    A  41           H3'        A  41 -13.733 -20.733  15.437
  429    H2'    A  41          H2''        A  41 -11.640 -19.911  15.889
  430   HO2'    A  41          H2'         A  41 -10.766 -21.676  13.843
  431    H1'    A  41           H1'        A  41 -10.782 -19.256  13.246
  432    H8     A  41           H8         A  41 -13.746 -17.373  14.845
  433    H61    A  41           H61        A  41  -9.491 -13.329  16.791
  434    H62    A  41           H62        A  41 -11.200 -13.611  16.547
  435    H2     A  41           H2         A  41  -7.358 -16.798  14.911
  436    H5'    U  42           H5'        U  42 -10.455 -24.021  14.408
  437   H5''    U  42          H5''        U  42 -10.315 -25.134  15.784
  438    H4'    U  42           H4'        U  42  -8.079 -24.274  14.902
  439    H3'    U  42           H3'        U  42  -9.150 -23.802  17.699
  440    H2'    U  42          H2''        U  42  -7.281 -22.575  18.333
  441   HO2'    U  42          H2'         U  42  -5.982 -23.966  16.236
  442    H1'    U  42           H1'        U  42  -6.719 -21.433  15.820
  443    H3     U  42           H3         U  42  -7.387 -17.790  18.401
  444    H5     U  42           H5         U  42 -11.181 -19.605  18.242
  445    H6     U  42           H6         U  42 -10.168 -21.480  17.101
  446    H5'    U  43           H5'        U  43  -5.207 -24.858  18.391
  447   H5''    U  43          H5''        U  43  -5.035 -25.750  19.916
  448    H4'    U  43           H4'        U  43  -3.867 -23.511  19.935
  449    H3'    U  43           H3'        U  43  -6.117 -24.329  21.765
  450    H2'    U  43          H2''        U  43  -6.312 -22.244  22.757
  451   HO2'    U  43          H2'         U  43  -3.668 -22.324  22.621
  452    H1'    U  43           H1'        U  43  -5.443 -20.644  20.610
  453    H3     U  43           H3         U  43  -9.527 -18.900  21.326
  454    H5     U  43           H5         U  43 -10.362 -22.923  20.390
  455    H6     U  43           H6         U  43  -7.973 -23.331  20.297
  456    H5'    A  44           H5'        A  44  -1.486 -23.481  23.997
  457   H5''    A  44          H5''        A  44  -1.911 -24.141  25.588
  458    H4'    A  44           H4'        A  44  -0.494 -22.015  25.639
  459    H3'    A  44           H3'        A  44  -3.189 -22.397  26.944
  460    H2'    A  44          H2''        A  44  -3.235 -20.211  27.752
  461   HO2'    A  44          H2'         A  44  -1.429 -18.993  28.101
  462    H1'    A  44           H1'        A  44  -1.940 -18.960  25.611
  463    H8     A  44           H8         A  44  -4.533 -20.966  23.942
  464    H61    A  44           H61        A  44  -8.849 -17.170  26.195
  465    H62    A  44           H62        A  44  -8.496 -18.406  25.008
  466    H2     A  44           H2         A  44  -4.958 -16.189  28.195
  467    H5'    A  45           H5'        A  45  -0.722 -20.711  30.068
  468   H5''    A  45          H5''        A  45  -1.000 -21.622  31.566
  469    H4'    A  45           H4'        A  45  -1.362 -19.139  31.826
  470    H3'    A  45           H3'        A  45  -3.420 -21.279  32.307
  471    H2'    A  45          H2''        A  45  -5.181 -19.825  32.507
  472   HO2'    A  45          H2'         A  45  -3.859 -18.731  34.248
  473    H1'    A  45           H1'        A  45  -4.099 -17.564  31.140
  474    H8     A  45           H8         A  45  -4.646 -20.690  29.020
  475    H61    A  45           H61        A  45 -10.532 -18.876  28.477
  476    H62    A  45           H62        A  45  -9.285 -19.924  27.838
  477    H2     A  45           H2         A  45  -8.529 -16.210  31.477
  478    H5'    G  46           H5'        G  46  -2.246 -19.721  36.991
  479   H5''    G  46          H5''        G  46  -3.405 -20.669  37.942
  480    H4'    G  46           H4'        G  46  -3.508 -17.991  37.905
  481    H3'    G  46           H3'        G  46  -5.599 -20.146  38.029
  482    H2'    G  46          H2''        G  46  -7.393 -18.721  37.627
  483   HO2'    G  46          H2'         G  46  -5.646 -16.693  38.555
  484    H1'    G  46           H1'        G  46  -6.213 -16.932  35.871
  485    H8     G  46           H8         G  46  -5.194 -20.320  34.685
  486    H1     G  46           H1         G  46 -11.354 -19.029  33.486
  487    H21    G  46           H21        G  46 -11.976 -17.217  34.580
  488    H22    G  46           H22        G  46 -10.944 -16.436  35.756
  489    H5'    C  47           H5'        C  47  -7.200 -18.059  41.799
  490   H5''    C  47          H5''        C  47  -7.932 -19.472  42.583
  491    H4'    C  47           H4'        C  47  -9.467 -17.554  41.545
  492    H3'    C  47           H3'        C  47  -9.703 -20.550  41.640
  493    H2'    C  47          H2''        C  47 -11.376 -20.677  40.076
  494   HO2'    C  47          H2'         C  47 -12.123 -18.073  40.938
  495    H1'    C  47           H1'        C  47 -10.998 -18.177  38.754
  496    H41    C  47           H41        C  47 -10.372 -22.806  34.431
  497    H42    C  47           H42        C  47  -8.773 -23.174  35.029
  498    H5     C  47           H5         C  47  -7.745 -21.974  36.856
  499    H6     C  47           H6         C  47  -8.140 -20.390  38.685
  500    H5'    C  48           H5'        C  48 -14.004 -19.061  42.067
  501   H5''    C  48          H5''        C  48 -14.484 -19.891  43.561
  502    H4'    C  48           H4'        C  48 -16.198 -20.330  41.885
  503    H3'    C  48           H3'        C  48 -14.260 -22.520  42.612
  504   HO3'    C  48          H3T         C  48 -17.040 -22.033  43.027
  505    H2'    C  48          H2''        C  48 -15.071 -23.978  41.029
  506   HO2'    C  48          H2'         C  48 -17.492 -22.486  40.923
  507    H1'    C  48           H1'        C  48 -16.048 -22.073  39.162
  508    H41    C  48           H41        C  48 -11.225 -25.152  36.366
  509    H42    C  48           H42        C  48 -10.081 -24.452  37.489
  510    H5     C  48           H5         C  48 -10.752 -23.194  39.429
  511    H6     C  48           H6         C  48 -12.635 -22.144  40.590
  Start of MODEL    6
    1    H5'    G   1           H5'        G   1 -13.998 -29.715  27.787
    2   H5''    G   1          H5''        G   1 -14.467 -28.282  26.852
    3    H4'    G   1           H4'        G   1 -16.510 -29.444  27.400
    4    H3'    G   1           H3'        G   1 -15.792 -26.882  28.733
    5    H2'    G   1          H2''        G   1 -17.317 -27.000  30.479
    6   HO2'    G   1          H2'         G   1 -19.264 -27.857  30.273
    7    H1'    G   1           H1'        G   1 -17.386 -29.690  30.977
    8    H8     G   1           H8         G   1 -13.854 -29.659  30.899
    9    H1     G   1           H1         G   1 -15.749 -25.316  35.217
   10    H21    G   1           H21        G   1 -17.912 -24.927  35.007
   11    H22    G   1           H22        G   1 -18.851 -25.571  33.678
   12   HO5'    G   1          H5T         G   1 -14.401 -27.829  29.546
   13    H5'    G   2           H5'        G   2 -19.854 -25.380  27.589
   14   H5''    G   2          H5''        G   2 -19.485 -23.775  26.926
   15    H4'    G   2           H4'        G   2 -20.890 -23.818  29.086
   16    H3'    G   2           H3'        G   2 -18.422 -22.263  28.431
   17    H2'    G   2          H2''        G   2 -17.930 -21.613  30.579
   18   HO2'    G   2          H2'         G   2 -19.559 -20.572  31.406
   19    H1'    G   2           H1'        G   2 -19.128 -23.663  32.069
   20    H8     G   2           H8         G   2 -16.766 -25.267  29.669
   21    H1     G   2           H1         G   2 -13.732 -22.278  34.461
   22    H21    G   2           H21        G   2 -15.163 -21.026  35.590
   23    H22    G   2           H22        G   2 -16.806 -20.767  35.051
   24    H5'    C   3           H5'        C   3 -21.344 -18.904  30.337
   25   H5''    C   3          H5''        C   3 -20.986 -17.626  29.158
   26    H4'    C   3           H4'        C   3 -20.730 -16.887  31.563
   27    H3'    C   3           H3'        C   3 -18.595 -16.839  29.448
   28    H2'    C   3          H2''        C   3 -16.881 -16.327  30.894
   29   HO2'    C   3          H2'         C   3 -17.506 -14.479  31.804
   30    H1'    C   3           H1'        C   3 -17.905 -17.389  33.294
   31    H41    C   3           H41        C   3 -12.794 -20.837  31.702
   32    H42    C   3           H42        C   3 -13.659 -21.560  30.367
   33    H5     C   3           H5         C   3 -15.963 -21.060  29.874
   34    H6     C   3           H6         C   3 -17.853 -19.588  30.391
   35    H5'    U   4           H5'        U   4 -18.053 -12.194  30.836
   36   H5''    U   4          H5''        U   4 -17.244 -11.779  29.312
   37    H4'    U   4           H4'        U   4 -15.926 -11.649  31.633
   38    H3'    U   4           H3'        U   4 -15.075 -12.671  28.915
   39    H2'    U   4          H2''        U   4 -12.953 -13.219  29.712
   40   HO2'    U   4          H2'         U   4 -12.003 -12.256  31.388
   41    H1'    U   4           H1'        U   4 -13.729 -14.134  32.217
   42    H3     U   4           H3         U   4 -11.794 -17.521  29.832
   43    H5     U   4           H5         U   4 -15.665 -17.155  28.207
   44    H6     U   4           H6         U   4 -15.978 -15.173  29.567
   45    H5'    U   5           H5'        U   5 -12.194  -9.941  31.057
   46   H5''    U   5          H5''        U   5 -11.569  -8.771  29.877
   47    H4'    U   5           H4'        U   5  -9.770  -9.711  31.357
   48    H3'    U   5           H3'        U   5  -9.890  -9.929  28.373
   49    H2'    U   5          H2''        U   5  -8.226 -11.498  28.167
   50   HO2'    U   5          H2'         U   5  -7.188 -10.555  30.645
   51    H1'    U   5           H1'        U   5  -8.307 -12.697  30.726
   52    H3     U   5           H3         U   5  -8.490 -16.104  27.723
   53    H5     U   5           H5         U   5 -12.265 -14.254  27.444
   54    H6     U   5           H6         U   5 -11.432 -12.493  28.883
   55    H5'    G   6           H5'        G   6  -6.260  -9.003  25.855
   56   H5''    G   6          H5''        G   6  -7.454 -10.133  26.528
   57    H4'    G   6           H4'        G   6  -4.640 -10.393  27.537
   58    H3'    G   6           H3'        G   6  -5.486 -10.608  24.679
   59    H2'    G   6          H2''        G   6  -4.940 -12.815  24.390
   60   HO2'    G   6          H2'         G   6  -3.030 -12.472  26.472
   61    H1'    G   6           H1'        G   6  -5.042 -13.767  27.039
   62    H8     G   6           H8         G   6  -8.431 -12.469  26.367
   63    H1     G   6           H1         G   6  -7.202 -17.703  22.876
   64    H21    G   6           H21        G   6  -5.059 -18.209  22.992
   65    H22    G   6           H22        G   6  -3.892 -17.158  23.762
   66    H5'    A   7           H5'        A   7  -0.566 -10.558  23.763
   67   H5''    A   7          H5''        A   7  -0.844  -9.882  22.146
   68    H4'    A   7           H4'        A   7   0.349 -12.245  22.425
   69    H3'    A   7           H3'        A   7  -1.610 -11.133  20.456
   70    H2'    A   7          H2''        A   7  -2.281 -13.146  19.582
   71   HO2'    A   7          H2'         A   7  -0.769 -14.403  18.881
   72    H1'    A   7           H1'        A   7  -1.686 -14.893  21.709
   73    H8     A   7           H8         A   7  -4.064 -12.013  22.539
   74    H61    A   7           H61        A   7  -8.591 -15.651  20.420
   75    H62    A   7           H62        A   7  -8.215 -14.236  21.378
   76    H2     A   7           H2         A   7  -4.671 -17.610  19.469
   77    H5'    U   8           H5'        U   8   1.772 -13.569  17.996
   78   H5''    U   8          H5''        U   8   1.620 -12.851  16.380
   79    H4'    U   8           H4'        U   8   1.301 -15.455  16.672
   80    H3'    U   8           H3'        U   8  -0.159 -13.407  15.045
   81    H2'    U   8          H2''        U   8  -1.971 -14.733  14.548
   82   HO2'    U   8          H2'         U   8  -1.817 -16.861  14.135
   83    H1'    U   8           H1'        U   8  -1.928 -16.525  16.725
   84    H3     U   8           H3         U   8  -6.145 -14.897  16.793
   85    H5     U   8           H5         U   8  -3.768 -11.564  17.784
   86    H6     U   8           H6         U   8  -1.806 -12.899  17.303
   87    H5'    U   9           H5'        U   9   0.054 -16.532  12.115
   88   H5''    U   9          H5''        U   9   0.658 -15.812  10.608
   89    H4'    U   9           H4'        U   9  -1.529 -16.834  10.184
   90    H3'    U   9           H3'        U   9  -1.152 -13.851  10.168
   91    H2'    U   9          H2''        U   9  -3.389 -13.358  10.112
   92   HO2'    U   9          H2'         U   9  -4.855 -14.535   8.955
   93    H1'    U   9           H1'        U   9  -4.452 -15.808  11.122
   94    H3     U   9           H3         U   9  -6.771 -12.901  13.612
   95    H5     U   9           H5         U   9  -2.774 -11.840  14.421
   96    H6     U   9           H6         U   9  -2.072 -13.509  12.806
   97    H5'    G  10           H5'        G  10  -2.944 -15.234   5.585
   98   H5''    G  10          H5''        G  10  -2.631 -13.678   4.793
   99    H4'    G  10           H4'        G  10  -5.065 -14.757   4.727
  100    H3'    G  10           H3'        G  10  -4.108 -11.920   5.071
  101    H2'    G  10          H2''        G  10  -6.237 -11.090   5.510
  102   HO2'    G  10          H2'         G  10  -7.262 -13.513   4.419
  103    H1'    G  10           H1'        G  10  -7.274 -13.220   6.937
  104    H8     G  10           H8         G  10  -3.873 -12.624   8.351
  105    H1     G  10           H1         G  10  -7.958  -7.917   9.846
  106    H21    G  10           H21        G  10  -9.753  -8.038   8.569
  107    H22    G  10           H22        G  10 -10.044  -9.387   7.493
  108    H5'    U  11           H5'        U  11  -6.717 -11.413   1.377
  109   H5''    U  11          H5''        U  11  -6.196  -9.882   0.647
  110    H4'    U  11           H4'        U  11  -8.560 -10.072   1.870
  111    H3'    U  11           H3'        U  11  -6.479  -7.896   1.770
  112    H2'    U  11          H2''        U  11  -7.493  -6.615   3.406
  113   HO2'    U  11          H2'         U  11  -9.917  -7.996   2.837
  114    H1'    U  11           H1'        U  11  -8.771  -8.653   4.878
  115    H3     U  11           H3         U  11  -6.159  -5.866   7.488
  116    H5     U  11           H5         U  11  -3.633  -8.935   6.095
  117    H6     U  11           H6         U  11  -5.393  -9.601   4.561
  118    H5'    A  12           H5'        A  12  -9.646  -5.375  -0.943
  119   H5''    A  12          H5''        A  12  -8.457  -4.141  -1.405
  120    H4'    A  12           H4'        A  12 -10.444  -3.571   0.301
  121    H3'    A  12           H3'        A  12  -7.529  -2.765   0.258
  122    H2'    A  12          H2''        A  12  -7.760  -1.536   2.258
  123   HO2'    A  12          H2'         A  12  -9.767  -1.085   3.177
  124    H1'    A  12           H1'        A  12  -9.166  -3.439   3.632
  125    H8     A  12           H8         A  12  -6.808  -5.477   1.591
  126    H61    A  12           H61        A  12  -2.281  -3.693   5.398
  127    H62    A  12           H62        A  12  -2.697  -4.707   4.035
  128    H2     A  12           H2         A  12  -5.861  -1.103   6.181
  129    H5'    U  13           H5'        U  13  -8.624   1.542   0.066
  130   H5''    U  13          H5''        U  13  -7.207   2.124  -0.829
  131    H4'    U  13           H4'        U  13  -7.467   2.656   1.762
  132    H3'    U  13           H3'        U  13  -5.097   1.901   0.066
  133    H2'    U  13          H2''        U  13  -3.664   1.631   1.894
  134   HO2'    U  13          H2'         U  13  -3.987   2.647   3.852
  135    H1'    U  13           H1'        U  13  -5.459   0.684   3.775
  136    H3     U  13           H3         U  13  -1.971  -2.216   2.779
  137    H5     U  13           H5         U  13  -5.114  -3.128   0.126
  138    H6     U  13           H6         U  13  -6.237  -1.113   0.861
  139    H5'    U  14           H5'        U  14  -3.456   5.675   1.592
  140   H5''    U  14          H5''        U  14  -2.851   6.579   0.189
  141    H4'    U  14           H4'        U  14  -0.995   6.127   1.738
  142    H3'    U  14           H3'        U  14  -1.172   4.752  -0.941
  143    H2'    U  14          H2''        U  14   0.726   3.461  -0.564
  144   HO2'    U  14          H2'         U  14   2.390   4.361   0.331
  145    H1'    U  14           H1'        U  14   0.415   3.012   2.153
  146    H3     U  14           H3         U  14   0.182  -1.043   0.101
  147    H5     U  14           H5         U  14  -3.491   0.794  -0.833
  148    H6     U  14           H6         U  14  -2.669   2.822   0.212
  149    H5'    A  15           H5'        A  15   2.963   6.855  -0.852
  150   H5''    A  15          H5''        A  15   3.564   6.842  -2.521
  151    H4'    A  15           H4'        A  15   4.797   5.428  -0.625
  152    H3'    A  15           H3'        A  15   4.199   4.887  -3.522
  153    H2'    A  15          H2''        A  15   4.758   2.665  -3.423
  154   HO2'    A  15          H2'         A  15   6.488   3.402  -1.296
  155    H1'    A  15           H1'        A  15   4.370   2.184  -0.648
  156    H8     A  15           H8         A  15   1.244   3.292  -2.522
  157    H61    A  15           H61        A  15   0.635  -2.579  -4.339
  158    H62    A  15           H62        A  15  -0.184  -1.048  -4.125
  159    H2     A  15           H2         A  15   4.703  -2.107  -2.515
  160    H5'    U  16           H5'        U  16   9.153   4.078  -3.425
  161   H5''    U  16          H5''        U  16   9.284   4.247  -5.186
  162    H4'    U  16           H4'        U  16  10.017   1.983  -3.984
  163    H3'    U  16           H3'        U  16   8.568   2.526  -6.574
  164    H2'    U  16          H2''        U  16   8.099   0.294  -6.952
  165   HO2'    U  16          H2'         U  16   9.482  -1.262  -6.525
  166    H1'    U  16           H1'        U  16   7.966  -0.603  -4.281
  167    H3     U  16           H3         U  16   4.112  -1.777  -6.448
  168    H5     U  16           H5         U  16   3.659   2.296  -5.511
  169    H6     U  16           H6         U  16   6.007   2.355  -4.910
  170    H5'    U  17           H5'        U  17  11.850  -0.460  -8.024
  171   H5''    U  17          H5''        U  17  12.175   0.234  -9.624
  172    H4'    U  17           H4'        U  17  11.408  -2.219  -9.600
  173    H3'    U  17           H3'        U  17  10.247   0.082 -11.154
  174    H2'    U  17          H2''        U  17   8.393  -1.073 -11.852
  175   HO2'    U  17          H2'         U  17   8.896  -2.795 -12.930
  176    H1'    U  17           H1'        U  17   8.323  -3.114  -9.860
  177    H3     U  17           H3         U  17   4.053  -1.669 -10.278
  178    H5     U  17           H5         U  17   6.071   1.600  -8.545
  179    H6     U  17           H6         U  17   8.154   0.397  -8.865
  180    H5'    A  18           H5'        A  18  11.381  -3.581 -14.413
  181   H5''    A  18          H5''        A  18  11.156  -2.638 -15.899
  182    H4'    A  18           H4'        A  18   9.774  -4.881 -15.500
  183    H3'    A  18           H3'        A  18   9.007  -2.215 -16.687
  184    H2'    A  18          H2''        A  18   6.770  -2.724 -16.774
  185   HO2'    A  18          H2'         A  18   7.613  -5.426 -16.996
  186    H1'    A  18           H1'        A  18   6.687  -4.747 -14.757
  187    H8     A  18           H8         A  18   7.652  -1.264 -13.562
  188    H61    A  18           H61        A  18   1.596  -0.043 -13.373
  189    H62    A  18           H62        A  18   3.179   0.461 -12.824
  190    H2     A  18           H2         A  18   2.155  -4.026 -15.361
  191    H5'    A  19           H5'        A  19   7.473  -5.661 -19.466
  192   H5''    A  19          H5''        A  19   7.654  -4.963 -21.086
  193    H4'    A  19           H4'        A  19   5.356  -5.909 -20.653
  194    H3'    A  19           H3'        A  19   5.927  -3.018 -21.313
  195    H2'    A  19          H2''        A  19   3.747  -2.369 -20.986
  196   HO2'    A  19          H2'         A  19   2.989  -5.045 -21.592
  197    H1'    A  19           H1'        A  19   2.906  -4.512 -19.284
  198    H8     A  19           H8         A  19   5.606  -2.046 -18.081
  199    H61    A  19           H61        A  19   0.927   1.414 -16.019
  200    H62    A  19           H62        A  19   2.643   1.101 -15.894
  201    H2     A  19           H2         A  19  -0.788  -1.930 -18.475
  202    H5'    A  20           H5'        A  20   2.559  -4.828 -23.751
  203   H5''    A  20          H5''        A  20   2.729  -4.230 -25.413
  204    H4'    A  20           H4'        A  20   0.401  -3.973 -24.780
  205    H3'    A  20           H3'        A  20   2.127  -1.489 -24.833
  206    H2'    A  20          H2''        A  20   0.332  -0.145 -24.194
  207   HO2'    A  20          H2'         A  20  -1.363  -2.302 -24.957
  208    H1'    A  20           H1'        A  20  -0.952  -1.980 -22.519
  209    H8     A  20           H8         A  20   2.860  -1.191 -22.244
  210    H61    A  20           H61        A  20   1.188   3.091 -18.127
  211    H62    A  20           H62        A  20   2.522   2.164 -18.775
  212    H2     A  20           H2         A  20  -2.545   1.315 -19.861
  213    H5'    U  21           H5'        U  21  -1.090  -0.153 -27.718
  214   H5''    U  21          H5''        U  21  -0.367   1.306 -28.423
  215    H4'    U  21           H4'        U  21  -2.359   1.492 -26.657
  216    H3'    U  21           H3'        U  21   0.112   3.123 -27.161
  217    H2'    U  21          H2''        U  21   0.021   4.285 -25.155
  218   HO2'    U  21          H2'         U  21  -1.790   5.255 -24.791
  219    H1'    U  21           H1'        U  21  -1.413   2.483 -23.565
  220    H3     U  21           H3         U  21   2.361   3.627 -21.297
  221    H5     U  21           H5         U  21   3.783   1.328 -24.531
  222    H6     U  21           H6         U  21   1.500   1.162 -25.330
  223    H5'    U  22           H5'        U  22  -3.383   5.794 -26.439
  224   H5''    U  22          H5''        U  22  -3.383   7.143 -27.592
  225    H4'    U  22           H4'        U  22  -3.633   7.866 -25.178
  226    H3'    U  22           H3'        U  22  -1.655   8.752 -27.197
  227    H2'    U  22          H2''        U  22   0.080   9.262 -25.830
  228   HO2'    U  22          H2'         U  22  -1.895  10.384 -24.121
  229    H1'    U  22           H1'        U  22  -0.953   8.398 -23.283
  230    H3     U  22           H3         U  22   3.280   7.104 -22.554
  231    H5     U  22           H5         U  22   2.383   5.324 -26.265
  232    H6     U  22           H6         U  22   0.223   6.425 -26.200
  233    H5'    A  23           H5'        A  23  -0.294  11.580 -28.522
  234   H5''    A  23          H5''        A  23   0.128  10.355 -27.311
  235    H4'    A  23           H4'        A  23   1.928  12.125 -27.745
  236    H3'    A  23           H3'        A  23   0.936  10.990 -25.288
  237    H2'    A  23          H2''        A  23   0.283  12.875 -24.176
  238   HO2'    A  23          H2'         A  23   2.443  12.735 -23.323
  239    H1'    A  23           H1'        A  23   1.500  14.986 -25.738
  240    H8     A  23           H8         A  23  -1.854  13.850 -26.859
  241    H61    A  23           H61        A  23  -4.423  16.952 -22.164
  242    H62    A  23           H62        A  23  -4.713  16.185 -23.710
  243    H2     A  23           H2         A  23   0.020  16.951 -21.563
  244    H5'    A  24           H5'        A  24   4.821   9.887 -22.815
  245   H5''    A  24          H5''        A  24   3.570   9.051 -21.875
  246    H4'    A  24           H4'        A  24   4.651  11.687 -21.448
  247    H3'    A  24           H3'        A  24   2.660   9.778 -20.236
  248    H2'    A  24          H2''        A  24   1.424  11.433 -19.216
  249   HO2'    A  24          H2'         A  24   2.701  13.540 -18.760
  250    H1'    A  24           H1'        A  24   2.363  13.679 -20.793
  251    H8     A  24           H8         A  24   0.252  11.533 -22.926
  252    H61    A  24           H61        A  24  -4.745  13.834 -20.114
  253    H62    A  24           H62        A  24  -4.148  12.987 -21.523
  254    H2     A  24           H2         A  24  -1.132  15.111 -17.784
  255    H5'    U  25           H5'        U  25   2.007   9.968 -17.814
  256   H5''    U  25          H5''        U  25   2.966  11.301 -17.144
  257    H4'    U  25           H4'        U  25   2.154   9.162 -15.215
  258    H3'    U  25           H3'        U  25   0.239  10.076 -17.001
  259    H2'    U  25          H2''        U  25   0.135  12.325 -16.469
  260   HO2'    U  25          H2'         U  25  -1.124  11.297 -14.131
  261    H1'    U  25           H1'        U  25   0.853  12.031 -13.603
  262    H3     U  25           H3         U  25   1.922  16.364 -13.324
  263    H5     U  25           H5         U  25   2.828  15.464 -17.341
  264    H6     U  25           H6         U  25   2.133  13.179 -16.920
  265    H5'    U  26           H5'        U  26  -1.255  11.139 -17.532
  266   H5''    U  26          H5''        U  26  -2.887  10.895 -16.885
  267    H4'    U  26           H4'        U  26  -3.204  11.400 -19.210
  268    H3'    U  26           H3'        U  26  -3.424   8.561 -18.310
  269    H2'    U  26          H2''        U  26  -3.296   7.583 -20.396
  270   HO2'    U  26          H2'         U  26  -3.915  10.073 -21.617
  271    H1'    U  26           H1'        U  26  -1.657   9.341 -21.739
  272    H3     U  26           H3         U  26  -0.017   4.997 -21.123
  273    H5     U  26           H5         U  26   1.570   7.405 -18.057
  274    H6     U  26           H6         U  26   0.026   9.149 -18.710
  275    H5'    C  27           H5'        C  27  -7.571   8.748 -16.133
  276   H5''    C  27          H5''        C  27  -6.287   7.912 -15.240
  277    H4'    C  27           H4'        C  27  -8.537   6.668 -16.137
  278    H3'    C  27           H3'        C  27  -5.630   5.751 -15.977
  279    H2'    C  27          H2''        C  27  -6.281   3.583 -16.659
  280   HO2'    C  27          H2'         C  27  -8.585   3.116 -16.878
  281    H1'    C  27           H1'        C  27  -8.093   4.470 -18.545
  282    H41    C  27           H41        C  27  -2.725   2.888 -21.597
  283    H42    C  27           H42        C  27  -1.927   4.330 -21.009
  284    H5     C  27           H5         C  27  -2.988   5.919 -19.556
  285    H6     C  27           H6         C  27  -4.996   6.415 -18.231
  286    H5'    U  28           H5'        U  28  -8.044   2.650 -14.354
  287   H5''    U  28          H5''        U  28  -7.092   1.475 -13.427
  288    H4'    U  28           H4'        U  28  -8.103   0.863 -15.832
  289    H3'    U  28           H3'        U  28  -5.597   0.107 -14.383
  290    H2'    U  28          H2''        U  28  -4.535  -0.812 -16.220
  291   HO2'    U  28          H2'         U  28  -5.636  -2.069 -17.491
  292    H1'    U  28           H1'        U  28  -5.384   0.885 -18.218
  293    H3     U  28           H3         U  28  -0.853   0.679 -16.988
  294    H5     U  28           H5         U  28  -2.625   3.909 -14.972
  295    H6     U  28           H6         U  28  -4.768   3.135 -15.708
  296    H5'    U  29           H5'        U  29  -6.763  -3.498 -16.248
  297   H5''    U  29          H5''        U  29  -7.129  -4.745 -15.040
  298    H4'    U  29           H4'        U  29  -5.679  -5.757 -16.698
  299    H3'    U  29           H3'        U  29  -4.585  -5.063 -13.985
  300    H2'    U  29          H2''        U  29  -2.386  -5.573 -14.529
  301   HO2'    U  29          H2'         U  29  -1.831  -7.100 -15.929
  302    H1'    U  29           H1'        U  29  -2.345  -4.776 -17.175
  303    H3     U  29           H3         U  29   0.578  -2.215 -14.742
  304    H5     U  29           H5         U  29  -3.211  -0.519 -14.039
  305    H6     U  29           H6         U  29  -4.197  -2.404 -15.201
  306    H5'    A  30           H5'        A  30  -2.807  -8.883 -14.773
  307   H5''    A  30          H5''        A  30  -2.617  -9.731 -13.227
  308    H4'    A  30           H4'        A  30  -0.448  -9.152 -14.500
  309    H3'    A  30           H3'        A  30  -1.135  -8.516 -11.629
  310    H2'    A  30          H2''        A  30   0.756  -7.258 -11.319
  311   HO2'    A  30          H2'         A  30   1.926  -8.964 -13.258
  312    H1'    A  30           H1'        A  30   1.319  -6.648 -14.066
  313    H8     A  30           H8         A  30  -1.824  -4.953 -12.872
  314    H61    A  30           H61        A  30   1.816  -0.758 -10.155
  315    H62    A  30           H62        A  30   0.200  -1.101 -10.732
  316    H2     A  30           H2         A  30   4.393  -4.179 -11.500
  317    H5'    A  31           H5'        A  31   3.196 -10.721 -11.715
  318   H5''    A  31          H5''        A  31   2.930 -11.757 -10.300
  319    H4'    A  31           H4'        A  31   5.126 -10.619 -10.155
  320    H3'    A  31           H3'        A  31   2.872 -10.021  -8.243
  321    H2'    A  31          H2''        A  31   4.035  -8.335  -7.164
  322   HO2'    A  31          H2'         A  31   6.138  -8.407  -6.820
  323    H1'    A  31           H1'        A  31   5.561  -7.384  -9.307
  324    H8     A  31           H8         A  31   1.777  -7.756  -9.865
  325    H61    A  31           H61        A  31   1.300  -2.059  -7.518
  326    H62    A  31           H62        A  31   0.483  -3.307  -8.432
  327    H2     A  31           H2         A  31   5.545  -3.415  -7.036
  328    H5'    U  32           H5'        U  32   6.650 -10.826  -5.632
  329   H5''    U  32          H5''        U  32   5.955 -11.270  -4.061
  330    H4'    U  32           H4'        U  32   7.505  -9.141  -4.238
  331    H3'    U  32           H3'        U  32   4.897  -9.578  -2.787
  332    H2'    U  32          H2''        U  32   4.652  -7.359  -2.252
  333   HO2'    U  32          H2'         U  32   6.249  -6.236  -1.426
  334    H1'    U  32           H1'        U  32   6.380  -6.239  -4.250
  335    H3     U  32           H3         U  32   2.762  -3.512  -4.089
  336    H5     U  32           H5         U  32   1.320  -7.064  -5.844
  337    H6     U  32           H6         U  32   3.455  -8.103  -5.345
  338    H5'    A  33           H5'        A  33   8.267  -7.691  -0.306
  339   H5''    A  33          H5''        A  33   8.190  -8.369   1.332
  340    H4'    A  33           H4'        A  33   8.502  -5.908   1.405
  341    H3'    A  33           H3'        A  33   6.061  -7.318   2.427
  342    H2'    A  33          H2''        A  33   4.792  -5.427   2.693
  343   HO2'    A  33          H2'         A  33   7.261  -4.085   3.113
  344    H1'    A  33           H1'        A  33   6.131  -3.659   0.910
  345    H8     A  33           H8         A  33   4.473  -6.878  -0.420
  346    H61    A  33           H61        A  33  -0.598  -3.416  -1.142
  347    H62    A  33           H62        A  33   0.168  -4.941  -1.524
  348    H2     A  33           H2         A  33   2.461  -0.969   1.040
  349    H5'    A  34           H5'        A  34   7.831  -4.247   5.469
  350   H5''    A  34          H5''        A  34   7.626  -4.963   7.081
  351    H4'    A  34           H4'        A  34   6.902  -2.574   7.025
  352    H3'    A  34           H3'        A  34   5.139  -4.904   7.659
  353    H2'    A  34          H2''        A  34   3.137  -3.780   7.477
  354   HO2'    A  34          H2'         A  34   2.904  -1.628   8.044
  355    H1'    A  34           H1'        A  34   3.870  -1.635   5.805
  356    H8     A  34           H8         A  34   4.247  -5.375   4.807
  357    H61    A  34           H61        A  34  -1.238  -4.660   2.052
  358    H62    A  34           H62        A  34   0.191  -5.664   2.167
  359    H2     A  34           H2         A  34  -0.344  -0.926   4.370
  360    H5'    C  35           H5'        C  35   3.872  -1.603  10.440
  361   H5''    C  35          H5''        C  35   3.284  -2.407  11.907
  362    H4'    C  35           H4'        C  35   1.666  -0.942  10.294
  363    H3'    C  35           H3'        C  35   1.436  -2.853  12.400
  364    H2'    C  35          H2''        C  35   0.618  -4.625  11.198
  365   HO2'    C  35          H2'         C  35  -1.703  -4.390  10.769
  366    H1'    C  35           H1'        C  35  -0.633  -3.017   9.035
  367    H41    C  35           H41        C  35  -0.137  -8.758   6.356
  368    H42    C  35           H42        C  35   1.566  -8.841   6.749
  369    H5     C  35           H5         C  35   2.664  -7.236   8.173
  370    H6     C  35           H6         C  35   2.431  -5.089   9.330
  371    H5'    U  36           H5'        U  36  -0.318   1.434  12.889
  372   H5''    U  36          H5''        U  36  -1.336   1.720  14.314
  373    H4'    U  36           H4'        U  36  -2.581   2.930  12.791
  374    H3'    U  36           H3'        U  36  -3.355   0.031  12.735
  375    H2'    U  36          H2''        U  36  -4.439   0.117  10.722
  376   HO2'    U  36          H2'         U  36  -5.709   1.800  10.117
  377    H1'    U  36           H1'        U  36  -3.266   2.474   9.624
  378    H3     U  36           H3         U  36  -3.703  -1.167   6.721
  379    H5     U  36           H5         U  36   0.156  -1.281   8.390
  380    H6     U  36           H6         U  36  -0.566   0.324  10.041
  381    H5'    A  37           H5'        A  37  -7.673   1.616  14.696
  382   H5''    A  37          H5''        A  37  -8.157  -0.026  15.160
  383    H4'    A  37           H4'        A  37  -9.537   1.335  13.321
  384    H3'    A  37           H3'        A  37  -8.741  -1.568  13.535
  385    H2'    A  37          H2''        A  37  -9.600  -2.104  11.434
  386   HO2'    A  37          H2'         A  37 -10.937   0.410  11.521
  387    H1'    A  37           H1'        A  37  -8.767   0.120  10.068
  388    H8     A  37           H8         A  37  -5.873  -0.667  12.274
  389    H61    A  37           H61        A  37  -4.596  -5.518   8.681
  390    H62    A  37           H62        A  37  -3.958  -4.385   9.852
  391    H2     A  37           H2         A  37  -8.671  -4.001   7.560
  392    H5'    C  38           H5'        C  38 -12.668  -1.325  12.330
  393   H5''    C  38          H5''        C  38 -13.861  -2.116  13.379
  394    H4'    C  38           H4'        C  38 -14.403  -2.717  11.094
  395    H3'    C  38           H3'        C  38 -13.147  -4.752  12.918
  396    H2'    C  38          H2''        C  38 -12.858  -6.348  11.256
  397   HO2'    C  38          H2'         C  38 -14.909  -6.406  10.414
  398    H1'    C  38           H1'        C  38 -12.316  -4.710   9.096
  399    H41    C  38           H41        C  38  -6.800  -7.157  11.220
  400    H42    C  38           H42        C  38  -6.657  -5.827  12.346
  401    H5     C  38           H5         C  38  -8.459  -4.302  12.809
  402    H6     C  38           H6         C  38 -10.700  -3.583  12.141
  403    H5'    A  39           H5'        A  39 -16.960  -7.290  12.384
  404   H5''    A  39          H5''        A  39 -16.664  -8.434  13.709
  405    H4'    A  39           H4'        A  39 -16.249  -9.137  11.153
  406    H3'    A  39           H3'        A  39 -14.640  -9.712  13.648
  407    H2'    A  39          H2''        A  39 -13.134 -11.004  12.408
  408   HO2'    A  39          H2'         A  39 -14.579 -12.246  11.216
  409    H1'    A  39           H1'        A  39 -13.124  -9.342  10.135
  410    H8     A  39           H8         A  39 -12.693  -7.127  13.115
  411    H61    A  39           H61        A  39  -6.839  -9.081  13.472
  412    H62    A  39           H62        A  39  -7.964  -7.823  13.931
  413    H2     A  39           H2         A  39  -9.008 -11.719  10.566
  414    H5'    A  40           H5'        A  40 -17.153 -13.320  12.215
  415   H5''    A  40          H5''        A  40 -17.372 -14.669  13.347
  416    H4'    A  40           H4'        A  40 -16.234 -15.329  11.185
  417    H3'    A  40           H3'        A  40 -15.189 -15.672  13.968
  418    H2'    A  40          H2''        A  40 -13.021 -16.144  13.391
  419   HO2'    A  40          H2'         A  40 -14.113 -17.153  10.972
  420    H1'    A  40           H1'        A  40 -12.847 -14.926  10.857
  421    H8     A  40           H8         A  40 -13.879 -12.689  13.804
  422    H61    A  40           H61        A  40  -7.833 -11.791  14.707
  423    H62    A  40           H62        A  40  -9.449 -11.325  15.191
  424    H2     A  40           H2         A  40  -8.317 -14.965  11.570
  425    H5'    A  41           H5'        A  41 -14.601 -20.290  12.674
  426   H5''    A  41          H5''        A  41 -14.699 -20.899  14.337
  427    H4'    A  41           H4'        A  41 -12.449 -21.167  12.947
  428    H3'    A  41           H3'        A  41 -13.022 -20.540  15.822
  429    H2'    A  41          H2''        A  41 -10.908 -19.798  16.315
  430   HO2'    A  41          H2'         A  41 -10.125 -21.715  14.394
  431    H1'    A  41           H1'        A  41  -9.963 -19.207  13.686
  432    H8     A  41           H8         A  41 -12.878 -17.148  15.125
  433    H61    A  41           H61        A  41  -8.500 -13.309  17.213
  434    H62    A  41           H62        A  41 -10.221 -13.586  17.065
  435    H2     A  41           H2         A  41  -6.481 -16.962  15.574
  436    H5'    U  42           H5'        U  42  -9.836 -23.873  14.881
  437   H5''    U  42          H5''        U  42  -9.794 -25.048  16.212
  438    H4'    U  42           H4'        U  42  -7.490 -24.281  15.474
  439    H3'    U  42           H3'        U  42  -8.676 -23.778  18.218
  440    H2'    U  42          H2''        U  42  -6.802 -22.621  18.960
  441   HO2'    U  42          H2'         U  42  -5.417 -23.964  16.875
  442    H1'    U  42           H1'        U  42  -6.067 -21.477  16.499
  443    H3     U  42           H3         U  42  -6.803 -17.835  19.067
  444    H5     U  42           H5         U  42 -10.623 -19.553  18.653
  445    H6     U  42           H6         U  42  -9.588 -21.434  17.541
  446    H5'    U  43           H5'        U  43  -4.817 -24.917  19.135
  447   H5''    U  43          H5''        U  43  -4.758 -25.811  20.666
  448    H4'    U  43           H4'        U  43  -3.564 -23.586  20.765
  449    H3'    U  43           H3'        U  43  -5.943 -24.377  22.435
  450    H2'    U  43          H2''        U  43  -6.187 -22.291  23.411
  451   HO2'    U  43          H2'         U  43  -3.431 -21.945  22.807
  452    H1'    U  43           H1'        U  43  -5.130 -20.703  21.336
  453    H3     U  43           H3         U  43  -9.208 -18.861  21.747
  454    H5     U  43           H5         U  43 -10.074 -22.878  20.810
  455    H6     U  43           H6         U  43  -7.696 -23.342  20.892
  456    H5'    A  44           H5'        A  44  -1.521 -23.891  25.601
  457   H5''    A  44          H5''        A  44  -2.538 -24.266  27.006
  458    H4'    A  44           H4'        A  44  -0.819 -22.235  27.097
  459    H3'    A  44           H3'        A  44  -3.645 -22.531  28.108
  460    H2'    A  44          H2''        A  44  -3.769 -20.312  28.803
  461   HO2'    A  44          H2'         A  44  -0.928 -20.230  28.621
  462    H1'    A  44           H1'        A  44  -2.247 -19.146  26.783
  463    H8     A  44           H8         A  44  -4.586 -21.242  24.874
  464    H61    A  44           H61        A  44  -9.176 -17.399  26.376
  465    H62    A  44           H62        A  44  -8.708 -18.780  25.408
  466    H2     A  44           H2         A  44  -5.600 -16.323  28.858
  467    H5'    A  45           H5'        A  45  -1.727 -20.649  31.261
  468   H5''    A  45          H5''        A  45  -2.093 -21.423  32.816
  469    H4'    A  45           H4'        A  45  -2.675 -18.992  32.820
  470    H3'    A  45           H3'        A  45  -4.661 -21.221  33.165
  471    H2'    A  45          H2''        A  45  -6.509 -19.878  32.980
  472   HO2'    A  45          H2'         A  45  -5.580 -18.585  34.809
  473    H1'    A  45           H1'        A  45  -5.357 -17.655  31.610
  474    H8     A  45           H8         A  45  -5.384 -20.928  29.659
  475    H61    A  45           H61        A  45 -11.228 -19.591  28.149
  476    H62    A  45           H62        A  45  -9.828 -20.563  27.753
  477    H2     A  45           H2         A  45  -9.882 -16.637  31.245
  478    H5'    G  46           H5'        G  46  -4.360 -19.171  37.809
  479   H5''    G  46          H5''        G  46  -5.567 -20.166  38.648
  480    H4'    G  46           H4'        G  46  -5.871 -17.514  38.440
  481    H3'    G  46           H3'        G  46  -7.783 -19.830  38.383
  482    H2'    G  46          H2''        G  46  -9.598 -18.592  37.634
  483   HO2'    G  46          H2'         G  46  -9.475 -16.960  39.195
  484    H1'    G  46           H1'        G  46  -8.310 -16.760  35.998
  485    H8     G  46           H8         G  46  -6.887 -20.098  35.123
  486    H1     G  46           H1         G  46 -12.874 -19.327  32.973
  487    H21    G  46           H21        G  46 -13.804 -17.572  33.929
  488    H22    G  46           H22        G  46 -12.959 -16.576  35.092
  489    H5'    C  47           H5'        C  47 -10.175 -17.608  41.630
  490   H5''    C  47          H5''        C  47 -10.910 -19.026  42.401
  491    H4'    C  47           H4'        C  47 -12.406 -17.322  41.000
  492    H3'    C  47           H3'        C  47 -12.423 -20.317  41.276
  493    H2'    C  47          H2''        C  47 -13.828 -20.674  39.499
  494   HO2'    C  47          H2'         C  47 -14.897 -18.115  40.108
  495    H1'    C  47           H1'        C  47 -13.442 -18.223  38.084
  496    H41    C  47           H41        C  47 -11.883 -23.009  34.191
  497    H42    C  47           H42        C  47 -10.366 -23.223  35.030
  498    H5     C  47           H5         C  47  -9.696 -21.855  36.904
  499    H6     C  47           H6         C  47 -10.457 -20.206  38.553
  500    H5'    C  48           H5'        C  48 -16.882 -19.193  41.029
  501   H5''    C  48          H5''        C  48 -17.481 -20.025  42.478
  502    H4'    C  48           H4'        C  48 -18.879 -20.682  40.579
  503    H3'    C  48           H3'        C  48 -16.887 -22.642  41.711
  504   HO3'    C  48          H3T         C  48 -18.709 -23.450  42.662
  505    H2'    C  48          H2''        C  48 -17.324 -24.237  40.113
  506   HO2'    C  48          H2'         C  48 -19.829 -23.002  39.567
  507    H1'    C  48           H1'        C  48 -18.207 -22.502  38.034
  508    H41    C  48           H41        C  48 -12.842 -25.289  36.027
  509    H42    C  48           H42        C  48 -11.911 -24.453  37.249
  510    H5     C  48           H5         C  48 -12.918 -23.173  39.020
  511    H6     C  48           H6         C  48 -15.011 -22.237  39.882
  Start of MODEL    7
    1    H5'    G   1           H5'        G   1 -15.070 -28.032  28.512
    2   H5''    G   1          H5''        G   1 -15.470 -26.458  27.797
    3    H4'    G   1           H4'        G   1 -17.548 -27.464  28.536
    4    H3'    G   1           H3'        G   1 -16.360 -25.110  29.912
    5    H2'    G   1          H2''        G   1 -17.634 -25.198  31.848
    6   HO2'    G   1          H2'         G   1 -19.658 -25.269  30.878
    7    H1'    G   1           H1'        G   1 -17.944 -27.893  32.189
    8    H8     G   1           H8         G   1 -14.486 -28.248  31.588
    9    H1     G   1           H1         G   1 -15.202 -24.034  36.366
   10    H21    G   1           H21        G   1 -17.310 -23.397  36.510
   11    H22    G   1           H22        G   1 -18.502 -23.838  35.309
   12   HO5'    G   1          H5T         G   1 -14.407 -25.490  29.321
   13    H5'    G   2           H5'        G   2 -20.325 -23.313  29.589
   14   H5''    G   2          H5''        G   2 -20.079 -21.699  28.893
   15    H4'    G   2           H4'        G   2 -21.038 -21.676  31.240
   16    H3'    G   2           H3'        G   2 -18.549 -20.335  30.265
   17    H2'    G   2          H2''        G   2 -17.685 -19.831  32.335
   18   HO2'    G   2          H2'         G   2 -19.448 -18.646  33.062
   19    H1'    G   2           H1'        G   2 -18.806 -21.847  33.913
   20    H8     G   2           H8         G   2 -17.048 -23.464  31.028
   21    H1     G   2           H1         G   2 -12.985 -21.187  35.432
   22    H21    G   2           H21        G   2 -14.074 -19.912  36.874
   23    H22    G   2           H22        G   2 -15.748 -19.462  36.643
   24    H5'    C   3           H5'        C   3 -20.776 -16.902  32.740
   25   H5''    C   3          H5''        C   3 -20.584 -15.581  31.571
   26    H4'    C   3           H4'        C   3 -19.855 -14.909  33.863
   27    H3'    C   3           H3'        C   3 -18.026 -15.048  31.478
   28    H2'    C   3          H2''        C   3 -16.100 -14.648  32.694
   29   HO2'    C   3          H2'         C   3 -17.788 -13.482  34.664
   30    H1'    C   3           H1'        C   3 -16.829 -15.768  35.150
   31    H41    C   3           H41        C   3 -12.494 -19.642  32.555
   32    H42    C   3           H42        C   3 -13.639 -20.165  31.342
   33    H5     C   3           H5         C   3 -15.913 -19.380  31.262
   34    H6     C   3           H6         C   3 -17.509 -17.757  32.165
   35    H5'    U   4           H5'        U   4 -16.649 -10.736  32.742
   36   H5''    U   4          H5''        U   4 -16.044 -10.324  31.127
   37    H4'    U   4           H4'        U   4 -14.353 -10.644  33.167
   38    H3'    U   4           H3'        U   4 -14.179 -11.556  30.286
   39    H2'    U   4          H2''        U   4 -12.105 -12.542  30.656
   40   HO2'    U   4          H2'         U   4 -10.678 -11.698  31.953
   41    H1'    U   4           H1'        U   4 -12.581 -13.442  33.258
   42    H3     U   4           H3         U   4 -11.581 -16.962  30.509
   43    H5     U   4           H5         U   4 -15.588 -16.010  29.621
   44    H6     U   4           H6         U   4 -15.367 -14.046  31.026
   45    H5'    U   5           H5'        U   5 -10.473  -9.428  31.962
   46   H5''    U   5          H5''        U   5  -9.921  -8.322  30.688
   47    H4'    U   5           H4'        U   5  -8.039  -9.608  31.753
   48    H3'    U   5           H3'        U   5  -8.792  -9.626  28.859
   49    H2'    U   5          H2''        U   5  -7.529 -11.448  28.262
   50   HO2'    U   5          H2'         U   5  -5.546 -10.650  28.826
   51    H1'    U   5           H1'        U   5  -7.281 -12.773  30.745
   52    H3     U   5           H3         U   5  -8.725 -15.901  27.785
   53    H5     U   5           H5         U   5 -12.059 -13.392  28.356
   54    H6     U   5           H6         U   5 -10.634 -11.902  29.630
   55    H5'    G   6           H5'        G   6  -5.587  -9.065  25.648
   56   H5''    G   6          H5''        G   6  -6.829 -10.074  26.419
   57    H4'    G   6           H4'        G   6  -3.938 -10.871  26.749
   58    H3'    G   6           H3'        G   6  -5.493 -10.708  24.202
   59    H2'    G   6          H2''        G   6  -5.447 -12.942  23.700
   60   HO2'    G   6          H2'         G   6  -3.089 -12.869  23.732
   61    H1'    G   6           H1'        G   6  -4.984 -14.073  26.250
   62    H8     G   6           H8         G   6  -8.201 -12.158  26.331
   63    H1     G   6           H1         G   6  -8.693 -17.634  23.030
   64    H21    G   6           H21        G   6  -6.687 -18.435  22.584
   65    H22    G   6           H22        G   6  -5.233 -17.739  23.260
   66    H5'    A   7           H5'        A   7  -0.619 -11.632  22.623
   67   H5''    A   7          H5''        A   7  -1.018 -11.063  20.990
   68    H4'    A   7           H4'        A   7   0.081 -13.462  21.343
   69    H3'    A   7           H3'        A   7  -2.000 -12.387  19.484
   70    H2'    A   7          H2''        A   7  -2.875 -14.407  18.850
   71   HO2'    A   7          H2'         A   7  -1.549 -15.851  18.129
   72    H1'    A   7           H1'        A   7  -2.164 -16.033  21.034
   73    H8     A   7           H8         A   7  -4.271 -12.985  21.939
   74    H61    A   7           H61        A   7  -9.201 -16.383  20.405
   75    H62    A   7           H62        A   7  -8.645 -14.967  21.268
   76    H2     A   7           H2         A   7  -5.525 -18.627  19.157
   77    H5'    U   8           H5'        U   8   1.009 -15.302  17.099
   78   H5''    U   8          H5''        U   8   0.962 -14.622  15.460
   79    H4'    U   8           H4'        U   8   0.504 -17.149  15.656
   80    H3'    U   8           H3'        U   8  -1.091 -15.033  14.256
   81    H2'    U   8          H2''        U   8  -2.951 -16.340  13.892
   82   HO2'    U   8          H2'         U   8  -1.208 -18.581  14.037
   83    H1'    U   8           H1'        U   8  -2.702 -18.205  15.992
   84    H3     U   8           H3         U   8  -6.882 -16.589  16.567
   85    H5     U   8           H5         U   8  -4.416 -13.272  17.363
   86    H6     U   8           H6         U   8  -2.516 -14.592  16.643
   87    H5'    U   9           H5'        U   9  -1.160 -18.056  11.044
   88   H5''    U   9          H5''        U   9  -0.852 -17.125   9.565
   89    H4'    U   9           H4'        U   9  -3.063 -18.291   9.496
   90    H3'    U   9           H3'        U   9  -2.686 -15.314   9.404
   91    H2'    U   9          H2''        U   9  -4.892 -14.798   9.727
   92   HO2'    U   9          H2'         U   9  -5.367 -17.210   8.329
   93    H1'    U   9           H1'        U   9  -5.810 -17.231  10.903
   94    H3     U   9           H3         U   9  -7.631 -14.236  13.692
   95    H5     U   9           H5         U   9  -3.515 -13.368  13.934
   96    H6     U   9           H6         U   9  -3.129 -15.037  12.217
   97    H5'    G  10           H5'        G  10  -5.257 -16.550   5.104
   98   H5''    G  10          H5''        G  10  -4.928 -14.980   4.347
   99    H4'    G  10           H4'        G  10  -7.428 -15.870   4.567
  100    H3'    G  10           H3'        G  10  -6.195 -13.142   4.875
  101    H2'    G  10          H2''        G  10  -8.135 -12.157   5.694
  102   HO2'    G  10          H2'         G  10  -9.590 -14.416   4.747
  103    H1'    G  10           H1'        G  10  -9.150 -14.257   7.175
  104    H8     G  10           H8         G  10  -5.514 -14.076   8.001
  105    H1     G  10           H1         G  10  -8.803  -9.154  10.455
  106    H21    G  10           H21        G  10 -10.842  -9.110   9.612
  107    H22    G  10           H22        G  10 -11.335 -10.168   8.309
  108    H5'    U  11           H5'        U  11  -9.273 -12.103   1.688
  109   H5''    U  11          H5''        U  11  -8.654 -10.600   0.978
  110    H4'    U  11           H4'        U  11 -10.815 -10.577   2.543
  111    H3'    U  11           H3'        U  11  -8.488  -8.686   2.245
  112    H2'    U  11          H2''        U  11  -9.067  -7.414   4.085
  113   HO2'    U  11          H2'         U  11 -11.715  -8.431   3.842
  114    H1'    U  11           H1'        U  11 -10.383  -9.384   5.622
  115    H3     U  11           H3         U  11  -7.083  -7.201   7.991
  116    H5     U  11           H5         U  11  -5.193 -10.369   5.955
  117    H6     U  11           H6         U  11  -7.236 -10.690   4.690
  118    H5'    A  12           H5'        A  12 -11.693  -5.623   0.234
  119   H5''    A  12          H5''        A  12 -10.463  -4.480  -0.344
  120    H4'    A  12           H4'        A  12 -12.086  -3.841   1.687
  121    H3'    A  12           H3'        A  12  -9.133  -3.346   1.249
  122    H2'    A  12          H2''        A  12  -8.961  -2.208   3.312
  123   HO2'    A  12          H2'         A  12 -10.853  -0.997   3.284
  124    H1'    A  12           H1'        A  12 -10.337  -4.059   4.778
  125    H8     A  12           H8         A  12  -8.503  -6.143   2.281
  126    H61    A  12           H61        A  12  -3.310  -5.010   5.436
  127    H62    A  12           H62        A  12  -4.018  -5.891   4.101
  128    H2     A  12           H2         A  12  -6.483  -2.204   6.916
  129    H5'    U  13           H5'        U  13  -9.919   0.970   1.399
  130   H5''    U  13          H5''        U  13  -8.631   1.604   0.358
  131    H4'    U  13           H4'        U  13  -8.470   1.953   2.965
  132    H3'    U  13           H3'        U  13  -6.388   1.130   0.942
  133    H2'    U  13          H2''        U  13  -4.761   0.721   2.592
  134   HO2'    U  13          H2'         U  13  -4.758   1.711   4.550
  135    H1'    U  13           H1'        U  13  -6.376  -0.239   4.605
  136    H3     U  13           H3         U  13  -3.146  -3.173   2.956
  137    H5     U  13           H5         U  13  -6.679  -3.867   0.769
  138    H6     U  13           H6         U  13  -7.616  -1.867   1.768
  139    H5'    U  14           H5'        U  14  -4.406   4.975   2.195
  140   H5''    U  14          H5''        U  14  -3.886   5.719   0.669
  141    H4'    U  14           H4'        U  14  -1.953   5.181   2.164
  142    H3'    U  14           H3'        U  14  -2.403   3.929  -0.541
  143    H2'    U  14          H2''        U  14  -0.587   2.498  -0.357
  144   HO2'    U  14          H2'         U  14   1.099   3.709   0.180
  145    H1'    U  14           H1'        U  14  -0.651   2.047   2.396
  146    H3     U  14           H3         U  14  -1.065  -1.943   0.213
  147    H5     U  14           H5         U  14  -4.874  -0.165  -0.073
  148    H6     U  14           H6         U  14  -3.932   1.856   0.885
  149    H5'    A  15           H5'        A  15   1.487   6.560  -0.905
  150   H5''    A  15          H5''        A  15   1.988   6.623  -2.606
  151    H4'    A  15           H4'        A  15   3.450   5.304  -0.800
  152    H3'    A  15           H3'        A  15   2.759   4.780  -3.676
  153    H2'    A  15          H2''        A  15   3.478   2.601  -3.676
  154   HO2'    A  15          H2'         A  15   5.434   2.269  -3.030
  155    H1'    A  15           H1'        A  15   3.269   2.003  -0.908
  156    H8     A  15           H8         A  15  -0.048   2.954  -2.494
  157    H61    A  15           H61        A  15  -0.374  -2.851  -4.574
  158    H62    A  15           H62        A  15  -1.292  -1.419  -4.171
  159    H2     A  15           H2         A  15   3.793  -2.147  -3.077
  160    H5'    U  16           H5'        U  16   7.296   4.080  -2.866
  161   H5''    U  16          H5''        U  16   8.133   4.560  -4.355
  162    H4'    U  16           H4'        U  16   8.793   2.268  -3.499
  163    H3'    U  16           H3'        U  16   7.623   2.889  -6.200
  164    H2'    U  16          H2''        U  16   7.352   0.682  -6.799
  165   HO2'    U  16          H2'         U  16   8.894  -0.715  -6.496
  166    H1'    U  16           H1'        U  16   7.107  -0.493  -4.241
  167    H3     U  16           H3         U  16   3.549  -1.962  -6.652
  168    H5     U  16           H5         U  16   2.689   2.086  -5.888
  169    H6     U  16           H6         U  16   4.961   2.351  -5.094
  170    H5'    U  17           H5'        U  17  11.188   0.201  -7.121
  171   H5''    U  17          H5''        U  17  11.784   0.806  -8.678
  172    H4'    U  17           H4'        U  17  11.096  -1.667  -8.632
  173    H3'    U  17           H3'        U  17  10.140   0.478 -10.519
  174    H2'    U  17          H2''        U  17   8.522  -0.839 -11.466
  175   HO2'    U  17          H2'         U  17  10.165  -3.057 -10.780
  176    H1'    U  17           H1'        U  17   8.216  -2.761  -9.369
  177    H3     U  17           H3         U  17   4.034  -1.727 -10.784
  178    H5     U  17           H5         U  17   5.354   1.756  -8.809
  179    H6     U  17           H6         U  17   7.553   0.745  -8.640
  180    H5'    A  18           H5'        A  18  11.413  -3.462 -12.501
  181   H5''    A  18          H5''        A  18  12.240  -3.052 -14.016
  182    H4'    A  18           H4'        A  18  10.634  -4.884 -14.399
  183    H3'    A  18           H3'        A  18  10.155  -2.133 -15.554
  184    H2'    A  18          H2''        A  18   8.096  -2.711 -16.397
  185   HO2'    A  18          H2'         A  18   8.202  -4.367 -17.677
  186    H1'    A  18           H1'        A  18   7.499  -4.873 -14.624
  187    H8     A  18           H8         A  18   7.887  -1.387 -13.095
  188    H61    A  18           H61        A  18   1.954  -0.500 -14.591
  189    H62    A  18           H62        A  18   3.304   0.096 -13.651
  190    H2     A  18           H2         A  18   3.284  -4.392 -16.388
  191    H5'    A  19           H5'        A  19  10.036  -5.018 -19.579
  192   H5''    A  19          H5''        A  19  10.266  -3.661 -20.697
  193    H4'    A  19           H4'        A  19   8.082  -5.178 -20.843
  194    H3'    A  19           H3'        A  19   8.459  -2.188 -21.103
  195    H2'    A  19          H2''        A  19   6.190  -1.808 -21.239
  196   HO2'    A  19          H2'         A  19   5.154  -2.909 -22.678
  197    H1'    A  19           H1'        A  19   5.297  -4.163 -19.882
  198    H8     A  19           H8         A  19   7.371  -1.740 -17.795
  199    H61    A  19           H61        A  19   2.110   1.360 -16.830
  200    H62    A  19           H62        A  19   3.759   1.126 -16.294
  201    H2     A  19           H2         A  19   1.310  -1.835 -19.875
  202    H5'    A  20           H5'        A  20   6.128  -3.272 -25.199
  203   H5''    A  20          H5''        A  20   6.439  -1.731 -26.020
  204    H4'    A  20           H4'        A  20   3.951  -2.454 -25.397
  205    H3'    A  20           H3'        A  20   5.369   0.209 -25.275
  206    H2'    A  20          H2''        A  20   3.581   1.260 -24.247
  207   HO2'    A  20          H2'         A  20   1.567   0.856 -24.767
  208    H1'    A  20           H1'        A  20   2.522  -0.927 -22.839
  209    H8     A  20           H8         A  20   6.257  -0.036 -22.382
  210    H61    A  20           H61        A  20   4.348   3.723 -17.865
  211    H62    A  20           H62        A  20   5.736   3.097 -18.726
  212    H2     A  20           H2         A  20   0.726   2.199 -20.026
  213    H5'    U  21           H5'        U  21   1.385   1.365 -27.294
  214   H5''    U  21          H5''        U  21   1.872   2.870 -28.096
  215    H4'    U  21           H4'        U  21   0.096   2.947 -26.141
  216    H3'    U  21           H3'        U  21   2.438   4.721 -26.790
  217    H2'    U  21          H2''        U  21   2.326   5.894 -24.803
  218   HO2'    U  21          H2'         U  21  -0.428   5.187 -24.776
  219    H1'    U  21           H1'        U  21   1.073   3.958 -23.170
  220    H3     U  21           H3         U  21   4.739   5.371 -20.883
  221    H5     U  21           H5         U  21   6.325   3.244 -24.157
  222    H6     U  21           H6         U  21   4.070   2.964 -24.987
  223    H5'    U  22           H5'        U  22  -1.622   6.993 -27.726
  224   H5''    U  22          H5''        U  22  -1.361   8.360 -28.828
  225    H4'    U  22           H4'        U  22  -2.275   8.854 -26.414
  226    H3'    U  22           H3'        U  22  -0.064  10.174 -27.995
  227    H2'    U  22          H2''        U  22   0.841  11.249 -26.212
  228   HO2'    U  22          H2'         U  22  -1.841  11.570 -25.327
  229    H1'    U  22           H1'        U  22  -0.678   9.888 -24.136
  230    H3     U  22           H3         U  22   3.536  11.304 -22.703
  231    H5     U  22           H5         U  22   3.872   7.381 -24.184
  232    H6     U  22           H6         U  22   1.696   7.671 -25.251
  233    H5'    A  23           H5'        A  23   0.829  13.331 -28.973
  234   H5''    A  23          H5''        A  23   1.244  12.539 -27.444
  235    H4'    A  23           H4'        A  23   2.169  14.941 -27.863
  236    H3'    A  23           H3'        A  23   1.240  13.543 -25.517
  237    H2'    A  23          H2''        A  23  -0.398  14.964 -24.789
  238   HO2'    A  23          H2'         A  23   0.311  16.711 -23.692
  239    H1'    A  23           H1'        A  23   0.074  17.333 -26.403
  240    H8     A  23           H8         A  23  -2.124  14.896 -28.024
  241    H61    A  23           H61        A  23  -6.730  16.439 -24.200
  242    H62    A  23           H62        A  23  -6.319  15.686 -25.725
  243    H2     A  23           H2         A  23  -2.946  18.237 -22.613
  244    H5'    A  24           H5'        A  24   4.700  14.491 -22.572
  245   H5''    A  24          H5''        A  24   4.005  13.128 -21.676
  246    H4'    A  24           H4'        A  24   3.255  15.897 -21.543
  247    H3'    A  24           H3'        A  24   2.486  13.232 -20.370
  248    H2'    A  24          H2''        A  24   0.346  13.874 -19.865
  249   HO2'    A  24          H2'         A  24   1.392  16.484 -19.401
  250    H1'    A  24           H1'        A  24   0.307  16.314 -21.478
  251    H8     A  24           H8         A  24  -0.055  13.304 -23.591
  252    H61    A  24           H61        A  24  -6.024  13.096 -22.005
  253    H62    A  24           H62        A  24  -4.788  12.435 -23.053
  254    H2     A  24           H2         A  24  -3.958  15.993 -19.277
  255    H5'    U  25           H5'        U  25   2.390  11.754 -17.934
  256   H5''    U  25          H5''        U  25   1.543  13.299 -18.140
  257    H4'    U  25           H4'        U  25   1.826  11.632 -15.622
  258    H3'    U  25           H3'        U  25  -0.111  11.864 -17.602
  259    H2'    U  25          H2''        U  25  -0.844  14.039 -17.214
  260   HO2'    U  25          H2'         U  25  -2.052  12.634 -15.049
  261    H1'    U  25           H1'        U  25  -0.348  13.910 -14.270
  262    H3     U  25           H3         U  25  -0.699  18.337 -13.763
  263    H5     U  25           H5         U  25   0.572  17.978 -17.764
  264    H6     U  25           H6         U  25   0.629  15.572 -17.469
  265    H5'    U  26           H5'        U  26  -1.796  12.408 -18.335
  266   H5''    U  26          H5''        U  26  -3.347  11.742 -17.796
  267    H4'    U  26           H4'        U  26  -3.582  11.930 -20.169
  268    H3'    U  26           H3'        U  26  -2.988   9.259 -18.995
  269    H2'    U  26          H2''        U  26  -2.215   8.223 -20.883
  270   HO2'    U  26          H2'         U  26  -3.993   8.382 -22.150
  271    H1'    U  26           H1'        U  26  -1.362  10.406 -22.431
  272    H3     U  26           H3         U  26   1.947   7.221 -21.945
  273    H5     U  26           H5         U  26   2.239   9.747 -18.588
  274    H6     U  26           H6         U  26   0.157  10.783 -19.257
  275    H5'    C  27           H5'        C  27  -6.349   7.719 -21.189
  276   H5''    C  27          H5''        C  27  -7.206   6.627 -20.082
  277    H4'    C  27           H4'        C  27  -6.024   5.373 -21.885
  278    H3'    C  27           H3'        C  27  -5.324   5.189 -18.961
  279    H2'    C  27          H2''        C  27  -3.451   3.875 -19.291
  280   HO2'    C  27          H2'         C  27  -3.200   2.561 -21.154
  281    H1'    C  27           H1'        C  27  -2.741   4.727 -21.882
  282    H41    C  27           H41        C  27   1.793   7.011 -18.061
  283    H42    C  27           H42        C  27   0.612   7.725 -16.986
  284    H5     C  27           H5         C  27  -1.759   7.368 -17.228
  285    H6     C  27           H6         C  27  -3.518   6.536 -18.711
  286    H5'    U  28           H5'        U  28  -7.706   0.761 -19.961
  287   H5''    U  28          H5''        U  28  -7.245  -0.222 -18.558
  288    H4'    U  28           H4'        U  28  -6.515  -0.909 -21.064
  289    H3'    U  28           H3'        U  28  -4.996  -1.029 -18.443
  290    H2'    U  28          H2''        U  28  -3.172  -2.046 -19.539
  291   HO2'    U  28          H2'         U  28  -4.964  -3.154 -21.057
  292    H1'    U  28           H1'        U  28  -3.231  -0.344 -21.742
  293    H3     U  28           H3         U  28   0.413   0.102 -18.867
  294    H5     U  28           H5         U  28  -2.621   2.595 -17.364
  295    H6     U  28           H6         U  28  -4.137   1.638 -18.979
  296    H5'    U  29           H5'        U  29  -4.758  -4.987 -19.953
  297   H5''    U  29          H5''        U  29  -5.209  -6.186 -18.724
  298    H4'    U  29           H4'        U  29  -3.017  -6.752 -19.725
  299    H3'    U  29           H3'        U  29  -3.337  -5.921 -16.850
  300    H2'    U  29          H2''        U  29  -1.067  -5.840 -16.427
  301   HO2'    U  29          H2'         U  29   0.433  -7.061 -17.531
  302    H1'    U  29           H1'        U  29  -0.125  -5.137 -18.966
  303    H3     U  29           H3         U  29   1.329  -2.094 -15.878
  304    H5     U  29           H5         U  29  -2.688  -1.057 -16.607
  305    H6     U  29           H6         U  29  -2.906  -3.084 -17.919
  306    H5'    A  30           H5'        A  30  -0.593  -9.541 -16.846
  307   H5''    A  30          H5''        A  30  -0.905 -10.349 -15.299
  308    H4'    A  30           H4'        A  30   1.527  -9.588 -15.764
  309    H3'    A  30           H3'        A  30  -0.166  -9.038 -13.322
  310    H2'    A  30          H2''        A  30   1.406  -7.646 -12.394
  311   HO2'    A  30          H2'         A  30   3.371  -9.077 -13.875
  312    H1'    A  30           H1'        A  30   2.826  -6.958 -14.796
  313    H8     A  30           H8         A  30  -0.741  -5.650 -14.592
  314    H61    A  30           H61        A  30   1.546  -0.994 -11.226
  315    H62    A  30           H62        A  30   0.189  -1.540 -12.185
  316    H2     A  30           H2         A  30   4.789  -4.052 -11.768
  317    H5'    A  31           H5'        A  31   3.870 -11.590 -11.616
  318   H5''    A  31          H5''        A  31   3.157 -11.907 -10.023
  319    H4'    A  31           H4'        A  31   5.494 -10.643 -10.231
  320    H3'    A  31           H3'        A  31   3.121 -10.215  -8.414
  321    H2'    A  31          H2''        A  31   3.980  -8.274  -7.513
  322   HO2'    A  31          H2'         A  31   6.545  -9.211  -8.319
  323    H1'    A  31           H1'        A  31   5.567  -7.427  -9.696
  324    H8     A  31           H8         A  31   1.908  -7.873 -10.599
  325    H61    A  31           H61        A  31   0.973  -2.259  -8.183
  326    H62    A  31           H62        A  31   0.319  -3.500  -9.228
  327    H2     A  31           H2         A  31   5.150  -3.539  -7.164
  328    H5'    U  32           H5'        U  32   6.941 -10.416  -5.686
  329   H5''    U  32          H5''        U  32   6.276 -10.792  -4.085
  330    H4'    U  32           H4'        U  32   7.617  -8.530  -4.483
  331    H3'    U  32           H3'        U  32   5.139  -9.168  -2.893
  332    H2'    U  32          H2''        U  32   4.608  -6.968  -2.514
  333   HO2'    U  32          H2'         U  32   6.103  -5.857  -1.574
  334    H1'    U  32           H1'        U  32   6.082  -5.770  -4.659
  335    H3     U  32           H3         U  32   2.026  -3.700  -4.424
  336    H5     U  32           H5         U  32   1.218  -7.475  -6.113
  337    H6     U  32           H6         U  32   3.508  -8.111  -5.632
  338    H5'    A  33           H5'        A  33   8.355  -6.797  -0.533
  339   H5''    A  33          H5''        A  33   8.297  -7.344   1.155
  340    H4'    A  33           H4'        A  33   8.323  -4.824   0.894
  341    H3'    A  33           H3'        A  33   6.268  -6.481   2.307
  342    H2'    A  33          H2''        A  33   4.697  -4.820   2.508
  343   HO2'    A  33          H2'         A  33   6.838  -2.945   2.408
  344    H1'    A  33           H1'        A  33   5.511  -3.076   0.424
  345    H8     A  33           H8         A  33   4.483  -6.622  -0.599
  346    H61    A  33           H61        A  33  -1.298  -4.439  -0.814
  347    H62    A  33           H62        A  33  -0.234  -5.739  -1.304
  348    H2     A  33           H2         A  33   1.319  -1.287   1.013
  349    H5'    A  34           H5'        A  34   6.729  -2.746   4.527
  350   H5''    A  34          H5''        A  34   7.383  -3.215   6.109
  351    H4'    A  34           H4'        A  34   5.701  -1.610   6.626
  352    H3'    A  34           H3'        A  34   4.981  -4.504   6.945
  353    H2'    A  34          H2''        A  34   2.724  -4.160   7.202
  354   HO2'    A  34          H2'         A  34   1.872  -2.352   8.188
  355    H1'    A  34           H1'        A  34   2.439  -1.669   5.879
  356    H8     A  34           H8         A  34   3.708  -5.113   4.504
  357    H61    A  34           H61        A  34  -1.886  -5.492   1.902
  358    H62    A  34           H62        A  34  -0.264  -6.148   1.915
  359    H2     A  34           H2         A  34  -1.769  -1.792   4.433
  360    H5'    C  35           H5'        C  35   3.031  -5.224  11.132
  361   H5''    C  35          H5''        C  35   2.487  -6.446   9.964
  362    H4'    C  35           H4'        C  35   1.622  -3.520   9.828
  363    H3'    C  35           H3'        C  35   0.964  -5.505  11.778
  364    H2'    C  35          H2''        C  35  -0.372  -6.833  10.437
  365   HO2'    C  35          H2'         C  35  -2.567  -5.845  10.239
  366    H1'    C  35           H1'        C  35  -1.249  -4.676   8.620
  367    H41    C  35           H41        C  35  -2.682 -10.001   5.444
  368    H42    C  35           H42        C  35  -1.019 -10.539   5.534
  369    H5     C  35           H5         C  35   0.651  -9.424   6.870
  370    H6     C  35           H6         C  35   1.139  -7.452   8.242
  371    H5'    U  36           H5'        U  36   0.334  -0.361  12.701
  372   H5''    U  36          H5''        U  36  -0.251  -0.337  14.377
  373    H4'    U  36           H4'        U  36  -1.910   0.973  13.437
  374    H3'    U  36           H3'        U  36  -2.579  -1.939  13.244
  375    H2'    U  36          H2''        U  36  -4.151  -1.741  11.598
  376   HO2'    U  36          H2'         U  36  -5.622  -0.507  12.638
  377    H1'    U  36           H1'        U  36  -3.435   0.775  10.487
  378    H3     U  36           H3         U  36  -4.336  -2.307   7.205
  379    H5     U  36           H5         U  36  -0.338  -2.960   8.343
  380    H6     U  36           H6         U  36  -0.713  -1.560  10.267
  381    H5'    A  37           H5'        A  37  -6.546  -0.293  15.840
  382   H5''    A  37          H5''        A  37  -7.168  -1.902  16.255
  383    H4'    A  37           H4'        A  37  -8.625  -0.214  14.784
  384    H3'    A  37           H3'        A  37  -8.208  -3.200  14.641
  385    H2'    A  37          H2''        A  37  -9.441  -3.422  12.676
  386   HO2'    A  37          H2'         A  37 -11.151  -2.254  12.364
  387    H1'    A  37           H1'        A  37  -8.546  -1.197  11.361
  388    H8     A  37           H8         A  37  -5.482  -2.531  13.006
  389    H61    A  37           H61        A  37  -5.354  -7.044   8.802
  390    H62    A  37           H62        A  37  -4.520  -6.302  10.149
  391    H2     A  37           H2         A  37  -9.365  -5.038   8.553
  392    H5'    C  38           H5'        C  38 -12.252  -2.350  14.114
  393   H5''    C  38          H5''        C  38 -13.339  -3.135  15.276
  394    H4'    C  38           H4'        C  38 -14.300  -3.399  13.054
  395    H3'    C  38           H3'        C  38 -13.085  -5.743  14.489
  396    H2'    C  38          H2''        C  38 -13.244  -7.192  12.680
  397   HO2'    C  38          H2'         C  38 -15.102  -5.380  11.510
  398    H1'    C  38           H1'        C  38 -12.795  -5.435  10.599
  399    H41    C  38           H41        C  38  -7.320  -8.560  11.591
  400    H42    C  38           H42        C  38  -6.967  -7.536  12.964
  401    H5     C  38           H5         C  38  -8.425  -5.766  13.687
  402    H6     C  38           H6         C  38 -10.633  -4.749  13.416
  403    H5'    A  39           H5'        A  39 -17.206  -7.795  14.366
  404   H5''    A  39          H5''        A  39 -16.844  -9.063  15.552
  405    H4'    A  39           H4'        A  39 -16.894  -9.601  12.926
  406    H3'    A  39           H3'        A  39 -15.007 -10.524  15.103
  407    H2'    A  39          H2''        A  39 -13.837 -11.850  13.568
  408   HO2'    A  39          H2'         A  39 -15.547 -12.863  12.533
  409    H1'    A  39           H1'        A  39 -13.980 -10.036  11.428
  410    H8     A  39           H8         A  39 -12.898  -8.099  14.442
  411    H61    A  39           H61        A  39  -7.295 -10.633  13.815
  412    H62    A  39           H62        A  39  -8.204  -9.311  14.512
  413    H2     A  39           H2         A  39 -10.118 -12.821  11.106
  414    H5'    A  40           H5'        A  40 -18.100 -13.836  13.917
  415   H5''    A  40          H5''        A  40 -18.191 -15.230  15.012
  416    H4'    A  40           H4'        A  40 -17.508 -15.784  12.612
  417    H3'    A  40           H3'        A  40 -16.098 -16.465  15.166
  418    H2'    A  40          H2''        A  40 -14.095 -17.068  14.222
  419   HO2'    A  40          H2'         A  40 -14.790 -18.725  12.956
  420    H1'    A  40           H1'        A  40 -14.183 -15.655  11.789
  421    H8     A  40           H8         A  40 -14.552 -13.540  14.959
  422    H61    A  40           H61        A  40  -8.384 -13.287  15.043
  423    H62    A  40           H62        A  40  -9.861 -12.594  15.672
  424    H2     A  40           H2         A  40  -9.614 -16.185  11.840
  425    H5'    A  41           H5'        A  41 -16.345 -21.018  13.793
  426   H5''    A  41          H5''        A  41 -16.200 -21.678  15.435
  427    H4'    A  41           H4'        A  41 -14.239 -22.018  13.660
  428    H3'    A  41           H3'        A  41 -14.276 -21.501  16.616
  429    H2'    A  41          H2''        A  41 -12.062 -20.923  16.765
  430   HO2'    A  41          H2'         A  41 -11.733 -22.740  14.620
  431    H1'    A  41           H1'        A  41 -11.542 -20.254  14.043
  432    H8     A  41           H8         A  41 -14.019 -18.071  16.008
  433    H61    A  41           H61        A  41  -9.070 -14.730  17.624
  434    H62    A  41           H62        A  41 -10.818 -14.769  17.554
  435    H2     A  41           H2         A  41  -7.636 -18.385  15.452
  436    H5'    U  42           H5'        U  42 -11.224 -24.920  15.284
  437   H5''    U  42          H5''        U  42 -11.082 -26.000  16.685
  438    H4'    U  42           H4'        U  42  -8.847 -25.187  15.722
  439    H3'    U  42           H3'        U  42  -9.840 -24.701  18.547
  440    H2'    U  42          H2''        U  42  -7.948 -23.494  19.132
  441   HO2'    U  42          H2'         U  42  -6.608 -24.655  16.901
  442    H1'    U  42           H1'        U  42  -7.385 -22.422  16.574
  443    H3     U  42           H3         U  42  -7.804 -18.700  19.101
  444    H5     U  42           H5         U  42 -11.680 -20.340  19.077
  445    H6     U  42           H6         U  42 -10.787 -22.272  17.930
  446    H5'    U  43           H5'        U  43  -6.056 -25.824  19.376
  447   H5''    U  43          H5''        U  43  -5.951 -26.698  20.917
  448    H4'    U  43           H4'        U  43  -4.864 -24.403  20.955
  449    H3'    U  43           H3'        U  43  -7.110 -25.371  22.708
  450    H2'    U  43          H2''        U  43  -7.580 -23.312  23.629
  451   HO2'    U  43          H2'         U  43  -4.858 -22.693  23.095
  452    H1'    U  43           H1'        U  43  -6.553 -21.633  21.583
  453    H3     U  43           H3         U  43 -10.695 -19.946  22.124
  454    H5     U  43           H5         U  43 -11.414 -23.895  20.841
  455    H6     U  43           H6         U  43  -9.024 -24.294  20.943
  456    H5'    A  44           H5'        A  44  -3.086 -23.533  24.078
  457   H5''    A  44          H5''        A  44  -2.522 -24.487  25.462
  458    H4'    A  44           H4'        A  44  -1.556 -22.378  25.880
  459    H3'    A  44           H3'        A  44  -4.229 -22.736  27.240
  460    H2'    A  44          H2''        A  44  -4.217 -20.558  28.067
  461   HO2'    A  44          H2'         A  44  -1.414 -20.564  27.568
  462    H1'    A  44           H1'        A  44  -2.900 -19.323  25.919
  463    H8     A  44           H8         A  44  -5.632 -21.170  24.285
  464    H61    A  44           H61        A  44  -9.685 -17.186  26.697
  465    H62    A  44           H62        A  44  -9.431 -18.428  25.492
  466    H2     A  44           H2         A  44  -5.700 -16.441  28.610
  467    H5'    A  45           H5'        A  45  -1.624 -21.121  30.303
  468   H5''    A  45          H5''        A  45  -1.972 -21.935  31.841
  469    H4'    A  45           H4'        A  45  -2.198 -19.400  31.906
  470    H3'    A  45           H3'        A  45  -4.307 -21.423  32.624
  471    H2'    A  45          H2''        A  45  -5.996 -19.881  32.796
  472   HO2'    A  45          H2'         A  45  -3.963 -18.017  33.496
  473    H1'    A  45           H1'        A  45  -4.872 -17.775  31.224
  474    H8     A  45           H8         A  45  -5.671 -20.966  29.308
  475    H61    A  45           H61        A  45 -11.485 -18.898  28.946
  476    H62    A  45           H62        A  45 -10.318 -20.029  28.297
  477    H2     A  45           H2         A  45  -9.231 -16.218  31.746
  478    H5'    G  46           H5'        G  46  -3.014 -19.300  37.134
  479   H5''    G  46          H5''        G  46  -4.156 -20.214  38.139
  480    H4'    G  46           H4'        G  46  -4.192 -17.539  38.104
  481    H3'    G  46           H3'        G  46  -6.333 -19.636  38.301
  482    H2'    G  46          H2''        G  46  -8.101 -18.177  37.943
  483   HO2'    G  46          H2'         G  46  -7.631 -16.650  39.489
  484    H1'    G  46           H1'        G  46  -6.921 -16.379  36.189
  485    H8     G  46           H8         G  46  -6.066 -19.781  34.915
  486    H1     G  46           H1         G  46 -12.197 -18.229  33.898
  487    H21    G  46           H21        G  46 -12.758 -16.496  35.143
  488    H22    G  46           H22        G  46 -11.582 -15.598  36.077
  489    H5'    C  47           H5'        C  47  -7.780 -17.531  42.142
  490   H5''    C  47          H5''        C  47  -8.510 -18.949  42.920
  491    H4'    C  47           H4'        C  47 -10.046 -16.991  41.967
  492    H3'    C  47           H3'        C  47 -10.324 -19.985  42.007
  493    H2'    C  47          H2''        C  47 -12.047 -20.051  40.496
  494   HO2'    C  47          H2'         C  47 -13.728 -18.778  40.682
  495    H1'    C  47           H1'        C  47 -11.670 -17.525  39.222
  496    H41    C  47           H41        C  47 -11.289 -22.052  34.768
  497    H42    C  47           H42        C  47  -9.689 -22.490  35.319
  498    H5     C  47           H5         C  47  -8.576 -21.370  37.147
  499    H6     C  47           H6         C  47  -8.875 -19.821  39.024
  500    H5'    C  48           H5'        C  48 -14.570 -18.342  42.657
  501   H5''    C  48          H5''        C  48 -15.022 -19.202  44.141
  502    H4'    C  48           H4'        C  48 -16.832 -19.489  42.535
  503    H3'    C  48           H3'        C  48 -14.986 -21.798  43.102
  504   HO3'    C  48          H3T         C  48 -17.734 -21.234  43.625
  505    H2'    C  48          H2''        C  48 -15.934 -23.159  41.509
  506   HO2'    C  48          H2'         C  48 -18.018 -23.324  41.369
  507    H1'    C  48           H1'        C  48 -16.874 -21.152  39.736
  508    H41    C  48           H41        C  48 -12.285 -24.368  36.705
  509    H42    C  48           H42        C  48 -11.075 -23.744  37.803
  510    H5     C  48           H5         C  48 -11.625 -22.502  39.791
  511    H6     C  48           H6         C  48 -13.422 -21.406  41.043
  Start of MODEL    8
    1    H5'    G   1           H5'        G   1 -15.975 -28.135  30.183
    2   H5''    G   1          H5''        G   1 -16.263 -26.536  29.465
    3    H4'    G   1           H4'        G   1 -18.362 -27.287  30.419
    4    H3'    G   1           H3'        G   1 -16.793 -25.060  31.614
    5    H2'    G   1          H2''        G   1 -17.874 -24.975  33.665
    6   HO2'    G   1          H2'         G   1 -19.969 -24.815  33.181
    7    H1'    G   1           H1'        G   1 -18.458 -27.610  34.100
    8    H8     G   1           H8         G   1 -15.134 -28.374  33.204
    9    H1     G   1           H1         G   1 -14.930 -24.047  37.929
   10    H21    G   1           H21        G   1 -16.924 -23.148  38.225
   11    H22    G   1           H22        G   1 -18.267 -23.479  37.155
   12   HO5'    G   1          H5T         G   1 -14.991 -25.651  30.888
   13    H5'    G   2           H5'        G   2 -20.668 -22.622  31.297
   14   H5''    G   2          H5''        G   2 -20.063 -21.108  30.594
   15    H4'    G   2           H4'        G   2 -21.100 -20.937  32.949
   16    H3'    G   2           H3'        G   2 -18.492 -19.910  31.915
   17    H2'    G   2          H2''        G   2 -17.526 -19.482  33.956
   18   HO2'    G   2          H2'         G   2 -19.158 -18.086  34.668
   19    H1'    G   2           H1'        G   2 -18.828 -21.320  35.602
   20    H8     G   2           H8         G   2 -17.409 -23.256  32.749
   21    H1     G   2           H1         G   2 -12.884 -21.255  36.823
   22    H21    G   2           H21        G   2 -13.737 -19.782  38.232
   23    H22    G   2           H22        G   2 -15.355 -19.144  38.052
   24    H5'    C   3           H5'        C   3 -20.229 -15.695  34.134
   25   H5''    C   3          H5''        C   3 -19.477 -14.732  32.848
   26    H4'    C   3           H4'        C   3 -18.850 -14.186  35.329
   27    H3'    C   3           H3'        C   3 -17.136 -14.497  32.885
   28    H2'    C   3          H2''        C   3 -15.132 -14.515  34.024
   29   HO2'    C   3          H2'         C   3 -14.753 -13.334  35.806
   30    H1'    C   3           H1'        C   3 -15.955 -15.543  36.499
   31    H41    C   3           H41        C   3 -12.317 -19.890  33.555
   32    H42    C   3           H42        C   3 -13.718 -20.462  32.680
   33    H5     C   3           H5         C   3 -15.814 -19.279  32.646
   34    H6     C   3           H6         C   3 -17.094 -17.430  33.619
   35    H5'    U   4           H5'        U   4 -15.083 -10.339  34.167
   36   H5''    U   4          H5''        U   4 -14.560 -10.040  32.498
   37    H4'    U   4           H4'        U   4 -12.767 -10.496  34.423
   38    H3'    U   4           H3'        U   4 -12.915 -11.486  31.569
   39    H2'    U   4          H2''        U   4 -10.919 -12.677  31.812
   40   HO2'    U   4          H2'         U   4 -10.495 -11.214  34.220
   41    H1'    U   4           H1'        U   4 -11.354 -13.573  34.398
   42    H3     U   4           H3         U   4 -11.186 -17.111  31.496
   43    H5     U   4           H5         U   4 -15.037 -15.484  30.979
   44    H6     U   4           H6         U   4 -14.382 -13.641  32.413
   45    H5'    U   5           H5'        U   5  -8.949  -9.969  32.946
   46   H5''    U   5          H5''        U   5  -8.311  -8.863  31.713
   47    H4'    U   5           H4'        U   5  -6.559 -10.430  32.588
   48    H3'    U   5           H3'        U   5  -7.470 -10.204  29.752
   49    H2'    U   5          H2''        U   5  -6.526 -12.154  28.996
   50   HO2'    U   5          H2'         U   5  -4.417 -11.636  29.458
   51    H1'    U   5           H1'        U   5  -6.296 -13.622  31.400
   52    H3     U   5           H3         U   5  -8.371 -16.413  28.482
   53    H5     U   5           H5         U   5 -11.255 -13.457  29.310
   54    H6     U   5           H6         U   5  -9.557 -12.240  30.537
   55    H5'    G   6           H5'        G   6  -5.056  -9.502  26.306
   56   H5''    G   6          H5''        G   6  -6.138 -10.555  27.243
   57    H4'    G   6           H4'        G   6  -3.329 -11.512  26.688
   58    H3'    G   6           H3'        G   6  -5.478 -10.929  24.695
   59    H2'    G   6          H2''        G   6  -5.737 -13.071  23.920
   60   HO2'    G   6          H2'         G   6  -3.492 -13.168  23.311
   61    H1'    G   6           H1'        G   6  -4.781 -14.576  26.101
   62    H8     G   6           H8         G   6  -7.635 -12.392  27.208
   63    H1     G   6           H1         G   6  -9.567 -17.399  23.704
   64    H21    G   6           H21        G   6  -7.847 -18.348  22.714
   65    H22    G   6           H22        G   6  -6.197 -17.881  23.059
   66    H5'    A   7           H5'        A   7  -1.189 -11.896  22.401
   67   H5''    A   7          H5''        A   7  -1.466 -11.257  20.769
   68    H4'    A   7           H4'        A   7  -0.612 -13.724  21.014
   69    H3'    A   7           H3'        A   7  -2.721 -12.497  19.282
   70    H2'    A   7          H2''        A   7  -3.750 -14.459  18.687
   71   HO2'    A   7          H2'         A   7  -1.168 -15.577  18.984
   72    H1'    A   7           H1'        A   7  -2.957 -16.151  20.808
   73    H8     A   7           H8         A   7  -4.933 -13.134  21.973
   74    H61    A   7           H61        A   7 -10.029 -16.295  20.469
   75    H62    A   7           H62        A   7  -9.392 -14.965  21.411
   76    H2     A   7           H2         A   7  -6.483 -18.512  18.849
   77    H5'    U   8           H5'        U   8  -0.003 -15.494  16.910
   78   H5''    U   8          H5''        U   8   0.076 -14.900  15.239
   79    H4'    U   8           H4'        U   8  -0.576 -17.366  15.510
   80    H3'    U   8           H3'        U   8  -1.968 -15.203  13.981
   81    H2'    U   8          H2''        U   8  -3.933 -16.346  13.642
   82   HO2'    U   8          H2'         U   8  -2.405 -18.729  13.912
   83    H1'    U   8           H1'        U   8  -3.905 -18.133  15.816
   84    H3     U   8           H3         U   8  -7.900 -16.077  16.272
   85    H5     U   8           H5         U   8  -5.116 -12.997  16.972
   86    H6     U   8           H6         U   8  -3.357 -14.524  16.306
   87    H5'    U   9           H5'        U   9  -2.194 -18.402  11.028
   88   H5''    U   9          H5''        U   9  -1.753 -17.684   9.466
   89    H4'    U   9           H4'        U   9  -4.043 -18.650   9.395
   90    H3'    U   9           H3'        U   9  -3.436 -15.728   9.079
   91    H2'    U   9          H2''        U   9  -5.604 -15.022   9.279
   92   HO2'    U   9          H2'         U   9  -7.269 -16.037   8.322
   93    H1'    U   9           H1'        U   9  -6.749 -17.284  10.593
   94    H3     U   9           H3         U   9  -8.450 -13.997  13.110
   95    H5     U   9           H5         U   9  -4.296 -13.386  13.451
   96    H6     U   9           H6         U   9  -3.967 -15.181  11.852
   97    H5'    G  10           H5'        G  10  -5.928 -17.074   4.776
   98   H5''    G  10          H5''        G  10  -5.428 -15.601   3.921
   99    H4'    G  10           H4'        G  10  -8.007 -16.238   4.105
  100    H3'    G  10           H3'        G  10  -6.528 -13.623   4.266
  101    H2'    G  10          H2''        G  10  -8.369 -12.404   4.966
  102   HO2'    G  10          H2'         G  10  -9.969 -14.534   3.961
  103    H1'    G  10           H1'        G  10  -9.676 -14.315   6.491
  104    H8     G  10           H8         G  10  -6.061 -14.322   7.493
  105    H1     G  10           H1         G  10  -9.177  -9.109   9.546
  106    H21    G  10           H21        G  10 -11.170  -9.001   8.609
  107    H22    G  10           H22        G  10 -11.665 -10.098   7.340
  108    H5'    U  11           H5'        U  11  -9.952 -12.834   1.091
  109   H5''    U  11          H5''        U  11  -9.349 -11.403   0.231
  110    H4'    U  11           H4'        U  11 -11.623 -11.291   1.615
  111    H3'    U  11           H3'        U  11  -9.351  -9.328   1.301
  112    H2'    U  11          H2''        U  11 -10.266  -7.834   2.842
  113   HO2'    U  11          H2'         U  11 -12.311  -7.464   2.561
  114    H1'    U  11           H1'        U  11 -11.376  -9.670   4.612
  115    H3     U  11           H3         U  11  -8.140  -7.077   6.642
  116    H5     U  11           H5         U  11  -6.107 -10.313   4.866
  117    H6     U  11           H6         U  11  -8.163 -10.895   3.720
  118    H5'    A  12           H5'        A  12 -12.140  -6.381  -1.027
  119   H5''    A  12          H5''        A  12 -10.794  -5.364  -1.576
  120    H4'    A  12           H4'        A  12 -12.405  -4.584   0.427
  121    H3'    A  12           H3'        A  12  -9.416  -4.303   0.021
  122    H2'    A  12          H2''        A  12  -9.185  -3.195   2.091
  123   HO2'    A  12          H2'         A  12 -11.062  -1.865   1.888
  124    H1'    A  12           H1'        A  12 -10.771  -4.905   3.539
  125    H8     A  12           H8         A  12  -9.018  -7.232   1.240
  126    H61    A  12           H61        A  12  -3.871  -6.298   4.530
  127    H62    A  12           H62        A  12  -4.681  -7.362   3.403
  128    H2     A  12           H2         A  12  -6.897  -3.235   5.784
  129    H5'    U  13           H5'        U  13  -9.941   0.134   0.400
  130   H5''    U  13          H5''        U  13  -8.593   0.661  -0.625
  131    H4'    U  13           H4'        U  13  -8.506   1.039   2.003
  132    H3'    U  13           H3'        U  13  -6.389   0.154   0.035
  133    H2'    U  13          H2''        U  13  -4.813  -0.198   1.739
  134   HO2'    U  13          H2'         U  13  -4.892   0.831   3.694
  135    H1'    U  13           H1'        U  13  -6.516  -1.063   3.742
  136    H3     U  13           H3         U  13  -3.162  -4.032   2.444
  137    H5     U  13           H5         U  13  -6.545  -4.878   0.077
  138    H6     U  13           H6         U  13  -7.568  -2.852   0.921
  139    H5'    U  14           H5'        U  14  -4.677   3.617   1.672
  140   H5''    U  14          H5''        U  14  -4.162   4.843   0.496
  141    H4'    U  14           H4'        U  14  -2.196   4.304   1.762
  142    H3'    U  14           H3'        U  14  -2.469   3.039  -0.963
  143    H2'    U  14          H2''        U  14  -0.534   1.782  -0.731
  144   HO2'    U  14          H2'         U  14   0.207   3.517   1.405
  145    H1'    U  14           H1'        U  14  -0.659   1.301   2.016
  146    H3     U  14           H3         U  14  -0.669  -2.745  -0.060
  147    H5     U  14           H5         U  14  -4.516  -1.191  -0.801
  148    H6     U  14           H6         U  14  -3.799   0.894   0.210
  149    H5'    A  15           H5'        A  15   1.070   6.355  -1.179
  150   H5''    A  15          H5''        A  15   1.716   6.372  -2.832
  151    H4'    A  15           H4'        A  15   3.231   5.564  -0.789
  152    H3'    A  15           H3'        A  15   2.949   4.674  -3.639
  153    H2'    A  15          H2''        A  15   4.074   2.686  -3.380
  154   HO2'    A  15          H2'         A  15   5.500   4.146  -1.486
  155    H1'    A  15           H1'        A  15   3.598   2.151  -0.668
  156    H8     A  15           H8         A  15   0.401   2.724  -2.660
  157    H61    A  15           H61        A  15   0.885  -3.134  -4.540
  158    H62    A  15           H62        A  15  -0.203  -1.783  -4.316
  159    H2     A  15           H2         A  15   4.749  -1.985  -2.586
  160    H5'    U  16           H5'        U  16   7.593   4.899  -2.666
  161   H5''    U  16          H5''        U  16   8.291   5.287  -4.250
  162    H4'    U  16           H4'        U  16   9.234   3.200  -3.073
  163    H3'    U  16           H3'        U  16   8.130   3.426  -5.866
  164    H2'    U  16          H2''        U  16   8.236   1.155  -6.274
  165   HO2'    U  16          H2'         U  16   9.866  -0.043  -5.640
  166    H1'    U  16           H1'        U  16   7.915   0.182  -3.658
  167    H3     U  16           H3         U  16   4.714  -1.817  -6.193
  168    H5     U  16           H5         U  16   3.338   2.120  -5.675
  169    H6     U  16           H6         U  16   5.522   2.699  -4.800
  170    H5'    U  17           H5'        U  17  11.595   1.025  -6.484
  171   H5''    U  17          H5''        U  17  12.442   1.644  -7.915
  172    H4'    U  17           H4'        U  17  11.848  -0.758  -8.181
  173    H3'    U  17           H3'        U  17  10.674   1.427  -9.897
  174    H2'    U  17          H2''        U  17   9.179   0.027 -10.932
  175   HO2'    U  17          H2'         U  17   9.708  -1.938 -11.612
  176    H1'    U  17           H1'        U  17   9.084  -2.052  -8.969
  177    H3     U  17           H3         U  17   4.790  -1.390 -10.212
  178    H5     U  17           H5         U  17   5.816   2.154  -8.171
  179    H6     U  17           H6         U  17   8.106   1.359  -8.084
  180    H5'    A  18           H5'        A  18  12.279  -2.213 -12.151
  181   H5''    A  18          H5''        A  18  13.040  -1.641 -13.648
  182    H4'    A  18           H4'        A  18  11.601  -3.583 -14.125
  183    H3'    A  18           H3'        A  18  10.846  -0.825 -15.100
  184    H2'    A  18          H2''        A  18   8.835  -1.546 -15.955
  185   HO2'    A  18          H2'         A  18   8.939  -3.159 -17.277
  186    H1'    A  18           H1'        A  18   8.475  -3.854 -14.309
  187    H8     A  18           H8         A  18   8.582  -0.402 -12.636
  188    H61    A  18           H61        A  18   2.534  -0.066 -13.874
  189    H62    A  18           H62        A  18   3.903   0.755 -13.157
  190    H2     A  18           H2         A  18   4.174  -3.727 -15.892
  191    H5'    A  19           H5'        A  19  10.835  -3.654 -19.110
  192   H5''    A  19          H5''        A  19  10.958  -2.323 -20.274
  193    H4'    A  19           H4'        A  19   8.895  -3.991 -20.365
  194    H3'    A  19           H3'        A  19   9.030  -0.986 -20.673
  195    H2'    A  19          H2''        A  19   6.736  -0.794 -20.792
  196   HO2'    A  19          H2'         A  19   6.825  -3.424 -21.842
  197    H1'    A  19           H1'        A  19   6.055  -3.210 -19.412
  198    H8     A  19           H8         A  19   7.872  -0.633 -17.292
  199    H61    A  19           H61        A  19   2.376   2.075 -16.474
  200    H62    A  19           H62        A  19   4.020   1.955 -15.889
  201    H2     A  19           H2         A  19   1.890  -1.171 -19.532
  202    H5'    A  20           H5'        A  20   6.718  -2.490 -24.508
  203   H5''    A  20          H5''        A  20   7.002  -1.123 -25.603
  204    H4'    A  20           H4'        A  20   4.534  -1.705 -25.008
  205    H3'    A  20           H3'        A  20   5.936   0.965 -24.956
  206    H2'    A  20          H2''        A  20   4.132   2.059 -24.019
  207   HO2'    A  20          H2'         A  20   2.195   1.747 -24.767
  208    H1'    A  20           H1'        A  20   2.931  -0.121 -22.668
  209    H8     A  20           H8         A  20   6.584   0.914 -21.898
  210    H61    A  20           H61        A  20   4.145   4.630 -17.603
  211    H62    A  20           H62        A  20   5.621   3.951 -18.252
  212    H2     A  20           H2         A  20   0.781   2.873 -19.988
  213    H5'    U  21           H5'        U  21   2.139   1.923 -27.473
  214   H5''    U  21          H5''        U  21   2.649   3.418 -28.281
  215    H4'    U  21           H4'        U  21   0.679   3.462 -26.494
  216    H3'    U  21           H3'        U  21   2.941   5.348 -27.095
  217    H2'    U  21          H2''        U  21   2.664   6.615 -25.176
  218   HO2'    U  21          H2'         U  21   0.747   7.238 -24.549
  219    H1'    U  21           H1'        U  21   1.439   4.715 -23.495
  220    H3     U  21           H3         U  21   4.952   6.369 -21.139
  221    H5     U  21           H5         U  21   6.755   4.149 -24.235
  222    H6     U  21           H6         U  21   4.545   3.742 -25.143
  223    H5'    U  22           H5'        U  22  -1.163   6.671 -27.608
  224   H5''    U  22          H5''        U  22  -1.761   7.723 -28.909
  225    H4'    U  22           H4'        U  22  -2.579   8.579 -26.766
  226    H3'    U  22           H3'        U  22  -0.587  10.022 -28.449
  227    H2'    U  22          H2''        U  22   0.358  11.281 -26.813
  228   HO2'    U  22          H2'         U  22  -1.453  12.587 -26.668
  229    H1'    U  22           H1'        U  22  -0.893  10.124 -24.488
  230    H3     U  22           H3         U  22   3.156  11.024 -22.747
  231    H5     U  22           H5         U  22   4.070   8.664 -26.116
  232    H6     U  22           H6         U  22   1.705   8.625 -26.650
  233    H5'    A  23           H5'        A  23  -0.061  13.155 -29.737
  234   H5''    A  23          H5''        A  23   0.462  12.336 -28.256
  235    H4'    A  23           H4'        A  23   1.373  14.713 -28.612
  236    H3'    A  23           H3'        A  23   0.336  13.385 -26.255
  237    H2'    A  23          H2''        A  23  -1.256  14.882 -25.579
  238   HO2'    A  23          H2'         A  23  -0.520  16.695 -24.588
  239    H1'    A  23           H1'        A  23  -0.767  17.166 -27.287
  240    H8     A  23           H8         A  23  -2.866  14.600 -28.857
  241    H61    A  23           H61        A  23  -7.634  16.285 -25.296
  242    H62    A  23           H62        A  23  -7.130  15.326 -26.670
  243    H2     A  23           H2         A  23  -3.928  18.183 -23.645
  244    H5'    A  24           H5'        A  24   3.525  14.523 -23.117
  245   H5''    A  24          H5''        A  24   2.812  13.192 -22.188
  246    H4'    A  24           H4'        A  24   1.995  15.946 -22.239
  247    H3'    A  24           H3'        A  24   1.254  13.327 -20.968
  248    H2'    A  24          H2''        A  24  -0.945  13.871 -20.638
  249   HO2'    A  24          H2'         A  24  -1.569  16.026 -20.061
  250    H1'    A  24           H1'        A  24  -1.021  16.222 -22.379
  251    H8     A  24           H8         A  24  -0.989  13.131 -24.365
  252    H61    A  24           H61        A  24  -7.025  12.470 -23.176
  253    H62    A  24           H62        A  24  -5.704  11.990 -24.218
  254    H2     A  24           H2         A  24  -5.397  15.638 -20.446
  255    H5'    U  25           H5'        U  25   1.863  11.801 -17.789
  256   H5''    U  25          H5''        U  25   0.829  12.827 -18.801
  257    H4'    U  25           H4'        U  25   0.501  12.074 -15.997
  258    H3'    U  25           H3'        U  25  -1.044  12.354 -18.245
  259    H2'    U  25          H2''        U  25  -1.115  14.695 -18.397
  260   HO2'    U  25          H2'         U  25  -3.234  14.451 -18.105
  261    H1'    U  25           H1'        U  25  -1.238  15.067 -15.433
  262    H3     U  25           H3         U  25  -0.287  19.432 -15.624
  263    H5     U  25           H5         U  25   1.472  17.966 -19.160
  264    H6     U  25           H6         U  25   0.718  15.744 -18.544
  265    H5'    U  26           H5'        U  26  -2.568  12.781 -19.380
  266   H5''    U  26          H5''        U  26  -4.142  12.363 -18.677
  267    H4'    U  26           H4'        U  26  -4.532  11.927 -20.959
  268    H3'    U  26           H3'        U  26  -3.703   9.584 -19.322
  269    H2'    U  26          H2''        U  26  -2.950   8.231 -21.011
  270   HO2'    U  26          H2'         U  26  -3.822   8.292 -23.101
  271    H1'    U  26           H1'        U  26  -2.273  10.084 -22.991
  272    H3     U  26           H3         U  26   1.444   7.581 -22.240
  273    H5     U  26           H5         U  26   1.250  10.187 -18.943
  274    H6     U  26           H6         U  26  -0.917  10.926 -19.717
  275    H5'    C  27           H5'        C  27  -6.578   7.417 -21.498
  276   H5''    C  27          H5''        C  27  -7.412   6.319 -20.380
  277    H4'    C  27           H4'        C  27  -5.971   5.085 -22.009
  278    H3'    C  27           H3'        C  27  -5.541   5.132 -19.028
  279    H2'    C  27          H2''        C  27  -3.519   4.012 -19.090
  280   HO2'    C  27          H2'         C  27  -4.623   2.335 -20.489
  281    H1'    C  27           H1'        C  27  -2.641   4.772 -21.657
  282    H41    C  27           H41        C  27   1.221   7.948 -17.740
  283    H42    C  27           H42        C  27  -0.116   8.446 -16.726
  284    H5     C  27           H5         C  27  -2.395   7.782 -17.133
  285    H6     C  27           H6         C  27  -3.901   6.602 -18.656
  286    H5'    U  28           H5'        U  28  -7.330   0.423 -19.996
  287   H5''    U  28          H5''        U  28  -6.887  -0.449 -18.515
  288    H4'    U  28           H4'        U  28  -5.896  -1.160 -20.922
  289    H3'    U  28           H3'        U  28  -4.576  -1.007 -18.196
  290    H2'    U  28          H2''        U  28  -2.592  -1.894 -19.106
  291   HO2'    U  28          H2'         U  28  -2.636  -3.265 -20.701
  292    H1'    U  28           H1'        U  28  -2.667  -0.341 -21.421
  293    H3     U  28           H3         U  28   0.803   0.656 -18.504
  294    H5     U  28           H5         U  28  -2.528   2.843 -17.156
  295    H6     U  28           H6         U  28  -3.889   1.660 -18.762
  296    H5'    U  29           H5'        U  29  -3.733  -4.745 -19.658
  297   H5''    U  29          H5''        U  29  -4.065  -6.080 -18.536
  298    H4'    U  29           H4'        U  29  -1.758  -6.236 -19.428
  299    H3'    U  29           H3'        U  29  -2.380  -5.705 -16.536
  300    H2'    U  29          H2''        U  29  -0.216  -5.224 -15.945
  301   HO2'    U  29          H2'         U  29   0.357  -7.142 -17.884
  302    H1'    U  29           H1'        U  29   0.819  -4.431 -18.465
  303    H3     U  29           H3         U  29   2.062  -1.370 -15.315
  304    H5     U  29           H5         U  29  -2.012  -0.576 -16.038
  305    H6     U  29           H6         U  29  -2.096  -2.586 -17.393
  306    H5'    A  30           H5'        A  30   0.801  -9.384 -16.600
  307   H5''    A  30          H5''        A  30   0.496 -10.039 -14.981
  308    H4'    A  30           H4'        A  30   2.928  -9.204 -15.647
  309    H3'    A  30           H3'        A  30   1.326  -8.889 -13.110
  310    H2'    A  30          H2''        A  30   2.838  -7.442 -12.167
  311   HO2'    A  30          H2'         A  30   4.646  -8.622 -12.083
  312    H1'    A  30           H1'        A  30   4.089  -6.494 -14.564
  313    H8     A  30           H8         A  30   0.434  -5.541 -14.243
  314    H61    A  30           H61        A  30   2.321  -0.884 -10.640
  315    H62    A  30           H62        A  30   1.000  -1.516 -11.598
  316    H2     A  30           H2         A  30   5.810  -3.620 -11.330
  317    H5'    A  31           H5'        A  31   5.533 -11.176 -11.492
  318   H5''    A  31          H5''        A  31   4.777 -11.634  -9.954
  319    H4'    A  31           H4'        A  31   6.988 -10.151  -9.981
  320    H3'    A  31           H3'        A  31   4.490  -9.994  -8.287
  321    H2'    A  31          H2''        A  31   5.160  -8.045  -7.256
  322   HO2'    A  31          H2'         A  31   7.083  -8.070  -6.439
  323    H1'    A  31           H1'        A  31   6.796  -7.000  -9.324
  324    H8     A  31           H8         A  31   3.172  -7.654 -10.318
  325    H61    A  31           H61        A  31   1.919  -2.111  -7.875
  326    H62    A  31           H62        A  31   1.326  -3.394  -8.905
  327    H2     A  31           H2         A  31   6.149  -3.178  -6.832
  328    H5'    U  32           H5'        U  32   8.144 -10.498  -5.254
  329   H5''    U  32          H5''        U  32   7.334 -10.924  -3.734
  330    H4'    U  32           H4'        U  32   8.787  -8.701  -3.908
  331    H3'    U  32           H3'        U  32   6.164  -9.313  -2.556
  332    H2'    U  32          H2''        U  32   5.702  -7.110  -2.085
  333   HO2'    U  32          H2'         U  32   8.519  -6.792  -2.013
  334    H1'    U  32           H1'        U  32   7.349  -5.872  -4.069
  335    H3     U  32           H3         U  32   3.348  -3.695  -4.096
  336    H5     U  32           H5         U  32   2.554  -7.420  -5.904
  337    H6     U  32           H6         U  32   4.791  -8.126  -5.284
  338    H5'    A  33           H5'        A  33   8.977  -7.614   0.895
  339   H5''    A  33          H5''        A  33   8.140  -8.123   2.374
  340    H4'    A  33           H4'        A  33   8.469  -5.536   1.838
  341    H3'    A  33           H3'        A  33   6.224  -7.120   3.044
  342    H2'    A  33          H2''        A  33   4.648  -5.466   2.853
  343   HO2'    A  33          H2'         A  33   6.809  -3.625   3.022
  344    H1'    A  33           H1'        A  33   5.816  -3.888   0.792
  345    H8     A  33           H8         A  33   4.910  -7.436  -0.252
  346    H61    A  33           H61        A  33  -0.833  -5.325  -1.151
  347    H62    A  33           H62        A  33   0.286  -6.631  -1.471
  348    H2     A  33           H2         A  33   1.526  -2.118   0.916
  349    H5'    A  34           H5'        A  34   6.634  -3.140   5.097
  350   H5''    A  34          H5''        A  34   6.897  -3.540   6.806
  351    H4'    A  34           H4'        A  34   5.323  -1.698   6.740
  352    H3'    A  34           H3'        A  34   4.444  -4.456   7.476
  353    H2'    A  34          H2''        A  34   2.195  -4.117   7.215
  354   HO2'    A  34          H2'         A  34   2.721  -1.414   7.929
  355    H1'    A  34           H1'        A  34   2.168  -1.844   5.532
  356    H8     A  34           H8         A  34   3.673  -5.339   4.670
  357    H61    A  34           H61        A  34  -1.668  -6.318   1.720
  358    H62    A  34           H62        A  34  -0.018  -6.864   1.917
  359    H2     A  34           H2         A  34  -1.974  -2.419   3.916
  360    H5'    C  35           H5'        C  35   2.597  -4.298  11.192
  361   H5''    C  35          H5''        C  35   2.630  -6.060  10.983
  362    H4'    C  35           H4'        C  35   1.213  -3.973   9.315
  363    H3'    C  35           H3'        C  35   0.623  -6.322  10.950
  364    H2'    C  35          H2''        C  35   0.760  -7.856   9.182
  365   HO2'    C  35          H2'         C  35  -1.203  -7.916   7.976
  366    H1'    C  35           H1'        C  35   0.135  -5.760   7.138
  367    H41    C  35           H41        C  35   2.367 -10.438   3.446
  368    H42    C  35           H42        C  35   3.657 -10.784   4.577
  369    H5     C  35           H5         C  35   4.009  -9.515   6.597
  370    H6     C  35           H6         C  35   3.087  -7.782   8.069
  371    H5'    U  36           H5'        U  36  -0.291  -3.552  11.726
  372   H5''    U  36          H5''        U  36  -0.949  -3.494  13.374
  373    H4'    U  36           H4'        U  36  -1.024  -1.226  12.915
  374    H3'    U  36           H3'        U  36  -3.502  -2.633  12.041
  375    H2'    U  36          H2''        U  36  -4.281  -1.011  10.587
  376   HO2'    U  36          H2'         U  36  -3.737   0.619  12.398
  377    H1'    U  36           H1'        U  36  -1.930   0.029   9.606
  378    H3     U  36           H3         U  36  -4.964  -2.646   6.956
  379    H5     U  36           H5         U  36  -1.275  -4.598   7.462
  380    H6     U  36           H6         U  36  -0.717  -2.990   9.178
  381    H5'    A  37           H5'        A  37  -6.685  -0.108  14.504
  382   H5''    A  37          H5''        A  37  -7.367  -1.687  14.936
  383    H4'    A  37           H4'        A  37  -8.708  -0.009  13.351
  384    H3'    A  37           H3'        A  37  -8.363  -3.007  13.309
  385    H2'    A  37          H2''        A  37  -9.511  -3.255  11.302
  386   HO2'    A  37          H2'         A  37 -10.420  -0.569  11.564
  387    H1'    A  37           H1'        A  37  -8.560  -1.038   9.983
  388    H8     A  37           H8         A  37  -5.494  -2.354  11.560
  389    H61    A  37           H61        A  37  -5.561  -7.081   7.597
  390    H62    A  37           H62        A  37  -4.610  -6.176   8.752
  391    H2     A  37           H2         A  37  -9.545  -5.020   7.357
  392    H5'    C  38           H5'        C  38 -12.252  -2.032  12.686
  393   H5''    C  38          H5''        C  38 -13.472  -2.554  13.866
  394    H4'    C  38           H4'        C  38 -14.448  -2.955  11.711
  395    H3'    C  38           H3'        C  38 -13.353  -5.294  13.242
  396    H2'    C  38          H2''        C  38 -13.583  -6.814  11.498
  397   HO2'    C  38          H2'         C  38 -15.721  -6.412  10.979
  398    H1'    C  38           H1'        C  38 -13.024  -5.190   9.346
  399    H41    C  38           H41        C  38  -7.773  -8.582  10.740
  400    H42    C  38           H42        C  38  -7.280  -7.331  11.859
  401    H5     C  38           H5         C  38  -8.733  -5.546  12.550
  402    H6     C  38           H6         C  38 -10.887  -4.451  12.174
  403    H5'    A  39           H5'        A  39 -17.633  -7.066  13.268
  404   H5''    A  39          H5''        A  39 -17.345  -8.303  14.507
  405    H4'    A  39           H4'        A  39 -17.486  -8.956  11.910
  406    H3'    A  39           H3'        A  39 -15.626  -9.917  14.092
  407    H2'    A  39          H2''        A  39 -14.599 -11.400  12.595
  408   HO2'    A  39          H2'         A  39 -16.475 -12.266  11.650
  409    H1'    A  39           H1'        A  39 -14.622  -9.663  10.394
  410    H8     A  39           H8         A  39 -13.399  -7.693  13.330
  411    H61    A  39           H61        A  39  -7.974 -10.603  12.771
  412    H62    A  39           H62        A  39  -8.802  -9.222  13.454
  413    H2     A  39           H2         A  39 -10.952 -12.707  10.164
  414    H5'    A  40           H5'        A  40 -18.832 -13.003  12.989
  415   H5''    A  40          H5''        A  40 -19.130 -14.336  14.123
  416    H4'    A  40           H4'        A  40 -18.375 -15.109  11.842
  417    H3'    A  40           H3'        A  40 -17.050 -15.668  14.467
  418    H2'    A  40          H2''        A  40 -15.069 -16.454  13.610
  419   HO2'    A  40          H2'         A  40 -16.763 -17.579  11.804
  420    H1'    A  40           H1'        A  40 -15.023 -15.201  11.093
  421    H8     A  40           H8         A  40 -15.373 -12.918  14.162
  422    H61    A  40           H61        A  40  -9.203 -12.894  14.362
  423    H62    A  40           H62        A  40 -10.665 -12.116  14.927
  424    H2     A  40           H2         A  40 -10.481 -15.859  11.240
  425    H5'    A  41           H5'        A  41 -17.514 -20.208  13.443
  426   H5''    A  41          H5''        A  41 -17.425 -20.811  15.110
  427    H4'    A  41           H4'        A  41 -15.425 -21.250  13.406
  428    H3'    A  41           H3'        A  41 -15.520 -20.602  16.337
  429    H2'    A  41          H2''        A  41 -13.290 -20.085  16.505
  430   HO2'    A  41          H2'         A  41 -12.978 -22.010  14.453
  431    H1'    A  41           H1'        A  41 -12.712 -19.574  13.751
  432    H8     A  41           H8         A  41 -15.093 -17.166  15.556
  433    H61    A  41           H61        A  41  -9.998 -13.970  17.003
  434    H62    A  41           H62        A  41 -11.743 -14.021  17.109
  435    H2     A  41           H2         A  41  -8.727 -17.871  15.185
  436    H5'    U  42           H5'        U  42 -12.781 -24.002  14.857
  437   H5''    U  42          H5''        U  42 -12.688 -25.311  16.053
  438    H4'    U  42           H4'        U  42 -10.428 -24.757  15.131
  439    H3'    U  42           H3'        U  42 -11.201 -24.169  18.004
  440    H2'    U  42          H2''        U  42  -9.113 -23.267  18.503
  441   HO2'    U  42          H2'         U  42  -7.276 -23.848  17.520
  442    H1'    U  42           H1'        U  42  -8.594 -22.125  15.998
  443    H3     U  42           H3         U  42  -8.652 -18.531  18.739
  444    H5     U  42           H5         U  42 -12.642 -19.868  18.773
  445    H6     U  42           H6         U  42 -11.939 -21.805  17.509
  446    H5'    U  43           H5'        U  43  -7.637 -25.571  18.792
  447   H5''    U  43          H5''        U  43  -7.619 -26.496  20.305
  448    H4'    U  43           H4'        U  43  -6.372 -24.264  20.379
  449    H3'    U  43           H3'        U  43  -8.587 -25.193  22.187
  450    H2'    U  43          H2''        U  43  -8.840 -23.160  23.248
  451   HO2'    U  43          H2'         U  43  -6.129 -22.671  22.535
  452    H1'    U  43           H1'        U  43  -7.831 -21.447  21.219
  453    H3     U  43           H3         U  43 -11.849 -19.933  22.889
  454    H5     U  43           H5         U  43 -12.827 -22.890  20.050
  455    H6     U  43           H6         U  43 -10.468 -23.427  19.894
  456    H5'    A  44           H5'        A  44  -3.822 -25.382  24.778
  457   H5''    A  44          H5''        A  44  -4.632 -25.637  26.335
  458    H4'    A  44           H4'        A  44  -2.556 -23.979  26.153
  459    H3'    A  44           H3'        A  44  -5.164 -23.789  27.657
  460    H2'    A  44          H2''        A  44  -4.727 -21.630  28.409
  461   HO2'    A  44          H2'         A  44  -2.803 -21.347  29.189
  462    H1'    A  44           H1'        A  44  -3.365 -20.669  26.172
  463    H8     A  44           H8         A  44  -6.401 -22.146  24.695
  464    H61    A  44           H61        A  44  -9.753 -17.590  27.171
  465    H62    A  44           H62        A  44  -9.723 -18.875  25.984
  466    H2     A  44           H2         A  44  -5.612 -17.347  28.870
  467    H5'    A  45           H5'        A  45  -2.083 -22.802  30.699
  468   H5''    A  45          H5''        A  45  -2.579 -23.578  32.217
  469    H4'    A  45           H4'        A  45  -2.231 -21.040  32.334
  470    H3'    A  45           H3'        A  45  -4.642 -22.633  33.153
  471    H2'    A  45          H2''        A  45  -6.023 -20.823  33.407
  472   HO2'    A  45          H2'         A  45  -3.651 -19.455  34.129
  473    H1'    A  45           H1'        A  45  -4.636 -18.911  31.807
  474    H8     A  45           H8         A  45  -5.994 -21.887  29.872
  475    H61    A  45           H61        A  45 -11.441 -18.964  29.825
  476    H62    A  45           H62        A  45 -10.489 -20.242  29.105
  477    H2     A  45           H2         A  45  -8.694 -16.738  32.584
  478    H5'    G  46           H5'        G  46  -2.673 -21.050  37.566
  479   H5''    G  46          H5''        G  46  -3.865 -21.733  38.689
  480    H4'    G  46           H4'        G  46  -3.457 -19.091  38.556
  481    H3'    G  46           H3'        G  46  -5.879 -20.798  39.014
  482    H2'    G  46          H2''        G  46  -7.427 -19.103  38.699
  483   HO2'    G  46          H2'         G  46  -5.307 -17.276  39.218
  484    H1'    G  46           H1'        G  46  -6.120 -17.552  36.806
  485    H8     G  46           H8         G  46  -5.910 -21.096  35.632
  486    H1     G  46           H1         G  46 -11.772 -18.607  34.949
  487    H21    G  46           H21        G  46 -11.919 -16.696  36.041
  488    H22    G  46           H22        G  46 -10.633 -16.105  37.070
  489    H5'    C  47           H5'        C  47  -6.718 -18.111  42.835
  490   H5''    C  47          H5''        C  47  -7.541 -19.402  43.733
  491    H4'    C  47           H4'        C  47  -8.885 -17.243  42.936
  492    H3'    C  47           H3'        C  47  -9.578 -20.158  43.102
  493    H2'    C  47          H2''        C  47 -11.458 -20.024  41.794
  494   HO2'    C  47          H2'         C  47 -12.886 -18.417  41.959
  495    H1'    C  47           H1'        C  47 -10.903 -17.644  40.348
  496    H41    C  47           H41        C  47 -11.374 -22.377  36.124
  497    H42    C  47           H42        C  47  -9.812 -22.997  36.604
  498    H5     C  47           H5         C  47  -8.453 -21.954  38.306
  499    H6     C  47           H6         C  47  -8.425 -20.288  40.105
  500    H5'    C  48           H5'        C  48 -13.474 -18.196  44.030
  501   H5''    C  48          H5''        C  48 -13.963 -18.998  45.536
  502    H4'    C  48           H4'        C  48 -15.780 -19.198  43.885
  503    H3'    C  48           H3'        C  48 -14.118 -21.610  44.615
  504   HO3'    C  48          H3T         C  48 -15.532 -20.815  46.174
  505    H2'    C  48          H2''        C  48 -15.183 -22.972  43.104
  506   HO2'    C  48          H2'         C  48 -17.292 -22.896  42.736
  507    H1'    C  48           H1'        C  48 -16.026 -20.941  41.274
  508    H41    C  48           H41        C  48 -12.028 -24.758  38.113
  509    H42    C  48           H42        C  48 -10.690 -24.248  39.119
  510    H5     C  48           H5         C  48 -10.974 -22.896  41.090
  511    H6     C  48           H6         C  48 -12.555 -21.561  42.400
  Start of MODEL    9
    1    H5'    G   1           H5'        G   1 -17.143 -27.409  30.116
    2   H5''    G   1          H5''        G   1 -17.342 -25.825  29.340
    3    H4'    G   1           H4'        G   1 -19.398 -26.300  30.529
    4    H3'    G   1           H3'        G   1 -17.496 -24.210  31.460
    5    H2'    G   1          H2''        G   1 -18.354 -23.931  33.598
    6   HO2'    G   1          H2'         G   1 -20.743 -25.215  32.726
    7    H1'    G   1           H1'        G   1 -19.171 -26.470  34.210
    8    H8     G   1           H8         G   1 -16.038 -27.608  33.030
    9    H1     G   1           H1         G   1 -14.942 -23.211  37.565
   10    H21    G   1           H21        G   1 -16.786 -22.078  37.993
   11    H22    G   1           H22        G   1 -18.268 -22.324  37.097
   12   HO5'    G   1          H5T         G   1 -15.572 -26.632  31.243
   13    H5'    G   2           H5'        G   2 -20.935 -21.208  31.452
   14   H5''    G   2          H5''        G   2 -20.101 -19.835  30.698
   15    H4'    G   2           H4'        G   2 -20.839 -19.598  33.192
   16    H3'    G   2           H3'        G   2 -18.275 -18.916  31.811
   17    H2'    G   2          H2''        G   2 -17.010 -18.661  33.708
   18   HO2'    G   2          H2'         G   2 -18.138 -17.071  34.710
   19    H1'    G   2           H1'        G   2 -18.390 -20.303  35.519
   20    H8     G   2           H8         G   2 -17.489 -22.461  32.636
   21    H1     G   2           H1         G   2 -12.378 -20.893  36.174
   22    H21    G   2           H21        G   2 -12.909 -19.281  37.589
   23    H22    G   2           H22        G   2 -14.457 -18.466  37.539
   24    H5'    C   3           H5'        C   3 -19.137 -14.727  34.395
   25   H5''    C   3          H5''        C   3 -18.528 -13.717  33.070
   26    H4'    C   3           H4'        C   3 -17.460 -13.339  35.388
   27    H3'    C   3           H3'        C   3 -16.118 -13.829  32.743
   28    H2'    C   3          H2''        C   3 -14.009 -14.089  33.633
   29   HO2'    C   3          H2'         C   3 -14.972 -12.338  35.607
   30    H1'    C   3           H1'        C   3 -14.657 -15.014  36.206
   31    H41    C   3           H41        C   3 -11.856 -19.798  33.066
   32    H42    C   3           H42        C   3 -13.298 -20.050  32.113
   33    H5     C   3           H5         C   3 -15.304 -18.746  32.402
   34    H6     C   3           H6         C   3 -16.279 -16.773  33.481
   35    H5'    U   4           H5'        U   4 -13.435  -9.903  33.828
   36   H5''    U   4          H5''        U   4 -13.054  -9.683  32.109
   37    H4'    U   4           H4'        U   4 -11.135 -10.300  33.863
   38    H3'    U   4           H3'        U   4 -11.656 -11.310  31.058
   39    H2'    U   4          H2''        U   4  -9.752 -12.668  31.142
   40   HO2'    U   4          H2'         U   4  -8.993 -11.180  33.449
   41    H1'    U   4           H1'        U   4 -10.037 -13.490  33.774
   42    H3     U   4           H3         U   4 -10.453 -17.068  30.952
   43    H5     U   4           H5         U   4 -14.161 -15.083  30.713
   44    H6     U   4           H6         U   4 -13.215 -13.292  32.046
   45    H5'    U   5           H5'        U   5  -7.517 -10.146  32.058
   46   H5''    U   5          H5''        U   5  -6.852  -9.113  30.777
   47    H4'    U   5           H4'        U   5  -5.198 -10.816  31.559
   48    H3'    U   5           H3'        U   5  -6.279 -10.572  28.783
   49    H2'    U   5          H2''        U   5  -5.553 -12.611  28.022
   50   HO2'    U   5          H2'         U   5  -3.485 -12.424  29.970
   51    H1'    U   5           H1'        U   5  -5.289 -14.038  30.448
   52    H3     U   5           H3         U   5  -7.770 -16.723  27.763
   53    H5     U   5           H5         U   5 -10.341 -13.510  28.663
   54    H6     U   5           H6         U   5  -8.473 -12.406  29.743
   55    H5'    G   6           H5'        G   6  -3.946 -10.396  25.167
   56   H5''    G   6          H5''        G   6  -5.080 -11.193  26.277
   57    H4'    G   6           H4'        G   6  -2.440 -12.551  25.814
   58    H3'    G   6           H3'        G   6  -4.467 -11.888  23.721
   59    H2'    G   6          H2''        G   6  -5.000 -14.043  23.148
   60   HO2'    G   6          H2'         G   6  -2.621 -14.382  22.772
   61    H1'    G   6           H1'        G   6  -4.290 -15.438  25.489
   62    H8     G   6           H8         G   6  -6.823 -12.823  26.368
   63    H1     G   6           H1         G   6  -9.394 -17.715  23.121
   64    H21    G   6           H21        G   6  -7.810 -18.948  22.219
   65    H22    G   6           H22        G   6  -6.116 -18.696  22.572
   66    H5'    A   7           H5'        A   7  -0.262 -13.424  21.164
   67   H5''    A   7          H5''        A   7  -0.780 -12.693  19.632
   68    H4'    A   7           H4'        A   7  -0.040 -15.224  19.664
   69    H3'    A   7           H3'        A   7  -2.264 -13.772  18.289
   70    H2'    A   7          H2''        A   7  -3.503 -15.629  17.742
   71   HO2'    A   7          H2'         A   7  -2.549 -17.224  16.779
   72    H1'    A   7           H1'        A   7  -2.640 -17.458  19.700
   73    H8     A   7           H8         A   7  -4.050 -14.397  21.361
   74    H61    A   7           H61        A   7  -9.682 -16.646  20.176
   75    H62    A   7           H62        A   7  -8.760 -15.511  21.137
   76    H2     A   7           H2         A   7  -6.691 -19.144  17.958
   77    H5'    U   8           H5'        U   8  -0.327 -16.799  15.411
   78   H5''    U   8          H5''        U   8  -0.443 -16.136  13.769
   79    H4'    U   8           H4'        U   8  -1.415 -18.503  14.135
   80    H3'    U   8           H3'        U   8  -2.631 -16.105  12.819
   81    H2'    U   8          H2''        U   8  -4.779 -16.923  12.736
   82   HO2'    U   8          H2'         U   8  -4.937 -18.774  11.782
   83    H1'    U   8           H1'        U   8  -4.741 -18.742  14.885
   84    H3     U   8           H3         U   8  -8.289 -16.095  15.808
   85    H5     U   8           H5         U   8  -4.982 -13.523  16.239
   86    H6     U   8           H6         U   8  -3.577 -15.283  15.349
   87    H5'    U   9           H5'        U   9  -3.726 -19.125   9.961
   88   H5''    U   9          H5''        U   9  -3.327 -18.529   8.338
   89    H4'    U   9           H4'        U   9  -5.728 -19.045   8.452
   90    H3'    U   9           H3'        U   9  -4.708 -16.229   8.203
   91    H2'    U   9          H2''        U   9  -6.731 -15.235   8.611
   92   HO2'    U   9          H2'         U   9  -8.665 -16.084   7.895
   93    H1'    U   9           H1'        U   9  -8.067 -17.381   9.943
   94    H3     U   9           H3         U   9  -9.085 -14.017  12.711
   95    H5     U   9           H5         U   9  -4.872 -13.950  12.667
   96    H6     U   9           H6         U   9  -4.927 -15.716  11.002
   97    H5'    G  10           H5'        G  10  -7.721 -17.177   4.137
   98   H5''    G  10          H5''        G  10  -7.192 -15.743   3.234
   99    H4'    G  10           H4'        G  10  -9.781 -16.180   3.643
  100    H3'    G  10           H3'        G  10  -8.108 -13.679   3.716
  101    H2'    G  10          H2''        G  10  -9.822 -12.349   4.542
  102   HO2'    G  10          H2'         G  10 -11.405 -12.909   3.043
  103    H1'    G  10           H1'        G  10 -11.104 -14.181   6.171
  104    H8     G  10           H8         G  10  -7.466 -14.487   6.940
  105    H1     G  10           H1         G  10  -9.915  -8.949   9.043
  106    H21    G  10           H21        G  10 -11.943  -8.659   8.228
  107    H22    G  10           H22        G  10 -12.627  -9.727   7.024
  108    H5'    U  11           H5'        U  11 -11.433 -12.580   0.577
  109   H5''    U  11          H5''        U  11 -10.746 -11.176  -0.264
  110    H4'    U  11           H4'        U  11 -12.936 -10.924   1.240
  111    H3'    U  11           H3'        U  11 -10.522  -9.149   0.867
  112    H2'    U  11          H2''        U  11 -11.240  -7.630   2.489
  113   HO2'    U  11          H2'         U  11 -13.814  -8.813   2.208
  114    H1'    U  11           H1'        U  11 -12.407  -9.435   4.262
  115    H3     U  11           H3         U  11  -8.866  -7.085   6.099
  116    H5     U  11           H5         U  11  -7.251 -10.583   4.398
  117    H6     U  11           H6         U  11  -9.381 -10.955   3.294
  118    H5'    A  12           H5'        A  12 -13.035  -5.821  -1.018
  119   H5''    A  12          H5''        A  12 -11.630  -4.953  -1.665
  120    H4'    A  12           H4'        A  12 -12.889  -4.114   0.554
  121    H3'    A  12           H3'        A  12  -9.946  -4.202  -0.171
  122    H2'    A  12          H2''        A  12  -9.368  -3.251   1.904
  123   HO2'    A  12          H2'         A  12 -12.147  -2.733   2.280
  124    H1'    A  12           H1'        A  12 -11.077  -4.767   3.441
  125    H8     A  12           H8         A  12  -9.809  -7.311   1.095
  126    H61    A  12           H61        A  12  -4.291  -6.922   3.849
  127    H62    A  12           H62        A  12  -5.327  -7.905   2.840
  128    H2     A  12           H2         A  12  -6.806  -3.492   5.282
  129    H5'    U  13           H5'        U  13 -10.173   0.347   0.691
  130   H5''    U  13          H5''        U  13  -8.887   0.875  -0.410
  131    H4'    U  13           H4'        U  13  -8.634   1.225   2.210
  132    H3'    U  13           H3'        U  13  -6.632   0.314   0.130
  133    H2'    U  13          H2''        U  13  -4.973   0.009   1.768
  134   HO2'    U  13          H2'         U  13  -4.832   1.216   3.526
  135    H1'    U  13           H1'        U  13  -6.595  -0.824   3.856
  136    H3     U  13           H3         U  13  -3.232  -3.767   2.542
  137    H5     U  13           H5         U  13  -6.641  -4.706   0.248
  138    H6     U  13           H6         U  13  -7.683  -2.684   1.080
  139    H5'    U  14           H5'        U  14  -5.007   4.000   1.606
  140   H5''    U  14          H5''        U  14  -4.515   5.155   0.350
  141    H4'    U  14           H4'        U  14  -2.564   4.761   1.710
  142    H3'    U  14           H3'        U  14  -2.713   3.361  -0.962
  143    H2'    U  14          H2''        U  14  -0.713   2.236  -0.624
  144   HO2'    U  14          H2'         U  14  -0.114   4.082   1.461
  145    H1'    U  14           H1'        U  14  -0.882   1.904   2.150
  146    H3     U  14           H3         U  14  -0.502  -2.224   0.268
  147    H5     U  14           H5         U  14  -4.459  -1.048  -0.580
  148    H6     U  14           H6         U  14  -3.933   1.141   0.324
  149    H5'    A  15           H5'        A  15   0.603   6.893  -1.274
  150   H5''    A  15          H5''        A  15   1.274   6.889  -2.916
  151    H4'    A  15           H4'        A  15   2.811   6.275  -0.826
  152    H3'    A  15           H3'        A  15   2.633   5.251  -3.635
  153    H2'    A  15          H2''        A  15   3.855   3.338  -3.282
  154   HO2'    A  15          H2'         A  15   5.094   4.783  -1.177
  155    H1'    A  15           H1'        A  15   3.414   2.915  -0.536
  156    H8     A  15           H8         A  15   0.180   3.131  -2.524
  157    H61    A  15           H61        A  15   1.112  -2.763  -4.103
  158    H62    A  15           H62        A  15  -0.082  -1.498  -3.924
  159    H2     A  15           H2         A  15   4.889  -1.209  -2.257
  160    H5'    U  16           H5'        U  16   7.143   5.734  -2.414
  161   H5''    U  16          H5''        U  16   7.948   6.218  -3.920
  162    H4'    U  16           H4'        U  16   9.029   4.242  -2.744
  163    H3'    U  16           H3'        U  16   7.961   4.277  -5.561
  164    H2'    U  16          H2''        U  16   8.302   2.016  -5.897
  165   HO2'    U  16          H2'         U  16  10.111   1.135  -5.320
  166    H1'    U  16           H1'        U  16   8.015   1.094  -3.259
  167    H3     U  16           H3         U  16   5.039  -1.287  -5.727
  168    H5     U  16           H5         U  16   3.361   2.563  -5.517
  169    H6     U  16           H6         U  16   5.452   3.354  -4.583
  170    H5'    U  17           H5'        U  17  11.902   2.366  -6.224
  171   H5''    U  17          H5''        U  17  12.429   3.005  -7.792
  172    H4'    U  17           H4'        U  17  12.155   0.473  -7.708
  173    H3'    U  17           H3'        U  17  10.773   2.361  -9.614
  174    H2'    U  17          H2''        U  17   9.420   0.730 -10.486
  175   HO2'    U  17          H2'         U  17  11.548  -1.042  -9.863
  176    H1'    U  17           H1'        U  17   9.566  -1.160  -8.336
  177    H3     U  17           H3         U  17   5.247  -1.112  -9.687
  178    H5     U  17           H5         U  17   5.803   2.661  -7.891
  179    H6     U  17           H6         U  17   8.170   2.156  -7.722
  180    H5'    A  18           H5'        A  18  12.859  -1.317 -11.516
  181   H5''    A  18          H5''        A  18  13.540  -0.784 -13.064
  182    H4'    A  18           H4'        A  18  12.409  -2.951 -13.353
  183    H3'    A  18           H3'        A  18  11.240  -0.438 -14.562
  184    H2'    A  18          H2''        A  18   9.390  -1.558 -15.374
  185   HO2'    A  18          H2'         A  18  10.982  -3.910 -15.246
  186    H1'    A  18           H1'        A  18   9.258  -3.630 -13.448
  187    H8     A  18           H8         A  18   9.117  -0.058 -12.100
  188    H61    A  18           H61        A  18   3.056  -0.245 -13.291
  189    H62    A  18           H62        A  18   4.365   0.715 -12.639
  190    H2     A  18           H2         A  18   4.941  -3.915 -15.061
  191    H5'    A  19           H5'        A  19  11.236  -3.634 -17.722
  192   H5''    A  19          H5''        A  19  11.660  -2.798 -19.227
  193    H4'    A  19           H4'        A  19   9.552  -4.138 -19.430
  194    H3'    A  19           H3'        A  19   9.628  -1.128 -19.725
  195    H2'    A  19          H2''        A  19   7.339  -0.996 -19.972
  196   HO2'    A  19          H2'         A  19   6.348  -2.271 -21.315
  197    H1'    A  19           H1'        A  19   6.653  -3.451 -18.660
  198    H8     A  19           H8         A  19   8.252  -0.702 -16.523
  199    H61    A  19           H61        A  19   2.536   1.554 -15.857
  200    H62    A  19           H62        A  19   4.180   1.601 -15.258
  201    H2     A  19           H2         A  19   2.369  -1.819 -18.810
  202    H5'    A  20           H5'        A  20   7.544  -2.745 -23.839
  203   H5''    A  20          H5''        A  20   7.719  -1.241 -24.764
  204    H4'    A  20           H4'        A  20   5.303  -2.231 -24.253
  205    H3'    A  20           H3'        A  20   6.373   0.587 -24.259
  206    H2'    A  20          H2''        A  20   4.450   1.487 -23.359
  207   HO2'    A  20          H2'         A  20   3.134  -0.758 -24.493
  208    H1'    A  20           H1'        A  20   3.481  -0.779 -21.967
  209    H8     A  20           H8         A  20   6.989   0.643 -21.177
  210    H61    A  20           H61        A  20   4.126   4.252 -17.059
  211    H62    A  20           H62        A  20   5.670   3.637 -17.606
  212    H2     A  20           H2         A  20   0.988   2.049 -19.387
  213    H5'    U  21           H5'        U  21   2.423   0.955 -26.767
  214   H5''    U  21          H5''        U  21   2.755   2.454 -27.655
  215    H4'    U  21           H4'        U  21   0.762   2.358 -25.902
  216    H3'    U  21           H3'        U  21   2.801   4.468 -26.554
  217    H2'    U  21          H2''        U  21   2.333   5.781 -24.704
  218   HO2'    U  21          H2'         U  21  -0.259   4.657 -24.919
  219    H1'    U  21           H1'        U  21   1.283   3.825 -22.963
  220    H3     U  21           H3         U  21   4.496   5.985 -20.590
  221    H5     U  21           H5         U  21   6.649   3.870 -23.531
  222    H6     U  21           H6         U  21   4.535   3.173 -24.486
  223    H5'    U  22           H5'        U  22  -1.397   5.719 -26.712
  224   H5''    U  22          H5''        U  22  -1.918   6.773 -28.043
  225    H4'    U  22           H4'        U  22  -2.799   7.598 -25.877
  226    H3'    U  22           H3'        U  22  -0.891   9.073 -27.628
  227    H2'    U  22          H2''        U  22   0.026  10.413 -26.041
  228   HO2'    U  22          H2'         U  22  -1.817  11.662 -25.897
  229    H1'    U  22           H1'        U  22  -1.150   9.277 -23.669
  230    H3     U  22           H3         U  22   2.869  10.312 -21.953
  231    H5     U  22           H5         U  22   3.849   7.969 -25.317
  232    H6     U  22           H6         U  22   1.486   7.869 -25.855
  233    H5'    A  23           H5'        A  23  -0.517  12.211 -28.982
  234   H5''    A  23          H5''        A  23   0.056  11.454 -27.488
  235    H4'    A  23           H4'        A  23   0.849  13.861 -27.903
  236    H3'    A  23           H3'        A  23  -0.134  12.550 -25.504
  237    H2'    A  23          H2''        A  23  -1.767  14.016 -24.852
  238   HO2'    A  23          H2'         A  23   0.410  15.864 -24.909
  239    H1'    A  23           H1'        A  23  -1.394  16.250 -26.646
  240    H8     A  23           H8         A  23  -3.376  13.541 -28.127
  241    H61    A  23           H61        A  23  -8.204  15.120 -24.601
  242    H62    A  23           H62        A  23  -7.649  14.098 -25.908
  243    H2     A  23           H2         A  23  -4.580  17.222 -23.011
  244    H5'    A  24           H5'        A  24   2.903  13.963 -22.334
  245   H5''    A  24          H5''        A  24   2.240  12.627 -21.376
  246    H4'    A  24           H4'        A  24   1.295  15.338 -21.525
  247    H3'    A  24           H3'        A  24   0.665  12.726 -20.176
  248    H2'    A  24          H2''        A  24  -1.562  13.174 -19.875
  249   HO2'    A  24          H2'         A  24  -0.876  15.927 -19.637
  250    H1'    A  24           H1'        A  24  -1.764  15.425 -21.712
  251    H8     A  24           H8         A  24  -1.479  12.298 -23.610
  252    H61    A  24           H61        A  24  -7.473  11.254 -22.484
  253    H62    A  24           H62        A  24  -6.059  10.703 -23.353
  254    H2     A  24           H2         A  24  -6.067  14.492 -19.711
  255    H5'    U  25           H5'        U  25   1.370  11.217 -17.186
  256   H5''    U  25          H5''        U  25   0.158  12.180 -18.055
  257    H4'    U  25           H4'        U  25   0.107  11.180 -15.292
  258    H3'    U  25           H3'        U  25  -1.572  11.294 -17.448
  259    H2'    U  25          H2''        U  25  -2.024  13.594 -17.511
  260   HO2'    U  25          H2'         U  25  -4.062  13.434 -17.071
  261    H1'    U  25           H1'        U  25  -2.070  13.906 -14.545
  262    H3     U  25           H3         U  25  -1.794  18.357 -14.784
  263    H5     U  25           H5         U  25   0.262  17.136 -18.252
  264    H6     U  25           H6         U  25  -0.197  14.834 -17.642
  265    H5'    U  26           H5'        U  26  -3.132  11.719 -18.566
  266   H5''    U  26          H5''        U  26  -4.732  11.231 -17.979
  267    H4'    U  26           H4'        U  26  -4.981  10.804 -20.268
  268    H3'    U  26           H3'        U  26  -4.045   8.469 -18.674
  269    H2'    U  26          H2''        U  26  -3.157   7.232 -20.388
  270   HO2'    U  26          H2'         U  26  -4.963   8.604 -22.112
  271    H1'    U  26           H1'        U  26  -2.553   9.211 -22.271
  272    H3     U  26           H3         U  26   1.217   6.771 -21.439
  273    H5     U  26           H5         U  26   0.936   9.475 -18.229
  274    H6     U  26           H6         U  26  -1.257  10.114 -19.028
  275    H5'    C  27           H5'        C  27  -6.673   6.129 -20.915
  276   H5''    C  27          H5''        C  27  -7.483   5.001 -19.808
  277    H4'    C  27           H4'        C  27  -5.923   3.811 -21.342
  278    H3'    C  27           H3'        C  27  -5.528   3.986 -18.359
  279    H2'    C  27          H2''        C  27  -3.456   2.955 -18.388
  280   HO2'    C  27          H2'         C  27  -2.830   1.627 -20.237
  281    H1'    C  27           H1'        C  27  -2.624   3.686 -20.984
  282    H41    C  27           H41        C  27   1.179   7.007 -17.133
  283    H42    C  27           H42        C  27  -0.166   7.501 -16.128
  284    H5     C  27           H5         C  27  -2.433   6.791 -16.520
  285    H6     C  27           H6         C  27  -3.919   5.547 -18.014
  286    H5'    U  28           H5'        U  28  -7.014  -0.862 -19.190
  287   H5''    U  28          H5''        U  28  -6.501  -1.656 -17.689
  288    H4'    U  28           H4'        U  28  -5.489  -2.373 -20.085
  289    H3'    U  28           H3'        U  28  -4.151  -2.050 -17.381
  290    H2'    U  28          H2''        U  28  -2.128  -2.844 -18.291
  291   HO2'    U  28          H2'         U  28  -3.625  -3.591 -20.602
  292    H1'    U  28           H1'        U  28  -2.329  -1.383 -20.657
  293    H3     U  28           H3         U  28   1.122  -0.063 -17.858
  294    H5     U  28           H5         U  28  -2.311   1.949 -16.502
  295    H6     U  28           H6         U  28  -3.626   0.628 -18.038
  296    H5'    U  29           H5'        U  29  -2.962  -5.606 -18.764
  297   H5''    U  29          H5''        U  29  -3.157  -6.982 -17.659
  298    H4'    U  29           H4'        U  29  -0.842  -6.892 -18.517
  299    H3'    U  29           H3'        U  29  -1.517  -6.378 -15.629
  300    H2'    U  29          H2''        U  29   0.595  -5.690 -15.066
  301   HO2'    U  29          H2'         U  29   1.473  -7.365 -17.181
  302    H1'    U  29           H1'        U  29   1.535  -4.888 -17.630
  303    H3     U  29           H3         U  29   2.657  -1.700 -14.556
  304    H5     U  29           H5         U  29  -1.466  -1.153 -15.230
  305    H6     U  29           H6         U  29  -1.457  -3.194 -16.538
  306    H5'    A  30           H5'        A  30   2.057  -9.514 -15.788
  307   H5''    A  30          H5''        A  30   1.798 -10.415 -14.282
  308    H4'    A  30           H4'        A  30   4.135  -9.371 -14.614
  309    H3'    A  30           H3'        A  30   2.290  -9.067 -12.243
  310    H2'    A  30          H2''        A  30   3.631  -7.510 -11.223
  311   HO2'    A  30          H2'         A  30   5.728  -8.895 -12.513
  312    H1'    A  30           H1'        A  30   5.046  -6.572 -13.532
  313    H8     A  30           H8         A  30   1.281  -5.912 -13.382
  314    H61    A  30           H61        A  30   2.709  -0.860 -10.118
  315    H62    A  30           H62        A  30   1.469  -1.656 -11.060
  316    H2     A  30           H2         A  30   6.441  -3.303 -10.619
  317    H5'    A  31           H5'        A  31   6.555 -10.956 -10.313
  318   H5''    A  31          H5''        A  31   5.814 -11.351  -8.751
  319    H4'    A  31           H4'        A  31   7.915  -9.718  -8.877
  320    H3'    A  31           H3'        A  31   5.399  -9.616  -7.205
  321    H2'    A  31          H2''        A  31   5.938  -7.563  -6.307
  322   HO2'    A  31          H2'         A  31   8.651  -8.077  -7.008
  323    H1'    A  31           H1'        A  31   7.503  -6.556  -8.447
  324    H8     A  31           H8         A  31   3.938  -7.517  -9.396
  325    H61    A  31           H61        A  31   2.296  -1.920  -7.344
  326    H62    A  31           H62        A  31   1.808  -3.298  -8.305
  327    H2     A  31           H2         A  31   6.577  -2.633  -6.199
  328    H5'    U  32           H5'        U  32   9.064  -9.573  -4.144
  329   H5''    U  32          H5''        U  32   8.271  -9.929  -2.599
  330    H4'    U  32           H4'        U  32   9.551  -7.623  -2.954
  331    H3'    U  32           H3'        U  32   6.959  -8.309  -1.575
  332    H2'    U  32          H2''        U  32   6.354  -6.110  -1.277
  333   HO2'    U  32          H2'         U  32   9.143  -5.589  -1.260
  334    H1'    U  32           H1'        U  32   7.909  -4.935  -3.367
  335    H3     U  32           H3         U  32   3.735  -3.100  -3.538
  336    H5     U  32           H5         U  32   3.261  -6.998  -5.060
  337    H6     U  32           H6         U  32   5.544  -7.471  -4.392
  338    H5'    A  33           H5'        A  33   9.485  -6.231   1.801
  339   H5''    A  33          H5''        A  33   8.634  -6.674   3.294
  340    H4'    A  33           H4'        A  33   8.733  -4.132   2.493
  341    H3'    A  33           H3'        A  33   6.597  -5.800   3.792
  342    H2'    A  33          H2''        A  33   4.895  -4.312   3.393
  343   HO2'    A  33          H2'         A  33   6.890  -2.285   3.443
  344    H1'    A  33           H1'        A  33   6.030  -2.841   1.227
  345    H8     A  33           H8         A  33   5.406  -6.492   0.412
  346    H61    A  33           H61        A  33  -0.465  -4.897  -0.693
  347    H62    A  33           H62        A  33   0.764  -6.115  -0.946
  348    H2     A  33           H2         A  33   1.591  -1.407   1.238
  349    H5'    A  34           H5'        A  34   6.324  -1.652   5.363
  350   H5''    A  34          H5''        A  34   6.657  -1.832   7.098
  351    H4'    A  34           H4'        A  34   4.800  -0.315   6.946
  352    H3'    A  34           H3'        A  34   4.332  -3.142   7.793
  353    H2'    A  34          H2''        A  34   2.064  -3.149   7.482
  354   HO2'    A  34          H2'         A  34   1.638  -1.581   9.020
  355    H1'    A  34           H1'        A  34   1.751  -0.931   5.731
  356    H8     A  34           H8         A  34   3.642  -4.274   5.011
  357    H61    A  34           H61        A  34  -1.484  -5.868   1.944
  358    H62    A  34           H62        A  34   0.201  -6.249   2.220
  359    H2     A  34           H2         A  34  -2.239  -1.948   3.991
  360    H5'    C  35           H5'        C  35   1.697  -4.340  11.344
  361   H5''    C  35          H5''        C  35   2.931  -4.638  10.103
  362    H4'    C  35           H4'        C  35   0.467  -3.303   9.087
  363    H3'    C  35           H3'        C  35   0.270  -5.627  10.837
  364    H2'    C  35          H2''        C  35   0.903  -7.181   9.196
  365   HO2'    C  35          H2'         C  35  -0.979  -8.037   8.827
  366    H1'    C  35           H1'        C  35  -0.071  -5.399   6.992
  367    H41    C  35           H41        C  35   3.319  -9.649   3.679
  368    H42    C  35           H42        C  35   4.629  -9.576   4.836
  369    H5     C  35           H5         C  35   4.508  -8.321   6.889
  370    H6     C  35           H6         C  35   3.149  -6.776   8.223
  371    H5'    U  36           H5'        U  36  -0.780  -3.194  11.443
  372   H5''    U  36          H5''        U  36  -1.437  -3.183  13.092
  373    H4'    U  36           H4'        U  36  -1.594  -0.916  12.682
  374    H3'    U  36           H3'        U  36  -4.011  -2.370  11.700
  375    H2'    U  36          H2''        U  36  -4.824  -0.671  10.348
  376   HO2'    U  36          H2'         U  36  -4.575   0.915  12.077
  377    H1'    U  36           H1'        U  36  -2.486   0.419   9.407
  378    H3     U  36           H3         U  36  -5.478  -2.228   6.679
  379    H5     U  36           H5         U  36  -1.785  -4.186   7.185
  380    H6     U  36           H6         U  36  -1.247  -2.592   8.922
  381    H5'    A  37           H5'        A  37  -6.379   0.423  12.809
  382   H5''    A  37          H5''        A  37  -7.494  -0.122  14.077
  383    H4'    A  37           H4'        A  37  -8.856   0.511  12.190
  384    H3'    A  37           H3'        A  37  -8.408  -2.462  12.577
  385    H2'    A  37          H2''        A  37  -9.803  -2.949  10.762
  386   HO2'    A  37          H2'         A  37 -11.508  -1.774  10.454
  387    H1'    A  37           H1'        A  37  -8.884  -0.944   9.093
  388    H8     A  37           H8         A  37  -5.810  -2.322  10.693
  389    H61    A  37           H61        A  37  -6.347  -7.295   7.080
  390    H62    A  37           H62        A  37  -5.258  -6.335   8.057
  391    H2     A  37           H2         A  37 -10.171  -4.959   6.797
  392    H5'    C  38           H5'        C  38 -12.431  -1.469  12.349
  393   H5''    C  38          H5''        C  38 -13.521  -2.069  13.614
  394    H4'    C  38           H4'        C  38 -14.586  -2.433  11.451
  395    H3'    C  38           H3'        C  38 -13.507  -4.749  13.040
  396    H2'    C  38          H2''        C  38 -13.910  -6.316  11.372
  397   HO2'    C  38          H2'         C  38 -15.651  -4.431  10.139
  398    H1'    C  38           H1'        C  38 -13.433  -4.760   9.130
  399    H41    C  38           H41        C  38  -8.289  -8.435  10.016
  400    H42    C  38           H42        C  38  -7.735  -7.378  11.295
  401    H5     C  38           H5         C  38  -8.935  -5.412  11.984
  402    H6     C  38           H6         C  38 -11.029  -4.166  11.778
  403    H5'    A  39           H5'        A  39 -17.849  -6.318  13.396
  404   H5''    A  39          H5''        A  39 -17.535  -7.524  14.661
  405    H4'    A  39           H4'        A  39 -17.857  -8.254  12.097
  406    H3'    A  39           H3'        A  39 -15.912  -9.227  14.199
  407    H2'    A  39          H2''        A  39 -15.044 -10.803  12.691
  408   HO2'    A  39          H2'         A  39 -16.838 -11.712  11.800
  409    H1'    A  39           H1'        A  39 -15.117  -9.119  10.444
  410    H8     A  39           H8         A  39 -13.650  -7.133  13.253
  411    H61    A  39           H61        A  39  -8.397 -10.301  12.493
  412    H62    A  39           H62        A  39  -9.116  -8.847  13.148
  413    H2     A  39           H2         A  39 -11.595 -12.324  10.090
  414    H5'    A  40           H5'        A  40 -19.346 -12.119  13.358
  415   H5''    A  40          H5''        A  40 -19.697 -13.405  14.530
  416    H4'    A  40           H4'        A  40 -19.144 -14.303  12.253
  417    H3'    A  40           H3'        A  40 -17.638 -14.861  14.782
  418    H2'    A  40          H2''        A  40 -15.804 -15.822  13.788
  419   HO2'    A  40          H2'         A  40 -16.971 -17.453  12.745
  420    H1'    A  40           H1'        A  40 -15.884 -14.633  11.241
  421    H8     A  40           H8         A  40 -15.817 -12.297  14.298
  422    H61    A  40           H61        A  40  -9.665 -12.741  14.001
  423    H62    A  40           H62        A  40 -11.011 -11.850  14.674
  424    H2     A  40           H2         A  40 -11.411 -15.594  11.008
  425    H5'    A  41           H5'        A  41 -18.435 -19.399  13.809
  426   H5''    A  41          H5''        A  41 -18.260 -20.006  15.467
  427    H4'    A  41           H4'        A  41 -16.465 -20.639  13.610
  428    H3'    A  41           H3'        A  41 -16.241 -19.962  16.527
  429    H2'    A  41          H2''        A  41 -13.965 -19.659  16.492
  430   HO2'    A  41          H2'         A  41 -12.622 -20.835  15.035
  431    H1'    A  41           H1'        A  41 -13.588 -19.218  13.692
  432    H8     A  41           H8         A  41 -15.572 -16.592  15.668
  433    H61    A  41           H61        A  41 -10.095 -13.908  16.704
  434    H62    A  41           H62        A  41 -11.829 -13.757  16.878
  435    H2     A  41           H2         A  41  -9.352 -17.888  14.774
  436    H5'    U  42           H5'        U  42 -14.089 -23.558  14.759
  437   H5''    U  42          H5''        U  42 -14.052 -24.952  15.857
  438    H4'    U  42           H4'        U  42 -11.860 -24.698  14.723
  439    H3'    U  42           H3'        U  42 -12.195 -24.065  17.667
  440    H2'    U  42          H2''        U  42  -9.961 -23.463  17.924
  441   HO2'    U  42          H2'         U  42  -8.341 -24.238  16.695
  442    H1'    U  42           H1'        U  42  -9.582 -22.337  15.390
  443    H3     U  42           H3         U  42  -8.871 -18.878  18.219
  444    H5     U  42           H5         U  42 -12.976 -19.684  18.657
  445    H6     U  42           H6         U  42 -12.682 -21.623  17.243
  446    H5'    U  43           H5'        U  43  -8.751 -25.834  18.100
  447   H5''    U  43          H5''        U  43  -8.711 -26.764  19.611
  448    H4'    U  43           H4'        U  43  -7.239 -24.664  19.567
  449    H3'    U  43           H3'        U  43  -9.363 -25.401  21.563
  450    H2'    U  43          H2''        U  43  -9.345 -23.366  22.643
  451   HO2'    U  43          H2'         U  43  -6.668 -23.095  21.716
  452    H1'    U  43           H1'        U  43  -8.335 -21.732  20.544
  453    H3     U  43           H3         U  43 -12.023 -19.835  22.548
  454    H5     U  43           H5         U  43 -13.534 -22.668  19.817
  455    H6     U  43           H6         U  43 -11.263 -23.433  19.454
  456    H5'    A  44           H5'        A  44  -4.472 -26.126  23.774
  457   H5''    A  44          H5''        A  44  -5.173 -26.303  25.393
  458    H4'    A  44           H4'        A  44  -2.960 -24.862  25.027
  459    H3'    A  44           H3'        A  44  -5.391 -24.421  26.761
  460    H2'    A  44          H2''        A  44  -4.655 -22.331  27.477
  461   HO2'    A  44          H2'         A  44  -2.639 -22.069  27.965
  462    H1'    A  44           H1'        A  44  -3.422 -21.490  25.122
  463    H8     A  44           H8         A  44  -6.743 -22.671  23.986
  464    H61    A  44           H61        A  44  -9.293 -17.700  26.617
  465    H62    A  44           H62        A  44  -9.573 -19.100  25.605
  466    H2     A  44           H2         A  44  -5.007 -17.902  27.907
  467    H5'    A  45           H5'        A  45  -2.040 -23.584  29.385
  468   H5''    A  45          H5''        A  45  -2.380 -24.284  30.980
  469    H4'    A  45           H4'        A  45  -1.911 -21.778  30.993
  470    H3'    A  45           H3'        A  45  -4.343 -23.184  32.063
  471    H2'    A  45          H2''        A  45  -5.559 -21.270  32.390
  472   HO2'    A  45          H2'         A  45  -4.660 -19.377  33.104
  473    H1'    A  45           H1'        A  45  -4.171 -19.507  30.620
  474    H8     A  45           H8         A  45  -5.958 -22.380  28.892
  475    H61    A  45           H61        A  45 -11.101 -18.967  29.254
  476    H62    A  45           H62        A  45 -10.352 -20.370  28.525
  477    H2     A  45           H2         A  45  -7.935 -16.977  31.729
  478    H5'    G  46           H5'        G  46  -1.928 -21.617  36.272
  479   H5''    G  46          H5''        G  46  -3.090 -22.193  37.484
  480    H4'    G  46           H4'        G  46  -2.498 -19.590  37.269
  481    H3'    G  46           H3'        G  46  -5.008 -21.101  37.917
  482    H2'    G  46          H2''        G  46  -6.433 -19.288  37.683
  483   HO2'    G  46          H2'         G  46  -5.358 -17.883  39.063
  484    H1'    G  46           H1'        G  46  -5.141 -17.873  35.678
  485    H8     G  46           H8         G  46  -5.323 -21.460  34.596
  486    H1     G  46           H1         G  46 -10.972 -18.457  34.219
  487    H21    G  46           H21        G  46 -10.861 -16.506  35.246
  488    H22    G  46           H22        G  46  -9.467 -16.025  36.188
  489    H5'    C  47           H5'        C  47  -5.427 -18.095  41.551
  490   H5''    C  47          H5''        C  47  -6.302 -19.233  42.595
  491    H4'    C  47           H4'        C  47  -7.498 -17.024  41.703
  492    H3'    C  47           H3'        C  47  -8.443 -19.842  42.134
  493    H2'    C  47          H2''        C  47 -10.389 -19.603  40.943
  494   HO2'    C  47          H2'         C  47 -11.662 -17.910  41.180
  495    H1'    C  47           H1'        C  47  -9.703 -17.364  39.321
  496    H41    C  47           H41        C  47 -11.059 -22.198  35.418
  497    H42    C  47           H42        C  47  -9.534 -22.963  35.796
  498    H5     C  47           H5         C  47  -7.924 -22.003  37.318
  499    H6     C  47           H6         C  47  -7.558 -20.273  39.015
  500    H5'    C  48           H5'        C  48 -12.094 -17.370  43.222
  501   H5''    C  48          H5''        C  48 -12.536 -18.087  44.785
  502    H4'    C  48           H4'        C  48 -14.480 -18.132  43.247
  503    H3'    C  48           H3'        C  48 -13.038 -20.692  43.982
  504   HO3'    C  48          H3T         C  48 -15.472 -19.416  44.727
  505    H2'    C  48          H2''        C  48 -14.375 -21.970  42.617
  506   HO2'    C  48          H2'         C  48 -16.332 -21.374  43.609
  507    H1'    C  48           H1'        C  48 -15.153 -19.892  40.809
  508    H41    C  48           H41        C  48 -12.066 -24.302  37.401
  509    H42    C  48           H42        C  48 -10.569 -23.941  38.231
  510    H5     C  48           H5         C  48 -10.451 -22.506  40.160
  511    H6     C  48           H6         C  48 -11.691 -20.946  41.582
  Start of MODEL   10
    1    H5'    G   1           H5'        G   1 -16.172 -30.746  29.663
    2   H5''    G   1          H5''        G   1 -16.469 -29.211  28.820
    3    H4'    G   1           H4'        G   1 -17.832 -29.474  30.938
    4    H3'    G   1           H3'        G   1 -15.856 -27.285  30.349
    5    H2'    G   1          H2''        G   1 -15.804 -26.465  32.483
    6   HO2'    G   1          H2'         G   1 -18.463 -27.437  32.783
    7    H1'    G   1           H1'        G   1 -16.797 -28.732  33.907
    8    H8     G   1           H8         G   1 -13.511 -29.701  32.543
    9    H1     G   1           H1         G   1 -12.956 -25.444  37.310
   10    H21    G   1           H21        G   1 -14.917 -24.519  37.726
   11    H22    G   1           H22        G   1 -16.382 -25.022  36.913
   12   HO5'    G   1          H5T         G   1 -14.392 -29.402  30.707
   13    H5'    G   2           H5'        G   2 -20.263 -24.565  30.404
   14   H5''    G   2          H5''        G   2 -19.439 -23.142  29.737
   15    H4'    G   2           H4'        G   2 -20.762 -22.993  32.055
   16    H3'    G   2           H3'        G   2 -18.247 -21.745  31.014
   17    H2'    G   2          H2''        G   2 -17.452 -21.032  33.057
   18   HO2'    G   2          H2'         G   2 -18.727 -20.092  34.434
   19    H1'    G   2           H1'        G   2 -18.514 -22.962  34.759
   20    H8     G   2           H8         G   2 -16.791 -24.698  31.916
   21    H1     G   2           H1         G   2 -12.689 -22.221  36.173
   22    H21    G   2           H21        G   2 -13.761 -20.882  37.564
   23    H22    G   2           H22        G   2 -15.440 -20.448  37.336
   24    H5'    C   3           H5'        C   3 -20.063 -18.569  33.701
   25   H5''    C   3          H5''        C   3 -20.316 -17.250  32.541
   26    H4'    C   3           H4'        C   3 -19.288 -16.275  34.500
   27    H3'    C   3           H3'        C   3 -17.616 -16.679  32.028
   28    H2'    C   3          H2''        C   3 -15.636 -16.034  33.054
   29   HO2'    C   3          H2'         C   3 -17.222 -14.814  35.078
   30    H1'    C   3           H1'        C   3 -16.103 -16.968  35.626
   31    H41    C   3           H41        C   3 -12.074 -21.117  32.959
   32    H42    C   3           H42        C   3 -13.306 -21.652  31.839
   33    H5     C   3           H5         C   3 -15.559 -20.810  31.871
   34    H6     C   3           H6         C   3 -17.050 -19.102  32.795
   35    H5'    U   4           H5'        U   4 -16.592 -12.226  32.618
   36   H5''    U   4          H5''        U   4 -15.912 -11.898  31.012
   37    H4'    U   4           H4'        U   4 -14.333 -12.015  33.166
   38    H3'    U   4           H3'        U   4 -13.956 -13.072  30.356
   39    H2'    U   4          H2''        U   4 -11.867 -13.953  30.892
   40   HO2'    U   4          H2'         U   4 -11.932 -12.357  33.252
   41    H1'    U   4           H1'        U   4 -12.464 -14.773  33.486
   42    H3     U   4           H3         U   4 -11.223 -18.297  30.823
   43    H5     U   4           H5         U   4 -15.264 -17.576  29.870
   44    H6     U   4           H6         U   4 -15.160 -15.570  31.228
   45    H5'    U   5           H5'        U   5 -10.541 -10.820  32.243
   46   H5''    U   5          H5''        U   5  -9.909  -9.666  31.050
   47    H4'    U   5           H4'        U   5  -8.087 -10.840  32.316
   48    H3'    U   5           H3'        U   5  -8.509 -10.894  29.357
   49    H2'    U   5          H2''        U   5  -7.082 -12.637  28.907
   50   HO2'    U   5          H2'         U   5  -5.259 -11.622  29.773
   51    H1'    U   5           H1'        U   5  -7.054 -13.978  31.387
   52    H3     U   5           H3         U   5  -8.042 -17.100  28.225
   53    H5     U   5           H5         U   5 -11.556 -14.806  28.588
   54    H6     U   5           H6         U   5 -10.326 -13.269  30.000
   55    H5'    G   6           H5'        G   6  -5.383 -10.113  26.419
   56   H5''    G   6          H5''        G   6  -6.461 -11.218  27.297
   57    H4'    G   6           H4'        G   6  -3.522 -11.643  27.692
   58    H3'    G   6           H3'        G   6  -4.925 -11.679  25.052
   59    H2'    G   6          H2''        G   6  -4.511 -13.884  24.552
   60   HO2'    G   6          H2'         G   6  -2.285 -13.738  26.320
   61    H1'    G   6           H1'        G   6  -4.259 -14.994  27.108
   62    H8     G   6           H8         G   6  -7.566 -13.284  27.049
   63    H1     G   6           H1         G   6  -7.508 -18.515  23.346
   64    H21    G   6           H21        G   6  -5.448 -19.262  23.116
   65    H22    G   6           H22        G   6  -4.062 -18.383  23.720
   66    H5'    A   7           H5'        A   7  -0.645 -11.740  23.095
   67   H5''    A   7          H5''        A   7  -1.099 -10.988  21.553
   68    H4'    A   7           H4'        A   7  -0.420 -13.562  21.648
   69    H3'    A   7           H3'        A   7  -2.487 -12.034  20.100
   70    H2'    A   7          H2''        A   7  -3.670 -13.879  19.418
   71   HO2'    A   7          H2'         A   7  -2.595 -15.379  18.443
   72    H1'    A   7           H1'        A   7  -2.897 -15.745  21.410
   73    H8     A   7           H8         A   7  -4.715 -12.677  22.736
   74    H61    A   7           H61        A   7  -9.969 -15.622  21.325
   75    H62    A   7           H62        A   7  -9.258 -14.300  22.224
   76    H2     A   7           H2         A   7  -6.557 -17.932  19.554
   77    H5'    U   8           H5'        U   8  -0.123 -15.027  17.325
   78   H5''    U   8          H5''        U   8  -0.175 -14.317  15.700
   79    H4'    U   8           H4'        U   8  -0.982 -16.757  15.909
   80    H3'    U   8           H3'        U   8  -2.341 -14.410  14.628
   81    H2'    U   8          H2''        U   8  -4.378 -15.453  14.342
   82   HO2'    U   8          H2'         U   8  -2.974 -17.924  14.463
   83    H1'    U   8           H1'        U   8  -4.319 -17.297  16.456
   84    H3     U   8           H3         U   8  -8.112 -14.951  17.204
   85    H5     U   8           H5         U   8  -5.049 -12.140  17.877
   86    H6     U   8           H6         U   8  -3.457 -13.778  17.074
   87    H5'    U   9           H5'        U   9  -2.660 -17.322  11.389
   88   H5''    U   9          H5''        U   9  -2.344 -16.484   9.856
   89    H4'    U   9           H4'        U   9  -4.644 -17.459   9.930
   90    H3'    U   9           H3'        U   9  -4.029 -14.530   9.699
   91    H2'    U   9          H2''        U   9  -6.171 -13.820  10.090
   92   HO2'    U   9          H2'         U   9  -6.912 -16.246   8.829
   93    H1'    U   9           H1'        U   9  -7.228 -16.136  11.387
   94    H3     U   9           H3         U   9  -8.731 -12.889  14.091
   95    H5     U   9           H5         U   9  -4.547 -12.421  14.275
   96    H6     U   9           H6         U   9  -4.345 -14.157  12.592
   97    H5'    G  10           H5'        G  10  -7.036 -16.106   6.101
   98   H5''    G  10          H5''        G  10  -6.568 -14.979   4.812
   99    H4'    G  10           H4'        G  10  -9.081 -15.260   5.114
  100    H3'    G  10           H3'        G  10  -7.528 -12.683   5.245
  101    H2'    G  10          H2''        G  10  -9.378 -11.408   5.855
  102   HO2'    G  10          H2'         G  10 -11.144 -11.767   4.796
  103    H1'    G  10           H1'        G  10 -10.680 -13.225   7.472
  104    H8     G  10           H8         G  10  -7.035 -13.308   8.372
  105    H1     G  10           H1         G  10  -9.954  -7.982  10.420
  106    H21    G  10           H21        G  10 -11.973  -7.837   9.542
  107    H22    G  10           H22        G  10 -12.539  -8.949   8.316
  108    H5'    U  11           H5'        U  11 -10.555 -11.715   2.022
  109   H5''    U  11          H5''        U  11  -9.915 -10.296   1.171
  110    H4'    U  11           H4'        U  11 -12.054 -10.084   2.751
  111    H3'    U  11           H3'        U  11  -9.685  -8.277   2.285
  112    H2'    U  11          H2''        U  11 -10.276  -6.819   3.985
  113   HO2'    U  11          H2'         U  11 -12.918  -7.862   3.792
  114    H1'    U  11           H1'        U  11 -11.574  -8.634   5.706
  115    H3     U  11           H3         U  11  -8.212  -6.276   7.819
  116    H5     U  11           H5         U  11  -6.399  -9.662   6.089
  117    H6     U  11           H6         U  11  -8.453 -10.056   4.860
  118    H5'    A  12           H5'        A  12 -12.724  -5.217   0.253
  119   H5''    A  12          H5''        A  12 -11.464  -4.161  -0.417
  120    H4'    A  12           H4'        A  12 -12.926  -3.386   1.686
  121    H3'    A  12           H3'        A  12  -9.969  -3.093   1.100
  122    H2'    A  12          H2''        A  12  -9.657  -1.893   3.114
  123   HO2'    A  12          H2'         A  12 -12.486  -1.918   3.463
  124    H1'    A  12           H1'        A  12 -11.088  -3.616   4.686
  125    H8     A  12           H8         A  12  -9.408  -5.853   2.197
  126    H61    A  12           H61        A  12  -4.071  -4.828   5.145
  127    H62    A  12           H62        A  12  -4.868  -5.748   3.890
  128    H2     A  12           H2         A  12  -7.108  -1.927   6.717
  129    H5'    U  13           H5'        U  13 -10.404   1.246   1.224
  130   H5''    U  13          H5''        U  13  -9.121   1.750   0.107
  131    H4'    U  13           H4'        U  13  -8.802   2.124   2.697
  132    H3'    U  13           H3'        U  13  -6.893   1.094   0.596
  133    H2'    U  13          H2''        U  13  -5.220   0.623   2.186
  134   HO2'    U  13          H2'         U  13  -5.177   1.594   4.212
  135    H1'    U  13           H1'        U  13  -6.807  -0.183   4.283
  136    H3     U  13           H3         U  13  -3.792  -3.250   2.404
  137    H5     U  13           H5         U  13  -7.535  -3.872   0.573
  138    H6     U  13           H6         U  13  -8.317  -1.834   1.626
  139    H5'    U  14           H5'        U  14  -4.631   4.435   1.896
  140   H5''    U  14          H5''        U  14  -4.082   5.422   0.526
  141    H4'    U  14           H4'        U  14  -2.129   4.569   1.746
  142    H3'    U  14           H3'        U  14  -2.818   3.469  -0.985
  143    H2'    U  14          H2''        U  14  -1.054   1.972  -0.947
  144   HO2'    U  14          H2'         U  14   0.571   3.473  -0.483
  145    H1'    U  14           H1'        U  14  -0.941   1.560   1.850
  146    H3     U  14           H3         U  14  -1.167  -2.451  -0.341
  147    H5     U  14           H5         U  14  -5.111  -0.963  -0.359
  148    H6     U  14           H6         U  14  -4.257   1.131   0.521
  149    H5'    A  15           H5'        A  15   1.002   6.506  -1.384
  150   H5''    A  15          H5''        A  15   1.585   6.478  -3.060
  151    H4'    A  15           H4'        A  15   3.122   5.591  -1.059
  152    H3'    A  15           H3'        A  15   2.709   4.713  -3.899
  153    H2'    A  15          H2''        A  15   3.750   2.675  -3.663
  154   HO2'    A  15          H2'         A  15   5.675   2.759  -2.857
  155    H1'    A  15           H1'        A  15   3.318   2.181  -0.930
  156    H8     A  15           H8         A  15   0.080   2.851  -2.796
  157    H61    A  15           H61        A  15   0.271  -3.058  -4.585
  158    H62    A  15           H62        A  15  -0.741  -1.642  -4.398
  159    H2     A  15           H2         A  15   4.280  -1.987  -2.897
  160    H5'    U  16           H5'        U  16   7.307   4.744  -2.943
  161   H5''    U  16          H5''        U  16   8.076   5.150  -4.491
  162    H4'    U  16           H4'        U  16   8.948   3.028  -3.350
  163    H3'    U  16           H3'        U  16   7.885   3.314  -6.149
  164    H2'    U  16          H2''        U  16   7.887   1.050  -6.585
  165   HO2'    U  16          H2'         U  16  10.220   1.113  -5.595
  166    H1'    U  16           H1'        U  16   7.555   0.048  -3.973
  167    H3     U  16           H3         U  16   4.296  -1.834  -6.532
  168    H5     U  16           H5         U  16   3.025   2.132  -5.943
  169    H6     U  16           H6         U  16   5.228   2.639  -5.076
  170    H5'    U  17           H5'        U  17  11.725   1.057  -6.952
  171   H5''    U  17          H5''        U  17  12.261   1.740  -8.500
  172    H4'    U  17           H4'        U  17  11.812  -0.784  -8.501
  173    H3'    U  17           H3'        U  17  10.635   1.294 -10.339
  174    H2'    U  17          H2''        U  17   9.132  -0.149 -11.292
  175   HO2'    U  17          H2'         U  17  11.113  -2.102 -10.780
  176    H1'    U  17           H1'        U  17   9.030  -2.134  -9.235
  177    H3     U  17           H3         U  17   4.751  -1.449 -10.568
  178    H5     U  17           H5         U  17   5.788   2.105  -8.553
  179    H6     U  17           H6         U  17   8.069   1.288  -8.426
  180    H5'    A  18           H5'        A  18  12.595  -2.411 -12.716
  181   H5''    A  18          H5''        A  18  12.978  -1.715 -14.302
  182    H4'    A  18           H4'        A  18  11.652  -3.907 -14.346
  183    H3'    A  18           H3'        A  18  10.871  -1.301 -15.658
  184    H2'    A  18          H2''        A  18   8.829  -2.110 -16.340
  185   HO2'    A  18          H2'         A  18  10.018  -4.692 -16.273
  186    H1'    A  18           H1'        A  18   8.522  -4.190 -14.403
  187    H8     A  18           H8         A  18   8.634  -0.658 -12.998
  188    H61    A  18           H61        A  18   2.651  -0.226 -14.489
  189    H62    A  18           H62        A  18   3.945   0.460 -13.532
  190    H2     A  18           H2         A  18   4.248  -4.053 -16.211
  191    H5'    A  19           H5'        A  19  10.258  -4.668 -18.511
  192   H5''    A  19          H5''        A  19  10.977  -4.144 -20.046
  193    H4'    A  19           H4'        A  19   8.749  -5.049 -20.485
  194    H3'    A  19           H3'        A  19   9.216  -2.070 -20.703
  195    H2'    A  19          H2''        A  19   6.989  -1.636 -21.115
  196   HO2'    A  19          H2'         A  19   6.027  -2.733 -22.614
  197    H1'    A  19           H1'        A  19   5.879  -3.978 -19.897
  198    H8     A  19           H8         A  19   7.783  -1.437 -17.720
  199    H61    A  19           H61        A  19   2.340   1.414 -17.063
  200    H62    A  19           H62        A  19   3.974   1.279 -16.452
  201    H2     A  19           H2         A  19   1.819  -1.924 -20.013
  202    H5'    A  20           H5'        A  20   7.436  -3.418 -25.058
  203   H5''    A  20          H5''        A  20   7.784  -1.917 -25.937
  204    H4'    A  20           H4'        A  20   5.273  -2.765 -25.641
  205    H3'    A  20           H3'        A  20   6.522  -0.025 -25.570
  206    H2'    A  20          H2''        A  20   4.629   1.010 -24.765
  207   HO2'    A  20          H2'         A  20   3.202  -1.100 -26.020
  208    H1'    A  20           H1'        A  20   3.368  -1.206 -23.514
  209    H8     A  20           H8         A  20   6.874   0.063 -22.434
  210    H61    A  20           H61        A  20   3.821   3.559 -18.351
  211    H62    A  20           H62        A  20   5.395   3.078 -18.943
  212    H2     A  20           H2         A  20   0.805   1.593 -21.025
  213    H5'    U  21           H5'        U  21   2.788   0.653 -28.316
  214   H5''    U  21          H5''        U  21   3.267   2.156 -29.128
  215    H4'    U  21           H4'        U  21   1.188   2.124 -27.458
  216    H3'    U  21           H3'        U  21   3.381   4.133 -27.940
  217    H2'    U  21          H2''        U  21   2.823   5.436 -26.111
  218   HO2'    U  21          H2'         U  21   0.245   4.499 -26.671
  219    H1'    U  21           H1'        U  21   1.648   3.465 -24.464
  220    H3     U  21           H3         U  21   4.821   5.470 -21.911
  221    H5     U  21           H5         U  21   7.027   3.351 -24.811
  222    H6     U  21           H6         U  21   4.934   2.747 -25.870
  223    H5'    U  22           H5'        U  22  -0.740   6.148 -28.149
  224   H5''    U  22          H5''        U  22  -0.656   7.454 -29.348
  225    H4'    U  22           H4'        U  22  -1.581   8.094 -27.024
  226    H3'    U  22           H3'        U  22   0.694   9.394 -28.539
  227    H2'    U  22          H2''        U  22   1.402  10.618 -26.762
  228   HO2'    U  22          H2'         U  22  -1.342  10.814 -26.030
  229    H1'    U  22           H1'        U  22  -0.192   9.266 -24.738
  230    H3     U  22           H3         U  22   3.841  11.023 -23.131
  231    H5     U  22           H5         U  22   4.476   7.035 -24.317
  232    H6     U  22           H6         U  22   2.356   7.130 -25.518
  233    H5'    A  23           H5'        A  23   1.519  12.632 -29.545
  234   H5''    A  23          H5''        A  23   1.837  11.947 -27.942
  235    H4'    A  23           H4'        A  23   2.602  14.402 -28.407
  236    H3'    A  23           H3'        A  23   1.567  13.030 -26.084
  237    H2'    A  23          H2''        A  23  -0.219  14.360 -25.563
  238   HO2'    A  23          H2'         A  23   0.275  16.184 -24.493
  239    H1'    A  23           H1'        A  23   0.212  16.672 -27.268
  240    H8     A  23           H8         A  23  -1.651  13.985 -28.920
  241    H61    A  23           H61        A  23  -6.682  15.409 -25.616
  242    H62    A  23           H62        A  23  -6.059  14.488 -26.966
  243    H2     A  23           H2         A  23  -3.179  17.524 -23.794
  244    H5'    A  24           H5'        A  24   4.646  14.393 -22.887
  245   H5''    A  24          H5''        A  24   3.973  13.027 -21.978
  246    H4'    A  24           H4'        A  24   3.012  15.733 -22.074
  247    H3'    A  24           H3'        A  24   2.343  13.080 -20.820
  248    H2'    A  24          H2''        A  24   0.124  13.565 -20.539
  249   HO2'    A  24          H2'         A  24   0.915  16.274 -20.138
  250    H1'    A  24           H1'        A  24   0.031  15.902 -22.293
  251    H8     A  24           H8         A  24   0.131  12.772 -24.257
  252    H61    A  24           H61        A  24  -5.914  12.071 -23.169
  253    H62    A  24           H62        A  24  -4.536  11.488 -24.077
  254    H2     A  24           H2         A  24  -4.367  15.271 -20.433
  255    H5'    U  25           H5'        U  25   2.024  11.821 -18.497
  256   H5''    U  25          H5''        U  25   1.150  13.358 -18.640
  257    H4'    U  25           H4'        U  25   1.453  11.647 -16.138
  258    H3'    U  25           H3'        U  25  -0.342  11.567 -18.259
  259    H2'    U  25          H2''        U  25  -1.433  13.597 -17.982
  260   HO2'    U  25          H2'         U  25  -3.301  13.099 -17.156
  261    H1'    U  25           H1'        U  25  -1.135  13.640 -15.016
  262    H3     U  25           H3         U  25  -2.127  17.990 -14.766
  263    H5     U  25           H5         U  25  -0.481  17.656 -18.630
  264    H6     U  25           H6         U  25  -0.125  15.294 -18.209
  265    H5'    U  26           H5'        U  26  -2.012  11.869 -19.128
  266   H5''    U  26          H5''        U  26  -3.494  11.000 -18.692
  267    H4'    U  26           H4'        U  26  -3.540  11.162 -21.093
  268    H3'    U  26           H3'        U  26  -2.802   8.591 -19.788
  269    H2'    U  26          H2''        U  26  -1.760   7.589 -21.560
  270   HO2'    U  26          H2'         U  26  -3.647   7.745 -22.875
  271    H1'    U  26           H1'        U  26  -0.967   9.801 -23.095
  272    H3     U  26           H3         U  26   2.557   6.963 -22.130
  273    H5     U  26           H5         U  26   2.291   9.672 -18.917
  274    H6     U  26           H6         U  26   0.194  10.462 -19.832
  275    H5'    C  27           H5'        C  27  -6.211   6.971 -21.963
  276   H5''    C  27          H5''        C  27  -7.105   5.890 -20.877
  277    H4'    C  27           H4'        C  27  -5.782   4.601 -22.539
  278    H3'    C  27           H3'        C  27  -5.206   4.579 -19.580
  279    H2'    C  27          H2''        C  27  -3.258   3.366 -19.773
  280   HO2'    C  27          H2'         C  27  -4.402   2.308 -22.151
  281    H1'    C  27           H1'        C  27  -2.596   4.011 -22.469
  282    H41    C  27           H41        C  27   2.135   6.366 -18.947
  283    H42    C  27           H42        C  27   1.014   7.160 -17.863
  284    H5     C  27           H5         C  27  -1.372   6.848 -17.993
  285    H6     C  27           H6         C  27  -3.208   6.003 -19.372
  286    H5'    U  28           H5'        U  28  -7.340  -0.009 -20.427
  287   H5''    U  28          H5''        U  28  -6.885  -0.875 -18.945
  288    H4'    U  28           H4'        U  28  -5.998  -1.651 -21.380
  289    H3'    U  28           H3'        U  28  -4.615  -1.553 -18.680
  290    H2'    U  28          H2''        U  28  -2.671  -2.491 -19.620
  291   HO2'    U  28          H2'         U  28  -4.163  -2.990 -21.999
  292    H1'    U  28           H1'        U  28  -2.733  -0.939 -21.939
  293    H3     U  28           H3         U  28   0.781  -0.019 -19.047
  294    H5     U  28           H5         U  28  -2.476   2.285 -17.724
  295    H6     U  28           H6         U  28  -3.877   1.115 -19.304
  296    H5'    U  29           H5'        U  29  -3.636  -5.170 -20.121
  297   H5''    U  29          H5''        U  29  -4.016  -6.511 -19.022
  298    H4'    U  29           H4'        U  29  -1.671  -6.672 -19.757
  299    H3'    U  29           H3'        U  29  -2.393  -5.994 -16.909
  300    H2'    U  29          H2''        U  29  -0.220  -5.572 -16.287
  301   HO2'    U  29          H2'         U  29   1.412  -6.791 -16.911
  302    H1'    U  29           H1'        U  29   0.859  -4.873 -18.815
  303    H3     U  29           H3         U  29   2.142  -1.757 -15.741
  304    H5     U  29           H5         U  29  -1.912  -0.903 -16.503
  305    H6     U  29           H6         U  29  -2.027  -2.937 -17.816
  306    H5'    A  30           H5'        A  30   0.812  -9.429 -16.903
  307   H5''    A  30          H5''        A  30   0.490 -10.273 -15.376
  308    H4'    A  30           H4'        A  30   2.898  -9.388 -15.760
  309    H3'    A  30           H3'        A  30   1.112  -8.977 -13.360
  310    H2'    A  30          H2''        A  30   2.592  -7.542 -12.350
  311   HO2'    A  30          H2'         A  30   4.616  -8.929 -13.784
  312    H1'    A  30           H1'        A  30   4.028  -6.699 -14.687
  313    H8     A  30           H8         A  30   0.364  -5.666 -14.525
  314    H61    A  30           H61        A  30   2.244  -0.911 -11.048
  315    H62    A  30           H62        A  30   0.937  -1.553 -12.018
  316    H2     A  30           H2         A  30   5.714  -3.702 -11.591
  317    H5'    A  31           H5'        A  31   5.112 -11.396 -11.475
  318   H5''    A  31          H5''        A  31   4.340 -11.722  -9.912
  319    H4'    A  31           H4'        A  31   6.618 -10.339 -10.040
  320    H3'    A  31           H3'        A  31   4.145  -9.976  -8.338
  321    H2'    A  31          H2''        A  31   4.946  -8.019  -7.399
  322   HO2'    A  31          H2'         A  31   6.964  -7.820  -6.825
  323    H1'    A  31           H1'        A  31   6.505  -7.113  -9.565
  324    H8     A  31           H8         A  31   2.890  -7.786 -10.522
  325    H61    A  31           H61        A  31   1.609  -2.200  -8.198
  326    H62    A  31           H62        A  31   1.028  -3.504  -9.209
  327    H2     A  31           H2         A  31   5.833  -3.237  -7.100
  328    H5'    U  32           H5'        U  32   7.965 -10.259  -5.560
  329   H5''    U  32          H5''        U  32   7.324 -10.529  -3.928
  330    H4'    U  32           H4'        U  32   8.789  -8.369  -4.468
  331    H3'    U  32           H3'        U  32   6.319  -8.761  -2.779
  332    H2'    U  32          H2''        U  32   6.080  -6.494  -2.370
  333   HO2'    U  32          H2'         U  32   7.745  -5.146  -2.134
  334    H1'    U  32           H1'        U  32   7.251  -5.495  -4.733
  335    H3     U  32           H3         U  32   3.110  -3.613  -4.163
  336    H5     U  32           H5         U  32   2.390  -7.438  -5.778
  337    H6     U  32           H6         U  32   4.736  -7.952  -5.443
  338    H5'    A  33           H5'        A  33   9.049  -6.363  -0.198
  339   H5''    A  33          H5''        A  33   8.486  -6.611   1.465
  340    H4'    A  33           H4'        A  33   8.259  -4.224   0.324
  341    H3'    A  33           H3'        A  33   6.416  -5.797   2.113
  342    H2'    A  33          H2''        A  33   4.624  -4.405   1.777
  343   HO2'    A  33          H2'         A  33   4.800  -2.245   1.749
  344    H1'    A  33           H1'        A  33   5.479  -3.160  -0.666
  345    H8     A  33           H8         A  33   4.662  -6.787  -1.212
  346    H61    A  33           H61        A  33  -1.293  -5.136  -1.391
  347    H62    A  33           H62        A  33  -0.130  -6.366  -1.831
  348    H2     A  33           H2         A  33   1.077  -1.648   0.137
  349    H5'    A  34           H5'        A  34   6.088  -1.541   3.326
  350   H5''    A  34          H5''        A  34   6.963  -1.561   4.869
  351    H4'    A  34           H4'        A  34   5.173  -0.196   5.459
  352    H3'    A  34           H3'        A  34   4.631  -3.098   5.959
  353    H2'    A  34          H2''        A  34   2.357  -2.903   6.163
  354   HO2'    A  34          H2'         A  34   2.567  -1.472   7.954
  355    H1'    A  34           H1'        A  34   1.927  -0.436   4.813
  356    H8     A  34           H8         A  34   3.367  -3.392   2.822
  357    H61    A  34           H61        A  34  -2.503  -4.854   1.590
  358    H62    A  34           H62        A  34  -0.827  -5.228   1.260
  359    H2     A  34           H2         A  34  -2.491  -1.346   4.385
  360    H5'    C  35           H5'        C  35   3.129  -3.857  10.330
  361   H5''    C  35          H5''        C  35   2.594  -5.157   9.246
  362    H4'    C  35           H4'        C  35   1.374  -2.363   9.183
  363    H3'    C  35           H3'        C  35   1.261  -4.204  11.306
  364    H2'    C  35          H2''        C  35   0.052  -5.893  10.339
  365   HO2'    C  35          H2'         C  35  -1.975  -3.928  10.679
  366    H1'    C  35           H1'        C  35  -1.471  -4.258   8.404
  367    H41    C  35           H41        C  35  -1.640 -10.129   5.960
  368    H42    C  35           H42        C  35   0.108 -10.206   5.934
  369    H5     C  35           H5         C  35   1.518  -8.420   6.725
  370    H6     C  35           H6         C  35   1.560  -6.223   7.815
  371    H5'    U  36           H5'        U  36  -0.163   0.610  12.172
  372   H5''    U  36          H5''        U  36  -0.874   0.661  13.798
  373    H4'    U  36           H4'        U  36  -2.484   1.856  12.598
  374    H3'    U  36           H3'        U  36  -3.057  -1.083  12.765
  375    H2'    U  36          H2''        U  36  -4.604  -1.126  11.082
  376   HO2'    U  36          H2'         U  36  -5.193   1.565  11.797
  377    H1'    U  36           H1'        U  36  -3.934   1.292   9.719
  378    H3     U  36           H3         U  36  -4.827  -2.221   6.848
  379    H5     U  36           H5         U  36  -0.748  -2.480   7.849
  380    H6     U  36           H6         U  36  -1.133  -0.880   9.613
  381    H5'    A  37           H5'        A  37  -7.010   0.976  15.233
  382   H5''    A  37          H5''        A  37  -7.750  -0.553  15.744
  383    H4'    A  37           H4'        A  37  -9.108   1.175  14.228
  384    H3'    A  37           H3'        A  37  -8.937  -1.836  14.231
  385    H2'    A  37          H2''        A  37 -10.221  -2.066  12.300
  386   HO2'    A  37          H2'         A  37 -10.951   0.670  12.625
  387    H1'    A  37           H1'        A  37  -9.176   0.002  10.847
  388    H8     A  37           H8         A  37  -6.187  -1.434  12.527
  389    H61    A  37           H61        A  37  -6.488  -6.278   8.731
  390    H62    A  37           H62        A  37  -5.461  -5.335   9.788
  391    H2     A  37           H2         A  37 -10.314  -3.961   8.314
  392    H5'    C  38           H5'        C  38 -12.830  -0.760  13.623
  393   H5''    C  38          H5''        C  38 -13.982  -1.286  14.868
  394    H4'    C  38           H4'        C  38 -15.024  -1.726  12.735
  395    H3'    C  38           H3'        C  38 -13.903  -4.015  14.324
  396    H2'    C  38          H2''        C  38 -14.205  -5.596  12.649
  397   HO2'    C  38          H2'         C  38 -16.025  -5.593  11.625
  398    H1'    C  38           H1'        C  38 -13.730  -4.045  10.415
  399    H41    C  38           H41        C  38  -8.409  -7.400  11.483
  400    H42    C  38           H42        C  38  -7.976  -6.334  12.800
  401    H5     C  38           H5         C  38  -9.317  -4.449  13.454
  402    H6     C  38           H6         C  38 -11.471  -3.325  13.169
  403    H5'    A  39           H5'        A  39 -18.090  -5.846  14.381
  404   H5''    A  39          H5''        A  39 -17.788  -7.066  15.634
  405    H4'    A  39           H4'        A  39 -17.854  -7.735  13.036
  406    H3'    A  39           H3'        A  39 -16.023  -8.634  15.267
  407    H2'    A  39          H2''        A  39 -14.911 -10.088  13.803
  408   HO2'    A  39          H2'         A  39 -17.049  -9.667  11.967
  409    H1'    A  39           H1'        A  39 -14.925  -8.357  11.593
  410    H8     A  39           H8         A  39 -13.849  -6.330  14.546
  411    H61    A  39           H61        A  39  -8.338  -9.106  14.206
  412    H62    A  39           H62        A  39  -9.215  -7.723  14.821
  413    H2     A  39           H2         A  39 -11.163 -11.298  11.503
  414    H5'    A  40           H5'        A  40 -19.136 -11.732  14.045
  415   H5''    A  40          H5''        A  40 -19.507 -13.073  15.147
  416    H4'    A  40           H4'        A  40 -18.682 -13.862  12.911
  417    H3'    A  40           H3'        A  40 -17.405 -14.406  15.563
  418    H2'    A  40          H2''        A  40 -15.407 -15.181  14.746
  419   HO2'    A  40          H2'         A  40 -16.857 -15.947  12.425
  420    H1'    A  40           H1'        A  40 -15.340 -13.961  12.208
  421    H8     A  40           H8         A  40 -15.671 -11.675  15.286
  422    H61    A  40           H61        A  40  -9.496 -11.705  15.462
  423    H62    A  40           H62        A  40 -10.949 -10.921  16.043
  424    H2     A  40           H2         A  40 -10.813 -14.626  12.320
  425    H5'    A  41           H5'        A  41 -17.710 -19.013  14.233
  426   H5''    A  41          H5''        A  41 -17.659 -19.657  15.886
  427    H4'    A  41           H4'        A  41 -15.676 -20.165  14.187
  428    H3'    A  41           H3'        A  41 -15.760 -19.571  17.126
  429    H2'    A  41          H2''        A  41 -13.515 -19.136  17.327
  430   HO2'    A  41          H2'         A  41 -13.148 -20.903  15.128
  431    H1'    A  41           H1'        A  41 -12.877 -18.574  14.601
  432    H8     A  41           H8         A  41 -15.259 -16.199  16.466
  433    H61    A  41           H61        A  41 -10.158 -13.121  18.121
  434    H62    A  41           H62        A  41 -11.902 -13.057  18.006
  435    H2     A  41           H2         A  41  -8.896 -16.899  16.058
  436    H5'    U  42           H5'        U  42 -13.186 -23.069  15.565
  437   H5''    U  42          H5''        U  42 -13.144 -24.408  16.729
  438    H4'    U  42           H4'        U  42 -10.873 -23.948  15.788
  439    H3'    U  42           H3'        U  42 -11.575 -23.398  18.682
  440    H2'    U  42          H2''        U  42  -9.438 -22.614  19.173
  441   HO2'    U  42          H2'         U  42  -7.637 -23.216  18.094
  442    H1'    U  42           H1'        U  42  -8.892 -21.443  16.684
  443    H3     U  42           H3         U  42  -8.691 -17.898  19.474
  444    H5     U  42           H5         U  42 -12.746 -19.015  19.588
  445    H6     U  42           H6         U  42 -12.184 -20.959  18.262
  446    H5'    U  43           H5'        U  43  -7.840 -25.359  18.775
  447   H5''    U  43          H5''        U  43  -7.673 -26.382  20.217
  448    H4'    U  43           H4'        U  43  -5.973 -24.525  20.142
  449    H3'    U  43           H3'        U  43  -8.105 -24.830  22.252
  450    H2'    U  43          H2''        U  43  -7.570 -22.846  23.324
  451   HO2'    U  43          H2'         U  43  -5.015 -23.082  22.086
  452    H1'    U  43           H1'        U  43  -6.598 -21.407  21.106
  453    H3     U  43           H3         U  43  -9.890 -18.636  22.373
  454    H5     U  43           H5         U  43 -11.922 -22.278  21.768
  455    H6     U  43           H6         U  43  -9.786 -23.310  21.261
  456    H5'    A  44           H5'        A  44  -3.191 -25.708  24.474
  457   H5''    A  44          H5''        A  44  -4.011 -25.990  26.022
  458    H4'    A  44           H4'        A  44  -1.870 -24.409  25.902
  459    H3'    A  44           H3'        A  44  -4.464 -24.195  27.420
  460    H2'    A  44          H2''        A  44  -3.969 -22.074  28.257
  461   HO2'    A  44          H2'         A  44  -2.006 -21.482  28.761
  462    H1'    A  44           H1'        A  44  -2.689 -21.027  26.034
  463    H8     A  44           H8         A  44  -5.659 -22.618  24.545
  464    H61    A  44           H61        A  44  -9.186 -18.196  27.010
  465    H62    A  44           H62        A  44  -9.136 -19.561  25.917
  466    H2     A  44           H2         A  44  -5.080 -17.839  28.778
  467    H5'    A  45           H5'        A  45  -1.662 -23.006  30.173
  468   H5''    A  45          H5''        A  45  -1.899 -23.742  31.770
  469    H4'    A  45           H4'        A  45  -1.941 -21.227  31.833
  470    H3'    A  45           H3'        A  45  -4.192 -23.038  32.659
  471    H2'    A  45          H2''        A  45  -5.748 -21.366  32.846
  472   HO2'    A  45          H2'         A  45  -5.282 -19.378  33.662
  473    H1'    A  45           H1'        A  45  -4.526 -19.376  31.205
  474    H8     A  45           H8         A  45  -5.557 -22.495  29.308
  475    H61    A  45           H61        A  45 -11.276 -20.147  29.172
  476    H62    A  45           H62        A  45 -10.203 -21.367  28.523
  477    H2     A  45           H2         A  45  -8.809 -17.636  31.951
  478    H5'    G  46           H5'        G  46  -2.410 -21.271  37.063
  479   H5''    G  46          H5''        G  46  -3.542 -22.036  38.194
  480    H4'    G  46           H4'        G  46  -3.396 -19.372  37.991
  481    H3'    G  46           H3'        G  46  -5.647 -21.298  38.462
  482    H2'    G  46          H2''        G  46  -7.347 -19.777  38.075
  483   HO2'    G  46          H2'         G  46  -7.161 -17.977  39.124
  484    H1'    G  46           H1'        G  46  -6.152 -18.131  36.178
  485    H8     G  46           H8         G  46  -5.622 -21.669  35.078
  486    H1     G  46           H1         G  46 -11.653 -19.678  34.225
  487    H21    G  46           H21        G  46 -11.976 -17.764  35.272
  488    H22    G  46           H22        G  46 -10.775 -17.070  36.339
  489    H5'    C  47           H5'        C  47  -6.858 -18.007  41.257
  490   H5''    C  47          H5''        C  47  -7.169 -18.884  42.769
  491    H4'    C  47           H4'        C  47  -9.132 -17.507  42.072
  492    H3'    C  47           H3'        C  47  -9.138 -20.499  42.317
  493    H2'    C  47          H2''        C  47 -11.177 -20.807  41.301
  494   HO2'    C  47          H2'         C  47 -12.867 -19.465  41.585
  495    H1'    C  47           H1'        C  47 -11.335 -18.446  39.749
  496    H41    C  47           H41        C  47 -11.051 -23.185  35.536
  497    H42    C  47           H42        C  47  -9.460 -23.650  36.091
  498    H5     C  47           H5         C  47  -8.267 -22.446  37.809
  499    H6     C  47           H6         C  47  -8.474 -20.777  39.591
  500    H5'    C  48           H5'        C  48 -13.052 -19.339  43.882
  501   H5''    C  48          H5''        C  48 -13.380 -20.406  45.263
  502    H4'    C  48           H4'        C  48 -15.116 -20.598  43.445
  503    H3'    C  48           H3'        C  48 -13.298 -22.865  44.267
  504   HO3'    C  48          H3T         C  48 -16.073 -22.292  44.620
  505    H2'    C  48          H2''        C  48 -14.153 -24.289  42.687
  506   HO2'    C  48          H2'         C  48 -16.512 -22.693  42.704
  507    H1'    C  48           H1'        C  48 -15.056 -22.287  40.836
  508    H41    C  48           H41        C  48 -10.680 -25.633  37.679
  509    H42    C  48           H42        C  48  -9.448 -25.226  38.852
  510    H5     C  48           H5         C  48  -9.865 -23.823  40.767
  511    H6     C  48           H6         C  48 -11.582 -22.645  42.058