*HEADER    RNA                                     01-SEP-03   1QWB              
*TITLE     NMR STRUCUTRE OF 5'-R(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : AN             
*TITLE    2 RNA HAIRPIN CONTAINING THE IN VITRO SELECTED CONSENSUS               
*TITLE    3 SEQUENCE FOR NUCLEOLIN RBD12                                         
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: SNRE26;                                                    
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 ENGINEERED: YES;                                                     
*COMPND   5 OTHER_DETAILS: RNA CONTAINS THE CONSENSUS SEQUENCE FOR THE           
*COMPND   6 IN VITRO SELECTED NRE.                                               
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES;                                                      
*SOURCE   3 OTHER_DETAILS: RNA WAS PREPARED BY IN VITRO TRANSCRIPTION            
*SOURCE   4 WITH T7 RNA POLYMERASE                                               
*KEYWDS    A-FORM HELIX, LOOP E MOTIF, S-TURN, DISORDERED HAIRPIN LOOP           
*EXPDTA    NMR, 17 STRUCTURES                                                    
*AUTHOR    L.D.FINGER, L.TRANTIREK, C.JOHANSSON, J.FEIGON                        
*REVDAT   1   25-NOV-03 1QWB    0                                                

!G1 INTRA
assign (resid   1 and  name   H1')(resid   1 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   1 and  name   H2')(resid   1 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   1 and  name    H8)(resid   1 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   1 and  name    H8)(resid   1 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   1 and  name    H8)(resid   1 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   1 and  name    H8)(resid   1 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid   1 and  name   H2')(resid   1 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   1 and  name    H8)(resid   1 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   1 and  name   H1')(resid   1 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   1 and  name   H2')(resid   1 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid   1 and  name   H1')(resid   1 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid   1 and  name   H1')(resid   1 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   1 and  name   H2')(resid   1 and  name   H5'*) 4.5 1.0 1.0 !M
!G1 INTER
assign (resid   1 and  name    H8)(resid   2 and  name    H8) 3.7 1.9 1.9 !VW
assign (resid   1 and  name   H2')(resid   2 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   1 and  name   H2')(resid   2 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   1 and  name   H2')(resid   2 and  name   H5'*) 4.5 1.0 1.0 !W
!G2INTRA
assign (resid   2 and  name    H8)(resid   2 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   2 and  name    H8)(resid   2 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid   2 and  name    H8)(resid   2 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid   2 and  name    H8)(resid   2 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   2 and  name   H1')(resid   2 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   2 and  name    H8)(resid   2 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid   2 and  name   H1')(resid   2 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   2 and  name   H1')(resid   2 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid   2 and  name   H1')(resid   2 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   2 and  name    H8)(resid   2 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   2 and  name   H1')(resid   2 and  name   H5'*) 4.5 1.0 1.0 !VW
!G2INTER
assign (resid   2 and  name    H8)(resid   1 and  name   H2') 2.4 0.6 0.6 !S
assign (resid   2 and  name    H8)(resid   1 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   2 and  name   H1')(resid   1 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   2 and  name    H8)(resid   1 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   2 and  name   H1')(resid   1 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid   2 and  name   H1')(resid   3 and  name   H5'*) 4.4 1.4 2.6 !VW
!A3INTRA
assign (resid   3 and  name    H8)(resid   3 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   3 and  name    H8)(resid   3 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid   3 and  name   H1')(resid   3 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   3 and  name    H2)(resid   3 and  name   H1') 4.5 1.0 1.0 !W
assign (resid   3 and  name    H8)(resid   3 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   3 and  name    H8)(resid   3 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   3 and  name   H1')(resid   3 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   3 and  name   H1')(resid   3 and  name   H4') 3.75 1.25 1.25 !M
!A3INTER
assign (resid   3 and  name    H2)(resid  25 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   3 and  name    H2)(resid   4 and  name   H1') 3.4 1.6 1.6 !S
assign (resid   3 and  name    H8)(resid   2 and  name    H8) 3.7 1.9 1.9 !VW
assign (resid   3 and  name   H1')(resid   4 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid   3 and  name    H2)(resid  24 and  name   H1') 4.4 1.4 1.6 !VW
assign (resid   3 and  name    H8)(resid   4 and  name    H6) 3.7 1.9 1.9 !VW
assign (resid   3 and  name   H1')(resid   4 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid   3 and  name    H2)(resid   4 and  name    H6) 4.4 1.4 2.6 !VW
assign (resid   3 and  name    H2)(resid   4 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid   3 and  name    H8)(resid   2 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   3 and  name    H8)(resid   3 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid   3 and  name    H8)(resid   4 and  name    H5) 4.5 1.0 1.0 !W
assign (resid   3 and  name    H8)(resid   2 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   3 and  name    H8)(resid   2 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   3 and  name   H1')(resid   4 and  name   H2') 4.4 2.6 2.6 !W
!C4INTRA
assign (resid   4 and  name   H1')(resid   4 and  name   H3') 4.4 2.6 2.6 !VW 
assign (resid   4 and  name   H1')(resid   4 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid   4 and  name    H6)(resid   4 and  name    H5) 2.4 0.6 0.6 !S
assign (resid   4 and  name    H6)(resid   4 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   4 and  name    H5)(resid   4 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid   4 and  name   H1')(resid   4 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   4 and  name    H6)(resid   4 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   4 and  name   H1')(resid   4 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid   4 and  name    H5)(resid   4 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   4 and  name    H5)(resid   4 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   4 and  name    H6)(resid   4 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   4 and  name   H1')(resid   4 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid   4 and  name    H6)(resid   4 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   4 and  name    H6)(resid   4 and  name   H1') 3.75 1.25 1.25 !M
!C4INTER
assign (resid   4 and  name   H1')(resid   3 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   4 and  name    H5)(resid   3 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   4 and  name    H6)(resid   3 and  name   H1') 3.4 1.6 1.6  !M
assign (resid   4 and  name    H5)(resid   3 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid   4 and  name   H1')(resid   3 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid   4 and  name    H6)(resid   3 and  name   H3') 3.4 2.6 2.6 !M
assign (resid   4 and  name    H6)(resid   3 and  name   H2') 2.4 0.6 0.6 !S
assign (resid   4 and  name   H1')(resid   4 and  name   H5'*) 4.4 2.6 2.6 !W
!A5INTRA
assign (resid   5 and  name   H1')(resid   5 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid   5 and  name   H1')(resid   5 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid   5 and  name   H1')(resid   5 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   5 and  name    H2)(resid   5 and  name   H1') 4.5 1.0 1.0 !W
assign (resid   5 and  name   H1')(resid   5 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   5 and  name   H1')(resid   5 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   5 and  name    H2)(resid   5 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H8)(resid   5 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   5 and  name    H8)(resid   5 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   5 and  name    H8)(resid   5 and  name   H3') 4.4 2.6 2.6 
assign (resid   5 and  name    H8)(resid   5 and  name   H5'*) 4.4 2.6 2.6
assign (resid   5 and  name    H8)(resid   5 and  name   H2') 3.75 1.25 1.25 !M
!A5INTER
assign (resid   5 and  name    H2)(resid  22 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H2)(resid  23 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   5 and  name    H8)(resid   4 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   5 and  name   H1')(resid   6 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H8)(resid   6 and  name    H6) 3.7 1.9 1.9 !VW
assign (resid   5 and  name    H8)(resid   6 and  name    H5) 4.5 1.0 1.0 !W
assign (resid   5 and  name   H1')(resid   4 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H2)(resid  22 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H2)(resid   6 and  name    H6) 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H2)(resid   6 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H8)(resid   4 and  name   H2') 2.4 0.6 0.6 !S
assign (resid   5 and  name    H8)(resid   4 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   5 and  name   H1')(resid   6 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid   5 and  name   H1')(resid   4 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   5 and  name    H8)(resid   4 and  name    H5) 3.7 1.9 1.9 
assign (resid   5 and  name   H1')(resid   6 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   5 and  name    H8)(resid   4 and  name    H6) 3.7 1.9 1.9 !VW 
!C6INTRA
assign (resid   6 and  name    H6)(resid   6 and  name    H5) 2.4 0.6 0.6 !S
assign (resid   6 and  name   H1')(resid   6 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   6 and  name   H1')(resid   6 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid   6 and  name   H1')(resid   6 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid   6 and  name    H6)(resid   6 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   6 and  name    H6)(resid   6 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   6 and  name   H1')(resid   6 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid   6 and  name    H6)(resid   6 and  name   H4') 4.5 1.0 1.0 !W
assign (resid   6 and  name   H1')(resid   6 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   6 and  name   H1')(resid   6 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   6 and  name    H6)(resid   6 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   6 and  name    H6)(resid   6 and  name    H5) 2.4 0.6 0.6 !S
assign (resid   6 and  name   H1')(resid   6 and  name   H4') 3.75 1.25 1.25 !M
!C6INTER
assign (resid   6 and  name    H6)(resid   5 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   6 and  name    H6)(resid   5 and  name   H2') 2.4 0.6 0.6 !S
assign (resid   6 and  name   H1')(resid   7 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   6 and  name   H1')(resid   7 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   6 and  name   H1')(resid   5 and  name   H2') 4.5 1.0 1.0 !W
assign (resid   6 and  name    H6)(resid   5 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   6 and  name    H6)(resid   5 and  name   H2') 2.4 0.6 0.6 !S
!G7INTRA
assign (resid   7 and  name   H1')(resid   7 and  name   H2') 3.4 1.6 1.6 !S
assign (resid   7 and  name    H8)(resid   7 and  name   H3') 2.1 1.1 1.1 !M
assign (resid   7 and  name   H3')(resid   7 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   7 and  name   H1')(resid   7 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   7 and  name   H3')(resid   7 and  name   H5'*) 3.75 1.25 1.25 !M
assign (resid   7 and  name    H8)(resid   7 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid   7 and  name    H8)(resid   7 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid   7 and  name   H1')(resid   7 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid   7 and  name   H1')(resid   7 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid   7 and  name    H8)(resid   7 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   7 and  name    H8)(resid   7 and  name   H5'*) 3.75 1.25 1.25 !M
assign (resid   7 and  name   H1')(resid   7 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   7 and  name    H8)(resid   7 and  name   H2') 3.75 1.25 1.25 !M
!G7INTER
assign (resid   7 and  name    H8)(resid   6 and  name   H1') 4.5 1.0 1.0 !W
assign (resid   7 and  name    H8)(resid   6 and  name    H6) 3.7 1.9 1.9 !VW
assign (resid   7 and  name    H8)(resid   6 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   7 and  name    H8)(resid   6 and  name   H2') 2.9 1.1 1.1 !
assign (resid   7 and  name    H8)(resid   6 and  name   H3') 2.9 1.1 1.1 !M
assign (resid   7 and  name   H1')(resid   6 and  name   H1') 4.4 1.4 2.6 !VW 
!A8INTRA
assign (resid   8 and  name    H8)(resid   8 and  name   H1') 2.9 1.1 1.1 !M
assign (resid   8 and  name    H8)(resid   8 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   8 and  name    H2)(resid   8 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   8 and  name   H1')(resid   8 and  name   H2') 3.4 2.6 2.6 !M
assign (resid   8 and  name   H1')(resid   8 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid   8 and  name    H8)(resid   8 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   8 and  name    H8)(resid   8 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   8 and  name   H2')(resid   8 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   8 and  name   H1')(resid   8 and  name   H5'*) 4.5 1.0 1.0 !W
!A8INTER
assign (resid   8 and  name   H2')(resid   9 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   8 and  name    H2)(resid  20 and  name    H2) 4.4 2.6 2.6 !W
assign (resid   8 and  name   H1')(resid   7 and  name   H4') 4.4 1.4 2.6 !VW
assign (resid   8 and  name   H1')(resid   8 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid   8 and  name    H8)(resid   7 and  name   H1') 6.0 1.0 1.0 !VW
assign (resid   8 and  name    H8)(resid   7 and  name   H2') 2.9 1.1 1.1 !M
assign (resid   8 and  name   H1')(resid   9 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   8 and  name    H2)(resid   9 and  name   H1') 2.9 1.1 1.1 !M
assign (resid   8 and  name   H1')(resid   7 and  name   H2') 4.5 1.0 1.5 !M
assign (resid   8 and  name   H2')(resid   7 and  name   H4') 4.4 1.4 2.6 !VW
assign (resid   8 and  name   H1')(resid   9 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   8 and  name   H2')(resid   9 and  name   H4') 4.4 1.4 2.6 !VW
!A9INTRA
assign (resid   9 and  name    H8)(resid   9 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   9 and  name   H1')(resid   9 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   9 and  name    H8)(resid   9 and  name   H1') 3.75 1.25 1.25 !M
assign (resid   9 and  name    H8)(resid   9 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   9 and  name   H1')(resid   9 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid   9 and  name    H8)(resid   9 and  name   H4') 3.75 1.25 1.25 !M
assign (resid   9 and  name   H1')(resid   9 and  name   H2') 3.75 1.25 1.25 !M
assign (resid   9 and  name   H1')(resid   9 and  name   H3') 3.75 1.25 1.25 !M
assign (resid   9 and  name    H8)(resid   9 and  name   H2') 3.75 1.25 1.25 !M
!A9INTER
assign (resid   9 and  name    H8)(resid   8 and  name   H2') 2.9 1.1 1.1 !M
assign (resid   9 and  name    H8)(resid   8 and  name   H1') 4.5 1.0 1.0 !W
assign (resid   9 and  name   H1')(resid   8 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid   9 and  name    H8)(resid   8 and  name    H8) 3.7 1.9 1.9 !VW
assign (resid   9 and  name    H2)(resid  16 and  name    H2) 6.0 0.0 1.0 !W
assign (resid   9 and  name    H8)(resid   8 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid   9 and  name    H8)(resid   8 and  name   H3') 4.4 2.6 1.6 !VW
assign (resid   9 and  name    H8)(resid   8 and  name   H5'*) 4.4 1.4 2.6 !VW
!A10INTRA
assign (resid  10 and  name    H8)(resid  10 and  name   H2') 3.4 1.6 1.6 !S
assign (resid  10 and  name    H8)(resid  10 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  10 and  name   H1')(resid  10 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  10 and  name    H8)(resid  10 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  10 and  name   H1')(resid  10 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  10 and  name   H1')(resid  10 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  10 and  name    H8)(resid  10 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  10 and  name    H8)(resid  10 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  10 and  name   H1')(resid  10 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  10 and  name    H2)(resid  10 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  10 and  name    H8)(resid  10 and  name   H5'*) 4.5 1.0 1.0 !VW
assign (resid  10 and  name   H1')(resid  10 and  name   H4') 3.75 1.25 1.25 !M 
!A10INTER
assign (resid  10 and  name    H8)(resid   9 and  name   H2') 2.9 1.1 1.6 !M
assign (resid  10 and  name    H8)(resid   9 and  name   H3') 2.9 1.1 2.1 !M
assign (resid  10 and  name    H8)(resid   9 and  name    H8) 3.7 1.9 1.9 !VW
assign (resid  10 and  name    H8)(resid  11 and  name    H6) 4.5 1.5 1.5!VW
assign (resid  10 and  name    H2)(resid  16 and  name    H2) 5.0 1.5 1.0 !VW
assign (resid  10 and  name    H2)(resid  11 and  name   H1') 4.5 1.5 1.5 !VW
assign (resid  10 and  name    H8)(resid   9 and  name   H1') 4.5 1.0 1.0 !W
assign (resid  10 and  name   H1')(resid  11 and  name    H6) 6.0 1.0 1.0
assign (resid  10 and  name    H2)(resid  16 and  name   H1') 4.5 1.0 1.5 !VW
assign (resid  10 and  name    H2)(resid  17 and  name   H2') 5.5 1.0 0.0 !VW
!U11INTRA
assign (resid  11 and  name    H5)(resid  11 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  11 and  name   H1')(resid  11 and  name   H4') 3.4 1.6 1.6  !M
assign (resid  11 and  name   H1')(resid  11 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  11 and  name   H1')(resid  11 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  11 and  name    H6)(resid  11 and  name    H5) 2.4 0.6 0.6 !M
assign (resid  11 and  name    H6)(resid  11 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  11 and  name   H1')(resid  11 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  11 and  name    H5)(resid  11 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  11 and  name    H6)(resid  11 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  11 and  name    H6)(resid  11 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  11 and  name    H6)(resid  11 and  name   H2') 3.4 2.6 2.6 !M
assign (resid  11 and  name    H6)(resid  11 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  11 and  name   H1')(resid  11 and  name   H5'*) 4.5 1.0 1.0 !W
!U11INTER
assign (resid  11 and  name    H6)(resid  12 and  name    H5) 4.5 0.5 1.5 !VW
assign (resid  11 and  name    H5)(resid  10 and  name   H3') 4.5 1.0 2.0 !VW
assign (resid  11 and  name    H6)(resid  10 and  name   H3') 4.0 1.0 2.0 !VW
assign (resid  11 and  name    H6)(resid  10 and  name   H2') 4.0 1.0 2.0 !VW
!C12INTRA
assign (resid  12 and  name    H6)(resid  12 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  12 and  name    H6)(resid  12 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  12 and  name    H6)(resid  12 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  12 and  name    H5)(resid  12 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  12 and  name   H1')(resid  12 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  12 and  name   H1')(resid  12 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  12 and  name    H6)(resid  12 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  12 and  name    H6)(resid  12 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  12 and  name    H5)(resid  12 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  12 and  name   H1')(resid  12 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  12 and  name   H1')(resid  12 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  12 and  name    H5)(resid  12 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  12 and  name   H1')(resid  12 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  12 and  name    H6)(resid  12 and  name   H5'*) 4.5 1.0 1.0 !W
!C12INTER
assign (resid  12 and  name    H6)(resid  11 and  name   H3') 3.0 0.0 2.5 !M
assign (resid  12 and  name    H5)(resid  11 and  name   H3') 3.0 0.0 2.5 !VW
assign (resid  12 and  name    H6)(resid  13 and  name    H5) 4.0 0.0 2.0 !VW
assign (resid  12 and  name    H6)(resid  13 and  name    H6) 4.0 0.0 2.0 !VW
assign (resid  12 and  name    H5)(resid  13 and  name    H5) 4.0 0.0 2.0 !VW
assign (resid  12 and  name    H5)(resid  11 and  name   H5'*) 4.0 0.0 2.0 !VW
assign (resid  12 and  name   H1')(resid  13 and  name   H5'*) 4.5 1.5 1.5 !VW
assign (resid  12 and  name    H5)(resid  11 and  name   H2') 4.5 1.5 2.6 !VW
assign (resid  12 and  name    H5)(resid  11 and  name   H5'*) 4.5 1.5 2.6 !VW
assign (resid  12 and  name    H5)(resid  11 and  name   H4') 4.5 1.5 2.6 !VW
assign (resid  12 and  name    H6)(resid  11 and  name   H1') 6.0 1.0 1.0 !VW
!C13INTRA
assign (resid  13 and  name   H1')(resid  13 and  name   H2') 3.4 1.6 1.6  !S
assign (resid  13 and  name    H6)(resid  13 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  13 and  name    H6)(resid  13 and  name   H3') 3.4 2.6 2.6 !M
assign (resid  13 and  name    H6)(resid  13 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  13 and  name    H6)(resid  13 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  13 and  name    H6)(resid  13 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  13 and  name    H5)(resid  13 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  13 and  name    H6)(resid  13 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  13 and  name   H1')(resid  13 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  13 and  name    H5)(resid  13 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid  13 and  name   H1')(resid  13 and  name   H5'*) 4.5 1.0 1.0 !W
!C13INTER
assign (resid  13 and  name    H6)(resid  12 and  name   H1') 4.4 0.4 1.1 !VW
assign (resid  13 and  name    H6)(resid  14 and name     H5) 4.4 0.4 3.6 !VW
assign (resid  13 and  name    H6)(resid  14 and  name   H5'*) 4.4 0.4 2.6 !VW
assign (resid  13 and  name    H6)(resid  12 and  name   H2') 4.5 0.5 1.0 !W
assign (resid  13 and  name    H6)(resid  12 and  name   H3') 4.4 0.4 2.6 !VW
assign (resid  13 and  name    H6)(resid  14 and  name    H6) 4.4 0.4 2.6 !VW
assign (resid  13 and  name    H5)(resid  12 and  name   H2') 4.4 0.4 2.6 !VW
assign (resid  13 and  name    H5)(resid  12 and  name   H1') 4.4 0.4 2.6 !VW
!C14INTRA
assign (resid  14 and  name   H1')(resid  14 and  name   H2') 4.4 2.6 2.6 !VW
assign (resid  14 and  name   H1')(resid  14 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid  14 and  name    H6)(resid  14 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  14 and  name   H4')(resid  14 and  name   H5'*) 4.5 2.7 1.0 !W
assign (resid  14 and  name   H3')(resid  14 and  name   H5'*) 3.75 1.25 1.25 !M
assign (resid  14 and  name    H6)(resid  14 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  14 and  name    H6)(resid  14 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  14 and  name   H1')(resid  14 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  14 and  name    H5)(resid  14 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  14 and  name    H5)(resid  14 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  14 and  name    H6)(resid  14 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  14 and  name   H1')(resid  14 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  14 and  name   H1')(resid  15 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  14 and  name    H5)(resid  14 and  name   H3') 4.4 1.4 2.6 !VW
!C14INTER
assign (resid  14 and  name    H6)(resid  13 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  14 and  name    H5)(resid  12 and  name   H2') 4.4 0.4 1.6 !VW
assign (resid  14 and  name    H6)(resid  13 and  name   H2') 4.5 1.5 1.0 !W
assign (resid  14 and  name    H5)(resid  13 and  name   H2') 4.4 0.4 1.6 !VW
assign (resid  14 and  name    H6)(resid  13 and  name   H4') 4.4 0.4 1.6 !VW
assign (resid  14 and  name   H1')(resid  15 and  name   H5'*) 4.4 0.4 2.6 !VW
assign (resid  14 and  name    H5)(resid  13 and  name   H3') 4.4 0.4 2.6 !VW
assign (resid  14 and  name   H1')(resid  13 and  name   H2') 4.4 0.4 2.6 !VW
assign (resid  14 and  name    H5)(resid  13 and  name   H4') 4.4 0.4 2.6 !VW
!G15INTRA
assign (resid  15 and  name   H1')(resid  15 and  name   H2') 3.4 1.6 1.6 !S
assign (resid  15 and  name    H8)(resid  15 and  name   H1') 2.4 0.6 0.6 !S
assign (resid  15 and  name    H8)(resid  15 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  15 and  name   H1')(resid  15 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  15 and  name    H8)(resid  15 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid  15 and  name   H1')(resid  15 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid  15 and  name    H8)(resid  15 and  name   H3') 4.5 1.0 1.0 !W
assign (resid  15 and  name   H1')(resid  15 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  15 and  name   H1')(resid  15 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  15 and  name    H8)(resid  15 and  name   H4') 4.5 1.0 1.0 !W
!G15INTER
assign (resid  15 and  name    H8)(resid  14 and  name   H4') 4.4 0.4 1.6 !VW
assign (resid  15 and  name   H1')(resid  14 and  name   H5'*) 4.4 0.4 1.6 !VW
assign (resid  15 and  name    H8)(resid  14 and  name   H5'*) 4.4 0.4 1.6 !VW
assign (resid  15 and  name   H1')(resid  14 and  name   H5'*) 4.4 0.4 1.6 !VW
!A16INTRA
assign (resid  16 and  name    H8)(resid  16 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  16 and  name    H8)(resid  16 and  name   H2') 4.4 2.6 2.6 !
assign (resid  16 and  name    H8)(resid  16 and  name   H3') 4.4 2.4 2.6 !VW
assign (resid  16 and  name   H1')(resid  16 and  name   H4') 3.4 2.6 2.6 !M
assign (resid  16 and  name   H1')(resid  16 and  name   H2') 4.4 2.6 2.6 !M
assign (resid  16 and  name   H1')(resid  16 and  name   H3') 4.4 2.6 2.6 !M
assign (resid  16 and  name    H8)(resid  16 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  16 and  name   H1')(resid  16 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  16 and  name   H1')(resid  16 and  name   H5'*) 4.5 1.0 1.0  !W
assign (resid  16 and  name    H8)(resid  16 and  name   H5'*) 4.5 1.0 1.0 !VW
!A16INTER
assign (resid  16 and  name   H2')(resid  17 and  name   H2') 3.4 1.6 1.6!?
assign (resid  16 and  name   H2')(resid  17 and  name   H3') 3.4 1.6 1.6!?
assign (resid  16 and  name   H2')(resid  17 and  name  H5'*) 3.4 1.6 1.6!?
assign (resid  16 and  name    H8)(resid  15 and  name   H2') 3.5 0.5 2.0 !M
assign (resid  16 and  name    H8)(resid  15 and  name   H3') 3.5 0.5 2.0 !M
assign (resid  16 and  name    H8)(resid  15 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  16 and  name    H2)(resid  16 and  name   H1') 6.0 1.0 1.0 !VW
assign (resid  16 and  name    H2)(resid  10 and  name   H1') 6.0 1.0 1.0 !VW
assign (resid  16 and  name    H8)(resid  17 and  name   H2') 3.5 0.5 0.5  !M
assign (resid  16 and  name    H8)(resid  17 and  name   H8)  3.4 1.6 1.6 !new
assign (resid  16 and  name    H2)(resid  15 and  name   H1') 6.0 0.0 1.0 !VW
!A17INTRA
assign (resid  17 and  name    H8)(resid  17 and  name   H2') 4.4 2.6 1.6 !VW
assign (resid  17 and  name    H8)(resid  17 and  name   H5'*) 4.4 2.6 1.6 !VW
assign (resid  17 and  name    H8)(resid  17 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  17 and  name    H8)(resid  17 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  17 and  name    H2)(resid  17 and  name   H1') 4.5 1.0 1.5 !VW
assign (resid  17 and  name   H1')(resid  17 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  17 and  name   H1')(resid  17 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  17 and  name    H8)(resid  17 and  name   H4') 4.4 2.6 2.6 !VW
!A17INTER
assign (resid  17 and  name    H8)(resid  19 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  17 and  name   H1')(resid  18 and  name   H4') 4.5 1.0 1.0 !VW
assign (resid  17 and  name   H1')(resid  19 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  17 and  name    H8)(resid  16 and  name   H4') 4.4 1.4 2.6  !W
assign (resid  17 and  name   H1')(resid  18 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  17 and  name    H2)(resid   8 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  17 and  name    H2)(resid  18 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  17 and  name   H1')(resid  19 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  17 and  name    H8)(resid  10 and  name    H2) 5.0 1.5 0.5 !W
assign (resid  17 and  name    H2)(resid   8 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  17 and  name    H2)(resid   8 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  17 and  name    H8)(resid  16 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  17 and  name    H8)(resid  16 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  17 and  name    H8)(resid  16 and  name   H1') 3.4 1.6 1.6 !W
assign (resid  17 and  name    H8)(resid  16 and  name   H3') 4.4 1.4 1.6 !VW
assign (resid  17 and  name    H8)(resid  19 and  name   H6) 3.0 0.0 2.5 !M
!G18INTRA
assign (resid  18 and  name   H3')(resid  18 and  name   H5'*) 3.75 1.25 1.25 !M
assign (resid  18 and  name   H3')(resid  18 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  18 and  name   H3')(resid  18 and  name   H5'*) 3.75 1.25 1.25 !M
assign (resid  18 and  name   H2')(resid  18 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  18 and  name   H2')(resid  18 and  name   H5'*) 4.5 1.0 1.0 !M
assign (resid  18 and  name   H2')(resid  18 and  name   H5'*) 4.4 2.6 2.6 !M
assign (resid  18 and  name   H1')(resid  18 and  name   H5'*) 4.4 2.6 2.6 !W
assign (resid  18 and  name   H1')(resid  18 and  name   H2') 4.4 2.6 2.6 !VW
assign (resid  18 and  name   H1')(resid  18 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid  18 and  name   H1')(resid  18 and  name   H4') 4.4 2.6 2.6 !M
assign (resid  18 and  name   H2')(resid  18 and  name   H5'*) 4.4 2.6 2.6 !M
!G18INTER
assign (resid  18 and  name   H1')(resid  17 and  name   H1') 4.4 1.4 2.6 !VW
!U19INTRA
assign (resid  19 and  name    H6)(resid  19 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  19 and  name   H1')(resid  19 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  19 and  name    H6)(resid  19 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  19 and  name    H6)(resid  19 and  name   H3') 3.4 1.6 1.6 !W
assign (resid  19 and  name   H1')(resid  19 and  name   H5'*) 4.4 2.6 2.6 !W
assign (resid  19 and  name    H5)(resid  19 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  19 and  name   H1')(resid  19 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  19 and  name    H6)(resid  19 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  19 and  name   H1')(resid  19 and  name   H5'*) 4.4 2.6 2.6 !M
assign (resid  19 and  name    H6)(resid  19 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  19 and  name   H1')(resid  19 and  name   H4') 3.75 1.25 1.25 !M
!U19INTER
assign (resid  19 and  name   H1')(resid  17 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  19 and  name   H1')(resid  17 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  19 and  name    H6)(resid  18 and  name   H4') 4.4 2.6 1.6 !VW
assign (resid  19 and  name    H6)(resid  18 and  name   H3') 4.4 2.6 1.6 !VW ! changed from 0.6 -> 1.6 
assign (resid  19 and  name    H6)(resid  17 and  name   H4') 4.5 1.0 1.0 !W  ! changed from H2' -> H4'
assign (resid  19 and  name    H6)(resid  20 and  name    H8) 3.7 1.9 1.9 !VW
assign (resid  19 and  name    H6)(resid  18 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  19 and  name   H1')(resid  17 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  19 and  name    H6)(resid  17 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  19 and  name    H6)(resid  17 and  name   H1') 4.5 1.0 1.0 !W
assign (resid  19 and  name    H6)(resid  18 and  name   H1') 4.4 2.6 0.6 !VW
assign (resid  19 and  name    H5)(resid  17 and  name   H1') 4.5 1.0 1.0 !W
!A20INTRA
assign (resid  20 and  name   H1')(resid  20 and  name   H2') 3.4 1.6 1.6 !S
assign (resid  20 and  name    H8)(resid  20 and  name   H2') 4.4 2.6 2.6 !VW
assign (resid  20 and  name    H8)(resid  20 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid  20 and  name    H8)(resid  20 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid  20 and  name    H8)(resid  20 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  20 and  name   H1')(resid  20 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  20 and  name    H8)(resid  20 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  20 and  name    H8)(resid  20 and  name   H5'*) 4.4 2.6 2.6 !W
!A20INTER
assign (resid  20 and  name    H8)(resid  19 and  name   H3') 4.4 2.6 1.6 !VW
assign (resid  20 and  name    H8)(resid  19 and  name   H1') 3.4 1.6 1.6!W
assign (resid  20 and  name    H8)(resid  21 and  name    H8) 3.7 1.9 1.9 !VW
assign (resid  20 and  name    H2)(resid  21 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  20 and  name   H1')(resid  21 and  name   H2') 4.4 2.6 2.6 !W
assign (resid  20 and  name   H1')(resid  19 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  20 and  name   H1')(resid  21 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  20 and  name   H1')(resid  21 and  name   H4') 4.4 1.4 2.6 !VW
assign (resid  20 and  name   H1')(resid  19 and  name   H2') 4.5 1.0 1.0 !W
assign (resid  20 and  name   H1')(resid  19 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  20 and  name    H2)(resid   8 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  20 and  name    H8)(resid  19 and  name   H2') 2.4 0.6 0.6 !s
!G21INTRA
assign (resid  21 and  name   H2')(resid  21 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  21 and  name   H4')(resid  21 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  21 and  name   H1')(resid  21 and  name    H8) 3.4 1.6 1.6 !W
assign (resid  21 and  name    H8)(resid  21 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid  21 and  name    H8)(resid  21 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid  21 and  name    H8)(resid  21 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  21 and  name    H8)(resid  21 and  name   H5'*) 4.5 1.0 1.0 !M
!G21INTER
assign (resid  21 and  name    H8)(resid  20 and  name   H2') 4.5 2.7 1.0 !W
assign (resid  21 and  name    H8)(resid  20 and  name   H1') 4.5 2.7 1.0 !W
assign (resid  21 and  name    H8)(resid  22 and  name    H5) 4.5 1.0 1.0 !W
assign (resid  21 and  name    H8)(resid  20 and  name   H4') 4.5 1.0 1.0  !VW
assign (resid  21 and  name    H8)(resid  19 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  21 and  name    H8)(resid  20 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  21 and  name    H8)(resid  22 and  name    H6) 3.7 1.9 1.9 !W

!U22INTRA
assign (resid  22 and  name   H1')(resid  22 and  name   H2') 3.4 1.6 1.6 !S
assign (resid  22 and  name    H6)(resid  22 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  22 and  name   H1')(resid  22 and  name   H4') 3.4 1.6 1.6 !W
assign (resid  22 and  name    H6)(resid  22 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  22 and  name   H1')(resid  22 and  name   H5'*) 4.4 2.6 2.6 !W
assign (resid  22 and  name    H5)(resid  22 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  22 and  name   H1')(resid  22 and  name    H5) 4.4 2.6 2.6 !V
assign (resid  22 and  name   H1')(resid  22 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  22 and  name    H6)(resid  22 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  22 and  name    H5)(resid  22 and  name   H4') 4.4 2.6 2.6 !W
assign (resid  22 and  name    H5)(resid  22 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  22 and  name   H1')(resid  22 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  22 and  name    H6)(resid  22 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  22 and  name    H6)(resid  22 and  name   H2') 3.4 2.1 2.1 !M
!U22INTER
assign (resid  22 and  name    H5)(resid  21 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  22 and  name    H5)(resid  21 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  22 and  name    H6)(resid  21 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  22 and  name    H5)(resid  21 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  22 and  name   H1')(resid  21 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  22 and  name   H1')(resid  21 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  22 and  name    H6)(resid  21 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  22 and  name    H6)(resid  21 and  name   H3') 3.75 1.25 1.25 !M
!G23INTRA
assign (resid  23 and  name    H8)(resid  23 and  name   H4') 4.5 1.0 1.0 !W
assign (resid  23 and  name   H1')(resid  23 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  23 and  name    H8)(resid  23 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  23 and  name    H8)(resid  23 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  23 and  name   H1')(resid  23 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  23 and  name    H8)(resid  23 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  23 and  name   H1')(resid  23 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  23 and  name   H1')(resid  23 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  23 and  name    H8)(resid  23 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  23 and  name    H8)(resid  23 and  name   H2') 3.75 1.25 1.25 !M
!G23INTER
assign (resid  23 and  name    H8)(resid  22 and  name   H1') 3.4 2.1 2.1 !M
assign (resid  23 and  name   H1')(resid  24 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid  23 and  name    H8)(resid  24 and  name    H5) 4.5 1.0 1.0 !W
assign (resid  23 and  name   H1')(resid  24 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  23 and  name   H1')(resid  22 and  name   H1') 4.4 1.4 2.6 !VW
assign (resid  23 and  name    H8)(resid  22 and  name    H6) 3.7 1.9 1.9 !VW
assign (resid  23 and  name    H8)(resid  22 and  name   H2') 2.4 0.6 0.6 !S
assign (resid  23 and  name    H8)(resid  24 and  name    H6) 3.7 1.9 1.9 !W
!U24INTRA
assign (resid  24 and  name   H1')(resid  24 and  name   H2') 4.4 2.6 2.6 !VW
assign (resid  24 and  name   H1')(resid  24 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid  24 and  name   H1')(resid  24 and  name   H4') 4.4 2.6 2.6 !VW
assign (resid  24 and  name    H6)(resid  24 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  24 and  name   H1')(resid  24 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  24 and  name    H6)(resid  24 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  24 and  name   H1')(resid  24 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid  24 and  name    H5)(resid  24 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  24 and  name    H6)(resid  24 and  name   H2') 4.4 2.6 2.6 !VW
assign (resid  24 and  name    H6)(resid  24 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid  24 and  name    H6)(resid  24 and  name   H5'*) 4.4 2.6 2.6 !VW
assign (resid  24 and  name    H5)(resid  24 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  24 and  name    H5)(resid  24 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  24 and  name    H6)(resid  24 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  24 and  name   H1')(resid  24 and  name   H5'*) 4.5 1.0 1.0 !W
!U24INTER
assign (resid  24 and  name    H6)(resid  25 and  name    H5) 4.5 1.0 1.0 !W
assign (resid  24 and  name    H6)(resid  23 and  name   H2') 4.4 2.6 2.6 !VW
assign (resid  24 and  name    H6)(resid  23 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  24 and  name    H6)(resid  23 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  24 and  name    H5)(resid  23 and  name   H3') 4.4 1.4 2.6 !VW
!C25INTRA
assign (resid  25 and  name   H1')(resid  25 and  name   H2') 3.4 1.6 1.6 !S
assign (resid  25 and  name    H6)(resid  25 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  25 and  name   H1')(resid  25 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  25 and  name    H6)(resid  25 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  25 and  name   H1')(resid  25 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  25 and  name    H6)(resid  25 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  25 and  name    H6)(resid  25 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  25 and  name    H5)(resid  25 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  25 and  name    H6)(resid  25 and  name   H3') 4.4 2.6 2.6 !VW
assign (resid  25 and  name   H1')(resid  25 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  25 and  name    H6)(resid  25 and  name   H4') 3.75 1.25 1.75 !M
assign (resid  25 and  name   H1')(resid  25 and  name   H5'*) 4.4 2.6 2.6 !M
assign (resid  25 and  name    H5)(resid  25 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  25 and  name    H6)(resid  25 and  name   H5'*) 4.5 1.0 1.0 !W
!C25INTER
assign (resid  25 and  name    H6)(resid  24 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  25 and  name    H5)(resid  26 and  name    H5) 4.5 1.0 1.0 !W
assign (resid  25 and  name    H5)(resid  24 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid  25 and  name   H1')(resid  26 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid  25 and  name    H6)(resid  26 and  name    H6) 3.7 1.9 1.9 !W
assign (resid  25 and  name    H6)(resid  24 and  name    H6) 3.7 1.9 1.9 !VW
assign (resid  25 and  name    H5)(resid  24 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  25 and  name   H1')(resid  26 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  25 and  name    H5)(resid  24 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  25 and  name    H6)(resid  24 and  name   H2') 4.4 2.6 2.6 !VW
assign (resid  25 and  name    H6)(resid  24 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  25 and  name   H1')(resid  26 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  25 and  name   H1')(resid  26 and  name   H2') 4.4 1.4 2.6 !VW
!C26INTRA
assign (resid  26 and  name   H1')(resid  26 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  26 and  name   H1')(resid  26 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  26 and  name    H6)(resid  26 and  name    H5) 2.4 0.6 0.6 !S
assign (resid  26 and  name    H6)(resid  26 and  name   H3') 3.75 1.25 1.25 !M
assign (resid  26 and  name    H6)(resid  26 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  26 and  name    H6)(resid  26 and  name   H1') 3.75 1.25 1.25 !M
assign (resid  26 and  name    H6)(resid  26 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  26 and  name   H1')(resid  26 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid  26 and  name    H5)(resid  26 and  name   H3') 4.4 1.4 2.6 !VW
assign (resid  26 and  name   H1')(resid  26 and  name   H5'*) 4.5 1.0 1.0 !W
assign (resid  26 and  name    H5)(resid  26 and  name   H5'*) 4.4 1.4 2.6 !VW
assign (resid  26 and  name   H1')(resid  26 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  26 and  name    H6)(resid  26 and  name   H4') 3.75 1.25 1.25 !M
assign (resid  26 and  name    H5)(resid  26 and  name   H2') 4.4 1.4 2.6 !VW
assign (resid  26 and  name    H5)(resid  26 and  name   H4') 4.4 1.4 2.6 !VW
!C26INTER
assign (resid  26 and  name    H6)(resid  25 and  name   H2') 3.75 1.25 1.25 !M
assign (resid  26 and  name    H6)(resid  25 and  name   H1') 2.4 1.6 1.6 !M
assign (resid  26 and  name    H5)(resid  25 and  name   H4') 4.4 1.4 2.6 !
assign (resid  26 and  name    H6)(resid  25 and  name    H5) 4.4 1.4 2.6 !VW
assign (resid  26 and  name    H5)(resid  25 and  name   H2') 4.4 2.6 2.6 !M
assign (resid  26 and  name    H6)(resid  25 and  name   H3') 4.4 2.6 2.6 !M
assign (resid  26 and  name    H5)(resid  25 and  name   H3') 4.4 1.4 2.6 !VW


!G1
assign (resid   1 and  name    H1)(resid  26 and  name   H41) 3.9 2.1 2.1             
assign (resid   1 and  name    H1)(resid  26 and  name   H42) 3.9 2.1 2.1
assign (resid   1 and  name    H1)(resid   2 and  name   H1') 3.9 2.1 2.1
!G2
assign (resid   2 and  name    H1)(resid  25 and  name   H41) 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid  25 and  name   H42) 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid   3 and  name   H1') 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid   3 and  name    H2) 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid  26 and  name   H1') 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid  25 and  name    H5) 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid  26 and  name    H5) 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid  26 and  name   H41) 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid   3 and  name   H61) 3.9 2.1 2.1
assign (resid   2 and  name    H1)(resid  24 and  name    H3) 3.9 2.1 2.1
!G7
assign (resid   7 and  name    H1)(resid   7 and  name   H22) 3.9 2.1 2.1
assign (resid   7 and  name    H1)(resid   7 and  name   H21) 3.9 2.1 2.1
assign (resid   7 and  name    H1)(resid  20 and  name   H61) 3.9 2.1 2.1
assign (resid   7 and  name    H1)(resid  20 and  name   H62) 3.9 2.1 2.1
!G21
assign (resid  21 and  name    H1)(resid   6 and  name   H41) 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid  21 and  name   H21) 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid  21 and  name   H22) 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid   7 and  name   H1') 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid   6 and  name   H42) 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid  20 and  name   H61) 3.9 2.1 2.1 
assign (resid  21 and  name    H1)(resid  20 and  name   H62) 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid  22 and  name   H1') 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid   5 and  name    H2) 3.9 2.1 2.1
assign (resid  21 and  name    H1)(resid  22 and  name    H5) 3.9 2.1 2.1
!U22
assign (resid  22 and  name    H3)(resid   5 and  name    H2) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid   5 and  name   H61) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid   5 and  name   H62) 3.9 0.5 0.5
assign (resid  22 and  name    H3)(resid  22 and  name    H5) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid  23 and  name   H1') 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid   6 and  name   H42) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid   4 and  name   H41) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid  21 and  name   H21) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid   4 and  name   H42) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid  23 and  name    H1) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid  21 and  name    H1) 3.9 2.1 2.1
assign (resid  22 and  name    H3)(resid  22 and  name   H1') 3.9 2.1 2.1
!G23
assign (resid  23 and  name    H1)(resid  23 and  name   H21) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid  23 and  name   H22) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   4 and  name   H42) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid  24 and  name   H1') 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   3 and  name    H2) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   4 and  name    H5) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   5 and  name    H2) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   5 and  name   H62) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   4 and  name   H41) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   5 and  name   H1') 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid   5 and  name   H61) 3.9 2.1 2.1
assign (resid  23 and  name    H1)(resid  24 and  name    H3) 3.9 2.1 2.1
!U24
assign (resid  24 and  name    H3)(resid   3 and  name    H2) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid  25 and  name   H41) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid   4 and  name   H41) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid  23 and  name   H21) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid   3 and  name   H61) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid  25 and  name   H42) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid   3 and  name   H62) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid  25 and  name    H5) 3.9 2.1 2.1
assign (resid  24 and  name    H3)(resid  24 and  name   H1') 3.9 2.1 2.1
!CPMGNOESY NOES
assign (resid  25 and  name   H41)(resid  26 and  name    N4) 6.2 3.1 3.1
assign (resid  26 and  name   H41)(resid  25 and  name    N4) 6.2 3.1 3.1
assign (resid  25 and  name   H41)(resid   3 and  name    N6) 6.2 3.1 3.1 
assign (resid   6 and  name   H42)(resid   5 and  name    N6) 6.2 3.1 3.1
assign (resid   4 and  name   H41)(resid   3 and  name    N6) 6.2 3.1 3.1 
assign (resid   4 and  name   H41)(resid   5 and  name    N6) 6.2 3.1 3.1
assign (resid   4 and  name   H42)(resid   3 and  name    N6) 6.2 3.1 3.1 
assign (resid   4 and  name   H42)(resid   5 and  name    N6) 6.2 3.1 3.1
assign (resid   8 and  name    H8)(resid  20 and  name    N6) 6.2 3.1 3.1 
assign (resid   7 and  name   H1')(resid  20 and  name    N6) 6.2 3.1 3.1
assign (resid   7 and  name   H2')(resid  20 and  name    N6) 6.2 3.1 3.1
assign (resid  20 and  name   H1')(resid   8 and  name    N6) 6.2 3.1 3.1
assign (resid  20 and  name   H1')(resid   8 and  name    N6) 6.2 3.1 3.1
assign (resid  24 and  name   H1')(resid  23 and  name    N2) 6.2 3.1 3.1
assign (resid   5 and  name   H1')(resid  23 and  name    N2) 6.2 3.1 3.1
assign (resid   7 and  name   H1')(resid  21 and  name    N2) 6.2 3.1 3.1
assign (resid   8 and  name   H1')(resid  20 and  name    N6) 6.2 3.1 3.1


 
     {GAU                        CYT}
assi (resi   1 and name   H1) (resi  26 and name   N3)  2.00  0.20  0.20
assi (resi   1 and name   N1) (resi  26 and name   N3)  2.90  0.30  0.30
assi (resi   1 and name   O6) (resi  26 and name  H41)  2.00  0.20  0.20
assi (resi   1 and name   O6) (resi  26 and name   N4)  2.90  0.30  0.30
assi (resi   1 and name  H21) (resi  26 and name   O2)  2.00  0.20  0.20
assi (resi   1 and name   N2) (resi  26 and name   O2)  2.90  0.30  0.30

     {GAU                        CYT}
assi (resi   2 and name   H1) (resi  25 and name   N3)  2.00  0.20  0.20
assi (resi   2 and name   N1) (resi  25 and name   N3)  2.90  0.30  0.30
assi (resi   2 and name   O6) (resi  25 and name  H41)  2.00  0.20  0.20
assi (resi   2 and name   O6) (resi  25 and name   N4)  2.90  0.30  0.30
assi (resi   2 and name  H21) (resi  25 and name   O2)  2.00  0.20  0.20
assi (resi   2 and name   N2) (resi  25 and name   O2)  2.90  0.30  0.30

    {URI                        ADE}
assi (resi  24 and name   H3) (resi  3 and name   N1)  2.00  0.20  0.20
assi (resi  24 and name   N3) (resi  3 and name   N1)  2.90  0.30  0.30
assi (resi  24 and name   O4) (resi  3 and name  H61)  2.00  0.20  0.20
assi (resi  24 and name   O4) (resi  3 and name   N6)  2.90  0.30  0.30

     {GAU                        CYT}
assi (resi   23 and name   H1) (resi  4 and name   N3)  2.00  0.20  0.20
assi (resi   23 and name   N1) (resi  4 and name   N3)  2.90  0.30  0.30
assi (resi   23 and name   O6) (resi  4 and name  H41)  2.00  0.20  0.20
assi (resi   23 and name   O6) (resi  4 and name   N4)  2.90  0.30  0.30
assi (resi   23 and name  H21) (resi  4 and name   O2)  2.00  0.20  0.20
assi (resi   23 and name   N2) (resi  4 and name   O2)  2.90  0.30  0.30

    {URI                        ADE}
assi (resi  22 and name   H3) (resi  5 and name   N1)  2.00  0.20  0.20
assi (resi  22 and name   N3) (resi  5 and name   N1)  2.90  0.30  0.30
assi (resi  22 and name   O4) (resi  5 and name  H61)  2.00  0.20  0.20
assi (resi  22 and name   O4) (resi  5 and name   N6)  2.90  0.30  0.30

    {GAU                        CYT}
assi (resi   21 and name   H1) (resi  6 and name   N3)  2.00  0.20  0.20
assi (resi   21 and name   N1) (resi  6 and name   N3)  2.90  0.30  0.30
assi (resi   21 and name   O6) (resi  6 and name  H41)  2.00  0.20  0.20
assi (resi   21 and name   O6) (resi  6 and name   N4)  2.90  0.30  0.30
assi (resi   21 and name  H21) (resi  6 and name   O2)  2.00  0.20  0.20
assi (resi   21 and name   N2) (resi  6 and name   O2)  2.90  0.30  0.30
    {loop E motif}
    {sheared GA PAIR}
assi (resid   7 and name   N3  ) (resid  20 and name  H62  )  2.30  2.30  0.00
assi (resid   7 and name   N3  ) (resid  20 and name   N6  )  3.30  3.30  0.00
assi (resid   7 and name  H22  ) (resid  20 and name   N7  )  2.30  2.30  0.00
assi (resid   7 and name   N2  ) (resid  20 and name   N7  )  3.30  3.30  0.00
    {Reverse hoogsteen}
assi (resid   8 and name   N7  ) (resid  19 and name   H3  )  2.30  2.30  0.00
assi (resid   8 and name   N7  ) (resid  19 and name   N3  )  3.30  3.30  0.00
assi (resid   8 and name  H62  ) (resid  19 and name   O2  )  2.30  2.30  0.00
assi (resid   8 and name   N6  ) (resid  19 and name   O2  )  3.30  3.30  0.00
     {bulged G}
assi (resid  18 and name  H22  ) (resid  19 and name   O4  )  2.30  2.30  0.00
assi (resid  18 and name   N2  ) (resid  19 and name   O4  )  3.30  3.30  0.00
assi (resid  18 and name   N2  ) (resid   8 and name    P  )  4.00  1.00  0.50
    {N7amino symmetric pair}
assi (resid   9 and name   N7  ) (resid  17 and name  H62   )  2.30  2.30  0.00
assi (resid   9 and name   N7  ) (resid  17 and name   N6  )  3.30  3.30  0.00
assi (resid   9 and name  H62  ) (resid  17 and name   N7  )  2.30  2.30  0.00
assi (resid   9 and name   N6  ) (resid  17 and name   N7  )  3.30  3.30  0.00







!{* select all base atoms: *}
vector identity (store1) 
           (not( name P   or name O1P or name O2P or name O5' or name H5T or
                name H1' or name H2' or name H3' or name H4' or name H5' or
                name H2'' or name H5'' or name O2' or name H7# or
                name O3' or name C1' or name C2' or name C3' or name C4' or
                name C5' or name O4' or name H3T or name HO2' ) )

!write coor output=test.pdb select=(store1) end stop !to test selection


!bases are kept flat
rest plan
   init
   group select  (store1 and (resi 1) )  weigh=300.0 end
   group select  (store1 and (resi 2) )  weigh=300.0 end
   group select  (store1 and (resi 3) )  weigh=300.0 end
   group select  (store1 and (resi 4) )  weigh=300.0 end
   group select  (store1 and (resi 5) )  weigh=300.0 end
   group select  (store1 and (resi 6) )  weigh=300.0 end
   group select  (store1 and (resi 7) )  weigh=300.0 end
   group select  (store1 and (resi 8) )  weigh=300.0 end
   group select  (store1 and (resi 9) )  weigh=300.0 end
   group select  (store1 and (resi 10))  weigh=300.0 end
   group select  (store1 and (resi 11))  weigh=300.0 end
   group select  (store1 and (resi 12))  weigh=300.0 end
   group select  (store1 and (resi 13))  weigh=300.0 end
   group select  (store1 and (resi 14))  weigh=300.0 end
   group select  (store1 and (resi 15))  weigh=300.0 end
   group select  (store1 and (resi 16))  weigh=300.0 end
   group select  (store1 and (resi 17))  weigh=300.0 end
   group select  (store1 and (resi 18))  weigh=300.0 end
   group select  (store1 and (resi 19))  weigh=300.0 end
   group select  (store1 and (resi 20))  weigh=300.0 end
   group select  (store1 and (resi 21))  weigh=300.0 end
   group select  (store1 and (resi 22))  weigh=300.0 end
   group select  (store1 and (resi 23))  weigh=300.0 end
   group select  (store1 and (resi 24))  weigh=300.0 end
   group select  (store1 and (resi 25))  weigh=300.0 end
   group select  (store1 and (resi 26))  weigh=300.0 end

!bases kept planar to one another  
   group select ( (store1 and (resi 1 or resi 26) ) ) weigh=3.0 end
   group select ( (store1 and (resi 2 or resi 25) ) ) weigh=3.0 end
   group select ( (store1 and (resi 3 or resi 24) ) ) weigh=3.0 end
   group select ( (store1 and (resi 4 or resi 23) ) ) weigh=3.0 end
   group select ( (store1 and (resi 5 or resi 22) ) ) weigh=3.0 end
   group select ( (store1 and (resi 6 or resi 21) ) ) weigh=3.0 end
   group select ( (store1 and (resi 7 or resi 20) ) ) weigh=3.0 end
   group select ( (store1 and (resi 8 or resi 19) ) ) weigh=3.0 end
   group select ( (store1 and (resi 18 or resi 19) ) ) weigh=3.0 end
   group select ( (store1 and (resi 9 or resi 17) ) ) weigh=5.0 end
   

end
{*artificial planarity restraints on bases in loop*}
 assign (resi 1 and name O4'  )
        (resi 1 and name C1'  )
        (resi 1 and name N9   )
        (resi 1 and name C4   )   1.0   -120.0  60.0  2 !{full anti range}
        !{-60 to -180}
 assign (resi 2 and name O4'  )
        (resi 2 and name C1'  )
        (resi 2 and name N9   )
        (resi 2 and name C4   )   1.0   -159.0  21.0  2

 assign (resi 3 and name O4'  )
        (resi 3 and name C1'  )
        (resi 3 and name N9   )
        (resi 3 and name C4   )   1.0   -159.0  21.0  2

 assign (resi 4 and name O4'  )
        (resi 4 and name C1'  )
        (resi 4 and name N1   )
        (resi 4 and name C2   )   1.0   -159.0  21.0  2

 assign (resi 5 and name O4'  )
        (resi 5 and name C1'  )
        (resi 5 and name N9   )
        (resi 5 and name C4   )   1.0   -159.0  21.0  2

 assign (resi 6 and name O4'  )
        (resi 6 and name C1'  )
        (resi 6 and name N1   )
        (resi 6 and name C2   )   1.0   -159.0  21.0  2

assign (resi 7 and name O4'  )
        (resi 7 and name C1'  )
        (resi 7 and name N9   )
        (resi 7 and name C4   )   1.0   -130.0  70.0  2

assign (resi 8 and name O4'  )
        (resi 8 and name C1'  )
        (resi 8 and name N9   )
        (resi 8 and name C4   )   1.0   -130.0  70.0  2 !{full anti range}
        !{-60 to -180}
assign (resi 9 and name O4'  )
        (resi 9 and name C1'  )
        (resi 9 and name N9   )
        (resi 9 and name C4   )   1.0   -130.0  70.0  2 !{full anti range}
        !{-60 to -180}
assign (resi 10 and name O4'  )
        (resi 10 and name C1'  )
        (resi 10 and name N9   )
        (resi 10 and name C4   )   1.0   -120.0  60.0  2 !{full anti range}
        !{-60 to -180}
assign (resi 11 and name O4'  )
        (resi 11 and name C1'  )
        (resi 11 and name N1   )
        (resi 11 and name C2   )   1.0   -120.0  60.0  2 !{full anti range}
        !{-60 to -180}
assign (resi 12 and name O4'  )
        (resi 12 and name C1'  )
        (resi 12 and name N1   )
        (resi 12 and name C2   )   1.0   -120.0  60.0  2 !{full anti range}
        !{-60 to -180}
assign (resi 13 and name O4'  )
        (resi 13 and name C1'  )
        (resi 13 and name N1   )
        (resi 13 and name C2   )   1.0   -120.0  60.0  2 !{full anti range}
        !{-60 to -180}
assign (resi 14 and name O4'  )
        (resi 14 and name C1'  )
        (resi 14 and name N1   )
        (resi 14 and name C2   )   1.0   -120.0  60.0  2 !{full anti range}
        !{-60 to -180}
 assign (resi 15 and name O4' )
        (resi 15 and name C1' )
        (resi 15 and name N9  )
        (resi 15 and name C4  )   1.0      60.0  30.0  2 !{syn}

 assign (resi 16 and name O4'  )
        (resi 16 and name C1'  )
        (resi 16 and name N9   )
        (resi 16 and name C4   )   1.0   -120.0  60.0  2

assign (resi 17 and name O4'  )
        (resi 17 and name C1'  )
        (resi 17 and name N9   )
        (resi 17 and name C4   )   1.0   -130.0  70.0  2

assign (resi 18 and name O4'  )
        (resi 18 and name C1'  )
        (resi 18 and name N9   )
        (resi 18 and name C4   )   1.0   -130.0  70.0  2

assign (resi 19 and name O4'  )
        (resi 19 and name C1'  )
        (resi 19 and name N1   )
        (resi 19 and name C2   )   1.0   -130.0  70.0  2

assign (resi 20 and name O4'  )
        (resi 20 and name C1'  )
        (resi 20 and name N9   )
        (resi 20 and name C4   )   1.0   -130.0  70.0  2

 assign (resi 21 and name O4'  )
        (resi 21 and name C1'  )
        (resi 21 and name N9   )
        (resi 21 and name C4   )   1.0   -159.0  21.0  2

assign (resi 22 and name O4'  )
        (resi 22 and name C1'  )
        (resi 22 and name N1   )
        (resi 22 and name C2   )   1.0   -159.0  21.0  2 

assign (resi 23 and name O4'  )
        (resi 23 and name C1'  )
        (resi 23 and name N9   )
        (resi 23 and name C4   )   1.0   -159.0  21.0  2 

assign (resi 24 and name O4'  )
        (resi 24 and name C1'  )
        (resi 24 and name N1   )
        (resi 24 and name C2   )   1.0   -159.0  21.0  2 

assign (resi 25 and name O4'  )
        (resi 25 and name C1'  )
        (resi 25 and name N1   )
        (resi 25 and name C2   )   1.0   -159.0  21.0  2 

assign (resi 26 and name O4'  )
        (resi 26 and name C1'  )
        (resi 26 and name N1   )
        (resi 26 and name C2   )   1.0   -120.0  60.0  2 !{full anti range}
        !{-60 to -180}
 assign (resi 2 and name  P   )
        (resi 2 and name O5'  )
        (resi 2 and name C5'  )
        (resi 2 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 3 and name  P   )
        (resi 3 and name O5'  )
        (resi 3 and name C5'  )
        (resi 3 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 4 and name  P   )
        (resi 4 and name O5'  )
        (resi 4 and name C5'  )
        (resi 4 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 5 and name  P   )
        (resi 5 and name O5'  )
        (resi 5 and name C5'  )
        (resi 5 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 6 and name  P   )
        (resi 6 and name O5'  )
        (resi 6 and name C5'  )
        (resi 6 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 7 and name  P   )
        (resi 7 and name O5'  )
        (resi 7 and name C5'  )
        (resi 7 and name C4'  )   1.0   180.0  30.0  2

assign  (resi 8 and name  P   )
        (resi 8 and name O5'  )
        (resi 8 and name C5'  )
        (resi 8 and name C4'  )   1.0   98.0  30.0  2 

assign  (resi 9 and name  P   )
        (resi 9 and name O5'  )
        (resi 9 and name C5'  )
        (resi 9 and name C4'  )   1.0   142.0  30.0  2

assign  (resi 10 and name  P   )
        (resi 10 and name O5'  )
        (resi 10 and name C5'  )
        (resi 10 and name C4'  )   1.0   -154.0  30.0  2 

!assign (resi 11 and name  P   )
!        (resi 11 and name O5'  )
!        (resi 11 and name C5'  )
!       (resi 11 and name  C4'  )   1.0   +-.0  60.0  2 

assign  (resi 12 and name  P   )
        (resi 12 and name O5'  )
        (resi 12 and name C5'  )
        (resi 12 and name C4'  )   1.0   -150.0  30.0  2 

assign  (resi 13 and name  P   )
        (resi 13 and name O5'  )
        (resi 13 and name C5'  )
        (resi 13 and name C4'  )   1.0   -142.0  30.0  2 

assign  (resi 14 and name  P   )
        (resi 14 and name O5'  )
        (resi 14 and name C5'  )
        (resi 14 and name C4'  )   1.0  -149.0  30.0  2 

assign  (resi 15 and name  P  )
        (resi 15 and name O5' )
        (resi 15 and name C5' )
        (resi 15 and name C4' )   1.0    149.0  30.0  2 

assign  (resi 16 and name  P   )
        (resi 16 and name O5'  )
        (resi 16 and name C5'  )
        (resi 16 and name C4'  )   1.0   144.0  30.0  2

 assign (resi 17 and name  P   )
        (resi 17 and name O5'  )
        (resi 17 and name C5'  )
        (resi 17 and name C4'  )   1.0   143.0   30.0  2

assign  (resi 18 and name  P   )
        (resi 18 and name O5'  )
        (resi 18 and name C5'  )
        (resi 18 and name C4'  )   1.0   -138.0  30.0  2

assign  (resi 19 and name  P   )
        (resi 19 and name O5'  )
        (resi 19 and name C5'  )
        (resi 19 and name C4'  )   1.0   139.0  30.0  2

!assign (resi 20 and name  P   )
!       (resi 20 and name O5'  )
!       (resi 20 and name C5'  )
!       (resi 20 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 21 and name  P   )
        (resi 21 and name O5'  )
        (resi 21 and name C5'  )
        (resi 21 and name C4'  )   1.0   -154.0  30.0  2

assign  (resi 22 and name  P   )
        (resi 22 and name O5'  )
        (resi 22 and name C5'  )
        (resi 22 and name C4'  )   1.0   180.0  30.0  2 

assign  (resi 23 and name  P   )
        (resi 23 and name O5'  )
        (resi 23 and name C5'  )
        (resi 23 and name C4'  )   1.0   180.0  30.0  2 

assign  (resi 24 and name  P   )
        (resi 24 and name O5'  )
        (resi 24 and name C5'  )
        (resi 24 and name C4'  )   1.0   180.0  30.0  2 

assign  (resi 25 and name  P   )
        (resi 25 and name O5'  )
        (resi 25 and name C5'  )
        (resi 25 and name C4'  )   1.0   180.0  30.0  2 

assign  (resi 26 and name  P   )
        (resi 26 and name O5'  )
        (resi 26 and name C5'  )
        (resi 26 and name C4'  )   1.0   180.0  30.0  2
!assign (resi   1 and name C5'  )
!       (resi   1 and name C4'  )
!       (resi   1 and name C3'  )
!       (resi   1 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   2 and name C5'  )
        (resi   2 and name C4'  )
        (resi   2 and name C3'  )
        (resi   2 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   3 and name C5'  )
        (resi   3 and name C4'  )
        (resi   3 and name C3'  )
        (resi   3 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   4 and name C5'  )
        (resi   4 and name C4'  )
        (resi   4 and name C3'  )
        (resi   4 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   5 and name C5'  )
        (resi   5 and name C4'  )
        (resi   5 and name C3'  )
        (resi   5 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   6 and name C5'  )
        (resi   6 and name C4'  )
        (resi   6 and name C3'  )
        (resi   6 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   7 and name C5'  )
        (resi   7 and name C4'  )
        (resi   7 and name C3'  )
        (resi   7 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   8 and name C5'  )
        (resi   8 and name C4'  )
        (resi   8 and name C3'  )
        (resi   8 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   9 and name C5'  )
        (resi   9 and name C4'  )
        (resi   9 and name C3'  )
        (resi   9 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   10 and name C5'  )
        (resi   10 and name C4'  )
        (resi   10 and name C3'  )
        (resi   10 and name O3'  )   5.0    145.0     30.0  2 {*delta*}

assign  (resi   11 and name C5'  )
        (resi   11 and name C4'  )
        (resi   11 and name C3'  )
        (resi   11 and name O3'  )   5.0    145.0    30.0  2 {*delta*}

assign  (resi   12 and name C5'  )
        (resi   12 and name C4'  )
        (resi   12 and name C3'  )
        (resi   12 and name O3'  )   5.0    145.0    30.0  2 {*delta*}

assign  (resi   13 and name C5'  )
        (resi   13 and name C4'  )
        (resi   13 and name C3'  )
        (resi   13 and name O3'  )   5.0    145.0   30.0  2 {*delta*}

assign  (resi   14 and name C5'  )
        (resi   14 and name C4'  )
        (resi   14 and name C3'  )
        (resi   14 and name O3'  )   5.0    145.0    30.0  2 {*delta*}

assign  (resi   15 and name C5'  )
        (resi   15 and name C4'  )
        (resi   15 and name C3'  )
        (resi   15 and name O3'  )   5.0    145.0     30.0  2 {*delta*}

assign  (resi   16 and name C5'  )
        (resi   16 and name C4'  )
        (resi   16 and name C3'  )
        (resi   16 and name O3'  )   5.0    145.0     30.0  2 {*delta*}

assign  (resi   17 and name C5'  )
        (resi   17 and name C4'  )
        (resi   17 and name C3'  )
        (resi   17 and name O3'  )   5.0    145.0     30.0  2 {*delta*}

assign  (resi   18 and name C5'  )
        (resi   18 and name C4'  )
        (resi   18 and name C3'  )
        (resi   18 and name O3'  )   5.0    145.0     30.0  2 {*delta*}

assign  (resi   19 and name C5'  )
        (resi   19 and name C4'  )
        (resi   19 and name C3'  )
        (resi   19 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   20 and name C5'  )
        (resi   20 and name C4'  )
        (resi   20 and name C3'  )
        (resi   20 and name O3'  )   5.0    82.0      20.0  2 {*delta*}

assign  (resi   21 and name C5'  )
        (resi   21 and name C4'  )
        (resi   21 and name C3'  )
        (resi   21 and name O3'  )   5.0    82.0     20.0  2 {*delta*}

assign  (resi   22 and name C5'  )
        (resi   22 and name C4'  )
        (resi   22 and name C3'  )
        (resi   22 and name O3'  )   5.0    82.0     20.0  2 {*delta*}

assign  (resi   23 and name C5'  )
        (resi   23 and name C4'  )
        (resi   23 and name C3'  )
        (resi   23 and name O3'  )   5.0    82.0     20.0  2 {*delta*}

assign  (resi   24 and name C5'  )
        (resi   24 and name C4'  )
        (resi   24 and name C3'  )
        (resi   24 and name O3'  )   5.0    82.0     20.0  2 {*delta*}

assign  (resi   25 and name C5'  )
        (resi   25 and name C4'  )
        (resi   25 and name C3'  )
        (resi   25 and name O3'  )   5.0    82.0     20.0  2 {*delta*}

!assign  (resi   26 and name C5'  )
!        (resi   26 and name C4'  )
!        (resi   26 and name C3'  )
!        (resi   26 and name O3'  )   5.0    82.0     20.0  2 {*delta*}
 assign (resi 1 and name C4'  )
        (resi 1 and name C3'  )
        (resi 1 and name O3'  )
        (resi 2 and name  P   )   1.0   -153.0  30.0  2 

 assign (resi 2 and name C4'  )
        (resi 2 and name C3'  )
        (resi 2 and name O3'  )
        (resi 3 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 3 and name C4'  )
        (resi 3 and name C3'  )
        (resi 3 and name O3'  )
        (resi 4 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 4 and name C4'  )
        (resi 4 and name C3'  )
        (resi 4 and name O3'  )
        (resi 5 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 5 and name C4'  )
        (resi 5 and name C3'  )
        (resi 5 and name O3'  )
        (resi 6 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 6 and name C4'  )
        (resi 6 and name C3'  )
        (resi 6 and name O3'  )
        (resi 7 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 7 and name C4'  )
        (resi 7 and name C3'  )
        (resi 7 and name O3'  )
        (resi 8 and name  P   )   1.0   -153.0  30.0  2

assign (resi 8 and name C4'  )
        (resi 8 and name C3'  )
        (resi 8 and name O3'  )
        (resi 9 and name  P   )   1.0   -128.0  30.0  2 

assign (resi 9 and name C4'  )
        (resi 9 and name C3'  )
        (resi 9 and name O3'  )
        (resi 10 and name  P   )   1.0   -153.0  30.0  2

assign (resi 10 and name C4'  )
        (resi 10 and name C3'  )
        (resi 10 and name O3'  )
        (resi 11 and name  P   )   1.0   -117.0  30.0  2 

!assign (resi 11 and name C4'  )
!        (resi 11 and name C3'  )
!        (resi 11 and name O3'  )
!       (resi 12 and name  P   )   1.0   -120.0  60.0  2 

assign (resi 12 and name C4'  )
        (resi 12 and name C3'  )
        (resi 12 and name O3'  )
        (resi 13 and name  P   )   1.0   -130.0  30.0  2 

assign (resi 13 and name C4'  )
        (resi 13 and name C3'  )
        (resi 13 and name O3'  )
        (resi 14 and name  P   )   1.0   -136.0  30.0  2 

assign (resi 14 and name C4'  )
        (resi 14 and name C3'  )
        (resi 14 and name O3'  )
        (resi 15 and name  P   )   1.0   -126.0  30.0  2 

 assign (resi 15 and name C4' )
        (resi 15 and name C3' )
        (resi 15 and name O3' )
        (resi 16 and name  P  )   1.0    -129.0  30.0  2 

 assign (resi 16 and name C4'  )
        (resi 16 and name C3'  )
        (resi 16 and name O3'  )
        (resi 17 and name  P   )   1.0   -116.0  30.0  2

 assign (resi 17 and name C4'  )
        (resi 17 and name C3'  )
        (resi 17 and name O3'  )
        (resi 18 and name  P   )   1.0   -98.0   30.0  2

 assign (resi 18 and name C4'  )
        (resi 18 and name C3'  )
        (resi 18 and name O3'  )
        (resi 19 and name  P   )   1.0   -117.0  30.0  2

! assign (resi 19 and name C4'  )
!       (resi 19 and name C3'  )
!       (resi 19 and name O3'  )
!       (resi 20 and name  P   )   1.0   -153.0  30.0  2

!assign (resi 20 and name C4'  )
!       (resi 20 and name C3'  )
!       (resi 20 and name O3'  )
!       (resi 21 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 21 and name C4'  )
        (resi 21 and name C3'  )
        (resi 21 and name O3'  )
        (resi 22 and name  P   )   1.0   -153.0  30.0  2

assign (resi 22 and name C4'  )
        (resi 22 and name C3'  )
        (resi 22 and name O3'  )
        (resi 23 and name  P   )   1.0   -153.0  30.0  2 

assign (resi 23 and name C4'  )
        (resi 23 and name C3'  )
        (resi 23 and name O3'  )
        (resi 24 and name  P   )   1.0   -153.0  30.0  2 

assign (resi 24 and name C4'  )
        (resi 24 and name C3'  )
        (resi 24 and name O3'  )
        (resi 25 and name  P   )   1.0   -153.0  30.0  2 

assign (resi 25 and name C4'  )
        (resi 25 and name C3'  )
        (resi 25 and name O3'  )
        (resi 26 and name  P   )   1.0   -153.0  30.0  2 

!RDC for SNRE: 1.12.2002
!1DCH derived from signal splitting in F2
!error was estimated to be 10 %
!the smallest error is however estimated to be 1.5 Hz

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 2   and name H8  )
        ( resid 2   and name C8  )  17.73  1.8  1.8

assign ( resid 500 and name OO  )
       ( resid 500 and name Z   )
       ( resid 500 and name X   )
       ( resid 500 and name Y   )
       ( resid 7   and name H8  )
       ( resid 7   and name C8  )  22.13  2.2  2.2

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 9   and name H2  )
        ( resid 9   and name C2  )  26.97  2.7  2.7

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 10  and name H8  )
        ( resid 10  and name C8  )  23.24  2.3  2.3

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 10  and name H2  )
        ( resid 10  and name C2  )  21.88  2.2  2.2

!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 11  and name H6  )
!        ( resid 11  and name C6  )   -3.77  1.5  1.5  !exception in error *
!
!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 11  and name H5  )
!        ( resid 11  and name C5  )   -1.12  1.5  1.5 !exception in error *
!
!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 12  and name H6  )
!        ( resid 12  and name C6  )    5.42  1.5  1.5 !exception in error  *
!
!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 13  and name H6  )
!        ( resid 13  and name C6  )   12.06  1.5  1.5 !exception in error *
!
!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 14  and name H6  )
!        ( resid 14  and name C6  )   17.41  1.7  1.7
!
!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 16  and name H2  )
!        ( resid 16  and name C2  )   20.71  2.1  2.1

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 17  and name H2  )
        ( resid 17  and name C2  )   26.39  2.6  2.6

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 21  and name H8  )
        ( resid 21  and name C8  )   27.78  2.8  2.8

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 23  and name H8  )
        ( resid 23  and name C8  )   24.46  2.4  2.4

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 26  and name H6  )
        ( resid 26  and name C6  )   28.79  2.9  2.9


  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1   1H5*    G   1          2H5*        G   1  -6.397  11.311   3.607
    2   2H5*    G   1          1H5*        G   1  -7.725  10.184   3.261
    3    H4*    G   1           H4*        G   1  -5.791  10.157   5.595
    4    H3*    G   1           H3*        G   1  -6.509   8.320   3.292
    5    H2*    G   1           H2*        G   1  -6.121   6.417   4.679
    6   2HO*    G   1          2HO*        G   1  -5.092   6.806   6.819
    7    H1*    G   1           H1*        G   1  -7.147   7.435   7.035
    8    H8     G   1           H8         G   1  -9.375   8.219   4.077
    9    H1     G   1           H1         G   1 -10.147   2.283   6.272
   10   1H2     G   1          H21         G   1  -8.569   1.812   7.758
   11   2H2     G   1          H22         G   1  -7.329   2.961   8.208
   12    H5T    G   1           H5T        G   1  -8.710  11.003   5.227
   13   1H5*    G   2          2H5*        G   2  -2.636   7.402   5.434
   14   2H5*    G   2          1H5*        G   2  -1.463   6.706   4.298
   15    H4*    G   2           H4*        G   2  -1.866   5.360   6.421
   16    H3*    G   2           H3*        G   2  -2.124   4.282   3.608
   17    H2*    G   2           H2*        G   2  -2.841   2.175   4.407
   18   2HO*    G   2          2HO*        G   2  -1.415   2.966   6.634
   19    H1*    G   2           H1*        G   2  -4.502   3.015   6.391
   20    H8     G   2           H8         G   2  -4.664   5.272   3.328
   21    H1     G   2           H1         G   2  -8.358   0.093   2.872
   22   1H2     G   2          H21         G   2  -7.936  -1.290   4.555
   23   2H2     G   2          H22         G   2  -6.746  -0.936   5.786
   24   1H5*    A   3          2H5*        A   3  -1.579   0.834   5.902
   25   2H5*    A   3          1H5*        A   3   0.039   0.274   5.436
   26    H4*    A   3           H4*        A   3  -1.606  -1.539   5.197
   27    H3*    A   3           H3*        A   3  -0.178  -0.409   2.809
   28    H2*    A   3           H2*        A   3  -1.763  -1.180   1.320
   29   2HO*    A   3          2HO*        A   3  -2.389  -3.435   1.480
   30    H1*    A   3           H1*        A   3  -3.523  -2.382   3.406
   31    H8     A   3           H8         A   3  -3.684   1.111   1.788
   32   1H6     A   3          H61         A   3  -8.379  -1.080  -1.541
   33   2H6     A   3          H62         A   3  -7.436   0.341  -1.154
   34    H2     A   3           H2         A   3  -6.674  -4.471   0.865
   35   1H5*    C   4          2H5*        C   4   1.099  -5.496   2.949
   36   2H5*    C   4          1H5*        C   4   1.715  -5.543   1.285
   37    H4*    C   4           H4*        C   4  -0.534  -6.895   2.261
   38    H3*    C   4           H3*        C   4   0.554  -6.241  -0.492
   39    H2*    C   4           H2*        C   4  -1.450  -6.899  -1.495
   40   2HO*    C   4          2HO*        C   4  -2.732  -8.503  -0.667
   41    H1*    C   4           H1*        C   4  -3.202  -6.357   0.673
   42   1H4     C   4          H41         C   4  -4.623  -2.405  -4.128
   43   2H4     C   4          H42         C   4  -3.373  -1.308  -3.586
   44    H5     C   4           H5         C   4  -1.842  -1.831  -1.799
   45    H6     C   4           H6         C   4  -1.181  -3.517  -0.147
   46   1H5*    A   5          2H5*        A   5   1.626 -10.467  -3.100
   47   2H5*    A   5          1H5*        A   5   1.204  -8.768  -3.398
   48    H4*    A   5           H4*        A   5  -0.595 -11.205  -3.620
   49    H3*    A   5           H3*        A   5   0.607  -9.193  -5.531
   50    H2*    A   5           H2*        A   5  -1.379  -9.096  -6.793
   51   2HO*    A   5          2HO*        A   5  -2.549 -11.284  -5.433
   52    H1*    A   5           H1*        A   5  -3.216  -9.313  -4.742
   53    H8     A   5           H8         A   5  -0.702  -6.855  -3.562
   54   1H6     A   5          H61         A   5  -3.282  -2.641  -7.234
   55   2H6     A   5          H62         A   5  -2.150  -2.904  -5.927
   56    H2     A   5           H2         A   5  -4.965  -6.661  -8.331
   57   1H5*    C   6          2H5*        C   6  -1.584 -11.712  -8.035
   58   2H5*    C   6          1H5*        C   6  -0.386 -12.646  -8.955
   59    H4*    C   6           H4*        C   6  -1.973 -11.907 -10.567
   60    H3*    C   6           H3*        C   6   0.580 -10.280 -10.498
   61    H2*    C   6           H2*        C   6  -0.244  -8.812 -12.143
   62   2HO*    C   6          2HO*        C   6  -2.244 -10.787 -12.685
   63    H1*    C   6           H1*        C   6  -2.906  -8.759 -11.380
   64   1H4     C   6          H41         C   6  -0.356  -3.388  -9.136
   65   2H4     C   6          H42         C   6   0.531  -4.274  -7.916
   66    H5     C   6           H5         C   6   0.520  -6.677  -7.761
   67    H6     C   6           H6         C   6  -0.343  -8.751  -8.742
   68   1H5*    G   7          2H5*        G   7   1.179 -10.604 -15.264
   69   2H5*    G   7          1H5*        G   7   2.730  -9.844 -14.854
   70    H4*    G   7           H4*        G   7   0.417  -8.572 -15.862
   71    H3*    G   7           H3*        G   7   3.091  -7.679 -14.749
   72    H2*    G   7           H2*        G   7   2.307  -5.418 -14.643
   73   2HO*    G   7          2HO*        G   7   0.128  -4.982 -15.586
   74    H1*    G   7           H1*        G   7  -0.180  -5.930 -13.659
   75    H8     G   7           H8         G   7   1.899  -8.373 -11.841
   76    H1     G   7           H1         G   7   3.144  -2.425  -9.910
   77   1H2     G   7          H21         G   7   2.249  -0.967 -11.321
   78   2H2     G   7          H22         G   7   1.347  -1.460 -12.736
   79   1H5*    A   8          2H5*        A   8   2.901  -8.322 -19.198
   80   2H5*    A   8          1H5*        A   8   3.339  -7.339 -20.610
   81    H4*    A   8           H4*        A   8   0.867  -8.332 -20.269
   82    H3*    A   8           H3*        A   8   1.887  -5.808 -21.562
   83    H2*    A   8           H2*        A   8  -0.309  -4.904 -21.782
   84   2HO*    A   8          2HO*        A   8  -1.181  -6.945 -22.582
   85    H1*    A   8           H1*        A   8  -1.353  -5.687 -19.394
   86    H8     A   8           H8         A   8   1.819  -4.698 -18.064
   87   1H6     A   8          H61         A   8   0.668   1.205 -19.385
   88   2H6     A   8          H62         A   8   1.687   0.110 -18.478
   89    H2     A   8           H2         A   8  -2.280  -1.328 -21.643
   90   1H5*    A   9          2H5*        A   9  -0.403  -6.765 -25.683
   91   2H5*    A   9          1H5*        A   9   0.911  -5.883 -26.486
   92    H4*    A   9           H4*        A   9  -1.685  -4.957 -26.134
   93    H3*    A   9           H3*        A   9   0.974  -3.646 -26.767
   94    H2*    A   9           H2*        A   9   0.037  -1.510 -26.482
   95   2HO*    A   9          2HO*        A   9  -2.117  -2.730 -27.537
   96    H1*    A   9           H1*        A   9  -1.793  -2.117 -24.460
   97    H8     A   9           H8         A   9   1.158  -3.452 -22.940
   98   1H6     A   9          H61         A   9   3.498   2.206 -22.247
   99   2H6     A   9          H62         A   9   3.637   0.531 -21.761
  100    H2     A   9           H2         A   9   0.074   2.455 -25.147
  101   1H5*    A  10          2H5*        A  10  -1.242  -0.626 -28.056
  102   2H5*    A  10          1H5*        A  10  -0.773  -0.375 -29.750
  103    H4*    A  10           H4*        A  10  -0.237   1.571 -28.264
  104    H3*    A  10           H3*        A  10   1.352   0.466 -30.289
  105    H2*    A  10           H2*        A  10   2.935  -0.579 -28.857
  106   2HO*    A  10          2HO*        A  10   4.246   1.726 -28.290
  107    H1*    A  10           H1*        A  10   2.713   1.726 -26.905
  108    H8     A  10           H8         A  10   2.657  -2.160 -27.080
  109   1H6     A  10          H61         A  10   6.614  -1.969 -22.366
  110   2H6     A  10          H62         A  10   5.731  -3.015 -23.457
  111    H2     A  10           H2         A  10   5.550   2.257 -23.465
  112   1H5*    U  11          2H5*        U  11   4.008   5.109 -32.223
  113   2H5*    U  11          1H5*        U  11   4.159   3.340 -32.206
  114    H4*    U  11           H4*        U  11   5.455   5.331 -30.312
  115    H3*    U  11           H3*        U  11   6.336   3.992 -32.731
  116    H2*    U  11           H2*        U  11   7.151   2.071 -31.677
  117   2HO*    U  11          2HO*        U  11   9.223   2.430 -31.457
  118    H1*    U  11           H1*        U  11   7.405   3.509 -29.032
  119    H3     U  11           H3         U  11   8.157  -0.284 -26.798
  120    H5     U  11           H5         U  11   5.742  -1.583 -29.999
  121    H6     U  11           H6         U  11   5.670   0.709 -30.789
  122   1H5*    C  12          2H5*        C  12   8.062   3.777 -35.380
  123   2H5*    C  12          1H5*        C  12   9.397   4.902 -35.059
  124    H4*    C  12           H4*        C  12   8.860   5.836 -37.047
  125    H3*    C  12           H3*        C  12   7.460   7.219 -35.086
  126    H2*    C  12           H2*        C  12   5.364   6.132 -35.438
  127   2HO*    C  12          2HO*        C  12   5.428   8.136 -37.483
  128    H1*    C  12           H1*        C  12   5.858   6.154 -38.424
  129   1H4     C  12          H41         C  12   0.745   2.398 -38.303
  130   2H4     C  12          H42         C  12   1.247   1.658 -36.799
  131    H5     C  12           H5         C  12   3.250   2.293 -35.620
  132    H6     C  12           H6         C  12   5.203   3.775 -35.628
  133   1H5*    C  13          2H5*        C  13   4.807  11.149 -36.728
  134   2H5*    C  13          1H5*        C  13   6.472  11.764 -36.708
  135    H4*    C  13           H4*        C  13   5.623  12.781 -34.808
  136    H3*    C  13           H3*        C  13   7.374  10.634 -34.308
  137    H2*    C  13           H2*        C  13   5.745   9.146 -33.441
  138   2HO*    C  13          2HO*        C  13   6.586  10.916 -31.399
  139    H1*    C  13           H1*        C  13   4.232  11.470 -32.230
  140   1H4     C  13          H41         C  13   0.257   6.582 -31.260
  141   2H4     C  13          H42         C  13   0.091   6.356 -32.986
  142    H5     C  13           H5         C  13   1.358   7.607 -34.609
  143    H6     C  13           H6         C  13   3.057   9.344 -34.928
  144   1H5*    C  14          2H5*        C  14   8.322   9.631 -31.777
  145   2H5*    C  14          1H5*        C  14   9.079  10.906 -30.801
  146    H4*    C  14           H4*        C  14  10.357   8.812 -30.641
  147    H3*    C  14           H3*        C  14  11.447  11.351 -31.306
  148    H2*    C  14           H2*        C  14  12.121  10.776 -33.501
  149   2HO*    C  14          2HO*        C  14  14.024  10.069 -31.615
  150    H1*    C  14           H1*        C  14  12.581   7.915 -32.618
  151   1H4     C  14          H41         C  14  13.371   7.655 -38.955
  152   2H4     C  14          H42         C  14  11.652   7.899 -39.167
  153    H5     C  14           H5         C  14  10.153   8.382 -37.344
  154    H6     C  14           H6         C  14   9.978   8.736 -34.925
  155   1H5*    G  15          2H5*        G  15  11.320  10.208 -26.415
  156   2H5*    G  15          1H5*        G  15  10.892   8.610 -27.060
  157    H4*    G  15           H4*        G  15   9.006  10.972 -26.701
  158    H3*    G  15           H3*        G  15   9.772   8.724 -24.955
  159    H2*    G  15           H2*        G  15   7.752   7.563 -24.908
  160   2HO*    G  15          2HO*        G  15   5.972   8.660 -24.589
  161    H1*    G  15           H1*        G  15   6.706   8.004 -27.358
  162    H8     G  15           H8         G  15   7.652   6.131 -29.024
  163    H1     G  15           H1         G  15  12.246   4.606 -24.875
  164   1H2     G  15          H21         G  15  12.346   6.126 -23.264
  165   2H2     G  15          H22         G  15  11.281   7.514 -23.212
  166   1H5*    A  16          2H5*        A  16   9.915   9.193 -20.655
  167   2H5*    A  16          1H5*        A  16  10.026   7.738 -21.667
  168    H4*    A  16           H4*        A  16   8.118   8.391 -19.457
  169    H3*    A  16           H3*        A  16  10.124   6.506 -19.780
  170    H2*    A  16           H2*        A  16   9.044   5.309 -21.543
  171   2HO*    A  16          2HO*        A  16   9.017   4.179 -19.180
  172    H1*    A  16           H1*        A  16   6.410   5.632 -20.070
  173    H8     A  16           H8         A  16   7.998   3.953 -22.827
  174   1H6     A  16          H61         A  16   2.934   4.576 -26.266
  175   2H6     A  16          H62         A  16   4.467   3.750 -26.105
  176    H2     A  16           H2         A  16   2.571   7.350 -22.748
  177   1H5*    A  17          2H5*        A  17   8.012   4.379 -17.737
  178   2H5*    A  17          1H5*        A  17   7.343   4.208 -16.101
  179    H4*    A  17           H4*        A  17   9.248   2.613 -15.593
  180    H3*    A  17           H3*        A  17  10.360   3.540 -17.978
  181    H2*    A  17           H2*        A  17   8.842   2.439 -19.444
  182   2HO*    A  17          2HO*        A  17  11.002   1.500 -19.697
  183    H1*    A  17           H1*        A  17   8.759   0.044 -17.600
  184    H8     A  17           H8         A  17   6.605   2.468 -19.742
  185   1H6     A  17          H61         A  17   3.365  -2.531 -21.308
  186   2H6     A  17          H62         A  17   3.547  -0.808 -21.545
  187    H2     A  17           H2         A  17   6.538  -3.788 -18.385
  188   1H5*    G  18          2H5*        G  18  11.332  -0.539 -14.578
  189   2H5*    G  18          1H5*        G  18  10.278   0.257 -15.764
  190    H4*    G  18           H4*        G  18   8.673   0.839 -14.090
  191    H3*    G  18           H3*        G  18  10.869   0.985 -12.314
  192    H2*    G  18           H2*        G  18  10.876  -1.324 -11.762
  193   2HO*    G  18          2HO*        G  18  10.380  -0.527  -9.776
  194    H1*    G  18           H1*        G  18   7.850  -1.333 -12.026
  195    H8     G  18           H8         G  18  10.657  -3.295 -10.926
  196    H1     G  18           H1         G  18   6.684  -7.023 -14.235
  197   1H2     G  18          H21         G  18   5.264  -5.778 -15.399
  198   2H2     G  18          H22         G  18   5.298  -4.030 -15.360
  199   1H5*    U  19          2H5*        U  19   6.141   3.408 -11.898
  200   2H5*    U  19          1H5*        U  19   6.226   1.856 -12.756
  201    H4*    U  19           H4*        U  19   5.685   4.573 -14.017
  202    H3*    U  19           H3*        U  19   3.938   2.269 -13.137
  203    H2*    U  19           H2*        U  19   2.653   2.368 -15.107
  204   2HO*    U  19          2HO*        U  19   2.192   4.246 -15.959
  205    H1*    U  19           H1*        U  19   4.655   2.905 -16.904
  206    H3     U  19           H3         U  19   2.823  -1.306 -17.424
  207    H5     U  19           H5         U  19   6.032  -1.730 -14.723
  208    H6     U  19           H6         U  19   6.176   0.690 -14.618
  209   1H5*    A  20          2H5*        A  20   0.494   5.917 -13.100
  210   2H5*    A  20          1H5*        A  20   1.266   4.344 -13.386
  211    H4*    A  20           H4*        A  20  -0.303   5.869 -15.500
  212    H3*    A  20           H3*        A  20  -1.180   3.891 -13.388
  213    H2*    A  20           H2*        A  20  -2.474   2.687 -14.950
  214   2HO*    A  20          2HO*        A  20  -3.223   3.574 -16.835
  215    H1*    A  20           H1*        A  20  -0.795   2.840 -17.116
  216    H8     A  20           H8         A  20   0.859   2.207 -13.713
  217   1H6     A  20          H61         A  20   0.072  -3.794 -14.857
  218   2H6     A  20          H62         A  20   0.778  -2.623 -13.766
  219    H2     A  20           H2         A  20  -1.981  -1.473 -18.113
  220   1H5*    G  21          2H5*        G  21  -6.555   4.208 -13.436
  221   2H5*    G  21          1H5*        G  21  -5.186   3.391 -12.655
  222    H4*    G  21           H4*        G  21  -6.205   2.965 -15.489
  223    H3*    G  21           H3*        G  21  -6.348   1.418 -12.898
  224    H2*    G  21           H2*        G  21  -5.900  -0.626 -14.003
  225   2HO*    G  21          2HO*        G  21  -6.117  -0.860 -16.239
  226    H1*    G  21           H1*        G  21  -3.993   0.234 -15.741
  227    H8     G  21           H8         G  21  -2.841   2.082 -12.870
  228    H1     G  21           H1         G  21  -2.375  -4.166 -11.692
  229   1H2     G  21          H21         G  21  -3.562  -5.310 -13.174
  230   2H2     G  21          H22         G  21  -4.470  -4.534 -14.453
  231   1H5*    U  22          2H5*        U  22 -10.019  -0.621 -14.470
  232   2H5*    U  22          1H5*        U  22 -10.998  -0.659 -12.990
  233    H4*    U  22           H4*        U  22  -9.978  -2.893 -13.957
  234    H3*    U  22           H3*        U  22 -10.097  -1.974 -11.067
  235    H2*    U  22           H2*        U  22  -8.950  -3.906 -10.387
  236   2HO*    U  22          2HO*        U  22  -9.695  -5.033 -12.910
  237    H1*    U  22           H1*        U  22  -7.363  -4.259 -12.682
  238    H3     U  22           H3         U  22  -4.955  -3.950  -8.737
  239    H5     U  22           H5         U  22  -5.406  -0.022 -10.198
  240    H6     U  22           H6         U  22  -6.991  -0.878 -11.823
  241   1H5*    G  23          2H5*        G  23 -11.550  -5.964 -10.757
  242   2H5*    G  23          1H5*        G  23 -13.236  -5.849 -10.213
  243    H4*    G  23           H4*        G  23 -12.261  -7.433  -8.751
  244    H3*    G  23           H3*        G  23 -12.421  -4.655  -7.558
  245    H2*    G  23           H2*        G  23 -11.307  -5.363  -5.614
  246   2HO*    G  23          2HO*        G  23 -12.767  -7.332  -5.598
  247    H1*    G  23           H1*        G  23  -9.583  -7.225  -6.755
  248    H8     G  23           H8         G  23  -9.905  -3.777  -8.407
  249    H1     G  23           H1         G  23  -5.445  -4.085  -3.860
  250   1H2     G  23          H21         G  23  -5.554  -6.046  -2.825
  251   2H2     G  23          H22         G  23  -6.723  -7.273  -3.257
  252   1H5*    U  24          2H5*        U  24 -14.267  -8.180  -4.424
  253   2H5*    U  24          1H5*        U  24 -14.985  -7.021  -3.286
  254    H4*    U  24           H4*        U  24 -13.001  -8.763  -2.617
  255    H3*    U  24           H3*        U  24 -13.794  -6.041  -1.556
  256    H2*    U  24           H2*        U  24 -11.883  -5.958  -0.180
  257   2HO*    U  24          2HO*        U  24 -10.794  -7.775   0.483
  258    H1*    U  24           H1*        U  24 -10.079  -7.179  -1.878
  259    H3     U  24           H3         U  24  -8.727  -2.874  -1.295
  260    H5     U  24           H5         U  24 -11.890  -2.631  -4.071
  261    H6     U  24           H6         U  24 -12.322  -4.987  -3.684
  262   1H5*    C  25          2H5*        C  25 -11.971  -8.413   2.250
  263   2H5*    C  25          1H5*        C  25 -13.437  -8.124   3.208
  264    H4*    C  25           H4*        C  25 -11.209  -7.322   4.219
  265    H3*    C  25           H3*        C  25 -13.753  -5.735   3.939
  266    H2*    C  25           H2*        C  25 -12.689  -3.717   4.285
  267   2HO*    C  25          2HO*        C  25 -10.654  -4.281   5.931
  268    H1*    C  25           H1*        C  25  -9.931  -4.764   4.217
  269   1H4     C  25          H41         C  25  -9.675   0.646   0.895
  270   2H4     C  25          H42         C  25 -10.903   0.077  -0.213
  271    H5     C  25           H5         C  25 -12.031  -2.037   0.040
  272    H6     C  25           H6         C  25 -12.223  -4.062   1.408
  273   1H5*    C  26          2H5*        C  26 -11.227  -5.907   7.247
  274   2H5*    C  26          1H5*        C  26 -11.837  -6.359   8.852
  275    H4*    C  26           H4*        C  26 -10.123  -4.873   9.399
  276    H3*    C  26           H3*        C  26 -12.733  -3.364   9.119
  277    H2*    C  26           H2*        C  26 -11.655  -1.349   9.607
  278   2HO*    C  26          2HO*        C  26 -10.317  -1.493  11.246
  279    H1*    C  26           H1*        C  26  -9.272  -1.885   8.276
  280   1H4     C  26          H41         C  26 -12.565   1.961   4.435
  281   2H4     C  26          H42         C  26 -13.691   0.678   4.054
  282    H5     C  26           H5         C  26 -13.608  -1.501   5.082
  283    H6     C  26           H6         C  26 -12.426  -2.917   6.695
  284    H3T    C  26           H3T        C  26 -11.804  -3.224  11.524
  Start of MODEL    2
    1   1H5*    G   1          2H5*        G   1  -7.427  10.105   5.960
    2   2H5*    G   1          1H5*        G   1  -8.563  10.961   7.024
    3    H4*    G   1           H4*        G   1  -7.469   9.734   8.975
    4    H3*    G   1           H3*        G   1  -5.597   8.920   7.010
    5    H2*    G   1           H2*        G   1  -6.982   7.218   6.047
    6   2HO*    G   1          2HO*        G   1  -6.016   6.048   8.478
    7    H1*    G   1           H1*        G   1  -8.198   6.717   8.777
    8    H8     G   1           H8         G   1 -10.171   7.775   5.724
    9    H1     G   1           H1         G   1 -10.386   1.491   6.777
   10   1H2     G   1          H21         G   1  -8.920   0.934   8.347
   11   2H2     G   1          H22         G   1  -7.892   2.112   9.132
   12    H5T    G   1           H5T        G   1  -6.554  12.078   6.498
   13   1H5*    G   2          2H5*        G   2  -2.256   6.094   7.795
   14   2H5*    G   2          1H5*        G   2  -3.869   6.303   7.081
   15    H4*    G   2           H4*        G   2  -3.281   4.027   8.993
   16    H3*    G   2           H3*        G   2  -2.575   4.281   6.060
   17    H2*    G   2           H2*        G   2  -3.458   2.169   5.596
   18   2HO*    G   2          2HO*        G   2  -3.602   1.344   8.280
   19    H1*    G   2           H1*        G   2  -5.414   2.056   7.632
   20    H8     G   2           H8         G   2  -5.454   4.999   5.196
   21    H1     G   2           H1         G   2  -8.778  -0.061   3.195
   22   1H2     G   2          H21         G   2  -8.431  -1.781   4.552
   23   2H2     G   2          H22         G   2  -7.381  -1.679   5.948
   24   1H5*    A   3          2H5*        A   3   0.025   0.800   4.588
   25   2H5*    A   3          1H5*        A   3  -1.577   1.353   4.059
   26    H4*    A   3           H4*        A   3  -1.044  -1.318   5.417
   27    H3*    A   3           H3*        A   3  -1.115  -0.489   2.504
   28    H2*    A   3           H2*        A   3  -2.381  -2.384   1.946
   29   2HO*    A   3          2HO*        A   3  -2.001  -4.263   2.865
   30    H1*    A   3           H1*        A   3  -3.856  -2.628   4.305
   31    H8     A   3           H8         A   3  -3.989   0.886   2.958
   32   1H6     A   3          H61         A   3  -8.398  -1.003  -0.902
   33   2H6     A   3          H62         A   3  -7.547   0.386  -0.266
   34    H2     A   3           H2         A   3  -6.648  -4.629   1.096
   35   1H5*    C   4          2H5*        C   4   1.028  -4.707   2.832
   36   2H5*    C   4          1H5*        C   4   1.585  -5.061   1.183
   37    H4*    C   4           H4*        C   4  -0.431  -6.413   2.376
   38    H3*    C   4           H3*        C   4   0.144  -5.731  -0.512
   39    H2*    C   4           H2*        C   4  -1.956  -6.544  -1.205
   40   2HO*    C   4          2HO*        C   4  -1.610  -8.169   0.985
   41    H1*    C   4           H1*        C   4  -3.481  -5.712   0.929
   42   1H4     C   4          H41         C   4  -4.235  -1.515  -3.822
   43   2H4     C   4          H42         C   4  -2.921  -0.563  -3.167
   44    H5     C   4           H5         C   4  -1.555  -1.292  -1.323
   45    H6     C   4           H6         C   4  -1.150  -3.093   0.291
   46   1H5*    A   5          2H5*        A   5   1.630  -9.693  -3.220
   47   2H5*    A   5          1H5*        A   5   0.971  -8.056  -3.409
   48    H4*    A   5           H4*        A   5  -0.516 -10.694  -3.669
   49    H3*    A   5           H3*        A   5   0.414  -8.529  -5.558
   50    H2*    A   5           H2*        A   5  -1.607  -8.587  -6.768
   51   2HO*    A   5          2HO*        A   5  -3.097 -10.508  -5.916
   52    H1*    A   5           H1*        A   5  -3.363  -8.963  -4.690
   53    H8     A   5           H8         A   5  -1.185  -6.410  -3.263
   54   1H6     A   5          H61         A   5  -3.597  -2.220  -7.081
   55   2H6     A   5          H62         A   5  -2.617  -2.461  -5.652
   56    H2     A   5           H2         A   5  -4.837  -6.293  -8.517
   57   1H5*    C   6          2H5*        C   6  -1.530 -10.600  -7.991
   58   2H5*    C   6          1H5*        C   6  -0.487 -11.785  -8.804
   59    H4*    C   6           H4*        C   6  -1.758 -11.106 -10.607
   60    H3*    C   6           H3*        C   6   0.607  -9.223 -10.368
   61    H2*    C   6           H2*        C   6  -0.228  -7.897 -12.125
   62   2HO*    C   6          2HO*        C   6  -1.000  -8.918 -13.801
   63    H1*    C   6           H1*        C   6  -2.942  -8.146 -11.581
   64   1H4     C   6          H41         C   6  -1.164  -2.403  -9.499
   65   2H4     C   6          H42         C   6  -0.370  -3.119  -8.114
   66    H5     C   6           H5         C   6  -0.190  -5.496  -7.778
   67    H6     C   6           H6         C   6  -0.730  -7.703  -8.697
   68   1H5*    G   7          2H5*        G   7   0.488  -9.886 -14.833
   69   2H5*    G   7          1H5*        G   7   2.117  -9.321 -15.254
   70    H4*    G   7           H4*        G   7  -0.116  -7.875 -15.744
   71    H3*    G   7           H3*        G   7   2.737  -7.075 -15.128
   72    H2*    G   7           H2*        G   7   2.108  -4.768 -15.043
   73   2HO*    G   7          2HO*        G   7  -0.406  -4.561 -15.597
   74    H1*    G   7           H1*        G   7  -0.220  -5.053 -13.660
   75    H8     G   7           H8         G   7   1.965  -7.532 -12.026
   76    H1     G   7           H1         G   7   3.869  -1.590 -10.717
   77   1H2     G   7          H21         G   7   2.852  -0.155 -12.065
   78   2H2     G   7          H22         G   7   1.704  -0.662 -13.285
   79   1H5*    A   8          2H5*        A   8   1.928  -8.487 -19.213
   80   2H5*    A   8          1H5*        A   8   2.330  -7.912 -20.843
   81    H4*    A   8           H4*        A   8  -0.185  -8.319 -20.184
   82    H3*    A   8           H3*        A   8   1.030  -6.032 -21.747
   83    H2*    A   8           H2*        A   8  -1.089  -4.943 -21.881
   84   2HO*    A   8          2HO*        A   8  -2.995  -6.026 -21.678
   85    H1*    A   8           H1*        A   8  -2.001  -5.514 -19.355
   86    H8     A   8           H8         A   8   1.305  -4.535 -18.386
   87   1H6     A   8          H61         A   8   0.193   1.289 -20.048
   88   2H6     A   8          H62         A   8   1.262   0.232 -19.154
   89    H2     A   8           H2         A   8  -3.013  -1.306 -21.832
   90   1H5*    A   9          2H5*        A   9  -1.528  -6.576 -23.784
   91   2H5*    A   9          1H5*        A   9  -1.710  -7.300 -25.395
   92    H4*    A   9           H4*        A   9  -2.534  -5.147 -25.757
   93    H3*    A   9           H3*        A   9   0.428  -5.254 -26.392
   94    H2*    A   9           H2*        A   9   0.479  -2.949 -26.774
   95   2HO*    A   9          2HO*        A   9  -1.435  -3.250 -28.245
   96    H1*    A   9           H1*        A   9  -1.646  -2.192 -25.057
   97    H8     A   9           H8         A   9   0.764  -3.870 -22.891
   98   1H6     A   9          H61         A   9   4.416   1.083 -23.168
   99   2H6     A   9          H62         A   9   4.104  -0.425 -22.337
  100    H2     A   9           H2         A   9   1.290   1.472 -26.375
  101   1H5*    A  10          2H5*        A  10   1.118  -3.078 -30.684
  102   2H5*    A  10          1H5*        A  10   2.255  -4.176 -29.876
  103    H4*    A  10           H4*        A  10   1.781  -1.231 -29.358
  104    H3*    A  10           H3*        A  10   3.722  -2.618 -30.850
  105    H2*    A  10           H2*        A  10   4.865  -3.562 -28.997
  106   2HO*    A  10          2HO*        A  10   6.675  -2.452 -29.023
  107    H1*    A  10           H1*        A  10   4.285  -1.079 -27.364
  108    H8     A  10           H8         A  10   3.060  -4.506 -26.377
  109   1H6     A  10          H61         A  10   7.858  -4.852 -22.531
  110   2H6     A  10          H62         A  10   6.357  -5.604 -23.023
  111    H2     A  10           H2         A  10   8.409  -1.223 -25.124
  112   1H5*    U  11          2H5*        U  11   6.729  -0.442 -33.223
  113   2H5*    U  11          1H5*        U  11   6.498  -2.153 -33.636
  114    H4*    U  11           H4*        U  11   8.478  -0.880 -31.829
  115    H3*    U  11           H3*        U  11   8.607  -2.550 -34.053
  116    H2*    U  11           H2*        U  11   7.789  -4.510 -32.962
  117   2HO*    U  11          2HO*        U  11   9.543  -5.690 -33.089
  118    H1*    U  11           H1*        U  11   9.343  -3.765 -30.473
  119    H3     U  11           H3         U  11   7.760  -7.267 -28.199
  120    H5     U  11           H5         U  11   4.533  -6.297 -30.731
  121    H6     U  11           H6         U  11   5.890  -4.516 -31.668
  122   1H5*    C  12          2H5*        C  12   9.342  -3.395 -36.144
  123   2H5*    C  12          1H5*        C  12  11.116  -3.354 -36.117
  124    H4*    C  12           H4*        C  12  11.076  -2.482 -38.186
  125    H3*    C  12           H3*        C  12  10.613  -0.266 -36.519
  126    H2*    C  12           H2*        C  12   8.285  -0.088 -36.951
  127   2HO*    C  12          2HO*        C  12   9.337   1.048 -39.355
  128    H1*    C  12           H1*        C  12   8.741  -0.988 -39.806
  129   1H4     C  12          H41         C  12   2.404  -1.317 -39.703
  130   2H4     C  12          H42         C  12   2.390  -1.737 -38.005
  131    H5     C  12           H5         C  12   4.392  -1.953 -36.682
  132    H6     C  12           H6         C  12   6.839  -1.811 -36.701
  133   1H5*    C  13          2H5*        C  13  10.991   4.006 -39.257
  134   2H5*    C  13          1H5*        C  13  12.681   3.475 -39.135
  135    H4*    C  13           H4*        C  13  12.728   5.354 -37.780
  136    H3*    C  13           H3*        C  13  12.866   2.925 -36.404
  137    H2*    C  13           H2*        C  13  10.657   2.984 -35.519
  138   2HO*    C  13          2HO*        C  13  10.813   4.136 -33.420
  139    H1*    C  13           H1*        C  13  10.866   5.982 -35.163
  140   1H4     C  13          H41         C  13   4.720   5.047 -33.842
  141   2H4     C  13          H42         C  13   4.493   4.149 -35.326
  142    H5     C  13           H5         C  13   6.291   3.635 -36.845
  143    H6     C  13           H6         C  13   8.694   3.873 -37.270
  144   1H5*    C  14          2H5*        C  14  13.167   2.981 -33.775
  145   2H5*    C  14          1H5*        C  14  14.078   4.241 -32.919
  146    H4*    C  14           H4*        C  14  14.028   2.537 -31.335
  147    H3*    C  14           H3*        C  14  16.514   3.072 -32.432
  148    H2*    C  14           H2*        C  14  16.576   1.207 -33.920
  149   2HO*    C  14          2HO*        C  14  17.750   0.728 -31.461
  150    H1*    C  14           H1*        C  14  15.291  -0.549 -31.821
  151   1H4     C  14          H41         C  14  15.275  -4.317 -36.956
  152   2H4     C  14          H42         C  14  14.280  -3.170 -37.823
  153    H5     C  14           H5         C  14  13.657  -1.021 -36.927
  154    H6     C  14           H6         C  14  13.855   0.491 -35.007
  155   1H5*    G  15          2H5*        G  15  15.016   4.519 -29.845
  156   2H5*    G  15          1H5*        G  15  15.102   5.035 -28.148
  157    H4*    G  15           H4*        G  15  12.867   4.093 -28.851
  158    H3*    G  15           H3*        G  15  14.468   3.358 -26.488
  159    H2*    G  15           H2*        G  15  13.663   1.199 -26.132
  160   2HO*    G  15          2HO*        G  15  11.587   0.607 -26.618
  161    H1*    G  15           H1*        G  15  13.126   0.300 -28.622
  162    H8     G  15           H8         G  15  15.372  -0.787 -29.621
  163    H1     G  15           H1         G  15  18.865   2.014 -25.082
  164   1H2     G  15          H21         G  15  17.644   3.522 -24.008
  165   2H2     G  15          H22         G  15  15.971   3.835 -24.409
  166   1H5*    A  16          2H5*        A  16  11.355   6.712 -23.918
  167   2H5*    A  16          1H5*        A  16  11.951   5.878 -22.471
  168    H4*    A  16           H4*        A  16   9.344   6.268 -22.866
  169    H3*    A  16           H3*        A  16  10.773   4.646 -21.138
  170    H2*    A  16           H2*        A  16  10.831   2.750 -22.594
  171   2HO*    A  16          2HO*        A  16   8.726   1.537 -21.928
  172    H1*    A  16           H1*        A  16   7.931   3.286 -23.310
  173    H8     A  16           H8         A  16  10.609   0.902 -23.632
  174   1H6     A  16          H61         A  16   8.847  -0.467 -29.364
  175   2H6     A  16          H62         A  16   9.828  -0.969 -28.005
  176    H2     A  16           H2         A  16   6.815   3.353 -28.168
  177   1H5*    A  17          2H5*        A  17   8.198   3.095 -19.691
  178   2H5*    A  17          1H5*        A  17   7.166   3.473 -18.297
  179    H4*    A  17           H4*        A  17   9.228   2.842 -16.851
  180    H3*    A  17           H3*        A  17  10.635   2.709 -19.160
  181    H2*    A  17           H2*        A  17   9.367   1.067 -20.312
  182   2HO*    A  17          2HO*        A  17  11.398   0.107 -20.122
  183    H1*    A  17           H1*        A  17   8.906  -0.684 -17.947
  184    H8     A  17           H8         A  17   7.248   1.422 -20.744
  185   1H6     A  17          H61         A  17   3.212  -3.206 -21.221
  186   2H6     A  17          H62         A  17   3.713  -1.664 -21.881
  187    H2     A  17           H2         A  17   6.003  -4.136 -17.823
  188   1H5*    G  18          2H5*        G  18  11.804   1.509 -13.523
  189   2H5*    G  18          1H5*        G  18  11.968   0.551 -15.006
  190    H4*    G  18           H4*        G  18   9.334   1.299 -15.153
  191    H3*    G  18           H3*        G  18   9.994   1.868 -12.433
  192    H2*    G  18           H2*        G  18  10.004  -0.369 -11.688
  193   2HO*    G  18          2HO*        G  18   7.791  -1.023 -11.213
  194    H1*    G  18           H1*        G  18   7.993  -1.133 -13.819
  195    H8     G  18           H8         G  18  11.222  -2.144 -11.922
  196    H1     G  18           H1         G  18   7.639  -7.041 -13.875
  197   1H2     G  18          H21         G  18   5.931  -6.304 -15.079
  198   2H2     G  18          H22         G  18   5.673  -4.604 -15.401
  199   1H5*    U  19          2H5*        U  19   7.737   3.123 -15.147
  200   2H5*    U  19          1H5*        U  19   7.644   4.894 -15.055
  201    H4*    U  19           H4*        U  19   5.836   4.896 -16.394
  202    H3*    U  19           H3*        U  19   4.745   3.108 -14.204
  203    H2*    U  19           H2*        U  19   3.045   2.339 -15.611
  204   2HO*    U  19          2HO*        U  19   2.941   3.854 -17.730
  205    H1*    U  19           H1*        U  19   4.383   2.620 -18.086
  206    H3     U  19           H3         U  19   2.803  -1.650 -17.781
  207    H5     U  19           H5         U  19   6.241  -1.573 -15.344
  208    H6     U  19           H6         U  19   6.311   0.835 -15.634
  209   1H5*    A  20          2H5*        A  20   1.866   6.696 -15.367
  210   2H5*    A  20          1H5*        A  20   0.644   6.901 -14.097
  211    H4*    A  20           H4*        A  20  -0.268   6.583 -16.450
  212    H3*    A  20           H3*        A  20  -1.020   4.862 -14.076
  213    H2*    A  20           H2*        A  20  -2.407   3.515 -15.424
  214   2HO*    A  20          2HO*        A  20  -2.903   4.267 -17.643
  215    H1*    A  20           H1*        A  20  -0.869   3.480 -17.717
  216    H8     A  20           H8         A  20   1.214   2.986 -14.587
  217   1H6     A  20          H61         A  20  -0.217  -2.990 -14.910
  218   2H6     A  20          H62         A  20   0.773  -1.791 -14.109
  219    H2     A  20           H2         A  20  -2.709  -0.796 -17.947
  220   1H5*    G  21          2H5*        G  21  -4.468   5.287 -16.569
  221   2H5*    G  21          1H5*        G  21  -5.885   5.400 -15.506
  222    H4*    G  21           H4*        G  21  -5.785   3.371 -17.075
  223    H3*    G  21           H3*        G  21  -6.234   3.273 -14.084
  224    H2*    G  21           H2*        G  21  -6.273   0.918 -14.100
  225   2HO*    G  21          2HO*        G  21  -6.151   0.161 -16.621
  226    H1*    G  21           H1*        G  21  -4.319   0.465 -15.990
  227    H8     G  21           H8         G  21  -3.432   3.204 -13.500
  228    H1     G  21           H1         G  21  -2.238  -2.673 -11.335
  229   1H2     G  21          H21         G  21  -3.080  -4.180 -12.728
  230   2H2     G  21          H22         G  21  -3.935  -3.737 -14.188
  231   1H5*    U  22          2H5*        U  22 -10.237   0.332 -13.527
  232   2H5*    U  22          1H5*        U  22  -8.993   0.775 -12.340
  233    H4*    U  22           H4*        U  22  -9.023  -1.683 -14.134
  234    H3*    U  22           H3*        U  22  -9.461  -1.166 -11.179
  235    H2*    U  22           H2*        U  22  -8.290  -3.130 -10.625
  236   2HO*    U  22          2HO*        U  22  -9.206  -3.914 -13.135
  237    H1*    U  22           H1*        U  22  -6.406  -3.085 -12.682
  238    H3     U  22           H3         U  22  -4.614  -2.951  -8.406
  239    H5     U  22           H5         U  22  -5.146   1.043  -9.644
  240    H6     U  22           H6         U  22  -6.425   0.217 -11.535
  241   1H5*    G  23          2H5*        G  23 -12.894  -4.887 -10.611
  242   2H5*    G  23          1H5*        G  23 -13.243  -3.765  -9.281
  243    H4*    G  23           H4*        G  23 -12.189  -6.334  -9.025
  244    H3*    G  23           H3*        G  23 -12.352  -3.905  -7.217
  245    H2*    G  23           H2*        G  23 -10.920  -4.920  -5.665
  246   2HO*    G  23          2HO*        G  23 -12.278  -7.109  -6.424
  247    H1*    G  23           H1*        G  23  -9.389  -6.461  -7.460
  248    H8     G  23           H8         G  23  -9.410  -2.867  -8.489
  249    H1     G  23           H1         G  23  -5.468  -3.936  -3.594
  250   1H2     G  23          H21         G  23  -5.817  -5.965  -2.766
  251   2H2     G  23          H22         G  23  -7.019  -7.053  -3.422
  252   1H5*    U  24          2H5*        U  24 -13.709  -7.584  -5.273
  253   2H5*    U  24          1H5*        U  24 -14.893  -7.382  -3.966
  254    H4*    U  24           H4*        U  24 -12.729  -8.521  -3.289
  255    H3*    U  24           H3*        U  24 -13.770  -5.995  -1.972
  256    H2*    U  24           H2*        U  24 -11.910  -5.954  -0.531
  257   2HO*    U  24          2HO*        U  24 -10.857  -8.438  -1.221
  258    H1*    U  24           H1*        U  24 -10.001  -6.943  -2.304
  259    H3     U  24           H3         U  24  -8.751  -2.755  -1.015
  260    H5     U  24           H5         U  24 -11.748  -2.142  -3.914
  261    H6     U  24           H6         U  24 -12.165  -4.532  -3.893
  262   1H5*    C  25          2H5*        C  25 -12.178  -8.882   1.473
  263   2H5*    C  25          1H5*        C  25 -13.535  -8.606   2.583
  264    H4*    C  25           H4*        C  25 -11.086  -8.097   3.385
  265    H3*    C  25           H3*        C  25 -13.631  -6.565   3.829
  266    H2*    C  25           H2*        C  25 -12.540  -4.583   4.259
  267   2HO*    C  25          2HO*        C  25 -11.286  -6.324   6.009
  268    H1*    C  25           H1*        C  25  -9.806  -5.625   3.746
  269   1H4     C  25          H41         C  25  -9.790   0.418   1.729
  270   2H4     C  25          H42         C  25 -10.886   0.006   0.429
  271    H5     C  25           H5         C  25 -11.870  -2.180   0.176
  272    H6     C  25           H6         C  25 -12.013  -4.441   1.112
  273   1H5*    C  26          2H5*        C  26 -10.607  -7.207   7.380
  274   2H5*    C  26          1H5*        C  26 -11.578  -7.445   8.846
  275    H4*    C  26           H4*        C  26  -9.727  -6.000   9.413
  276    H3*    C  26           H3*        C  26 -12.402  -4.608   9.106
  277    H2*    C  26           H2*        C  26 -11.419  -2.579   9.754
  278   2HO*    C  26          2HO*        C  26  -9.003  -3.911  10.459
  279    H1*    C  26           H1*        C  26  -9.017  -2.934   8.414
  280   1H4     C  26          H41         C  26 -12.557   0.905   4.780
  281   2H4     C  26          H42         C  26 -13.521  -0.451   4.240
  282    H5     C  26           H5         C  26 -13.251  -2.687   5.094
  283    H6     C  26           H6         C  26 -11.997  -4.107   6.656
  284    H3T    C  26           H3T        C  26 -10.753  -5.487  11.272
  Start of MODEL    3
    1   1H5*    G   1          2H5*        G   1  -5.822  11.071   2.883
    2   2H5*    G   1          1H5*        G   1  -7.125   9.952   2.438
    3    H4*    G   1           H4*        G   1  -5.448  10.010   4.954
    4    H3*    G   1           H3*        G   1  -6.105   8.030   2.754
    5    H2*    G   1           H2*        G   1  -5.975   6.230   4.317
    6   2HO*    G   1          2HO*        G   1  -5.048   6.595   6.431
    7    H1*    G   1           H1*        G   1  -7.144   7.495   6.471
    8    H8     G   1           H8         G   1  -9.073   8.284   3.336
    9    H1     G   1           H1         G   1 -10.362   2.467   5.607
   10   1H2     G   1          H21         G   1  -8.922   1.943   7.210
   11   2H2     G   1          H22         G   1  -7.646   3.025   7.718
   12    H5T    G   1           H5T        G   1  -7.166  12.081   4.298
   13   1H5*    G   2          2H5*        G   2  -2.449   7.153   5.193
   14   2H5*    G   2          1H5*        G   2  -1.241   6.205   4.303
   15    H4*    G   2           H4*        G   2  -2.007   5.221   6.529
   16    H3*    G   2           H3*        G   2  -2.041   3.774   3.875
   17    H2*    G   2           H2*        G   2  -3.045   1.868   4.847
   18   2HO*    G   2          2HO*        G   2  -2.393   3.036   7.377
   19    H1*    G   2           H1*        G   2  -4.818   3.112   6.500
   20    H8     G   2           H8         G   2  -4.560   4.963   3.203
   21    H1     G   2           H1         G   2  -8.411  -0.112   2.937
   22   1H2     G   2          H21         G   2  -8.202  -1.322   4.784
   23   2H2     G   2          H22         G   2  -7.115  -0.877   6.080
   24   1H5*    A   3          2H5*        A   3  -2.091   0.564   6.465
   25   2H5*    A   3          1H5*        A   3  -0.460  -0.119   6.304
   26    H4*    A   3           H4*        A   3  -2.080  -1.889   5.936
   27    H3*    A   3           H3*        A   3  -0.476  -0.894   3.590
   28    H2*    A   3           H2*        A   3  -1.898  -1.860   2.051
   29   2HO*    A   3          2HO*        A   3  -2.631  -4.093   3.524
   30    H1*    A   3           H1*        A   3  -3.924  -2.753   4.021
   31    H8     A   3           H8         A   3  -3.683   0.652   2.243
   32   1H6     A   3          H61         A   3  -8.060  -1.441  -1.545
   33   2H6     A   3          H62         A   3  -7.088  -0.056  -1.101
   34    H2     A   3           H2         A   3  -6.863  -4.801   1.191
   35   1H5*    C   4          2H5*        C   4   0.714  -6.025   3.730
   36   2H5*    C   4          1H5*        C   4   1.420  -5.890   2.107
   37    H4*    C   4           H4*        C   4  -0.906  -7.310   2.832
   38    H3*    C   4           H3*        C   4   0.408  -6.488   0.226
   39    H2*    C   4           H2*        C   4  -1.518  -7.033  -0.970
   40   2HO*    C   4          2HO*        C   4  -2.019  -8.836   1.181
   41    H1*    C   4           H1*        C   4  -3.415  -6.705   1.142
   42   1H4     C   4          H41         C   4  -4.713  -2.530  -3.510
   43   2H4     C   4          H42         C   4  -3.581  -1.406  -2.794
   44    H5     C   4           H5         C   4  -2.162  -1.968  -0.931
   45    H6     C   4           H6         C   4  -1.522  -3.731   0.649
   46   1H5*    A   5          2H5*        A   5   1.116  -9.915  -2.801
   47   2H5*    A   5          1H5*        A   5   0.614  -8.244  -3.130
   48    H4*    A   5           H4*        A   5  -1.023 -10.784  -3.425
   49    H3*    A   5           H3*        A   5   0.123  -8.685  -5.272
   50    H2*    A   5           H2*        A   5  -1.816  -8.683  -6.609
   51   2HO*    A   5          2HO*        A   5  -2.239 -10.787  -6.990
   52    H1*    A   5           H1*        A   5  -3.714  -8.980  -4.640
   53    H8     A   5           H8         A   5  -1.450  -6.470  -3.203
   54   1H6     A   5          H61         A   5  -3.737  -2.267  -7.077
   55   2H6     A   5          H62         A   5  -2.758  -2.520  -5.649
   56    H2     A   5           H2         A   5  -5.120  -6.320  -8.443
   57   1H5*    C   6          2H5*        C   6  -1.278 -12.003  -8.735
   58   2H5*    C   6          1H5*        C   6   0.366 -11.863  -9.392
   59    H4*    C   6           H4*        C   6  -1.606 -11.306 -10.972
   60    H3*    C   6           H3*        C   6   0.856  -9.606 -10.492
   61    H2*    C   6           H2*        C   6   0.036  -7.925 -11.910
   62   2HO*    C   6          2HO*        C   6  -1.123 -10.094 -13.152
   63    H1*    C   6           H1*        C   6  -2.692  -8.208 -11.382
   64   1H4     C   6          H41         C   6  -0.723  -2.921  -8.434
   65   2H4     C   6          H42         C   6  -0.028  -3.875  -7.142
   66    H5     C   6           H5         C   6   0.033  -6.283  -7.167
   67    H6     C   6           H6         C   6  -0.557  -8.296  -8.434
   68   1H5*    G   7          2H5*        G   7   0.796 -10.058 -15.036
   69   2H5*    G   7          1H5*        G   7   2.396  -9.456 -15.517
   70    H4*    G   7           H4*        G   7   0.169  -8.031 -15.933
   71    H3*    G   7           H3*        G   7   2.993  -7.205 -15.268
   72    H2*    G   7           H2*        G   7   2.348  -4.929 -14.944
   73   2HO*    G   7          2HO*        G   7  -0.262  -5.488 -15.941
   74    H1*    G   7           H1*        G   7   0.005  -5.329 -13.623
   75    H8     G   7           H8         G   7   2.216  -7.964 -12.252
   76    H1     G   7           H1         G   7   3.924  -2.181 -10.177
   77   1H2     G   7          H21         G   7   2.899  -0.616 -11.368
   78   2H2     G   7          H22         G   7   1.796  -0.998 -12.671
   79   1H5*    A   8          2H5*        A   8   2.706  -7.935 -20.221
   80   2H5*    A   8          1H5*        A   8   2.920  -6.545 -21.306
   81    H4*    A   8           H4*        A   8   0.527  -7.827 -20.839
   82    H3*    A   8           H3*        A   8   1.323  -5.115 -21.890
   83    H2*    A   8           H2*        A   8  -0.915  -4.297 -21.731
   84   2HO*    A   8          2HO*        A   8  -1.549  -7.064 -21.659
   85    H1*    A   8           H1*        A   8  -1.606  -5.399 -19.345
   86    H8     A   8           H8         A   8   1.649  -4.467 -18.255
   87   1H6     A   8          H61         A   8   0.328   1.518 -18.854
   88   2H6     A   8          H62         A   8   1.440   0.357 -18.166
   89    H2     A   8           H2         A   8  -2.807  -0.830 -21.060
   90   1H5*    A   9          2H5*        A   9  -1.409  -5.797 -24.505
   91   2H5*    A   9          1H5*        A   9  -0.953  -6.094 -26.194
   92    H4*    A   9           H4*        A   9  -2.495  -4.224 -26.136
   93    H3*    A   9           H3*        A   9   0.407  -3.617 -26.740
   94    H2*    A   9           H2*        A   9  -0.019  -1.314 -26.818
   95   2HO*    A   9          2HO*        A   9  -2.279  -2.145 -27.960
   96    H1*    A   9           H1*        A   9  -2.083  -1.184 -24.931
   97    H8     A   9           H8         A   9   0.901  -3.021 -23.569
   98   1H6     A   9          H61         A   9   3.357   2.464 -22.218
   99   2H6     A   9          H62         A   9   3.506   0.734 -22.005
  100    H2     A   9           H2         A   9  -0.274   3.152 -24.778
  101   1H5*    A  10          2H5*        A  10  -0.380  -0.937 -29.017
  102   2H5*    A  10          1H5*        A  10   0.260  -1.294 -30.634
  103    H4*    A  10           H4*        A  10   1.341   0.692 -29.569
  104    H3*    A  10           H3*        A  10   2.591  -1.362 -30.997
  105    H2*    A  10           H2*        A  10   3.566  -2.445 -29.116
  106   2HO*    A  10          2HO*        A  10   5.709  -1.380 -28.783
  107    H1*    A  10           H1*        A  10   4.049   0.245 -27.811
  108    H8     A  10           H8         A  10   2.553  -3.267 -27.050
  109   1H6     A  10          H61         A  10   6.085  -3.172 -22.009
  110   2H6     A  10          H62         A  10   4.918  -4.097 -22.926
  111    H2     A  10           H2         A  10   6.756   0.666 -24.251
  112   1H5*    U  11          2H5*        U  11   5.468   1.397 -29.814
  113   2H5*    U  11          1H5*        U  11   6.450   2.354 -30.942
  114    H4*    U  11           H4*        U  11   7.809   1.373 -29.110
  115    H3*    U  11           H3*        U  11   8.408   1.321 -31.880
  116    H2*    U  11           H2*        U  11   8.210  -1.023 -32.148
  117   2HO*    U  11          2HO*        U  11  10.461  -1.783 -31.021
  118    H1*    U  11           H1*        U  11   9.176  -1.439 -29.307
  119    H3     U  11           H3         U  11   8.582  -5.860 -29.528
  120    H5     U  11           H5         U  11   5.515  -4.407 -32.030
  121    H6     U  11           H6         U  11   6.308  -2.157 -31.583
  122   1H5*    C  12          2H5*        C  12  11.061   5.415 -30.069
  123   2H5*    C  12          1H5*        C  12   9.397   5.252 -30.665
  124    H4*    C  12           H4*        C  12  11.935   5.760 -32.196
  125    H3*    C  12           H3*        C  12   9.644   7.287 -31.562
  126    H2*    C  12           H2*        C  12   8.188   6.244 -33.114
  127   2HO*    C  12          2HO*        C  12   8.704   7.347 -35.293
  128    H1*    C  12           H1*        C  12  10.503   5.824 -35.020
  129   1H4     C  12          H41         C  12   6.249   2.124 -37.929
  130   2H4     C  12          H42         C  12   5.437   1.763 -36.422
  131    H5     C  12           H5         C  12   6.141   2.653 -34.297
  132    H6     C  12           H6         C  12   7.775   4.081 -33.158
  133   1H5*    C  13          2H5*        C  13   9.213   9.096 -34.769
  134   2H5*    C  13          1H5*        C  13  10.655  10.114 -34.965
  135    H4*    C  13           H4*        C  13   9.381  11.860 -35.573
  136    H3*    C  13           H3*        C  13   8.502  11.484 -32.791
  137    H2*    C  13           H2*        C  13   6.232  11.427 -33.267
  138   2HO*    C  13          2HO*        C  13   5.439  13.498 -34.213
  139    H1*    C  13           H1*        C  13   6.610  12.447 -36.072
  140   1H4     C  13          H41         C  13   0.869   9.685 -36.230
  141   2H4     C  13          H42         C  13   1.592   8.127 -35.896
  142    H5     C  13           H5         C  13   3.934   7.835 -35.414
  143    H6     C  13           H6         C  13   6.089   8.973 -35.148
  144   1H5*    C  14          2H5*        C  14  10.430  12.974 -29.997
  145   2H5*    C  14          1H5*        C  14   9.169  11.945 -30.709
  146    H4*    C  14           H4*        C  14   8.374  14.314 -29.019
  147    H3*    C  14           H3*        C  14  10.059  12.287 -27.949
  148    H2*    C  14           H2*        C  14   8.438  10.564 -27.967
  149   2HO*    C  14          2HO*        C  14   6.979  11.240 -25.924
  150    H1*    C  14           H1*        C  14   6.241  12.593 -27.496
  151   1H4     C  14          H41         C  14   2.794   7.395 -28.709
  152   2H4     C  14          H42         C  14   3.749   7.033 -30.129
  153    H5     C  14           H5         C  14   5.658   8.339 -30.803
  154    H6     C  14           H6         C  14   7.063  10.275 -30.262
  155   1H5*    G  15          2H5*        G  15   8.332  12.343 -24.335
  156   2H5*    G  15          1H5*        G  15   9.626  12.170 -23.134
  157    H4*    G  15           H4*        G  15   8.119  10.094 -23.954
  158    H3*    G  15           H3*        G  15  10.803  10.372 -22.763
  159    H2*    G  15           H2*        G  15  11.846   8.526 -23.732
  160   2HO*    G  15          2HO*        G  15   9.207   7.479 -24.089
  161    H1*    G  15           H1*        G  15  10.671   8.324 -26.156
  162    H8     G  15           H8         G  15  12.020   9.881 -27.874
  163    H1     G  15           H1         G  15  14.886  12.897 -23.043
  164   1H2     G  15          H21         G  15  13.903  12.363 -21.128
  165   2H2     G  15          H22         G  15  12.544  11.264 -21.043
  166   1H5*    A  16          2H5*        A  16   7.103   9.172 -21.884
  167   2H5*    A  16          1H5*        A  16   6.123   9.607 -20.469
  168    H4*    A  16           H4*        A  16   5.144   7.588 -20.637
  169    H3*    A  16           H3*        A  16   7.439   7.132 -19.118
  170    H2*    A  16           H2*        A  16   8.739   6.259 -20.921
  171   2HO*    A  16          2HO*        A  16   7.216   4.154 -19.756
  172    H1*    A  16           H1*        A  16   6.252   4.835 -21.923
  173    H8     A  16           H8         A  16   9.813   5.063 -22.350
  174   1H6     A  16          H61         A  16   9.238   4.407 -28.444
  175   2H6     A  16          H62         A  16  10.351   4.365 -27.094
  176    H2     A  16           H2         A  16   5.188   5.392 -26.765
  177   1H5*    A  17          2H5*        A  17   8.528   4.945 -16.909
  178   2H5*    A  17          1H5*        A  17   8.554   4.483 -18.623
  179    H4*    A  17           H4*        A  17   9.237   2.901 -16.230
  180    H3*    A  17           H3*        A  17  10.486   3.444 -18.605
  181    H2*    A  17           H2*        A  17   8.948   2.300 -20.031
  182   2HO*    A  17          2HO*        A  17  10.106   0.635 -20.755
  183    H1*    A  17           H1*        A  17   8.744  -0.010 -18.105
  184    H8     A  17           H8         A  17   6.480   2.553 -19.958
  185   1H6     A  17          H61         A  17   3.344  -2.364 -21.938
  186   2H6     A  17          H62         A  17   3.443  -0.617 -21.971
  187    H2     A  17           H2         A  17   6.745  -3.815 -19.385
  188   1H5*    G  18          2H5*        G  18  12.220   0.950 -13.578
  189   2H5*    G  18          1H5*        G  18  12.132   0.235 -15.198
  190    H4*    G  18           H4*        G  18   9.533   0.963 -14.868
  191    H3*    G  18           H3*        G  18  10.591   1.213 -12.203
  192    H2*    G  18           H2*        G  18  10.537  -1.087 -11.708
  193   2HO*    G  18          2HO*        G  18   8.054   0.062 -11.359
  194    H1*    G  18           H1*        G  18   8.279  -1.477 -13.691
  195    H8     G  18           H8         G  18  11.542  -2.938 -12.188
  196    H1     G  18           H1         G  18   7.519  -7.284 -14.546
  197   1H2     G  18          H21         G  18   5.796  -6.280 -15.517
  198   2H2     G  18          H22         G  18   5.639  -4.538 -15.582
  199   1H5*    U  19          2H5*        U  19   8.006   2.920 -14.342
  200   2H5*    U  19          1H5*        U  19   8.013   4.660 -13.993
  201    H4*    U  19           H4*        U  19   5.989   4.919 -14.950
  202    H3*    U  19           H3*        U  19   5.226   2.699 -13.032
  203    H2*    U  19           H2*        U  19   3.314   2.206 -14.291
  204   2HO*    U  19          2HO*        U  19   3.118   4.796 -14.423
  205    H1*    U  19           H1*        U  19   4.278   2.945 -16.834
  206    H3     U  19           H3         U  19   2.885  -1.352 -17.223
  207    H5     U  19           H5         U  19   6.441  -1.607 -14.974
  208    H6     U  19           H6         U  19   6.465   0.818 -14.862
  209   1H5*    A  20          2H5*        A  20   1.558   6.480 -13.125
  210   2H5*    A  20          1H5*        A  20   0.453   5.550 -12.091
  211    H4*    A  20           H4*        A  20  -0.136   6.353 -14.637
  212    H3*    A  20           H3*        A  20  -1.125   4.134 -12.850
  213    H2*    A  20           H2*        A  20  -2.276   3.075 -14.616
  214   2HO*    A  20          2HO*        A  20  -3.356   4.454 -15.819
  215    H1*    A  20           H1*        A  20  -0.457   3.431 -16.618
  216    H8     A  20           H8         A  20   1.362   2.656 -13.402
  217   1H6     A  20          H61         A  20   0.276  -3.301 -14.523
  218   2H6     A  20          H62         A  20   1.142  -2.165 -13.513
  219    H2     A  20           H2         A  20  -2.094  -0.873 -17.472
  220   1H5*    G  21          2H5*        G  21  -6.596   4.683 -13.842
  221   2H5*    G  21          1H5*        G  21  -5.569   3.790 -12.701
  222    H4*    G  21           H4*        G  21  -5.963   3.310 -15.664
  223    H3*    G  21           H3*        G  21  -6.442   1.805 -13.091
  224    H2*    G  21           H2*        G  21  -5.730  -0.236 -14.034
  225   2HO*    G  21          2HO*        G  21  -6.482   1.038 -16.405
  226    H1*    G  21           H1*        G  21  -3.636   0.670 -15.539
  227    H8     G  21           H8         G  21  -3.082   2.612 -12.516
  228    H1     G  21           H1         G  21  -2.226  -3.590 -11.312
  229   1H2     G  21          H21         G  21  -3.055  -4.806 -12.970
  230   2H2     G  21          H22         G  21  -3.820  -4.090 -14.371
  231   1H5*    U  22          2H5*        U  22  -9.969  -0.668 -14.645
  232   2H5*    U  22          1H5*        U  22 -10.676  -0.669 -13.016
  233    H4*    U  22           H4*        U  22  -9.300  -2.779 -14.147
  234    H3*    U  22           H3*        U  22  -9.913  -1.968 -11.290
  235    H2*    U  22           H2*        U  22  -8.500  -3.646 -10.473
  236   2HO*    U  22          2HO*        U  22  -7.826  -5.356 -12.137
  237    H1*    U  22           H1*        U  22  -6.670  -3.725 -12.626
  238    H3     U  22           H3         U  22  -4.789  -3.149  -8.405
  239    H5     U  22           H5         U  22  -5.481   0.685 -10.014
  240    H6     U  22           H6         U  22  -6.780  -0.361 -11.776
  241   1H5*    G  23          2H5*        G  23 -13.504  -5.427  -9.465
  242   2H5*    G  23          1H5*        G  23 -12.425  -4.214  -8.747
  243    H4*    G  23           H4*        G  23 -12.109  -7.219  -8.845
  244    H3*    G  23           H3*        G  23 -12.204  -5.054  -6.731
  245    H2*    G  23           H2*        G  23 -10.607  -6.174  -5.421
  246   2HO*    G  23          2HO*        G  23 -11.866  -8.330  -6.388
  247    H1*    G  23           H1*        G  23  -9.056  -7.266  -7.455
  248    H8     G  23           H8         G  23  -9.513  -3.700  -8.330
  249    H1     G  23           H1         G  23  -5.504  -4.398  -3.421
  250   1H2     G  23          H21         G  23  -5.624  -6.467  -2.632
  251   2H2     G  23          H22         G  23  -6.690  -7.674  -3.315
  252   1H5*    U  24          2H5*        U  24 -12.707  -8.766  -4.608
  253   2H5*    U  24          1H5*        U  24 -14.183  -8.673  -3.625
  254    H4*    U  24           H4*        U  24 -12.338  -9.389  -2.210
  255    H3*    U  24           H3*        U  24 -13.435  -6.597  -1.805
  256    H2*    U  24           H2*        U  24 -11.840  -6.149  -0.132
  257   2HO*    U  24          2HO*        U  24 -10.549  -8.009   0.705
  258    H1*    U  24           H1*        U  24  -9.690  -7.518  -1.208
  259    H3     U  24           H3         U  24  -8.430  -3.176  -1.248
  260    H5     U  24           H5         U  24 -11.339  -3.416  -4.291
  261    H6     U  24           H6         U  24 -11.767  -5.704  -3.609
  262   1H5*    C  25          2H5*        C  25 -12.850  -8.598   2.745
  263   2H5*    C  25          1H5*        C  25 -14.296  -7.750   3.331
  264    H4*    C  25           H4*        C  25 -11.864  -7.347   4.406
  265    H3*    C  25           H3*        C  25 -14.238  -5.530   4.022
  266    H2*    C  25           H2*        C  25 -12.974  -3.616   4.276
  267   2HO*    C  25          2HO*        C  25 -11.933  -5.153   6.386
  268    H1*    C  25           H1*        C  25 -10.338  -4.939   4.255
  269   1H4     C  25          H41         C  25  -9.625   0.275   0.685
  270   2H4     C  25          H42         C  25 -10.769  -0.334  -0.489
  271    H5     C  25           H5         C  25 -12.000  -2.385  -0.192
  272    H6     C  25           H6         C  25 -12.398  -4.294   1.295
  273   1H5*    C  26          2H5*        C  26 -12.539  -5.956   8.895
  274   2H5*    C  26          1H5*        C  26 -13.618  -4.788   9.686
  275    H4*    C  26           H4*        C  26 -10.988  -4.615   9.977
  276    H3*    C  26           H3*        C  26 -12.992  -2.390   9.519
  277    H2*    C  26           H2*        C  26 -11.268  -0.800   9.624
  278   2HO*    C  26          2HO*        C  26 -10.177  -1.596  11.456
  279    H1*    C  26           H1*        C  26  -9.386  -2.246   8.218
  280   1H4     C  26          H41         C  26 -12.191   1.911   4.256
  281   2H4     C  26          H42         C  26 -13.366   0.686   3.830
  282    H5     C  26           H5         C  26 -13.494  -1.456   4.924
  283    H6     C  26           H6         C  26 -12.522  -2.889   6.660
  284    H3T    C  26           H3T        C  26 -12.376  -2.069  11.774
  Start of MODEL    4
    1   1H5*    G   1          2H5*        G   1  -9.154  10.057   5.170
    2   2H5*    G   1          1H5*        G   1  -7.403  10.170   4.900
    3    H4*    G   1           H4*        G   1  -7.519   9.557   7.154
    4    H3*    G   1           H3*        G   1  -7.130   7.179   5.341
    5    H2*    G   1           H2*        G   1  -7.390   5.640   7.147
    6   2HO*    G   1          2HO*        G   1  -7.371   6.420   9.348
    7    H1*    G   1           H1*        G   1  -9.434   6.856   8.465
    8    H8     G   1           H8         G   1 -10.524   7.397   5.024
    9    H1     G   1           H1         G   1 -10.704   1.186   6.455
   10   1H2     G   1          H21         G   1  -9.572   0.807   8.325
   11   2H2     G   1          H22         G   1  -8.774   2.083   9.216
   12    H5T    G   1           H5T        G   1  -8.167   8.973   3.251
   13   1H5*    G   2          2H5*        G   2  -2.721   6.258   7.831
   14   2H5*    G   2          1H5*        G   2  -2.403   5.313   6.362
   15    H4*    G   2           H4*        G   2  -2.718   4.267   8.904
   16    H3*    G   2           H3*        G   2  -2.817   3.162   6.100
   17    H2*    G   2           H2*        G   2  -3.783   1.127   6.822
   18   2HO*    G   2          2HO*        G   2  -3.880   0.613   9.093
   19    H1*    G   2           H1*        G   2  -5.570   2.097   8.606
   20    H8     G   2           H8         G   2  -5.714   4.687   6.000
   21    H1     G   2           H1         G   2  -8.304  -0.762   3.938
   22   1H2     G   2          H21         G   2  -7.778  -2.420   5.312
   23   2H2     G   2          H22         G   2  -6.790  -2.183   6.736
   24   1H5*    A   3          2H5*        A   3  -2.646  -0.350   8.048
   25   2H5*    A   3          1H5*        A   3  -0.987  -0.925   7.788
   26    H4*    A   3           H4*        A   3  -2.555  -2.694   7.184
   27    H3*    A   3           H3*        A   3  -0.982  -1.337   4.993
   28    H2*    A   3           H2*        A   3  -2.296  -2.269   3.336
   29   2HO*    A   3          2HO*        A   3  -2.680  -4.438   3.306
   30    H1*    A   3           H1*        A   3  -4.379  -3.339   5.127
   31    H8     A   3           H8         A   3  -4.358   0.306   4.049
   32   1H6     A   3          H61         A   3  -8.040  -1.352  -0.598
   33   2H6     A   3          H62         A   3  -7.322  -0.002   0.253
   34    H2     A   3           H2         A   3  -6.612  -5.091   1.449
   35   1H5*    C   4          2H5*        C   4   0.568  -5.372   2.173
   36   2H5*    C   4          1H5*        C   4  -0.481  -3.946   2.313
   37    H4*    C   4           H4*        C   4  -1.710  -6.616   2.892
   38    H3*    C   4           H3*        C   4  -0.703  -5.731   0.170
   39    H2*    C   4           H2*        C   4  -2.718  -6.404  -0.824
   40   2HO*    C   4          2HO*        C   4  -2.627  -8.521   0.167
   41    H1*    C   4           H1*        C   4  -4.436  -5.906   1.351
   42   1H4     C   4          H41         C   4  -5.364  -1.702  -3.410
   43   2H4     C   4          H42         C   4  -4.485  -0.532  -2.450
   44    H5     C   4           H5         C   4  -3.335  -1.096  -0.409
   45    H6     C   4           H6         C   4  -2.779  -2.903   1.152
   46   1H5*    A   5          2H5*        A   5   0.314 -10.058  -1.859
   47   2H5*    A   5          1H5*        A   5   1.054  -8.881  -2.960
   48    H4*    A   5           H4*        A   5  -1.390 -10.336  -3.300
   49    H3*    A   5           H3*        A   5   0.178  -8.265  -4.868
   50    H2*    A   5           H2*        A   5  -1.671  -7.888  -6.268
   51   2HO*    A   5          2HO*        A   5  -2.148 -10.532  -5.686
   52    H1*    A   5           H1*        A   5  -3.696  -8.251  -4.384
   53    H8     A   5           H8         A   5  -1.532  -5.886  -2.684
   54   1H6     A   5          H61         A   5  -3.282  -1.448  -6.574
   55   2H6     A   5          H62         A   5  -2.472  -1.793  -5.063
   56    H2     A   5           H2         A   5  -4.601  -5.393  -8.277
   57   1H5*    C   6          2H5*        C   6  -1.613 -10.053  -7.487
   58   2H5*    C   6          1H5*        C   6  -0.783 -11.395  -8.301
   59    H4*    C   6           H4*        C   6  -1.801 -10.499 -10.149
   60    H3*    C   6           H3*        C   6   0.732  -8.888  -9.715
   61    H2*    C   6           H2*        C   6   0.125  -7.414 -11.434
   62   2HO*    C   6          2HO*        C   6  -1.378  -8.028 -13.065
   63    H1*    C   6           H1*        C   6  -2.673  -7.576 -11.141
   64   1H4     C   6          H41         C   6  -0.928  -1.787  -9.165
   65   2H4     C   6          H42         C   6  -0.281  -2.458  -7.684
   66    H5     C   6           H5         C   6  -0.189  -4.824  -7.237
   67    H6     C   6           H6         C   6  -0.696  -7.057  -8.111
   68   1H5*    G   7          2H5*        G   7   0.549  -9.451 -14.391
   69   2H5*    G   7          1H5*        G   7   2.216  -8.923 -14.699
   70    H4*    G   7           H4*        G   7  -0.045  -7.424 -15.212
   71    H3*    G   7           H3*        G   7   2.884  -6.777 -14.806
   72    H2*    G   7           H2*        G   7   2.397  -4.435 -14.787
   73   2HO*    G   7          2HO*        G   7   0.992  -3.918 -16.304
   74    H1*    G   7           H1*        G   7   0.119  -4.522 -13.286
   75    H8     G   7           H8         G   7   2.298  -7.013 -11.645
   76    H1     G   7           H1         G   7   4.418  -1.082 -10.649
   77   1H2     G   7          H21         G   7   3.386   0.331 -12.012
   78   2H2     G   7          H22         G   7   2.176  -0.189 -13.164
   79   1H5*    A   8          2H5*        A   8   1.493  -8.064 -18.823
   80   2H5*    A   8          1H5*        A   8   1.716  -7.482 -20.484
   81    H4*    A   8           H4*        A   8  -0.678  -7.451 -19.202
   82    H3*    A   8           H3*        A   8   0.502  -5.651 -21.339
   83    H2*    A   8           H2*        A   8  -1.393  -4.226 -21.199
   84   2HO*    A   8          2HO*        A   8  -3.357  -5.003 -20.842
   85    H1*    A   8           H1*        A   8  -1.964  -4.600 -18.472
   86    H8     A   8           H8         A   8   1.334  -3.467 -18.013
   87   1H6     A   8          H61         A   8  -0.023   2.110 -20.248
   88   2H6     A   8          H62         A   8   1.139   1.177 -19.332
   89    H2     A   8           H2         A   8  -3.318  -0.706 -21.432
   90   1H5*    A   9          2H5*        A   9  -2.575  -6.614 -23.137
   91   2H5*    A   9          1H5*        A   9  -2.681  -7.307 -24.768
   92    H4*    A   9           H4*        A   9  -3.442  -5.041 -24.947
   93    H3*    A   9           H3*        A   9  -0.639  -5.553 -25.966
   94    H2*    A   9           H2*        A   9  -0.261  -3.286 -26.298
   95   2HO*    A   9          2HO*        A   9  -2.760  -2.239 -26.379
   96    H1*    A   9           H1*        A   9  -2.313  -2.269 -24.542
   97    H8     A   9           H8         A   9   0.539  -4.073 -22.874
   98   1H6     A   9          H61         A   9   3.584   1.279 -22.847
   99   2H6     A   9          H62         A   9   3.576  -0.369 -22.260
  100    H2     A   9           H2         A   9  -0.092   1.779 -25.384
  101   1H5*    A  10          2H5*        A  10  -0.895  -2.797 -29.279
  102   2H5*    A  10          1H5*        A  10  -0.497  -4.033 -30.489
  103    H4*    A  10           H4*        A  10   1.246  -2.186 -30.087
  104    H3*    A  10           H3*        A  10   1.550  -4.922 -30.749
  105    H2*    A  10           H2*        A  10   2.472  -5.600 -28.677
  106   2HO*    A  10          2HO*        A  10   4.194  -5.599 -30.338
  107    H1*    A  10           H1*        A  10   3.780  -2.889 -28.351
  108    H8     A  10           H8         A  10   1.635  -5.542 -26.481
  109   1H6     A  10          H61         A  10   5.475  -4.639 -21.750
  110   2H6     A  10          H62         A  10   4.085  -5.537 -22.318
  111    H2     A  10           H2         A  10   6.721  -1.913 -25.098
  112   1H5*    U  11          2H5*        U  11   5.428  -2.564 -31.529
  113   2H5*    U  11          1H5*        U  11   6.375  -3.087 -32.937
  114    H4*    U  11           H4*        U  11   7.542  -3.000 -30.610
  115    H3*    U  11           H3*        U  11   7.979  -4.591 -32.910
  116    H2*    U  11           H2*        U  11   7.190  -6.623 -31.986
  117   2HO*    U  11          2HO*        U  11   9.460  -6.822 -30.401
  118    H1*    U  11           H1*        U  11   8.158  -5.776 -29.245
  119    H3     U  11           H3         U  11   6.397  -9.366 -27.254
  120    H5     U  11           H5         U  11   3.787  -8.764 -30.509
  121    H6     U  11           H6         U  11   5.143  -6.860 -31.159
  122   1H5*    C  12          2H5*        C  12   9.555  -7.696 -33.488
  123   2H5*    C  12          1H5*        C  12  11.092  -7.479 -32.625
  124    H4*    C  12           H4*        C  12  12.018  -8.120 -34.600
  125    H3*    C  12           H3*        C  12  11.980  -5.332 -34.459
  126    H2*    C  12           H2*        C  12  10.172  -5.001 -35.971
  127   2HO*    C  12          2HO*        C  12  12.351  -4.325 -36.917
  128    H1*    C  12           H1*        C  12  11.141  -7.318 -37.660
  129   1H4     C  12          H41         C  12   5.461  -6.504 -40.368
  130   2H4     C  12          H42         C  12   4.769  -5.894 -38.881
  131    H5     C  12           H5         C  12   6.022  -5.667 -36.837
  132    H6     C  12           H6         C  12   8.210  -5.975 -35.776
  133   1H5*    C  13          2H5*        C  13  14.824  -3.747 -38.002
  134   2H5*    C  13          1H5*        C  13  16.144  -4.364 -36.987
  135    H4*    C  13           H4*        C  13  16.737  -2.140 -37.049
  136    H3*    C  13           H3*        C  13  15.598  -2.897 -34.622
  137    H2*    C  13           H2*        C  13  13.483  -1.859 -34.960
  138   2HO*    C  13          2HO*        C  13  13.519  -0.145 -33.647
  139    H1*    C  13           H1*        C  13  14.807   0.471 -36.361
  140   1H4     C  13          H41         C  13   8.670   1.671 -37.510
  141   2H4     C  13          H42         C  13   8.427   0.052 -38.125
  142    H5     C  13           H5         C  13  10.147  -1.632 -38.128
  143    H6     C  13           H6         C  13  12.474  -2.131 -37.541
  144   1H5*    C  14          2H5*        C  14  15.142  -1.792 -32.775
  145   2H5*    C  14          1H5*        C  14  16.075  -0.325 -32.419
  146    H4*    C  14           H4*        C  14  15.109  -0.696 -30.352
  147    H3*    C  14           H3*        C  14  17.821  -1.286 -30.441
  148    H2*    C  14           H2*        C  14  17.583  -3.659 -30.529
  149   2HO*    C  14          2HO*        C  14  17.976  -2.630 -28.032
  150    H1*    C  14           H1*        C  14  15.274  -3.510 -28.579
  151   1H4     C  14          H41         C  14  15.393  -9.648 -30.353
  152   2H4     C  14          H42         C  14  14.764  -9.192 -31.920
  153    H5     C  14           H5         C  14  14.471  -6.901 -32.607
  154    H6     C  14           H6         C  14  14.716  -4.555 -31.941
  155   1H5*    G  15          2H5*        G  15  14.898   1.654 -27.337
  156   2H5*    G  15          1H5*        G  15  14.315   0.348 -28.390
  157    H4*    G  15           H4*        G  15  14.363   3.166 -29.444
  158    H3*    G  15           H3*        G  15  12.834   2.362 -27.095
  159    H2*    G  15           H2*        G  15  10.709   2.087 -27.983
  160   2HO*    G  15          2HO*        G  15  11.258   3.718 -30.233
  161    H1*    G  15           H1*        G  15  11.107   1.474 -30.598
  162    H8     G  15           H8         G  15  11.166  -1.174 -30.791
  163    H1     G  15           H1         G  15  12.223  -1.767 -24.533
  164   1H2     G  15          H21         G  15  12.695   0.211 -23.654
  165   2H2     G  15          H22         G  15  12.751   1.676 -24.609
  166   1H5*    A  16          2H5*        A  16  12.049   4.342 -23.984
  167   2H5*    A  16          1H5*        A  16  11.599   2.954 -24.996
  168    H4*    A  16           H4*        A  16   9.636   5.100 -24.110
  169    H3*    A  16           H3*        A  16  10.796   3.260 -22.375
  170    H2*    A  16           H2*        A  16  10.035   1.327 -23.558
  171   2HO*    A  16          2HO*        A  16   7.707   1.048 -22.492
  172    H1*    A  16           H1*        A  16   7.389   2.752 -23.999
  173    H8     A  16           H8         A  16   9.035  -0.438 -24.268
  174   1H6     A  16          H61         A  16   6.030  -1.679 -29.490
  175   2H6     A  16          H62         A  16   6.993  -2.350 -28.193
  176    H2     A  16           H2         A  16   5.587   2.714 -28.647
  177   1H5*    A  17          2H5*        A  17   8.197   2.804 -20.582
  178   2H5*    A  17          1H5*        A  17   7.288   3.329 -19.150
  179    H4*    A  17           H4*        A  17   9.423   2.612 -17.823
  180    H3*    A  17           H3*        A  17  10.568   2.170 -20.242
  181    H2*    A  17           H2*        A  17   9.009   0.588 -21.099
  182   2HO*    A  17          2HO*        A  17   9.919  -1.602 -20.226
  183    H1*    A  17           H1*        A  17   8.758  -0.901 -18.513
  184    H8     A  17           H8         A  17   6.524   1.219 -20.887
  185   1H6     A  17          H61         A  17   3.031  -3.834 -21.343
  186   2H6     A  17          H62         A  17   3.212  -2.166 -21.839
  187    H2     A  17           H2         A  17   6.521  -4.786 -18.675
  188   1H5*    G  18          2H5*        G  18  12.512   1.295 -14.753
  189   2H5*    G  18          1H5*        G  18  12.316   0.203 -16.138
  190    H4*    G  18           H4*        G  18   9.790   1.219 -15.958
  191    H3*    G  18           H3*        G  18  10.956   2.015 -13.462
  192    H2*    G  18           H2*        G  18  10.830  -0.106 -12.443
  193   2HO*    G  18          2HO*        G  18   9.276   0.491 -11.129
  194    H1*    G  18           H1*        G  18   8.430  -0.800 -14.159
  195    H8     G  18           H8         G  18  11.695  -2.078 -12.501
  196    H1     G  18           H1         G  18   7.314  -6.583 -13.578
  197   1H2     G  18          H21         G  18   5.599  -5.725 -14.691
  198   2H2     G  18          H22         G  18   5.535  -4.043 -15.168
  199   1H5*    U  19          2H5*        U  19   8.289   2.829 -15.899
  200   2H5*    U  19          1H5*        U  19   8.629   4.474 -16.474
  201    H4*    U  19           H4*        U  19   6.461   4.841 -17.112
  202    H3*    U  19           H3*        U  19   5.755   3.261 -14.623
  203    H2*    U  19           H2*        U  19   3.708   2.619 -15.561
  204   2HO*    U  19          2HO*        U  19   2.589   3.890 -16.958
  205    H1*    U  19           H1*        U  19   4.471   2.648 -18.284
  206    H3     U  19           H3         U  19   2.744  -1.477 -17.583
  207    H5     U  19           H5         U  19   6.394  -1.520 -15.475
  208    H6     U  19           H6         U  19   6.624   0.847 -15.957
  209   1H5*    A  20          2H5*        A  20   2.412   7.274 -14.449
  210   2H5*    A  20          1H5*        A  20   1.350   6.435 -13.300
  211    H4*    A  20           H4*        A  20   0.693   7.098 -15.906
  212    H3*    A  20           H3*        A  20  -0.402   5.212 -13.827
  213    H2*    A  20           H2*        A  20  -1.721   4.048 -15.393
  214   2HO*    A  20          2HO*        A  20  -1.278   5.609 -17.621
  215    H1*    A  20           H1*        A  20   0.000   4.005 -17.512
  216    H8     A  20           H8         A  20   1.943   3.448 -14.325
  217   1H6     A  20          H61         A  20   0.301  -2.478 -14.661
  218   2H6     A  20          H62         A  20   1.321  -1.316 -13.842
  219    H2     A  20           H2         A  20  -2.046  -0.204 -17.747
  220   1H5*    G  21          2H5*        G  21  -3.388   5.676 -16.565
  221   2H5*    G  21          1H5*        G  21  -4.944   5.874 -15.735
  222    H4*    G  21           H4*        G  21  -4.755   3.789 -17.163
  223    H3*    G  21           H3*        G  21  -5.433   3.771 -14.214
  224    H2*    G  21           H2*        G  21  -5.499   1.415 -14.176
  225   2HO*    G  21          2HO*        G  21  -6.762   1.404 -16.226
  226    H1*    G  21           H1*        G  21  -3.401   0.895 -15.879
  227    H8     G  21           H8         G  21  -2.674   3.716 -13.438
  228    H1     G  21           H1         G  21  -1.756  -2.080 -10.944
  229   1H2     G  21          H21         G  21  -2.513  -3.632 -12.335
  230   2H2     G  21          H22         G  21  -3.243  -3.239 -13.875
  231   1H5*    U  22          2H5*        U  22  -9.571   0.839 -13.792
  232   2H5*    U  22          1H5*        U  22  -8.238   1.451 -12.793
  233    H4*    U  22           H4*        U  22  -8.122  -1.110 -14.435
  234    H3*    U  22           H3*        U  22  -8.939  -0.560 -11.572
  235    H2*    U  22           H2*        U  22  -7.676  -2.376 -10.798
  236   2HO*    U  22          2HO*        U  22  -8.013  -3.337 -13.449
  237    H1*    U  22           H1*        U  22  -5.621  -2.324 -12.708
  238    H3     U  22           H3         U  22  -4.264  -2.015  -8.262
  239    H5     U  22           H5         U  22  -4.689   1.912  -9.735
  240    H6     U  22           H6         U  22  -5.783   0.988 -11.694
  241   1H5*    G  23          2H5*        G  23 -11.897  -4.619 -11.792
  242   2H5*    G  23          1H5*        G  23 -12.741  -3.893 -10.409
  243    H4*    G  23           H4*        G  23 -11.284  -6.214 -10.291
  244    H3*    G  23           H3*        G  23 -12.069  -4.136  -8.233
  245    H2*    G  23           H2*        G  23 -10.666  -5.106  -6.627
  246   2HO*    G  23          2HO*        G  23 -10.750  -7.465  -8.241
  247    H1*    G  23           H1*        G  23  -8.670  -6.099  -8.334
  248    H8     G  23           H8         G  23  -9.187  -2.479  -9.046
  249    H1     G  23           H1         G  23  -5.927  -3.404  -3.644
  250   1H2     G  23          H21         G  23  -6.035  -5.539  -3.051
  251   2H2     G  23          H22         G  23  -6.908  -6.731  -3.987
  252   1H5*    U  24          2H5*        U  24 -14.135  -7.539  -4.791
  253   2H5*    U  24          1H5*        U  24 -13.711  -5.935  -4.160
  254    H4*    U  24           H4*        U  24 -12.218  -8.532  -3.955
  255    H3*    U  24           H3*        U  24 -12.970  -6.221  -2.140
  256    H2*    U  24           H2*        U  24 -11.024  -6.545  -0.855
  257   2HO*    U  24          2HO*        U  24 -10.463  -9.005  -2.166
  258    H1*    U  24           H1*        U  24  -9.281  -7.225  -2.890
  259    H3     U  24           H3         U  24  -8.261  -3.255  -0.725
  260    H5     U  24           H5         U  24 -10.711  -2.258  -4.007
  261    H6     U  24           H6         U  24 -11.153  -4.624  -4.310
  262   1H5*    C  25          2H5*        C  25 -10.770  -8.588   0.512
  263   2H5*    C  25          1H5*        C  25 -12.016  -9.167   1.637
  264    H4*    C  25           H4*        C  25 -10.155  -8.107   2.858
  265    H3*    C  25           H3*        C  25 -12.930  -6.968   2.908
  266    H2*    C  25           H2*        C  25 -12.231  -4.867   3.551
  267   2HO*    C  25          2HO*        C  25 -10.243  -5.191   5.238
  268    H1*    C  25           H1*        C  25  -9.324  -5.477   3.498
  269   1H4     C  25          H41         C  25  -9.752   0.551   1.513
  270   2H4     C  25          H42         C  25 -10.758   0.075   0.163
  271    H5     C  25           H5         C  25 -11.516  -2.186  -0.184
  272    H6     C  25           H6         C  25 -11.473  -4.478   0.686
  273   1H5*    C  26          2H5*        C  26 -11.374  -7.817   7.915
  274   2H5*    C  26          1H5*        C  26 -12.921  -7.205   8.533
  275    H4*    C  26           H4*        C  26 -10.616  -6.175   9.364
  276    H3*    C  26           H3*        C  26 -13.183  -4.729   8.653
  277    H2*    C  26           H2*        C  26 -12.195  -2.687   9.214
  278   2HO*    C  26          2HO*        C  26 -10.179  -2.630  10.396
  279    H1*    C  26           H1*        C  26  -9.628  -3.285   8.285
  280   1H4     C  26          H41         C  26 -12.365   0.600   4.042
  281   2H4     C  26          H42         C  26 -13.204  -0.758   3.325
  282    H5     C  26           H5         C  26 -13.129  -2.987   4.236
  283    H6     C  26           H6         C  26 -12.236  -4.395   6.036
  284    H3T    C  26           H3T        C  26 -12.131  -4.731  11.213
  Start of MODEL    5
    1   1H5*    G   1          2H5*        G   1  -8.834  11.021   5.824
    2   2H5*    G   1          1H5*        G   1  -7.145  10.537   5.565
    3    H4*    G   1           H4*        G   1  -8.244  10.074   7.888
    4    H3*    G   1           H3*        G   1  -6.083   8.935   6.639
    5    H2*    G   1           H2*        G   1  -7.316   7.161   5.551
    6   2HO*    G   1          2HO*        G   1  -7.233   5.393   7.414
    7    H1*    G   1           H1*        G   1  -8.892   6.716   8.093
    8    H8     G   1           H8         G   1 -10.313   7.677   4.693
    9    H1     G   1           H1         G   1 -10.862   1.463   6.005
   10   1H2     G   1          H21         G   1  -9.729   0.971   7.845
   11   2H2     G   1          H22         G   1  -8.837   2.175   8.750
   12    H5T    G   1           H5T        G   1  -7.861   9.411   3.975
   13   1H5*    G   2          2H5*        G   2  -2.999   6.066   8.981
   14   2H5*    G   2          1H5*        G   2  -3.961   6.368   7.519
   15    H4*    G   2           H4*        G   2  -4.324   4.037   9.444
   16    H3*    G   2           H3*        G   2  -2.804   4.411   6.891
   17    H2*    G   2           H2*        G   2  -4.049   2.876   5.725
   18   2HO*    G   2          2HO*        G   2  -4.094   0.790   6.434
   19    H1*    G   2           H1*        G   2  -5.908   2.225   7.945
   20    H8     G   2           H8         G   2  -6.640   4.993   5.469
   21    H1     G   2           H1         G   2  -8.935  -0.669   3.644
   22   1H2     G   2          H21         G   2  -8.160  -2.263   4.984
   23   2H2     G   2          H22         G   2  -7.084  -1.926   6.320
   24   1H5*    A   3          2H5*        A   3  -0.547   1.201   5.285
   25   2H5*    A   3          1H5*        A   3  -2.230   1.759   5.236
   26    H4*    A   3           H4*        A   3  -1.705  -1.135   5.862
   27    H3*    A   3           H3*        A   3  -1.257   0.220   3.188
   28    H2*    A   3           H2*        A   3  -2.469  -1.441   2.089
   29   2HO*    A   3          2HO*        A   3  -1.482  -3.030   4.191
   30    H1*    A   3           H1*        A   3  -4.134  -2.242   4.256
   31    H8     A   3           H8         A   3  -4.410   1.386   3.217
   32   1H6     A   3          H61         A   3  -8.503  -0.417  -1.019
   33   2H6     A   3          H62         A   3  -7.766   0.961  -0.232
   34    H2     A   3           H2         A   3  -6.656  -4.094   0.789
   35   1H5*    C   4          2H5*        C   4  -0.098  -4.115   3.751
   36   2H5*    C   4          1H5*        C   4   1.179  -4.639   2.635
   37    H4*    C   4           H4*        C   4  -0.980  -6.054   2.711
   38    H3*    C   4           H3*        C   4   0.328  -4.951   0.208
   39    H2*    C   4           H2*        C   4  -1.386  -5.833  -1.121
   40   2HO*    C   4          2HO*        C   4  -1.725  -7.884  -0.711
   41    H1*    C   4           H1*        C   4  -3.484  -5.698   0.762
   42   1H4     C   4          H41         C   4  -4.682  -1.423  -3.807
   43   2H4     C   4          H42         C   4  -3.588  -0.291  -3.042
   44    H5     C   4           H5         C   4  -2.228  -0.853  -1.134
   45    H6     C   4           H6         C   4  -1.623  -2.620   0.452
   46   1H5*    A   5          2H5*        A   5   1.552  -9.286  -2.549
   47   2H5*    A   5          1H5*        A   5   1.314  -7.580  -2.978
   48    H4*    A   5           H4*        A   5  -0.644  -9.879  -3.222
   49    H3*    A   5           H3*        A   5   0.723  -7.928  -5.087
   50    H2*    A   5           H2*        A   5  -1.210  -7.751  -6.425
   51   2HO*    A   5          2HO*        A   5  -2.712  -9.337  -6.565
   52    H1*    A   5           H1*        A   5  -3.124  -7.856  -4.442
   53    H8     A   5           H8         A   5  -0.480  -5.545  -3.211
   54   1H6     A   5          H61         A   5  -2.793  -1.181  -6.886
   55   2H6     A   5          H62         A   5  -1.687  -1.513  -5.572
   56    H2     A   5           H2         A   5  -4.692  -5.098  -8.008
   57   1H5*    C   6          2H5*        C   6  -1.342 -10.253  -7.403
   58   2H5*    C   6          1H5*        C   6  -0.372 -11.539  -8.150
   59    H4*    C   6           H4*        C   6  -1.724 -10.960  -9.937
   60    H3*    C   6           H3*        C   6   0.775  -9.251  -9.991
   61    H2*    C   6           H2*        C   6  -0.053  -8.000 -11.804
   62   2HO*    C   6          2HO*        C   6  -1.914  -8.816 -13.020
   63    H1*    C   6           H1*        C   6  -2.747  -7.992 -11.129
   64   1H4     C   6          H41         C   6  -0.551  -2.253  -9.510
   65   2H4     C   6          H42         C   6   0.331  -2.931  -8.160
   66    H5     C   6           H5         C   6   0.436  -5.294  -7.704
   67    H6     C   6           H6         C   6  -0.280  -7.517  -8.444
   68   1H5*    G   7          2H5*        G   7   0.630 -10.075 -14.592
   69   2H5*    G   7          1H5*        G   7   2.308  -9.532 -14.789
   70    H4*    G   7           H4*        G   7   0.085  -8.045 -15.444
   71    H3*    G   7           H3*        G   7   2.969  -7.391 -14.821
   72    H2*    G   7           H2*        G   7   2.482  -5.050 -14.742
   73   2HO*    G   7          2HO*        G   7  -0.191  -5.425 -15.581
   74    H1*    G   7           H1*        G   7   0.132  -5.173 -13.381
   75    H8     G   7           H8         G   7   2.135  -7.802 -11.737
   76    H1     G   7           H1         G   7   4.346  -1.996 -10.306
   77   1H2     G   7          H21         G   7   3.450  -0.487 -11.662
   78   2H2     G   7          H22         G   7   2.309  -0.912 -12.917
   79   1H5*    A   8          2H5*        A   8   2.576  -8.600 -19.464
   80   2H5*    A   8          1H5*        A   8   2.752  -7.498 -20.843
   81    H4*    A   8           H4*        A   8   0.371  -8.586 -19.994
   82    H3*    A   8           H3*        A   8   1.156  -6.209 -21.671
   83    H2*    A   8           H2*        A   8  -1.043  -5.284 -21.583
   84   2HO*    A   8          2HO*        A   8  -1.855  -7.847 -20.594
   85    H1*    A   8           H1*        A   8  -1.633  -5.795 -18.982
   86    H8     A   8           H8         A   8   1.612  -4.766 -18.132
   87   1H6     A   8          H61         A   8   0.672   0.926 -20.282
   88   2H6     A   8          H62         A   8   1.698  -0.081 -19.282
   89    H2     A   8           H2         A   8  -2.559  -1.735 -21.921
   90   1H5*    A   9          2H5*        A   9  -1.657  -7.451 -25.253
   91   2H5*    A   9          1H5*        A   9  -0.431  -6.811 -26.365
   92    H4*    A   9           H4*        A   9  -2.823  -5.600 -25.898
   93    H3*    A   9           H3*        A   9  -0.108  -4.546 -26.727
   94    H2*    A   9           H2*        A   9  -0.840  -2.320 -26.509
   95   2HO*    A   9          2HO*        A   9  -3.030  -1.759 -26.548
   96    H1*    A   9           H1*        A   9  -2.526  -2.628 -24.329
   97    H8     A   9           H8         A   9   0.599  -4.392 -23.421
   98   1H6     A   9          H61         A   9   3.213   1.073 -22.307
   99   2H6     A   9          H62         A   9   3.376  -0.658 -22.122
  100    H2     A   9           H2         A   9  -0.669   1.795 -24.456
  101   1H5*    A  10          2H5*        A  10  -1.156  -1.160 -30.515
  102   2H5*    A  10          1H5*        A  10   0.316  -2.091 -30.170
  103    H4*    A  10           H4*        A  10  -0.807   0.284 -28.660
  104    H3*    A  10           H3*        A  10   1.124   0.129 -30.666
  105    H2*    A  10           H2*        A  10   2.724  -1.115 -29.418
  106   2HO*    A  10          2HO*        A  10   3.388   1.261 -28.101
  107    H1*    A  10           H1*        A  10   1.986   0.410 -26.911
  108    H8     A  10           H8         A  10   1.643  -3.344 -27.340
  109   1H6     A  10          H61         A  10   6.867  -3.902 -24.124
  110   2H6     A  10          H62         A  10   5.519  -4.764 -24.831
  111    H2     A  10           H2         A  10   6.243   0.457 -25.029
  112   1H5*    U  11          2H5*        U  11   3.314   3.287 -32.280
  113   2H5*    U  11          1H5*        U  11   3.289   1.738 -33.146
  114    H4*    U  11           H4*        U  11   4.240   2.197 -30.293
  115    H3*    U  11           H3*        U  11   5.636   2.564 -32.722
  116    H2*    U  11           H2*        U  11   5.770   0.266 -33.293
  117   2HO*    U  11          2HO*        U  11   7.734  -0.589 -32.349
  118    H1*    U  11           H1*        U  11   5.955  -0.447 -30.354
  119    H3     U  11           H3         U  11   6.687  -4.615 -32.023
  120    H5     U  11           H5         U  11   2.873  -3.552 -33.470
  121    H6     U  11           H6         U  11   3.232  -1.320 -32.585
  122   1H5*    C  12          2H5*        C  12   9.522   0.973 -32.562
  123   2H5*    C  12          1H5*        C  12  10.053   2.156 -31.351
  124    H4*    C  12           H4*        C  12  11.710   2.356 -32.982
  125    H3*    C  12           H3*        C  12  10.015   4.538 -32.696
  126    H2*    C  12           H2*        C  12   8.715   4.150 -34.653
  127   2HO*    C  12          2HO*        C  12  10.240   5.230 -36.438
  128    H1*    C  12           H1*        C  12  11.182   3.254 -36.155
  129   1H4     C  12          H41         C  12   6.785   1.323 -40.302
  130   2H4     C  12          H42         C  12   5.610   1.060 -39.032
  131    H5     C  12           H5         C  12   6.073   1.467 -36.703
  132    H6     C  12           H6         C  12   7.759   2.214 -35.088
  133   1H5*    C  13          2H5*        C  13   9.702   6.876 -33.241
  134   2H5*    C  13          1H5*        C  13  10.911   6.436 -34.465
  135    H4*    C  13           H4*        C  13  11.731   8.917 -34.150
  136    H3*    C  13           H3*        C  13   9.522   8.927 -32.342
  137    H2*    C  13           H2*        C  13   7.842   9.162 -33.982
  138   2HO*    C  13          2HO*        C  13   8.004  11.598 -34.682
  139    H1*    C  13           H1*        C  13   9.774  10.637 -35.789
  140   1H4     C  13          H41         C  13   4.552   9.675 -39.385
  141   2H4     C  13          H42         C  13   5.096   8.034 -39.655
  142    H5     C  13           H5         C  13   6.989   7.067 -38.523
  143    H6     C  13           H6         C  13   8.771   7.463 -36.889
  144   1H5*    C  14          2H5*        C  14   8.208  11.231 -31.727
  145   2H5*    C  14          1H5*        C  14   9.191  12.693 -31.508
  146    H4*    C  14           H4*        C  14   7.763  13.320 -29.889
  147    H3*    C  14           H3*        C  14   9.568  11.632 -28.597
  148    H2*    C  14           H2*        C  14   8.172   9.708 -28.543
  149   2HO*    C  14          2HO*        C  14   7.167  11.275 -26.368
  150    H1*    C  14           H1*        C  14   5.744  11.449 -28.070
  151   1H4     C  14          H41         C  14   2.878   5.898 -29.196
  152   2H4     C  14          H42         C  14   3.958   5.545 -30.526
  153    H5     C  14           H5         C  14   5.773   6.993 -31.171
  154    H6     C  14           H6         C  14   6.943   9.090 -30.681
  155   1H5*    G  15          2H5*        G  15   9.712  11.352 -24.367
  156   2H5*    G  15          1H5*        G  15  11.334  10.908 -24.935
  157    H4*    G  15           H4*        G  15   8.748   9.427 -25.164
  158    H3*    G  15           H3*        G  15  11.450   8.914 -24.179
  159    H2*    G  15           H2*        G  15  12.179   7.272 -25.648
  160   2HO*    G  15          2HO*        G  15  10.920   5.584 -25.752
  161    H1*    G  15           H1*        G  15  10.790   7.696 -27.937
  162    H8     G  15           H8         G  15  12.205   9.393 -29.466
  163    H1     G  15           H1         G  15  15.851  10.991 -24.487
  164   1H2     G  15          H21         G  15  14.965  10.203 -22.613
  165   2H2     G  15          H22         G  15  13.477   9.285 -22.592
  166   1H5*    A  16          2H5*        A  16   7.714   7.035 -23.230
  167   2H5*    A  16          1H5*        A  16   6.964   8.341 -22.290
  168    H4*    A  16           H4*        A  16   6.096   6.882 -20.698
  169    H3*    A  16           H3*        A  16   8.602   5.401 -21.144
  170    H2*    A  16           H2*        A  16   7.731   3.249 -21.471
  171   2HO*    A  16          2HO*        A  16   5.273   3.117 -20.803
  172    H1*    A  16           H1*        A  16   5.419   3.700 -22.747
  173    H8     A  16           H8         A  16   9.122   4.115 -22.840
  174   1H6     A  16          H61         A  16   8.896   4.415 -28.973
  175   2H6     A  16          H62         A  16   9.938   4.257 -27.577
  176    H2     A  16           H2         A  16   4.688   4.721 -27.444
  177   1H5*    A  17          2H5*        A  17   9.035   3.059 -19.722
  178   2H5*    A  17          1H5*        A  17   7.531   2.654 -18.872
  179    H4*    A  17           H4*        A  17   9.667   1.779 -17.205
  180    H3*    A  17           H3*        A  17  10.844   1.857 -19.653
  181    H2*    A  17           H2*        A  17   9.130   0.670 -20.842
  182   2HO*    A  17          2HO*        A  17  11.206  -0.995 -19.944
  183    H1*    A  17           H1*        A  17   8.919  -1.395 -18.658
  184    H8     A  17           H8         A  17   6.555   1.151 -20.394
  185   1H6     A  17          H61         A  17   3.230  -3.764 -22.035
  186   2H6     A  17          H62         A  17   3.328  -2.018 -22.081
  187    H2     A  17           H2         A  17   6.869  -5.215 -19.833
  188   1H5*    G  18          2H5*        G  18  12.198   0.083 -14.250
  189   2H5*    G  18          1H5*        G  18  12.019  -0.925 -15.699
  190    H4*    G  18           H4*        G  18   9.498   0.014 -15.537
  191    H3*    G  18           H3*        G  18  10.599   0.842 -13.004
  192    H2*    G  18           H2*        G  18  10.358  -1.244 -11.949
  193   2HO*    G  18          2HO*        G  18   8.714  -0.177 -10.905
  194    H1*    G  18           H1*        G  18   8.077  -1.936 -13.822
  195    H8     G  18           H8         G  18  11.169  -3.233 -11.875
  196    H1     G  18           H1         G  18   6.859  -7.705 -13.317
  197   1H2     G  18          H21         G  18   5.263  -6.840 -14.591
  198   2H2     G  18          H22         G  18   5.261  -5.162 -15.085
  199   1H5*    U  19          2H5*        U  19   8.211   1.948 -15.418
  200   2H5*    U  19          1H5*        U  19   8.796   3.592 -15.740
  201    H4*    U  19           H4*        U  19   6.773   4.294 -16.577
  202    H3*    U  19           H3*        U  19   5.584   2.452 -14.487
  203    H2*    U  19           H2*        U  19   3.639   2.158 -15.779
  204   2HO*    U  19          2HO*        U  19   4.406   4.271 -17.527
  205    H1*    U  19           H1*        U  19   4.793   2.165 -18.297
  206    H3     U  19           H3         U  19   3.007  -1.964 -17.732
  207    H5     U  19           H5         U  19   6.471  -1.994 -15.330
  208    H6     U  19           H6         U  19   6.732   0.373 -15.794
  209   1H5*    A  20          2H5*        A  20   2.900   6.161 -15.612
  210   2H5*    A  20          1H5*        A  20   1.809   6.434 -14.238
  211    H4*    A  20           H4*        A  20   0.691   6.162 -16.520
  212    H3*    A  20           H3*        A  20   0.014   4.584 -14.032
  213    H2*    A  20           H2*        A  20  -1.545   3.257 -15.198
  214   2HO*    A  20          2HO*        A  20  -1.641   4.325 -17.651
  215    H1*    A  20           H1*        A  20  -0.203   2.982 -17.579
  216    H8     A  20           H8         A  20   1.876   2.705 -14.363
  217   1H6     A  20          H61         A  20   0.645  -3.327 -14.532
  218   2H6     A  20          H62         A  20   1.549  -2.070 -13.719
  219    H2     A  20           H2         A  20  -1.713  -1.330 -17.797
  220   1H5*    G  21          2H5*        G  21  -3.815   5.436 -16.309
  221   2H5*    G  21          1H5*        G  21  -5.024   5.583 -15.018
  222    H4*    G  21           H4*        G  21  -5.297   3.673 -16.765
  223    H3*    G  21           H3*        G  21  -5.572   3.525 -13.766
  224    H2*    G  21           H2*        G  21  -5.814   1.180 -13.792
  225   2HO*    G  21          2HO*        G  21  -6.952   0.302 -15.340
  226    H1*    G  21           H1*        G  21  -4.005   0.554 -15.744
  227    H8     G  21           H8         G  21  -2.822   3.333 -13.418
  228    H1     G  21           H1         G  21  -1.706  -2.527 -11.165
  229   1H2     G  21          H21         G  21  -2.712  -4.035 -12.439
  230   2H2     G  21          H22         G  21  -3.658  -3.599 -13.844
  231   1H5*    U  22          2H5*        U  22  -8.917   0.270 -15.374
  232   2H5*    U  22          1H5*        U  22 -10.034   0.806 -14.101
  233    H4*    U  22           H4*        U  22  -8.877  -1.678 -14.201
  234    H3*    U  22           H3*        U  22 -10.114   0.008 -12.051
  235    H2*    U  22           H2*        U  22  -8.864  -0.934 -10.360
  236   2HO*    U  22          2HO*        U  22  -8.630  -3.507 -11.027
  237    H1*    U  22           H1*        U  22  -7.232  -2.691 -12.109
  238    H3     U  22           H3         U  22  -4.539  -2.368  -8.487
  239    H5     U  22           H5         U  22  -4.922   1.609  -9.831
  240    H6     U  22           H6         U  22  -6.562   0.836 -11.444
  241   1H5*    G  23          2H5*        G  23 -13.258  -3.886  -9.792
  242   2H5*    G  23          1H5*        G  23 -12.029  -2.873  -9.007
  243    H4*    G  23           H4*        G  23 -12.009  -5.861  -9.474
  244    H3*    G  23           H3*        G  23 -11.884  -3.978  -7.115
  245    H2*    G  23           H2*        G  23 -10.313  -5.332  -5.998
  246   2HO*    G  23          2HO*        G  23 -11.216  -7.358  -7.786
  247    H1*    G  23           H1*        G  23  -8.798  -6.129  -8.140
  248    H8     G  23           H8         G  23  -9.290  -2.563  -8.838
  249    H1     G  23           H1         G  23  -5.490  -3.375  -3.783
  250   1H2     G  23          H21         G  23  -5.614  -5.473  -3.072
  251   2H2     G  23          H22         G  23  -6.632  -6.668  -3.844
  252   1H5*    U  24          2H5*        U  24 -12.896  -7.915  -5.583
  253   2H5*    U  24          1H5*        U  24 -13.963  -7.846  -4.166
  254    H4*    U  24           H4*        U  24 -11.635  -8.895  -3.828
  255    H3*    U  24           H3*        U  24 -12.875  -6.719  -2.130
  256    H2*    U  24           H2*        U  24 -10.929  -6.536  -0.826
  257   2HO*    U  24          2HO*        U  24 -10.460  -9.177  -1.745
  258    H1*    U  24           H1*        U  24  -9.031  -7.055  -2.794
  259    H3     U  24           H3         U  24  -8.453  -2.861  -1.015
  260    H5     U  24           H5         U  24 -11.378  -2.439  -4.022
  261    H6     U  24           H6         U  24 -11.461  -4.857  -4.190
  262   1H5*    C  25          2H5*        C  25 -10.669  -9.188   1.054
  263   2H5*    C  25          1H5*        C  25 -12.064  -9.417   2.129
  264    H4*    C  25           H4*        C  25  -9.991  -8.248   3.123
  265    H3*    C  25           H3*        C  25 -12.862  -7.402   3.312
  266    H2*    C  25           H2*        C  25 -12.350  -5.196   3.739
  267   2HO*    C  25          2HO*        C  25 -11.009  -6.535   5.720
  268    H1*    C  25           H1*        C  25  -9.401  -5.543   3.553
  269   1H4     C  25          H41         C  25 -10.457   0.304   1.289
  270   2H4     C  25          H42         C  25 -11.470  -0.334   0.013
  271    H5     C  25           H5         C  25 -12.038  -2.669  -0.179
  272    H6     C  25           H6         C  25 -11.757  -4.895   0.809
  273   1H5*    C  26          2H5*        C  26 -11.642  -7.644   8.574
  274   2H5*    C  26          1H5*        C  26 -13.136  -6.701   8.751
  275    H4*    C  26           H4*        C  26 -10.578  -5.874   9.493
  276    H3*    C  26           H3*        C  26 -13.170  -4.409   8.915
  277    H2*    C  26           H2*        C  26 -12.081  -2.368   9.214
  278   2HO*    C  26          2HO*        C  26  -9.989  -2.273  10.243
  279    H1*    C  26           H1*        C  26  -9.597  -3.153   8.165
  280   1H4     C  26          H41         C  26 -12.476   0.691   3.964
  281   2H4     C  26          H42         C  26 -13.312  -0.688   3.285
  282    H5     C  26           H5         C  26 -13.197  -2.900   4.237
  283    H6     C  26           H6         C  26 -12.258  -4.263   6.048
  284    H3T    C  26           H3T        C  26 -11.603  -4.875  11.267
  Start of MODEL    6
    1   1H5*    G   1          2H5*        G   1  -9.796  10.580   7.463
    2   2H5*    G   1          1H5*        G   1  -8.062  10.267   7.247
    3    H4*    G   1           H4*        G   1  -9.156   9.360   9.393
    4    H3*    G   1           H3*        G   1  -7.001   8.415   7.926
    5    H2*    G   1           H2*        G   1  -8.228   6.723   6.723
    6   2HO*    G   1          2HO*        G   1  -6.603   5.694   8.069
    7    H1*    G   1           H1*        G   1  -9.785   6.105   9.245
    8    H8     G   1           H8         G   1 -11.475   7.267   6.091
    9    H1     G   1           H1         G   1 -11.368   0.913   6.611
   10   1H2     G   1          H21         G   1 -10.020   0.309   8.263
   11   2H2     G   1          H22         G   1  -9.147   1.471   9.237
   12    H5T    G   1           H5T        G   1  -8.570   9.329   5.467
   13   1H5*    G   2          2H5*        G   2  -3.753   5.705   9.379
   14   2H5*    G   2          1H5*        G   2  -4.711   6.130   7.948
   15    H4*    G   2           H4*        G   2  -4.405   3.412   9.260
   16    H3*    G   2           H3*        G   2  -3.564   4.705   6.688
   17    H2*    G   2           H2*        G   2  -4.667   3.169   5.372
   18   2HO*    G   2          2HO*        G   2  -2.918   1.679   6.713
   19    H1*    G   2           H1*        G   2  -5.826   1.623   7.634
   20    H8     G   2           H8         G   2  -7.323   4.575   5.671
   21    H1     G   2           H1         G   2  -9.521  -1.138   3.888
   22   1H2     G   2          H21         G   2  -8.427  -2.739   4.962
   23   2H2     G   2          H22         G   2  -7.157  -2.400   6.115
   24   1H5*    A   3          2H5*        A   3  -1.126   0.292   7.494
   25   2H5*    A   3          1H5*        A   3   0.121   0.503   6.248
   26    H4*    A   3           H4*        A   3  -1.452  -1.661   6.303
   27    H3*    A   3           H3*        A   3  -0.355  -0.088   3.957
   28    H2*    A   3           H2*        A   3  -1.674  -1.276   2.462
   29   2HO*    A   3          2HO*        A   3  -2.406  -3.522   3.610
   30    H1*    A   3           H1*        A   3  -3.633  -2.247   4.357
   31    H8     A   3           H8         A   3  -3.276   1.445   3.381
   32   1H6     A   3          H61         A   3  -7.696   0.384  -0.773
   33   2H6     A   3          H62         A   3  -6.698   1.608  -0.021
   34    H2     A   3           H2         A   3  -6.562  -3.546   1.093
   35   1H5*    C   4          2H5*        C   4   1.486  -5.011   3.099
   36   2H5*    C   4          1H5*        C   4   1.591  -4.595   1.378
   37    H4*    C   4           H4*        C   4  -0.264  -6.356   2.682
   38    H3*    C   4           H3*        C   4   0.283  -5.428  -0.154
   39    H2*    C   4           H2*        C   4  -1.795  -6.290  -0.862
   40   2HO*    C   4          2HO*        C   4  -2.447  -8.131  -0.060
   41    H1*    C   4           H1*        C   4  -3.290  -5.633   1.366
   42   1H4     C   4          H41         C   4  -4.259  -1.302  -3.250
   43   2H4     C   4          H42         C   4  -3.096  -0.262  -2.460
   44    H5     C   4           H5         C   4  -1.760  -0.963  -0.582
   45    H6     C   4           H6         C   4  -1.251  -2.811   0.945
   46   1H5*    A   5          2H5*        A   5   0.069 -10.268  -1.774
   47   2H5*    A   5          1H5*        A   5   1.126  -9.539  -2.998
   48    H4*    A   5           H4*        A   5  -1.459 -10.453  -3.432
   49    H3*    A   5           H3*        A   5   0.390  -8.557  -4.911
   50    H2*    A   5           H2*        A   5  -1.350  -7.953  -6.367
   51   2HO*    A   5          2HO*        A   5  -2.440 -10.461  -5.598
   52    H1*    A   5           H1*        A   5  -3.489  -8.185  -4.567
   53    H8     A   5           H8         A   5  -1.019  -6.015  -2.903
   54   1H6     A   5          H61         A   5  -2.720  -1.388  -6.592
   55   2H6     A   5          H62         A   5  -1.822  -1.822  -5.154
   56    H2     A   5           H2         A   5  -4.477  -5.189  -8.225
   57   1H5*    C   6          2H5*        C   6  -2.234 -10.132  -7.800
   58   2H5*    C   6          1H5*        C   6  -1.230 -11.376  -8.572
   59    H4*    C   6           H4*        C   6  -2.255 -10.397 -10.423
   60    H3*    C   6           H3*        C   6   0.396  -9.035  -9.867
   61    H2*    C   6           H2*        C   6   0.011  -7.498 -11.599
   62   2HO*    C   6          2HO*        C   6  -2.218  -8.810 -12.676
   63    H1*    C   6           H1*        C   6  -2.773  -7.310 -11.377
   64   1H4     C   6          H41         C   6  -0.450  -1.900  -8.989
   65   2H4     C   6          H42         C   6   0.219  -2.746  -7.611
   66    H5     C   6           H5         C   6   0.113  -5.140  -7.354
   67    H6     C   6           H6         C   6  -0.656  -7.238  -8.361
   68   1H5*    G   7          2H5*        G   7   0.331  -9.859 -14.284
   69   2H5*    G   7          1H5*        G   7   1.983  -9.502 -14.825
   70    H4*    G   7           H4*        G   7  -0.094  -7.839 -15.279
   71    H3*    G   7           H3*        G   7   2.858  -7.375 -14.878
   72    H2*    G   7           H2*        G   7   2.566  -5.011 -14.734
   73   2HO*    G   7          2HO*        G   7   0.547  -5.532 -16.425
   74    H1*    G   7           H1*        G   7   0.293  -4.944 -13.243
   75    H8     G   7           H8         G   7   2.210  -7.745 -11.758
   76    H1     G   7           H1         G   7   4.830  -2.109 -10.331
   77   1H2     G   7          H21         G   7   3.953  -0.521 -11.608
   78   2H2     G   7          H22         G   7   2.723  -0.849 -12.808
   79   1H5*    A   8          2H5*        A   8   1.585  -8.771 -18.881
   80   2H5*    A   8          1H5*        A   8   1.891  -8.227 -20.543
   81    H4*    A   8           H4*        A   8  -0.580  -8.319 -19.545
   82    H3*    A   8           H3*        A   8   0.722  -6.361 -21.444
   83    H2*    A   8           H2*        A   8  -1.184  -4.934 -21.395
   84   2HO*    A   8          2HO*        A   8  -2.961  -6.372 -19.951
   85    H1*    A   8           H1*        A   8  -1.893  -5.241 -18.750
   86    H8     A   8           H8         A   8   1.524  -4.638 -18.068
   87   1H6     A   8          H61         A   8   1.125   1.129 -20.187
   88   2H6     A   8          H62         A   8   2.081   0.011 -19.241
   89    H2     A   8           H2         A   8  -2.477  -1.139 -21.632
   90   1H5*    A   9          2H5*        A   9  -2.375  -6.688 -22.904
   91   2H5*    A   9          1H5*        A   9  -2.880  -7.298 -24.494
   92    H4*    A   9           H4*        A   9  -3.580  -5.025 -24.456
   93    H3*    A   9           H3*        A   9  -1.041  -5.542 -26.001
   94    H2*    A   9           H2*        A   9  -0.529  -3.293 -26.146
   95   2HO*    A   9          2HO*        A   9  -3.182  -3.249 -26.826
   96    H1*    A   9           H1*        A   9  -2.440  -2.331 -24.155
   97    H8     A   9           H8         A   9   0.639  -4.022 -22.836
   98   1H6     A   9          H61         A   9   3.470   1.443 -23.061
   99   2H6     A   9          H62         A   9   3.581  -0.208 -22.491
  100    H2     A   9           H2         A   9  -0.458   1.817 -25.217
  101   1H5*    A  10          2H5*        A  10  -1.094  -3.793 -30.495
  102   2H5*    A  10          1H5*        A  10  -0.040  -4.879 -29.567
  103    H4*    A  10           H4*        A  10  -0.002  -1.855 -29.690
  104    H3*    A  10           H3*        A  10   1.552  -3.903 -30.915
  105    H2*    A  10           H2*        A  10   2.881  -4.401 -29.031
  106   2HO*    A  10          2HO*        A  10   3.873  -2.189 -30.394
  107    H1*    A  10           H1*        A  10   2.612  -1.556 -28.036
  108    H8     A  10           H8         A  10   1.417  -4.722 -26.274
  109   1H6     A  10          H61         A  10   6.294  -4.114 -22.563
  110   2H6     A  10          H62         A  10   4.813  -5.000 -22.852
  111    H2     A  10           H2         A  10   6.662  -1.078 -25.856
  112   1H5*    U  11          2H5*        U  11   4.623  -1.454 -33.814
  113   2H5*    U  11          1H5*        U  11   5.099  -3.152 -34.021
  114    H4*    U  11           H4*        U  11   6.060  -1.130 -32.010
  115    H3*    U  11           H3*        U  11   7.211  -2.259 -34.273
  116    H2*    U  11           H2*        U  11   7.349  -4.486 -33.430
  117   2HO*    U  11          2HO*        U  11   9.558  -4.199 -32.021
  118    H1*    U  11           H1*        U  11   8.069  -3.415 -30.692
  119    H3     U  11           H3         U  11   8.712  -7.963 -30.252
  120    H5     U  11           H5         U  11   4.543  -7.381 -30.483
  121    H6     U  11           H6         U  11   4.966  -5.070 -31.090
  122   1H5*    C  12          2H5*        C  12   7.139  -0.597 -36.376
  123   2H5*    C  12          1H5*        C  12   8.470   0.554 -36.145
  124    H4*    C  12           H4*        C  12   6.428   1.421 -37.421
  125    H3*    C  12           H3*        C  12   8.158   2.736 -35.620
  126    H2*    C  12           H2*        C  12   6.599   2.921 -33.841
  127   2HO*    C  12          2HO*        C  12   6.985   5.079 -34.768
  128    H1*    C  12           H1*        C  12   4.349   3.230 -35.846
  129   1H4     C  12          H41         C  12   0.810   2.413 -30.643
  130   2H4     C  12          H42         C  12   2.029   1.407 -29.893
  131    H5     C  12           H5         C  12   4.128   0.873 -30.946
  132    H6     C  12           H6         C  12   5.515   1.190 -32.942
  133   1H5*    C  13          2H5*        C  13   7.312   7.565 -35.661
  134   2H5*    C  13          1H5*        C  13   8.914   7.347 -36.394
  135    H4*    C  13           H4*        C  13   9.521   8.205 -34.332
  136    H3*    C  13           H3*        C  13  10.091   5.519 -34.640
  137    H2*    C  13           H2*        C  13   8.242   4.682 -33.386
  138   2HO*    C  13          2HO*        C  13   9.318   4.957 -30.985
  139    H1*    C  13           H1*        C  13   8.559   6.894 -31.352
  140   1H4     C  13          H41         C  13   3.094   4.017 -29.713
  141   2H4     C  13          H42         C  13   2.321   4.720 -31.115
  142    H5     C  13           H5         C  13   3.512   5.967 -32.794
  143    H6     C  13           H6         C  13   5.706   6.810 -33.494
  144   1H5*    C  14          2H5*        C  14  10.603   3.486 -33.126
  145   2H5*    C  14          1H5*        C  14  11.715   4.108 -31.890
  146    H4*    C  14           H4*        C  14  12.360   1.880 -31.973
  147    H3*    C  14           H3*        C  14  14.195   3.659 -33.040
  148    H2*    C  14           H2*        C  14  13.711   3.229 -35.334
  149   2HO*    C  14          2HO*        C  14  15.378   1.983 -36.074
  150    H1*    C  14           H1*        C  14  13.390   0.281 -34.748
  151   1H4     C  14          H41         C  14  11.476   0.748 -40.809
  152   2H4     C  14          H42         C  14  10.141   1.769 -40.324
  153    H5     C  14           H5         C  14   9.830   2.550 -38.066
  154    H6     C  14           H6         C  14  10.731   2.520 -35.787
  155   1H5*    G  15          2H5*        G  15  15.065   2.650 -28.619
  156   2H5*    G  15          1H5*        G  15  14.502   1.047 -28.107
  157    H4*    G  15           H4*        G  15  12.928   3.561 -28.601
  158    H3*    G  15           H3*        G  15  13.546   1.886 -26.333
  159    H2*    G  15           H2*        G  15  11.598   0.687 -25.995
  160   2HO*    G  15          2HO*        G  15  10.627   3.126 -26.049
  161    H1*    G  15           H1*        G  15  10.221   0.786 -28.346
  162    H8     G  15           H8         G  15  10.842  -1.419 -29.740
  163    H1     G  15           H1         G  15  15.815  -2.563 -25.917
  164   1H2     G  15          H21         G  15  16.205  -0.801 -24.632
  165   2H2     G  15          H22         G  15  15.241   0.657 -24.715
  166   1H5*    A  16          2H5*        A  16  10.524   5.112 -25.644
  167   2H5*    A  16          1H5*        A  16  10.907   6.278 -24.360
  168    H4*    A  16           H4*        A  16   8.798   5.970 -23.626
  169    H3*    A  16           H3*        A  16  10.340   4.031 -22.348
  170    H2*    A  16           H2*        A  16   9.701   2.236 -23.778
  171   2HO*    A  16          2HO*        A  16   7.721   1.279 -22.708
  172    H1*    A  16           H1*        A  16   6.881   3.357 -23.829
  173    H8     A  16           H8         A  16   8.880   0.510 -24.745
  174   1H6     A  16          H61         A  16   5.694  -0.190 -29.963
  175   2H6     A  16          H62         A  16   6.817  -0.945 -28.853
  176    H2     A  16           H2         A  16   4.790   3.895 -28.325
  177   1H5*    A  17          2H5*        A  17   8.495   2.732 -20.632
  178   2H5*    A  17          1H5*        A  17   7.491   2.837 -19.173
  179    H4*    A  17           H4*        A  17   9.828   2.301 -17.976
  180    H3*    A  17           H3*        A  17  10.829   2.194 -20.477
  181    H2*    A  17           H2*        A  17   9.298   0.653 -21.446
  182   2HO*    A  17          2HO*        A  17  10.335  -1.340 -21.551
  183    H1*    A  17           H1*        A  17   9.215  -1.198 -19.111
  184    H8     A  17           H8         A  17   6.947   1.253 -21.107
  185   1H6     A  17          H61         A  17   3.135  -3.541 -21.742
  186   2H6     A  17          H62         A  17   3.392  -1.853 -22.121
  187    H2     A  17           H2         A  17   6.694  -4.896 -19.353
  188   1H5*    G  18          2H5*        G  18  12.484   0.849 -15.038
  189   2H5*    G  18          1H5*        G  18  12.272  -0.147 -16.491
  190    H4*    G  18           H4*        G  18   9.731   0.662 -16.212
  191    H3*    G  18           H3*        G  18  10.910   1.586 -13.743
  192    H2*    G  18           H2*        G  18  10.753  -0.463 -12.614
  193   2HO*    G  18          2HO*        G  18   9.058  -0.132 -11.401
  194    H1*    G  18           H1*        G  18   8.470  -1.328 -14.406
  195    H8     G  18           H8         G  18  11.736  -2.386 -12.602
  196    H1     G  18           H1         G  18   7.575  -7.119 -13.567
  197   1H2     G  18          H21         G  18   5.851  -6.387 -14.755
  198   2H2     G  18          H22         G  18   5.726  -4.732 -15.307
  199   1H5*    U  19          2H5*        U  19   8.763   2.690 -16.077
  200   2H5*    U  19          1H5*        U  19   8.928   4.402 -16.520
  201    H4*    U  19           H4*        U  19   6.862   4.450 -17.435
  202    H3*    U  19           H3*        U  19   6.053   3.173 -14.810
  203    H2*    U  19           H2*        U  19   4.137   2.270 -15.772
  204   2HO*    U  19          2HO*        U  19   2.937   3.789 -16.619
  205    H1*    U  19           H1*        U  19   5.013   2.292 -18.510
  206    H3     U  19           H3         U  19   3.064  -1.759 -17.882
  207    H5     U  19           H5         U  19   6.629  -1.953 -15.642
  208    H6     U  19           H6         U  19   6.968   0.406 -16.102
  209   1H5*    A  20          2H5*        A  20   1.526   7.016 -14.299
  210   2H5*    A  20          1H5*        A  20   1.859   5.360 -13.751
  211    H4*    A  20           H4*        A  20   0.619   6.271 -16.359
  212    H3*    A  20           H3*        A  20  -0.192   4.582 -13.981
  213    H2*    A  20           H2*        A  20  -1.370   3.077 -15.354
  214   2HO*    A  20          2HO*        A  20  -2.185   3.618 -17.319
  215    H1*    A  20           H1*        A  20   0.337   3.047 -17.516
  216    H8     A  20           H8         A  20   2.329   2.888 -14.324
  217   1H6     A  20          H61         A  20   1.122  -3.149 -14.151
  218   2H6     A  20          H62         A  20   2.060  -1.855 -13.442
  219    H2     A  20           H2         A  20  -1.402  -1.315 -17.384
  220   1H5*    G  21          2H5*        G  21  -4.943   6.016 -15.562
  221   2H5*    G  21          1H5*        G  21  -3.480   5.465 -14.722
  222    H4*    G  21           H4*        G  21  -4.767   3.911 -16.997
  223    H3*    G  21           H3*        G  21  -5.337   3.897 -14.018
  224    H2*    G  21           H2*        G  21  -5.424   1.550 -14.019
  225   2HO*    G  21          2HO*        G  21  -6.200   0.439 -15.681
  226    H1*    G  21           H1*        G  21  -3.512   1.070 -16.008
  227    H8     G  21           H8         G  21  -2.315   3.449 -13.322
  228    H1     G  21           H1         G  21  -1.930  -2.671 -11.579
  229   1H2     G  21          H21         G  21  -2.971  -3.949 -13.066
  230   2H2     G  21          H22         G  21  -3.758  -3.291 -14.483
  231   1H5*    U  22          2H5*        U  22  -9.413   1.225 -13.418
  232   2H5*    U  22          1H5*        U  22  -8.177   1.637 -12.211
  233    H4*    U  22           H4*        U  22  -8.335  -0.878 -13.912
  234    H3*    U  22           H3*        U  22  -8.715  -0.212 -10.982
  235    H2*    U  22           H2*        U  22  -7.617  -2.185 -10.333
  236   2HO*    U  22          2HO*        U  22  -8.859  -3.158 -12.473
  237    H1*    U  22           H1*        U  22  -5.754  -2.345 -12.398
  238    H3     U  22           H3         U  22  -3.956  -2.016  -8.127
  239    H5     U  22           H5         U  22  -4.265   1.903  -9.652
  240    H6     U  22           H6         U  22  -5.589   1.016 -11.481
  241   1H5*    G  23          2H5*        G  23 -11.395  -3.971 -11.260
  242   2H5*    G  23          1H5*        G  23 -12.739  -3.556 -10.176
  243    H4*    G  23           H4*        G  23 -11.311  -5.596  -9.526
  244    H3*    G  23           H3*        G  23 -12.002  -3.263  -7.729
  245    H2*    G  23           H2*        G  23 -10.637  -4.069  -6.017
  246   2HO*    G  23          2HO*        G  23 -11.594  -6.451  -6.958
  247    H1*    G  23           H1*        G  23  -8.787  -5.546  -7.586
  248    H8     G  23           H8         G  23  -9.004  -1.881  -8.458
  249    H1     G  23           H1         G  23  -5.237  -3.025  -3.442
  250   1H2     G  23          H21         G  23  -5.480  -5.124  -2.774
  251   2H2     G  23          H22         G  23  -6.569  -6.243  -3.564
  252   1H5*    U  24          2H5*        U  24 -12.893  -7.329  -5.903
  253   2H5*    U  24          1H5*        U  24 -14.161  -7.192  -4.668
  254    H4*    U  24           H4*        U  24 -11.795  -8.130  -4.003
  255    H3*    U  24           H3*        U  24 -13.574  -6.193  -2.523
  256    H2*    U  24           H2*        U  24 -11.895  -5.601  -1.044
  257   2HO*    U  24          2HO*        U  24 -10.223  -7.286  -0.539
  258    H1*    U  24           H1*        U  24  -9.640  -6.654  -2.545
  259    H3     U  24           H3         U  24  -8.125  -2.818  -0.630
  260    H5     U  24           H5         U  24 -10.841  -1.538  -3.588
  261    H6     U  24           H6         U  24 -11.473  -3.857  -3.916
  262   1H5*    C  25          2H5*        C  25 -11.665  -8.972   0.467
  263   2H5*    C  25          1H5*        C  25 -12.939  -9.293   1.661
  264    H4*    C  25           H4*        C  25 -10.737  -8.275   2.535
  265    H3*    C  25           H3*        C  25 -13.544  -7.368   3.117
  266    H2*    C  25           H2*        C  25 -12.881  -5.289   3.851
  267   2HO*    C  25          2HO*        C  25 -10.443  -6.080   4.953
  268    H1*    C  25           H1*        C  25 -10.030  -5.557   3.132
  269   1H4     C  25          H41         C  25 -11.616   0.418   1.628
  270   2H4     C  25          H42         C  25 -12.797  -0.149   0.469
  271    H5     C  25           H5         C  25 -13.308  -2.481   0.140
  272    H6     C  25           H6         C  25 -12.800  -4.771   0.852
  273   1H5*    C  26          2H5*        C  26 -10.485  -8.057   6.998
  274   2H5*    C  26          1H5*        C  26 -11.675  -8.395   8.270
  275    H4*    C  26           H4*        C  26  -9.965  -6.812   9.071
  276    H3*    C  26           H3*        C  26 -12.784  -5.782   8.644
  277    H2*    C  26           H2*        C  26 -12.152  -3.691   9.473
  278   2HO*    C  26          2HO*        C  26 -10.559  -3.408  10.907
  279    H1*    C  26           H1*        C  26  -9.568  -3.668   8.404
  280   1H4     C  26          H41         C  26 -13.013   0.201   4.722
  281   2H4     C  26          H42         C  26 -13.880  -1.158   4.041
  282    H5     C  26           H5         C  26 -13.564  -3.429   4.780
  283    H6     C  26           H6         C  26 -12.354  -4.888   6.338
  284    H3T    C  26           H3T        C  26 -12.317  -7.376  10.279
  Start of MODEL    7
    1   1H5*    G   1          2H5*        G   1  -8.797  10.979   5.716
    2   2H5*    G   1          1H5*        G   1  -7.652  10.581   4.419
    3    H4*    G   1           H4*        G   1  -6.726  10.120   6.685
    4    H3*    G   1           H3*        G   1  -7.112   7.956   4.618
    5    H2*    G   1           H2*        G   1  -6.421   6.253   6.144
    6   2HO*    G   1          2HO*        G   1  -4.862   8.194   7.067
    7    H1*    G   1           H1*        G   1  -7.688   7.142   8.378
    8    H8     G   1           H8         G   1 -10.037   7.825   5.554
    9    H1     G   1           H1         G   1  -9.824   1.627   7.034
   10   1H2     G   1          H21         G   1  -8.130   1.234   8.408
   11   2H2     G   1          H22         G   1  -7.054   2.497   8.960
   12    H5T    G   1           H5T        G   1 -10.054   9.821   4.472
   13   1H5*    G   2          2H5*        G   2  -2.991   7.309   6.755
   14   2H5*    G   2          1H5*        G   2  -2.027   6.595   5.447
   15    H4*    G   2           H4*        G   2  -2.396   5.249   7.672
   16    H3*    G   2           H3*        G   2  -2.474   4.276   4.814
   17    H2*    G   2           H2*        G   2  -3.167   2.116   5.482
   18   2HO*    G   2          2HO*        G   2  -2.837   2.726   8.230
   19    H1*    G   2           H1*        G   2  -4.956   2.809   7.404
   20    H8     G   2           H8         G   2  -5.180   5.298   4.575
   21    H1     G   2           H1         G   2  -8.288  -0.130   3.346
   22   1H2     G   2          H21         G   2  -7.784  -1.656   4.874
   23   2H2     G   2          H22         G   2  -6.683  -1.336   6.196
   24   1H5*    A   3          2H5*        A   3  -1.819   0.715   6.500
   25   2H5*    A   3          1H5*        A   3  -0.124   0.342   6.133
   26    H4*    A   3           H4*        A   3  -1.395  -1.546   5.394
   27    H3*    A   3           H3*        A   3  -0.471   0.319   3.197
   28    H2*    A   3           H2*        A   3  -1.785  -0.754   1.624
   29   2HO*    A   3          2HO*        A   3  -2.100  -3.245   2.593
   30    H1*    A   3           H1*        A   3  -3.439  -2.260   3.514
   31    H8     A   3           H8         A   3  -3.778   1.479   2.677
   32   1H6     A   3          H61         A   3  -8.256  -0.189  -1.205
   33   2H6     A   3          H62         A   3  -7.413   1.163  -0.483
   34    H2     A   3           H2         A   3  -6.384  -3.926   0.452
   35   1H5*    C   4          2H5*        C   4   1.803  -4.380   2.285
   36   2H5*    C   4          1H5*        C   4   2.061  -4.022   0.566
   37    H4*    C   4           H4*        C   4   0.280  -5.929   1.699
   38    H3*    C   4           H3*        C   4   0.878  -4.871  -1.082
   39    H2*    C   4           H2*        C   4  -1.072  -5.862  -1.914
   40   2HO*    C   4          2HO*        C   4  -1.685  -7.802  -1.278
   41    H1*    C   4           H1*        C   4  -2.625  -5.760   0.451
   42   1H4     C   4          H41         C   4  -5.093  -1.809  -3.926
   43   2H4     C   4          H42         C   4  -4.111  -0.517  -3.270
   44    H5     C   4           H5         C   4  -2.438  -0.864  -1.574
   45    H6     C   4           H6         C   4  -1.344  -2.522  -0.138
   46   1H5*    A   5          2H5*        A   5   1.965  -9.322  -3.117
   47   2H5*    A   5          1H5*        A   5   2.262  -8.182  -4.444
   48    H4*    A   5           H4*        A   5   0.040  -9.969  -4.080
   49    H3*    A   5           H3*        A   5   0.942  -7.958  -6.168
   50    H2*    A   5           H2*        A   5  -1.189  -8.007  -7.160
   51   2HO*    A   5          2HO*        A   5  -2.291 -10.086  -5.707
   52    H1*    A   5           H1*        A   5  -2.709  -8.323  -4.846
   53    H8     A   5           H8         A   5  -0.499  -5.527  -4.023
   54   1H6     A   5          H61         A   5  -3.764  -1.882  -7.759
   55   2H6     A   5          H62         A   5  -2.553  -1.925  -6.499
   56    H2     A   5           H2         A   5  -4.952  -6.137  -8.577
   57   1H5*    C   6          2H5*        C   6  -1.804 -10.388  -8.030
   58   2H5*    C   6          1H5*        C   6  -0.831 -11.472  -9.046
   59    H4*    C   6           H4*        C   6  -2.658 -10.819 -10.418
   60    H3*    C   6           H3*        C   6  -0.096  -9.309 -10.980
   61    H2*    C   6           H2*        C   6  -1.171  -7.972 -12.595
   62   2HO*    C   6          2HO*        C   6  -2.830  -8.683 -13.776
   63    H1*    C   6           H1*        C   6  -3.634  -7.708 -11.366
   64   1H4     C   6          H41         C   6  -0.565  -2.290 -10.110
   65   2H4     C   6          H42         C   6   0.501  -3.108  -8.990
   66    H5     C   6           H5         C   6   0.452  -5.487  -8.622
   67    H6     C   6           H6         C   6  -0.628  -7.594  -9.244
   68   1H5*    G   7          2H5*        G   7   0.493  -9.582 -16.108
   69   2H5*    G   7          1H5*        G   7   1.321  -8.870 -14.708
   70    H4*    G   7           H4*        G   7  -0.993  -7.757 -16.310
   71    H3*    G   7           H3*        G   7   1.828  -6.924 -15.596
   72    H2*    G   7           H2*        G   7   1.157  -4.630 -15.460
   73   2HO*    G   7          2HO*        G   7  -1.257  -4.300 -16.071
   74    H1*    G   7           H1*        G   7  -1.186  -4.988 -14.132
   75    H8     G   7           H8         G   7   0.974  -7.516 -12.546
   76    H1     G   7           H1         G   7   2.804  -1.626 -10.935
   77   1H2     G   7          H21         G   7   1.824  -0.137 -12.256
   78   2H2     G   7          H22         G   7   0.719  -0.596 -13.532
   79   1H5*    A   8          2H5*        A   8   0.228  -8.450 -19.019
   80   2H5*    A   8          1H5*        A   8   0.713  -8.798 -20.691
   81    H4*    A   8           H4*        A   8  -1.502  -7.536 -20.379
   82    H3*    A   8           H3*        A   8   0.777  -6.784 -22.191
   83    H2*    A   8           H2*        A   8   0.022  -4.580 -22.440
   84   2HO*    A   8          2HO*        A   8  -2.144  -6.022 -23.147
   85    H1*    A   8           H1*        A   8  -2.135  -4.747 -20.434
   86    H8     A   8           H8         A   8   0.800  -3.924 -18.583
   87   1H6     A   8          H61         A   8   0.685   1.862 -20.685
   88   2H6     A   8          H62         A   8   1.358   0.786 -19.481
   89    H2     A   8           H2         A   8  -2.051  -0.610 -23.255
   90   1H5*    A   9          2H5*        A   9   0.473  -7.070 -26.616
   91   2H5*    A   9          1H5*        A   9   1.557  -6.204 -25.510
   92    H4*    A   9           H4*        A   9  -0.475  -5.086 -27.446
   93    H3*    A   9           H3*        A   9   2.486  -4.769 -26.886
   94    H2*    A   9           H2*        A   9   2.403  -2.493 -27.475
   95   2HO*    A   9          2HO*        A   9  -0.149  -3.011 -28.661
   96    H1*    A   9           H1*        A   9  -0.119  -1.889 -26.488
   97    H8     A   9           H8         A   9   1.748  -3.825 -23.888
   98   1H6     A   9          H61         A   9   4.676   1.380 -22.385
   99   2H6     A   9          H62         A   9   4.367  -0.278 -21.920
  100    H2     A   9           H2         A   9   2.420   2.102 -26.205
  101   1H5*    A  10          2H5*        A  10   4.570  -2.754 -29.920
  102   2H5*    A  10          1H5*        A  10   4.823  -4.273 -30.805
  103    H4*    A  10           H4*        A  10   6.986  -4.105 -30.181
  104    H3*    A  10           H3*        A  10   5.719  -5.584 -28.210
  105    H2*    A  10           H2*        A  10   5.453  -3.812 -26.641
  106   2HO*    A  10          2HO*        A  10   7.164  -3.997 -25.139
  107    H1*    A  10           H1*        A  10   8.177  -2.708 -27.351
  108    H8     A  10           H8         A  10   4.758  -1.016 -27.690
  109   1H6     A  10          H61         A  10   6.343   2.370 -22.796
  110   2H6     A  10          H62         A  10   5.150   2.140 -24.055
  111    H2     A  10           H2         A  10   9.494  -0.776 -23.394
  112   1H5*    U  11          2H5*        U  11   8.734  -5.159 -26.161
  113   2H5*    U  11          1H5*        U  11  10.193  -6.150 -26.373
  114    H4*    U  11           H4*        U  11  10.223  -6.011 -24.086
  115    H3*    U  11           H3*        U  11   9.070  -8.456 -24.999
  116    H2*    U  11           H2*        U  11   6.927  -8.103 -24.084
  117   2HO*    U  11          2HO*        U  11   6.890  -8.853 -21.907
  118    H1*    U  11           H1*        U  11   8.100  -6.405 -21.872
  119    H3     U  11           H3         U  11   4.032  -5.434 -20.298
  120    H5     U  11           H5         U  11   3.387  -5.580 -24.460
  121    H6     U  11           H6         U  11   5.725  -6.168 -24.736
  122   1H5*    C  12          2H5*        C  12  10.929 -11.330 -25.169
  123   2H5*    C  12          1H5*        C  12  12.353 -10.925 -24.189
  124    H4*    C  12           H4*        C  12  13.509 -11.621 -26.018
  125    H3*    C  12           H3*        C  12  13.239  -8.835 -26.089
  126    H2*    C  12           H2*        C  12  11.603  -8.759 -27.813
  127   2HO*    C  12          2HO*        C  12  12.854  -8.745 -29.898
  128    H1*    C  12           H1*        C  12  12.914 -11.119 -29.182
  129   1H4     C  12          H41         C  12   7.544 -10.930 -32.556
  130   2H4     C  12          H42         C  12   6.644 -10.280 -31.205
  131    H5     C  12           H5         C  12   7.633  -9.818 -29.058
  132    H6     C  12           H6         C  12   9.700  -9.880 -27.742
  133   1H5*    C  13          2H5*        C  13  17.133  -8.295 -29.924
  134   2H5*    C  13          1H5*        C  13  17.882  -7.941 -28.354
  135    H4*    C  13           H4*        C  13  18.084  -6.043 -29.946
  136    H3*    C  13           H3*        C  13  17.083  -5.917 -27.239
  137    H2*    C  13           H2*        C  13  15.049  -4.877 -27.758
  138   2HO*    C  13          2HO*        C  13  15.322  -2.612 -28.021
  139    H1*    C  13           H1*        C  13  16.171  -3.763 -30.333
  140   1H4     C  13          H41         C  13   9.872  -2.781 -30.797
  141   2H4     C  13          H42         C  13   9.632  -4.500 -31.014
  142    H5     C  13           H5         C  13  11.406  -6.116 -30.815
  143    H6     C  13           H6         C  13  13.794  -6.435 -30.364
  144   1H5*    C  14          2H5*        C  14  15.897  -3.242 -26.148
  145   2H5*    C  14          1H5*        C  14  17.229  -2.125 -25.784
  146    H4*    C  14           H4*        C  14  15.689  -2.180 -23.899
  147    H3*    C  14           H3*        C  14  18.469  -2.725 -23.688
  148    H2*    C  14           H2*        C  14  18.242  -4.976 -22.997
  149   2HO*    C  14          2HO*        C  14  17.963  -3.236 -20.826
  150    H1*    C  14           H1*        C  14  15.625  -4.304 -21.630
  151   1H4     C  14          H41         C  14  15.764 -10.660 -21.169
  152   2H4     C  14          H42         C  14  15.778 -10.804 -22.913
  153    H5     C  14           H5         C  14  15.921  -8.908 -24.393
  154    H6     C  14           H6         C  14  16.081  -6.466 -24.522
  155   1H5*    G  15          2H5*        G  15  15.855   0.378 -21.798
  156   2H5*    G  15          1H5*        G  15  16.054  -0.034 -23.514
  157    H4*    G  15           H4*        G  15  16.594   2.772 -22.526
  158    H3*    G  15           H3*        G  15  13.989   1.433 -22.531
  159    H2*    G  15           H2*        G  15  12.985   2.426 -24.378
  160   2HO*    G  15          2HO*        G  15  13.410   4.562 -23.423
  161    H1*    G  15           H1*        G  15  15.042   3.016 -26.032
  162    H8     G  15           H8         G  15  15.482   0.888 -27.605
  163    H1     G  15           H1         G  15  12.003  -2.809 -23.749
  164   1H2     G  15          H21         G  15  11.579  -1.739 -21.853
  165   2H2     G  15          H22         G  15  12.153  -0.117 -21.540
  166   1H5*    A  16          2H5*        A  16  11.863   4.024 -22.098
  167   2H5*    A  16          1H5*        A  16  12.480   5.668 -21.835
  168    H4*    A  16           H4*        A  16  10.641   6.268 -20.477
  169    H3*    A  16           H3*        A  16  10.659   3.462 -19.708
  170    H2*    A  16           H2*        A  16   8.546   2.749 -20.390
  171   2HO*    A  16          2HO*        A  16   7.655   4.572 -19.058
  172    H1*    A  16           H1*        A  16   7.918   4.322 -22.478
  173    H8     A  16           H8         A  16  10.345   1.817 -21.119
  174   1H6     A  16          H61         A  16  11.545  -0.046 -26.847
  175   2H6     A  16          H62         A  16  11.761  -0.390 -25.145
  176    H2     A  16           H2         A  16   9.135   3.730 -27.129
  177   1H5*    A  17          2H5*        A  17   8.439   3.079 -17.994
  178   2H5*    A  17          1H5*        A  17   7.259   3.604 -16.776
  179    H4*    A  17           H4*        A  17   8.417   1.999 -15.155
  180    H3*    A  17           H3*        A  17  10.371   1.782 -17.110
  181    H2*    A  17           H2*        A  17   9.047   0.622 -18.717
  182   2HO*    A  17          2HO*        A  17  10.713  -0.871 -17.331
  183    H1*    A  17           H1*        A  17   7.731  -0.995 -16.531
  184    H8     A  17           H8         A  17   6.696   1.298 -19.496
  185   1H6     A  17          H61         A  17   3.445  -3.535 -21.492
  186   2H6     A  17          H62         A  17   3.876  -1.869 -21.804
  187    H2     A  17           H2         A  17   5.576  -4.748 -17.723
  188   1H5*    G  18          2H5*        G  18   9.861  -1.735 -12.835
  189   2H5*    G  18          1H5*        G  18   9.285  -1.047 -14.367
  190    H4*    G  18           H4*        G  18   7.460   0.092 -13.226
  191    H3*    G  18           H3*        G  18   9.078  -0.011 -10.926
  192    H2*    G  18           H2*        G  18   8.548  -2.265 -10.373
  193   2HO*    G  18          2HO*        G  18   6.381  -0.676  -9.390
  194    H1*    G  18           H1*        G  18   5.725  -1.766 -11.377
  195    H8     G  18           H8         G  18   7.777  -4.118  -9.588
  196    H1     G  18           H1         G  18   4.087  -7.278 -13.717
  197   1H2     G  18          H21         G  18   3.244  -5.871 -15.211
  198   2H2     G  18          H22         G  18   3.592  -4.157 -15.189
  199   1H5*    U  19          2H5*        U  19   5.028   3.464 -11.772
  200   2H5*    U  19          1H5*        U  19   4.772   1.868 -12.507
  201    H4*    U  19           H4*        U  19   5.322   4.492 -13.944
  202    H3*    U  19           H3*        U  19   2.917   2.708 -13.549
  203    H2*    U  19           H2*        U  19   2.265   2.934 -15.800
  204   2HO*    U  19          2HO*        U  19   4.059   5.163 -15.896
  205    H1*    U  19           H1*        U  19   4.744   2.929 -16.988
  206    H3     U  19           H3         U  19   2.126  -0.764 -17.986
  207    H5     U  19           H5         U  19   4.474  -1.802 -14.642
  208    H6     U  19           H6         U  19   5.132   0.527 -14.464
  209   1H5*    A  20          2H5*        A  20   1.531   5.651 -15.666
  210   2H5*    A  20          1H5*        A  20   0.632   6.876 -14.746
  211    H4*    A  20           H4*        A  20  -0.698   6.671 -16.643
  212    H3*    A  20           H3*        A  20  -1.656   4.906 -14.408
  213    H2*    A  20           H2*        A  20  -3.175   3.729 -15.762
  214   2HO*    A  20          2HO*        A  20  -2.844   5.831 -17.678
  215    H1*    A  20           H1*        A  20  -1.736   3.537 -18.069
  216    H8     A  20           H8         A  20   0.242   3.127 -14.801
  217   1H6     A  20          H61         A  20  -0.917  -2.899 -15.306
  218   2H6     A  20          H62         A  20  -0.050  -1.676 -14.406
  219    H2     A  20           H2         A  20  -3.207  -0.765 -18.532
  220   1H5*    G  21          2H5*        G  21  -6.835   5.583 -13.984
  221   2H5*    G  21          1H5*        G  21  -5.448   4.760 -13.243
  222    H4*    G  21           H4*        G  21  -6.863   4.029 -15.833
  223    H3*    G  21           H3*        G  21  -6.712   2.867 -13.048
  224    H2*    G  21           H2*        G  21  -6.538   0.669 -13.890
  225   2HO*    G  21          2HO*        G  21  -7.323   0.074 -15.831
  226    H1*    G  21           H1*        G  21  -4.910   1.136 -16.022
  227    H8     G  21           H8         G  21  -3.262   3.218 -13.538
  228    H1     G  21           H1         G  21  -2.727  -2.933 -11.952
  229   1H2     G  21          H21         G  21  -4.152  -4.148 -13.139
  230   2H2     G  21          H22         G  21  -5.234  -3.444 -14.319
  231   1H5*    U  22          2H5*        U  22 -10.474  -0.132 -14.590
  232   2H5*    U  22          1H5*        U  22 -11.055   0.084 -12.926
  233    H4*    U  22           H4*        U  22 -10.142  -2.291 -13.965
  234    H3*    U  22           H3*        U  22 -10.356  -1.186 -11.152
  235    H2*    U  22           H2*        U  22  -9.154  -3.005 -10.293
  236   2HO*    U  22          2HO*        U  22  -8.902  -4.953 -11.667
  237    H1*    U  22           H1*        U  22  -7.505  -3.511 -12.511
  238    H3     U  22           H3         U  22  -4.975  -2.803  -8.752
  239    H5     U  22           H5         U  22  -5.947   1.032 -10.210
  240    H6     U  22           H6         U  22  -7.470  -0.021 -11.776
  241   1H5*    G  23          2H5*        G  23 -12.994  -5.994 -10.623
  242   2H5*    G  23          1H5*        G  23 -13.495  -5.059  -9.200
  243    H4*    G  23           H4*        G  23 -12.077  -7.440  -9.144
  244    H3*    G  23           H3*        G  23 -12.557  -5.196  -7.174
  245    H2*    G  23           H2*        G  23 -10.911  -6.022  -5.716
  246   2HO*    G  23          2HO*        G  23 -11.361  -8.470  -7.087
  247    H1*    G  23           H1*        G  23  -9.109  -7.004  -7.584
  248    H8     G  23           H8         G  23 -10.306  -3.536  -8.474
  249    H1     G  23           H1         G  23  -5.700  -3.523  -4.063
  250   1H2     G  23          H21         G  23  -5.335  -5.588  -3.341
  251   2H2     G  23          H22         G  23  -6.227  -6.966  -3.946
  252   1H5*    U  24          2H5*        U  24 -11.857  -8.959  -4.785
  253   2H5*    U  24          1H5*        U  24 -12.994  -8.756  -3.438
  254    H4*    U  24           H4*        U  24 -10.322  -8.789  -3.083
  255    H3*    U  24           H3*        U  24 -12.571  -7.428  -1.627
  256    H2*    U  24           H2*        U  24 -11.216  -5.806  -0.709
  257   2HO*    U  24          2HO*        U  24 -10.149  -6.921   0.773
  258    H1*    U  24           H1*        U  24  -8.767  -6.475  -2.200
  259    H3     U  24           H3         U  24  -8.353  -2.042  -1.250
  260    H5     U  24           H5         U  24 -11.533  -2.255  -4.008
  261    H6     U  24           H6         U  24 -11.448  -4.673  -3.818
  262   1H5*    C  25          2H5*        C  25 -12.117  -9.337   3.401
  263   2H5*    C  25          1H5*        C  25 -12.798  -7.851   2.711
  264    H4*    C  25           H4*        C  25 -10.155  -8.216   4.151
  265    H3*    C  25           H3*        C  25 -12.757  -6.817   4.668
  266    H2*    C  25           H2*        C  25 -11.783  -4.739   4.886
  267   2HO*    C  25          2HO*        C  25 -10.823  -5.995   6.903
  268    H1*    C  25           H1*        C  25  -9.013  -5.639   4.292
  269   1H4     C  25          H41         C  25  -9.476   0.212   1.818
  270   2H4     C  25          H42         C  25 -10.600  -0.371   0.611
  271    H5     C  25           H5         C  25 -11.456  -2.623   0.584
  272    H6     C  25           H6         C  25 -11.417  -4.802   1.704
  273   1H5*    C  26          2H5*        C  26  -9.531  -7.143   7.823
  274   2H5*    C  26          1H5*        C  26 -10.182  -7.510   9.433
  275    H4*    C  26           H4*        C  26  -8.436  -5.927   9.793
  276    H3*    C  26           H3*        C  26 -11.196  -4.674   9.789
  277    H2*    C  26           H2*        C  26 -10.253  -2.587  10.288
  278   2HO*    C  26          2HO*        C  26  -7.994  -4.119  11.092
  279    H1*    C  26           H1*        C  26  -7.999  -2.846   8.689
  280   1H4     C  26          H41         C  26 -12.112   0.769   5.457
  281   2H4     C  26          H42         C  26 -13.049  -0.642   5.017
  282    H5     C  26           H5         C  26 -12.564  -2.857   5.839
  283    H6     C  26           H6         C  26 -11.076  -4.192   7.260
  284    H3T    C  26           H3T        C  26 -10.522  -4.586  12.094
  Start of MODEL    8
    1   1H5*    G   1          2H5*        G   1  -9.447  10.009   5.252
    2   2H5*    G   1          1H5*        G   1  -9.044  11.372   6.316
    3    H4*    G   1           H4*        G   1  -8.569  10.011   8.059
    4    H3*    G   1           H3*        G   1  -6.544   9.111   6.397
    5    H2*    G   1           H2*        G   1  -7.834   7.362   5.349
    6   2HO*    G   1          2HO*        G   1  -6.145   6.231   6.265
    7    H1*    G   1           H1*        G   1  -9.079   6.721   8.035
    8    H8     G   1           H8         G   1 -10.971   7.753   4.905
    9    H1     G   1           H1         G   1 -11.002   1.457   5.910
   10   1H2     G   1          H21         G   1  -9.602   0.944   7.553
   11   2H2     G   1          H22         G   1  -8.661   2.154   8.398
   12    H5T    G   1           H5T        G   1  -7.652  11.002   4.430
   13   1H5*    G   2          2H5*        G   2  -3.036   6.351   7.968
   14   2H5*    G   2          1H5*        G   2  -4.324   6.631   6.779
   15    H4*    G   2           H4*        G   2  -4.206   4.245   8.664
   16    H3*    G   2           H3*        G   2  -3.049   4.737   5.945
   17    H2*    G   2           H2*        G   2  -4.323   3.127   4.920
   18   2HO*    G   2          2HO*        G   2  -4.337   1.271   6.982
   19    H1*    G   2           H1*        G   2  -5.898   2.368   7.315
   20    H8     G   2           H8         G   2  -6.950   5.165   4.982
   21    H1     G   2           H1         G   2  -9.302  -0.514   3.292
   22   1H2     G   2          H21         G   2  -8.377  -2.113   4.519
   23   2H2     G   2          H22         G   2  -7.182  -1.779   5.752
   24   1H5*    A   3          2H5*        A   3   0.001   0.974   4.800
   25   2H5*    A   3          1H5*        A   3  -1.490   1.482   3.982
   26    H4*    A   3           H4*        A   3  -0.988  -1.189   5.355
   27    H3*    A   3           H3*        A   3  -1.117  -0.258   2.473
   28    H2*    A   3           H2*        A   3  -2.277  -2.210   1.856
   29   2HO*    A   3          2HO*        A   3  -1.467  -3.992   2.653
   30    H1*    A   3           H1*        A   3  -3.786  -2.552   4.163
   31    H8     A   3           H8         A   3  -3.910   1.014   2.933
   32   1H6     A   3          H61         A   3  -8.325  -0.747  -0.978
   33   2H6     A   3          H62         A   3  -7.471   0.621  -0.299
   34    H2     A   3           H2         A   3  -6.575  -4.437   0.900
   35   1H5*    C   4          2H5*        C   4   1.179  -4.399   2.629
   36   2H5*    C   4          1H5*        C   4   1.741  -4.670   0.966
   37    H4*    C   4           H4*        C   4  -0.215  -6.143   2.115
   38    H3*    C   4           H3*        C   4   0.287  -5.326  -0.756
   39    H2*    C   4           H2*        C   4  -1.774  -6.252  -1.438
   40   2HO*    C   4          2HO*        C   4  -1.917  -7.532   1.117
   41    H1*    C   4           H1*        C   4  -3.305  -5.518   0.719
   42   1H4     C   4          H41         C   4  -4.220  -1.247  -3.939
   43   2H4     C   4          H42         C   4  -2.938  -0.264  -3.265
   44    H5     C   4           H5         C   4  -1.543  -0.986  -1.441
   45    H6     C   4           H6         C   4  -1.074  -2.801   0.134
   46   1H5*    A   5          2H5*        A   5   0.076 -10.162  -1.942
   47   2H5*    A   5          1H5*        A   5   1.159  -9.723  -3.277
   48    H4*    A   5           H4*        A   5  -1.384 -10.592  -3.649
   49    H3*    A   5           H3*        A   5   0.369  -8.704  -5.249
   50    H2*    A   5           H2*        A   5  -1.419  -8.216  -6.695
   51   2HO*    A   5          2HO*        A   5  -3.277  -9.605  -6.799
   52    H1*    A   5           H1*        A   5  -3.507  -8.385  -4.848
   53    H8     A   5           H8         A   5  -0.851  -6.190  -3.424
   54   1H6     A   5          H61         A   5  -2.964  -1.620  -6.963
   55   2H6     A   5          H62         A   5  -1.904  -2.033  -5.635
   56    H2     A   5           H2         A   5  -4.913  -5.440  -8.312
   57   1H5*    C   6          2H5*        C   6  -1.296 -10.779  -7.783
   58   2H5*    C   6          1H5*        C   6  -0.564 -12.234  -8.491
   59    H4*    C   6           H4*        C   6  -1.385 -11.443 -10.454
   60    H3*    C   6           H3*        C   6   1.077  -9.755  -9.947
   61    H2*    C   6           H2*        C   6   0.529  -8.319 -11.723
   62   2HO*    C   6          2HO*        C   6  -1.005 -10.531 -12.640
   63    H1*    C   6           H1*        C   6  -2.249  -8.408 -11.513
   64   1H4     C   6          H41         C   6  -0.565  -2.789  -9.082
   65   2H4     C   6          H42         C   6   0.195  -3.563  -7.709
   66    H5     C   6           H5         C   6   0.368  -5.954  -7.468
   67    H6     C   6           H6         C   6  -0.152  -8.119  -8.491
   68   1H5*    G   7          2H5*        G   7   0.973 -10.245 -14.401
   69   2H5*    G   7          1H5*        G   7   2.608  -9.713 -14.843
   70    H4*    G   7           H4*        G   7   0.390  -8.172 -15.162
   71    H3*    G   7           H3*        G   7   3.304  -7.505 -14.679
   72    H2*    G   7           H2*        G   7   2.762  -5.180 -14.501
   73   2HO*    G   7          2HO*        G   7   1.294  -4.476 -15.850
   74    H1*    G   7           H1*        G   7   0.477  -5.435 -13.025
   75    H8     G   7           H8         G   7   2.702  -7.973 -11.540
   76    H1     G   7           H1         G   7   4.688  -2.079 -10.139
   77   1H2     G   7          H21         G   7   3.637  -0.601 -11.417
   78   2H2     G   7          H22         G   7   2.449  -1.069 -12.612
   79   1H5*    A   8          2H5*        A   8   2.239  -8.452 -18.967
   80   2H5*    A   8          1H5*        A   8   2.411  -7.578 -20.503
   81    H4*    A   8           H4*        A   8   0.010  -8.240 -19.453
   82    H3*    A   8           H3*        A   8   0.905  -5.915 -21.171
   83    H2*    A   8           H2*        A   8  -1.242  -4.888 -20.971
   84   2HO*    A   8          2HO*        A   8  -2.614  -6.573 -21.366
   85    H1*    A   8           H1*        A   8  -1.726  -5.473 -18.335
   86    H8     A   8           H8         A   8   1.607  -4.409 -17.769
   87   1H6     A   8          H61         A   8   0.249   1.357 -19.456
   88   2H6     A   8          H62         A   8   1.416   0.339 -18.643
   89    H2     A   8           H2         A   8  -3.069  -1.325 -20.867
   90   1H5*    A   9          2H5*        A   9  -2.158  -7.216 -23.508
   91   2H5*    A   9          1H5*        A   9  -1.793  -7.374 -25.239
   92    H4*    A   9           H4*        A   9  -3.397  -5.540 -24.829
   93    H3*    A   9           H3*        A   9  -0.630  -4.943 -25.897
   94    H2*    A   9           H2*        A   9  -1.024  -2.635 -25.840
   95   2HO*    A   9          2HO*        A   9  -3.452  -2.056 -25.462
   96    H1*    A   9           H1*        A   9  -2.765  -2.533 -23.645
   97    H8     A   9           H8         A   9   0.303  -4.397 -22.651
   98   1H6     A   9          H61         A   9   3.152   1.016 -21.936
   99   2H6     A   9          H62         A   9   3.252  -0.707 -21.646
  100    H2     A   9           H2         A   9  -0.748   1.761 -24.041
  101   1H5*    A  10          2H5*        A  10  -1.590  -2.587 -30.539
  102   2H5*    A  10          1H5*        A  10  -0.126  -3.478 -30.075
  103    H4*    A  10           H4*        A  10  -0.849  -0.611 -29.618
  104    H3*    A  10           H3*        A  10   1.133  -1.964 -31.074
  105    H2*    A  10           H2*        A  10   2.438  -2.627 -29.203
  106   2HO*    A  10          2HO*        A  10   3.803  -0.547 -28.713
  107    H1*    A  10           H1*        A  10   1.754  -0.037 -27.793
  108    H8     A  10           H8         A  10   0.914  -3.495 -26.487
  109   1H6     A  10          H61         A  10   5.778  -2.972 -22.745
  110   2H6     A  10          H62         A  10   4.370  -3.932 -23.141
  111    H2     A  10           H2         A  10   5.852   0.483 -25.614
  112   1H5*    U  11          2H5*        U  11   4.525   0.413 -33.464
  113   2H5*    U  11          1H5*        U  11   3.969  -1.152 -32.838
  114    H4*    U  11           H4*        U  11   6.117   0.593 -31.571
  115    H3*    U  11           H3*        U  11   6.391  -1.052 -33.825
  116    H2*    U  11           H2*        U  11   5.996  -3.116 -32.725
  117   2HO*    U  11          2HO*        U  11   8.147  -3.814 -31.827
  118    H1*    U  11           H1*        U  11   7.373  -2.099 -30.232
  119    H3     U  11           H3         U  11   6.321  -5.758 -27.894
  120    H5     U  11           H5         U  11   3.128  -5.483 -30.634
  121    H6     U  11           H6         U  11   4.168  -3.489 -31.545
  122   1H5*    C  12          2H5*        C  12   8.328  -2.584 -36.061
  123   2H5*    C  12          1H5*        C  12   9.819  -1.649 -35.817
  124    H4*    C  12           H4*        C  12   9.586  -0.997 -37.966
  125    H3*    C  12           H3*        C  12   8.184   0.864 -36.398
  126    H2*    C  12           H2*        C  12   6.004   0.105 -36.964
  127   2HO*    C  12          2HO*        C  12   6.672   1.571 -39.327
  128    H1*    C  12           H1*        C  12   6.953  -0.536 -39.768
  129   1H4     C  12          H41         C  12   1.302  -3.409 -40.039
  130   2H4     C  12          H42         C  12   1.310  -3.729 -38.320
  131    H5     C  12           H5         C  12   3.114  -3.073 -36.861
  132    H6     C  12           H6         C  12   5.297  -1.967 -36.740
  133   1H5*    C  13          2H5*        C  13   7.456   5.187 -39.404
  134   2H5*    C  13          1H5*        C  13   9.106   5.226 -38.745
  135    H4*    C  13           H4*        C  13   7.819   6.901 -37.585
  136    H3*    C  13           H3*        C  13   9.112   4.800 -36.224
  137    H2*    C  13           H2*        C  13   7.137   3.673 -35.542
  138   2HO*    C  13          2HO*        C  13   8.170   5.284 -33.721
  139    H1*    C  13           H1*        C  13   5.721   6.334 -35.255
  140   1H4     C  13          H41         C  13   1.051   2.092 -34.274
  141   2H4     C  13          H42         C  13   1.124   1.629 -35.960
  142    H5     C  13           H5         C  13   2.793   2.463 -37.486
  143    H6     C  13           H6         C  13   4.749   3.920 -37.725
  144   1H5*    C  14          2H5*        C  14   9.139   3.586 -33.322
  145   2H5*    C  14          1H5*        C  14   9.505   4.995 -32.305
  146    H4*    C  14           H4*        C  14  10.949   3.364 -31.449
  147    H3*    C  14           H3*        C  14  12.134   5.497 -32.864
  148    H2*    C  14           H2*        C  14  12.874   4.211 -34.716
  149   2HO*    C  14          2HO*        C  14  15.019   3.668 -34.352
  150    H1*    C  14           H1*        C  14  13.344   1.842 -32.886
  151   1H4     C  14          H41         C  14  14.275  -0.806 -38.598
  152   2H4     C  14          H42         C  14  12.687  -0.296 -39.128
  153    H5     C  14           H5         C  14  11.222   1.065 -37.786
  154    H6     C  14           H6         C  14  10.962   2.233 -35.646
  155   1H5*    G  15          2H5*        G  15  11.105   6.789 -30.348
  156   2H5*    G  15          1H5*        G  15  11.287   7.125 -28.614
  157    H4*    G  15           H4*        G  15   9.104   5.951 -29.510
  158    H3*    G  15           H3*        G  15  10.565   5.794 -26.991
  159    H2*    G  15           H2*        G  15  10.693   3.489 -26.900
  160   2HO*    G  15          2HO*        G  15   9.046   3.171 -25.611
  161    H1*    G  15           H1*        G  15   8.476   3.158 -28.912
  162    H8     G  15           H8         G  15   8.619   0.619 -28.165
  163    H1     G  15           H1         G  15  14.690   0.244 -30.065
  164   1H2     G  15          H21         G  15  15.462   2.270 -30.527
  165   2H2     G  15          H22         G  15  14.480   3.709 -30.368
  166   1H5*    A  16          2H5*        A  16   9.068   6.469 -23.872
  167   2H5*    A  16          1H5*        A  16   8.229   5.078 -24.588
  168    H4*    A  16           H4*        A  16   7.358   6.857 -22.305
  169    H3*    A  16           H3*        A  16   8.233   4.080 -22.632
  170    H2*    A  16           H2*        A  16   6.265   2.931 -22.104
  171   2HO*    A  16          2HO*        A  16   5.391   3.533 -20.280
  172    H1*    A  16           H1*        A  16   4.314   4.540 -22.985
  173    H8     A  16           H8         A  16   7.321   2.555 -23.922
  174   1H6     A  16          H61         A  16   5.254   2.203 -29.698
  175   2H6     A  16          H62         A  16   6.426   1.597 -28.548
  176    H2     A  16           H2         A  16   2.750   5.242 -27.542
  177   1H5*    A  17          2H5*        A  17   8.032   2.920 -19.934
  178   2H5*    A  17          1H5*        A  17   7.784   3.574 -18.303
  179    H4*    A  17           H4*        A  17   9.533   2.065 -17.426
  180    H3*    A  17           H3*        A  17  10.529   1.919 -19.991
  181    H2*    A  17           H2*        A  17   8.748   0.625 -20.923
  182   2HO*    A  17          2HO*        A  17  10.532  -1.256 -19.708
  183    H1*    A  17           H1*        A  17   8.617  -1.071 -18.426
  184    H8     A  17           H8         A  17   6.099   1.142 -20.369
  185   1H6     A  17          H61         A  17   2.961  -4.066 -21.346
  186   2H6     A  17          H62         A  17   2.970  -2.332 -21.577
  187    H2     A  17           H2         A  17   6.753  -5.110 -19.169
  188   1H5*    G  18          2H5*        G  18  12.651   0.629 -14.673
  189   2H5*    G  18          1H5*        G  18  12.350  -0.478 -16.025
  190    H4*    G  18           H4*        G  18   9.856   0.632 -15.653
  191    H3*    G  18           H3*        G  18  11.245   1.200 -13.187
  192    H2*    G  18           H2*        G  18  11.003  -0.960 -12.287
  193   2HO*    G  18          2HO*        G  18   8.385   0.167 -12.143
  194    H1*    G  18           H1*        G  18   8.507  -1.375 -13.958
  195    H8     G  18           H8         G  18  11.680  -2.994 -12.430
  196    H1     G  18           H1         G  18   7.022  -7.108 -13.850
  197   1H2     G  18          H21         G  18   5.368  -6.056 -14.889
  198   2H2     G  18          H22         G  18   5.414  -4.341 -15.230
  199   1H5*    U  19          2H5*        U  19   8.520   2.427 -15.305
  200   2H5*    U  19          1H5*        U  19   9.132   4.031 -15.762
  201    H4*    U  19           H4*        U  19   7.014   4.871 -16.181
  202    H3*    U  19           H3*        U  19   6.120   2.950 -14.016
  203    H2*    U  19           H2*        U  19   3.995   2.749 -15.000
  204   2HO*    U  19          2HO*        U  19   4.093   5.239 -15.286
  205    H1*    U  19           H1*        U  19   4.739   2.980 -17.680
  206    H3     U  19           H3         U  19   2.872  -1.124 -17.390
  207    H5     U  19           H5         U  19   6.514  -1.520 -15.304
  208    H6     U  19           H6         U  19   6.842   0.870 -15.556
  209   1H5*    A  20          2H5*        A  20   1.780   6.520 -12.689
  210   2H5*    A  20          1H5*        A  20   1.966   4.754 -12.674
  211    H4*    A  20           H4*        A  20   0.835   6.504 -14.878
  212    H3*    A  20           H3*        A  20  -0.213   4.409 -12.980
  213    H2*    A  20           H2*        A  20  -1.512   3.375 -14.654
  214   2HO*    A  20          2HO*        A  20  -0.997   5.541 -16.435
  215    H1*    A  20           H1*        A  20   0.222   3.544 -16.750
  216    H8     A  20           H8         A  20   2.147   2.767 -13.594
  217   1H6     A  20          H61         A  20   0.627  -3.142 -14.424
  218   2H6     A  20          H62         A  20   1.610  -2.030 -13.498
  219    H2     A  20           H2         A  20  -1.718  -0.674 -17.360
  220   1H5*    G  21          2H5*        G  21  -3.393   5.334 -15.575
  221   2H5*    G  21          1H5*        G  21  -4.893   5.386 -14.627
  222    H4*    G  21           H4*        G  21  -4.783   3.590 -16.434
  223    H3*    G  21           H3*        G  21  -5.424   3.106 -13.522
  224    H2*    G  21           H2*        G  21  -5.507   0.771 -13.835
  225   2HO*    G  21          2HO*        G  21  -5.497  -0.067 -16.082
  226    H1*    G  21           H1*        G  21  -3.444   0.481 -15.620
  227    H8     G  21           H8         G  21  -2.664   2.946 -12.830
  228    H1     G  21           H1         G  21  -1.668  -3.136 -11.191
  229   1H2     G  21          H21         G  21  -2.457  -4.485 -12.765
  230   2H2     G  21          H22         G  21  -3.225  -3.886 -14.218
  231   1H5*    U  22          2H5*        U  22  -8.278   0.622 -15.337
  232   2H5*    U  22          1H5*        U  22  -9.764   0.694 -14.368
  233    H4*    U  22           H4*        U  22  -8.313  -1.522 -14.446
  234    H3*    U  22           H3*        U  22  -9.854  -0.237 -12.219
  235    H2*    U  22           H2*        U  22  -8.599  -1.228 -10.559
  236   2HO*    U  22          2HO*        U  22  -8.472  -3.647 -12.044
  237    H1*    U  22           H1*        U  22  -6.717  -2.619 -12.392
  238    H3     U  22           H3         U  22  -4.450  -2.517  -8.439
  239    H5     U  22           H5         U  22  -4.676   1.510  -9.664
  240    H6     U  22           H6         U  22  -6.181   0.817 -11.438
  241   1H5*    G  23          2H5*        G  23 -13.049  -3.500 -10.273
  242   2H5*    G  23          1H5*        G  23 -11.830  -2.513  -9.440
  243    H4*    G  23           H4*        G  23 -12.088  -5.526  -9.540
  244    H3*    G  23           H3*        G  23 -12.042  -3.364  -7.425
  245    H2*    G  23           H2*        G  23 -10.831  -4.731  -5.947
  246   2HO*    G  23          2HO*        G  23 -10.840  -7.114  -7.277
  247    H1*    G  23           H1*        G  23  -9.240  -6.069  -7.775
  248    H8     G  23           H8         G  23  -9.250  -2.398  -8.554
  249    H1     G  23           H1         G  23  -5.433  -3.844  -3.658
  250   1H2     G  23          H21         G  23  -5.801  -5.929  -2.999
  251   2H2     G  23          H22         G  23  -6.985  -6.963  -3.767
  252   1H5*    U  24          2H5*        U  24 -13.773  -7.451  -5.372
  253   2H5*    U  24          1H5*        U  24 -14.525  -6.685  -3.958
  254    H4*    U  24           H4*        U  24 -12.445  -8.423  -3.788
  255    H3*    U  24           H3*        U  24 -13.344  -6.117  -2.052
  256    H2*    U  24           H2*        U  24 -11.394  -6.244  -0.740
  257   2HO*    U  24          2HO*        U  24 -10.293  -8.096  -0.437
  258    H1*    U  24           H1*        U  24  -9.577  -6.910  -2.713
  259    H3     U  24           H3         U  24  -8.540  -2.797  -1.000
  260    H5     U  24           H5         U  24 -11.555  -2.086  -3.858
  261    H6     U  24           H6         U  24 -11.865  -4.486  -4.033
  262   1H5*    C  25          2H5*        C  25 -12.025  -8.620   0.341
  263   2H5*    C  25          1H5*        C  25 -12.962  -9.219   1.726
  264    H4*    C  25           H4*        C  25 -10.867  -8.197   2.497
  265    H3*    C  25           H3*        C  25 -13.520  -6.945   3.169
  266    H2*    C  25           H2*        C  25 -12.579  -4.932   3.777
  267   2HO*    C  25          2HO*        C  25 -10.409  -6.445   4.857
  268    H1*    C  25           H1*        C  25  -9.835  -5.539   2.887
  269   1H4     C  25          H41         C  25 -10.977   0.499   1.218
  270   2H4     C  25          H42         C  25 -12.140  -0.030   0.023
  271    H5     C  25           H5         C  25 -12.799  -2.333  -0.249
  272    H6     C  25           H6         C  25 -12.484  -4.623   0.567
  273   1H5*    C  26          2H5*        C  26 -10.236  -7.537   6.657
  274   2H5*    C  26          1H5*        C  26 -11.239  -7.968   8.057
  275    H4*    C  26           H4*        C  26  -9.556  -6.414   8.816
  276    H3*    C  26           H3*        C  26 -12.331  -5.249   8.466
  277    H2*    C  26           H2*        C  26 -11.581  -3.181   9.254
  278   2HO*    C  26          2HO*        C  26  -9.039  -3.655   9.995
  279    H1*    C  26           H1*        C  26  -9.044  -3.266   8.098
  280   1H4     C  26          H41         C  26 -12.496   0.633   4.456
  281   2H4     C  26          H42         C  26 -13.417  -0.714   3.822
  282    H5     C  26           H5         C  26 -13.137  -2.978   4.590
  283    H6     C  26           H6         C  26 -11.915  -4.444   6.133
  284    H3T    C  26           H3T        C  26 -10.981  -5.528  10.905
  Start of MODEL    9
    1   1H5*    G   1          2H5*        G   1  -5.103  11.095   4.159
    2   2H5*    G   1          1H5*        G   1  -4.640  10.004   2.836
    3    H4*    G   1           H4*        G   1  -3.588   9.651   5.208
    4    H3*    G   1           H3*        G   1  -4.686   7.587   3.295
    5    H2*    G   1           H2*        G   1  -4.352   5.836   4.887
    6   2HO*    G   1          2HO*        G   1  -2.400   6.110   5.766
    7    H1*    G   1           H1*        G   1  -5.199   7.141   7.118
    8    H8     G   1           H8         G   1  -7.404   8.221   4.271
    9    H1     G   1           H1         G   1  -8.869   2.392   6.400
   10   1H2     G   1          H21         G   1  -7.300   1.679   7.797
   11   2H2     G   1          H22         G   1  -5.896   2.639   8.203
   12    H5T    G   1           H5T        G   1  -7.050  10.506   3.727
   13   1H5*    G   2          2H5*        G   2  -0.452   6.086   4.943
   14   2H5*    G   2          1H5*        G   2  -0.052   4.832   3.753
   15    H4*    G   2           H4*        G   2  -0.496   4.271   6.346
   16    H3*    G   2           H3*        G   2  -1.004   2.699   3.818
   17    H2*    G   2           H2*        G   2  -2.177   1.022   4.994
   18   2HO*    G   2          2HO*        G   2  -2.018   1.671   7.555
   19    H1*    G   2           H1*        G   2  -3.565   2.596   6.736
   20    H8     G   2           H8         G   2  -3.558   4.377   3.443
   21    H1     G   2           H1         G   2  -7.666  -0.500   3.550
   22   1H2     G   2          H21         G   2  -7.306  -1.755   5.343
   23   2H2     G   2          H22         G   2  -6.056  -1.391   6.510
   24   1H5*    A   3          2H5*        A   3  -1.340  -0.543   6.284
   25   2H5*    A   3          1H5*        A   3   0.153  -1.437   5.940
   26    H4*    A   3           H4*        A   3  -1.728  -2.901   5.497
   27    H3*    A   3           H3*        A   3  -0.171  -1.851   3.134
   28    H2*    A   3           H2*        A   3  -1.789  -2.532   1.633
   29   2HO*    A   3          2HO*        A   3  -2.976  -4.654   2.558
   30    H1*    A   3           H1*        A   3  -3.832  -3.228   3.642
   31    H8     A   3           H8         A   3  -3.098   0.287   2.279
   32   1H6     A   3          H61         A   3  -7.833  -0.616  -1.555
   33   2H6     A   3          H62         A   3  -6.651   0.540  -0.982
   34    H2     A   3           H2         A   3  -7.096  -4.447   0.675
   35   1H5*    C   4          2H5*        C   4   0.342  -7.053   2.944
   36   2H5*    C   4          1H5*        C   4   0.940  -7.038   1.273
   37    H4*    C   4           H4*        C   4  -1.506  -8.090   2.169
   38    H3*    C   4           H3*        C   4  -0.303  -7.422  -0.533
   39    H2*    C   4           H2*        C   4  -2.379  -7.666  -1.569
   40   2HO*    C   4          2HO*        C   4  -2.825  -9.752  -0.924
   41    H1*    C   4           H1*        C   4  -4.033  -7.055   0.669
   42   1H4     C   4          H41         C   4  -4.881  -2.653  -3.884
   43   2H4     C   4          H42         C   4  -3.571  -1.722  -3.193
   44    H5     C   4           H5         C   4  -2.183  -2.527  -1.396
   45    H6     C   4           H6         C   4  -1.752  -4.399   0.127
   46   1H5*    A   5          2H5*        A   5   0.480 -10.618  -3.694
   47   2H5*    A   5          1H5*        A   5  -0.099  -8.968  -3.390
   48    H4*    A   5           H4*        A   5  -1.885 -11.283  -4.238
   49    H3*    A   5           H3*        A   5  -0.365  -9.200  -5.827
   50    H2*    A   5           H2*        A   5  -2.228  -8.821  -7.212
   51   2HO*    A   5          2HO*        A   5  -3.407 -11.216  -6.187
   52    H1*    A   5           H1*        A   5  -4.240  -9.165  -5.326
   53    H8     A   5           H8         A   5  -1.753  -6.896  -3.776
   54   1H6     A   5          H61         A   5  -3.942  -2.315  -7.262
   55   2H6     A   5          H62         A   5  -2.914  -2.720  -5.905
   56    H2     A   5           H2         A   5  -5.654  -6.176  -8.799
   57   1H5*    C   6          2H5*        C   6  -1.908 -11.225  -8.226
   58   2H5*    C   6          1H5*        C   6  -1.355 -12.704  -9.040
   59    H4*    C   6           H4*        C   6  -2.277 -11.822 -10.909
   60    H3*    C   6           H3*        C   6   0.255 -10.198 -10.558
   61    H2*    C   6           H2*        C   6  -0.417  -8.688 -12.226
   62   2HO*    C   6          2HO*        C   6  -1.922 -10.899 -13.119
   63    H1*    C   6           H1*        C   6  -3.170  -8.747 -11.782
   64   1H4     C   6          H41         C   6  -1.194  -3.227  -9.347
   65   2H4     C   6          H42         C   6  -0.354  -4.051  -8.052
   66    H5     C   6           H5         C   6  -0.212  -6.450  -7.887
   67    H6     C   6           H6         C   6  -0.846  -8.577  -8.926
   68   1H5*    G   7          2H5*        G   7   1.529 -10.011 -15.357
   69   2H5*    G   7          1H5*        G   7   2.686  -9.131 -14.341
   70    H4*    G   7           H4*        G   7   0.395  -8.128 -15.865
   71    H3*    G   7           H3*        G   7   2.888  -6.999 -14.548
   72    H2*    G   7           H2*        G   7   1.908  -4.816 -14.578
   73   2HO*    G   7          2HO*        G   7   0.203  -4.292 -15.888
   74    H1*    G   7           H1*        G   7  -0.605  -5.528 -13.799
   75    H8     G   7           H8         G   7   1.506  -7.729 -11.732
   76    H1     G   7           H1         G   7   2.051  -1.654  -9.875
   77   1H2     G   7          H21         G   7   1.166  -0.311 -11.403
   78   2H2     G   7          H22         G   7   0.443  -0.914 -12.878
   79   1H5*    A   8          2H5*        A   8   3.767  -7.613 -19.533
   80   2H5*    A   8          1H5*        A   8   3.871  -6.124 -20.491
   81    H4*    A   8           H4*        A   8   1.550  -7.701 -19.885
   82    H3*    A   8           H3*        A   8   2.164  -5.184 -21.466
   83    H2*    A   8           H2*        A   8  -0.166  -4.683 -21.581
   84   2HO*    A   8          2HO*        A   8  -1.570  -6.257 -21.771
   85    H1*    A   8           H1*        A   8  -0.865  -5.490 -19.040
   86    H8     A   8           H8         A   8   1.805  -3.610 -17.832
   87   1H6     A   8          H61         A   8  -0.480   1.657 -20.059
   88   2H6     A   8          H62         A   8   0.667   0.950 -18.944
   89    H2     A   8           H2         A   8  -2.587  -1.748 -22.100
   90   1H5*    A   9          2H5*        A   9  -0.119  -6.283 -24.050
   91   2H5*    A   9          1H5*        A   9   0.500  -7.002 -25.551
   92    H4*    A   9           H4*        A   9  -0.806  -5.214 -26.328
   93    H3*    A   9           H3*        A   9   2.120  -4.477 -26.114
   94    H2*    A   9           H2*        A   9   1.678  -2.243 -26.710
   95   2HO*    A   9          2HO*        A   9  -0.997  -2.869 -27.443
   96    H1*    A   9           H1*        A   9  -0.736  -1.912 -25.414
   97    H8     A   9           H8         A   9   1.655  -3.695 -23.130
   98   1H6     A   9          H61         A   9   4.097   1.791 -21.767
   99   2H6     A   9          H62         A   9   4.053   0.095 -21.343
  100    H2     A   9           H2         A   9   1.299   2.335 -25.245
  101   1H5*    A  10          2H5*        A  10   2.136  -2.455 -29.095
  102   2H5*    A  10          1H5*        A  10   3.020  -3.240 -30.419
  103    H4*    A  10           H4*        A  10   4.004  -1.049 -29.899
  104    H3*    A  10           H3*        A  10   5.442  -3.481 -30.081
  105    H2*    A  10           H2*        A  10   6.066  -3.601 -27.802
  106   2HO*    A  10          2HO*        A  10   7.871  -2.370 -29.354
  107    H1*    A  10           H1*        A  10   6.170  -0.579 -27.642
  108    H8     A  10           H8         A  10   4.505  -3.565 -25.792
  109   1H6     A  10          H61         A  10   7.135  -1.292 -20.709
  110   2H6     A  10          H62         A  10   6.105  -2.552 -21.350
  111    H2     A  10           H2         A  10   8.322   1.310 -24.177
  112   1H5*    U  11          2H5*        U  11   8.085  -0.243 -29.773
  113   2H5*    U  11          1H5*        U  11   9.202   0.207 -31.077
  114    H4*    U  11           H4*        U  11  10.194   0.233 -28.741
  115    H3*    U  11           H3*        U  11  11.332  -0.697 -31.193
  116    H2*    U  11           H2*        U  11  11.576  -2.947 -30.524
  117   2HO*    U  11          2HO*        U  11  13.726  -2.209 -30.540
  118    H1*    U  11           H1*        U  11  11.858  -2.078 -27.637
  119    H3     U  11           H3         U  11  12.455  -6.432 -26.661
  120    H5     U  11           H5         U  11   8.969  -6.437 -29.028
  121    H6     U  11           H6         U  11   9.291  -4.059 -29.391
  122   1H5*    C  12          2H5*        C  12  13.960  -1.551 -32.957
  123   2H5*    C  12          1H5*        C  12  15.226  -0.480 -32.323
  124    H4*    C  12           H4*        C  12  15.362   0.271 -34.458
  125    H3*    C  12           H3*        C  12  13.583   1.920 -33.028
  126    H2*    C  12           H2*        C  12  11.600   1.170 -34.093
  127   2HO*    C  12          2HO*        C  12  11.152   2.941 -35.153
  128    H1*    C  12           H1*        C  12  13.119   0.785 -36.684
  129   1H4     C  12          H41         C  12   7.768  -2.222 -38.295
  130   2H4     C  12          H42         C  12   7.454  -2.685 -36.637
  131    H5     C  12           H5         C  12   8.902  -2.097 -34.805
  132    H6     C  12           H6         C  12  10.965  -0.937 -34.165
  133   1H5*    C  13          2H5*        C  13  13.025   5.837 -35.570
  134   2H5*    C  13          1H5*        C  13  14.565   6.371 -34.868
  135    H4*    C  13           H4*        C  13  13.238   7.981 -33.934
  136    H3*    C  13           H3*        C  13  13.784   5.940 -32.106
  137    H2*    C  13           H2*        C  13  11.632   4.924 -32.180
  138   2HO*    C  13          2HO*        C  13  10.465   6.751 -30.573
  139    H1*    C  13           H1*        C  13  10.344   7.651 -32.439
  140   1H4     C  13          H41         C  13   5.377   3.764 -33.319
  141   2H4     C  13          H42         C  13   6.162   3.036 -34.702
  142    H5     C  13           H5         C  13   8.405   3.587 -35.390
  143    H6     C  13           H6         C  13  10.379   4.955 -34.897
  144   1H5*    C  14          2H5*        C  14  12.139   6.913 -29.341
  145   2H5*    C  14          1H5*        C  14  12.549   8.468 -28.587
  146    H4*    C  14           H4*        C  14  11.881   6.873 -26.864
  147    H3*    C  14           H3*        C  14  14.234   8.363 -26.777
  148    H2*    C  14           H2*        C  14  15.715   6.584 -27.331
  149   2HO*    C  14          2HO*        C  14  15.630   7.213 -24.805
  150    H1*    C  14           H1*        C  14  14.051   4.655 -25.702
  151   1H4     C  14          H41         C  14  18.249   0.827 -28.599
  152   2H4     C  14          H42         C  14  17.561   1.235 -30.154
  153    H5     C  14           H5         C  14  15.841   2.897 -30.442
  154    H6     C  14           H6         C  14  14.409   4.526 -29.300
  155   1H5*    G  15          2H5*        G  15  12.165  10.830 -23.503
  156   2H5*    G  15          1H5*        G  15  11.552  10.162 -21.975
  157    H4*    G  15           H4*        G  15   9.523  10.610 -22.916
  158    H3*    G  15           H3*        G  15  10.307   7.892 -23.478
  159    H2*    G  15           H2*        G  15  10.189   8.066 -25.801
  160   2HO*    G  15          2HO*        G  15   8.225   7.406 -26.422
  161    H1*    G  15           H1*        G  15   8.216  10.344 -25.556
  162    H8     G  15           H8         G  15   7.717   9.857 -28.104
  163    H1     G  15           H1         G  15  13.786  11.001 -29.674
  164   1H2     G  15          H21         G  15  15.024  11.142 -27.838
  165   2H2     G  15          H22         G  15  14.351  10.955 -26.234
  166   1H5*    A  16          2H5*        A  16   6.369   7.246 -23.553
  167   2H5*    A  16          1H5*        A  16   5.214   8.387 -22.834
  168    H4*    A  16           H4*        A  16   3.847   6.723 -22.058
  169    H3*    A  16           H3*        A  16   6.393   5.510 -21.208
  170    H2*    A  16           H2*        A  16   6.033   3.311 -21.922
  171   2HO*    A  16          2HO*        A  16   3.815   3.516 -20.825
  172    H1*    A  16           H1*        A  16   4.581   3.609 -24.163
  173    H8     A  16           H8         A  16   7.812   4.380 -22.455
  174   1H6     A  16          H61         A  16  10.545   4.812 -27.944
  175   2H6     A  16          H62         A  16  10.795   4.724 -26.214
  176    H2     A  16           H2         A  16   6.114   4.660 -28.642
  177   1H5*    A  17          2H5*        A  17   7.678   5.607 -18.372
  178   2H5*    A  17          1H5*        A  17   7.155   4.228 -19.360
  179    H4*    A  17           H4*        A  17   7.751   4.244 -16.379
  180    H3*    A  17           H3*        A  17   9.515   3.881 -18.464
  181    H2*    A  17           H2*        A  17   8.410   2.010 -19.456
  182   2HO*    A  17          2HO*        A  17  10.408   1.158 -19.006
  183    H1*    A  17           H1*        A  17   7.837   0.845 -16.728
  184    H8     A  17           H8         A  17   5.741   1.889 -19.822
  185   1H6     A  17          H61         A  17   4.095  -4.038 -20.143
  186   2H6     A  17          H62         A  17   3.877  -2.449 -20.842
  187    H2     A  17           H2         A  17   7.031  -3.585 -16.770
  188   1H5*    G  18          2H5*        G  18  10.805   1.728 -13.511
  189   2H5*    G  18          1H5*        G  18   9.803   1.710 -14.976
  190    H4*    G  18           H4*        G  18   7.856   2.478 -13.590
  191    H3*    G  18           H3*        G  18   9.810   3.061 -11.631
  192    H2*    G  18           H2*        G  18  10.077   0.820 -10.891
  193   2HO*    G  18          2HO*        G  18   8.013   2.138  -9.566
  194    H1*    G  18           H1*        G  18   7.127   0.352 -11.441
  195    H8     G  18           H8         G  18  10.056  -1.108  -9.939
  196    H1     G  18           H1         G  18   6.987  -5.572 -13.299
  197   1H2     G  18          H21         G  18   5.530  -4.621 -14.674
  198   2H2     G  18          H22         G  18   5.315  -2.887 -14.762
  199   1H5*    U  19          2H5*        U  19   4.770   4.645 -11.806
  200   2H5*    U  19          1H5*        U  19   5.217   3.126 -12.611
  201    H4*    U  19           H4*        U  19   4.361   5.668 -14.049
  202    H3*    U  19           H3*        U  19   2.841   3.241 -13.075
  203    H2*    U  19           H2*        U  19   1.668   3.049 -15.103
  204   2HO*    U  19          2HO*        U  19   1.458   4.753 -16.556
  205    H1*    U  19           H1*        U  19   3.683   3.755 -16.843
  206    H3     U  19           H3         U  19   2.378  -0.643 -17.315
  207    H5     U  19           H5         U  19   5.408  -0.622 -14.384
  208    H6     U  19           H6         U  19   5.281   1.801 -14.365
  209   1H5*    A  20          2H5*        A  20  -0.971   6.153 -13.427
  210   2H5*    A  20          1H5*        A  20   0.122   4.802 -13.790
  211    H4*    A  20           H4*        A  20  -1.496   6.140 -15.973
  212    H3*    A  20           H3*        A  20  -2.414   4.148 -13.892
  213    H2*    A  20           H2*        A  20  -3.469   2.819 -15.534
  214   2HO*    A  20          2HO*        A  20  -3.072   4.411 -17.742
  215    H1*    A  20           H1*        A  20  -1.596   3.026 -17.521
  216    H8     A  20           H8         A  20  -0.244   2.646 -13.948
  217   1H6     A  20          H61         A  20  -0.408  -3.431 -14.930
  218   2H6     A  20          H62         A  20   0.087  -2.169 -13.822
  219    H2     A  20           H2         A  20  -2.319  -1.398 -18.453
  220   1H5*    G  21          2H5*        G  21  -5.221   4.106 -16.774
  221   2H5*    G  21          1H5*        G  21  -6.846   4.197 -16.063
  222    H4*    G  21           H4*        G  21  -6.478   2.096 -17.362
  223    H3*    G  21           H3*        G  21  -7.013   1.999 -14.374
  224    H2*    G  21           H2*        G  21  -6.913  -0.353 -14.435
  225   2HO*    G  21          2HO*        G  21  -7.112  -1.508 -16.420
  226    H1*    G  21           H1*        G  21  -4.947  -0.614 -16.394
  227    H8     G  21           H8         G  21  -4.054   1.853 -13.658
  228    H1     G  21           H1         G  21  -2.910  -4.209 -12.046
  229   1H2     G  21          H21         G  21  -3.787  -5.576 -13.557
  230   2H2     G  21          H22         G  21  -4.653  -4.992 -14.961
  231   1H5*    U  22          2H5*        U  22  -9.339  -1.465 -15.922
  232   2H5*    U  22          1H5*        U  22 -10.846  -1.261 -15.007
  233    H4*    U  22           H4*        U  22  -9.417  -3.427 -14.643
  234    H3*    U  22           H3*        U  22 -10.775  -1.681 -12.592
  235    H2*    U  22           H2*        U  22  -9.585  -2.611 -10.844
  236   2HO*    U  22          2HO*        U  22  -9.026  -5.100 -11.505
  237    H1*    U  22           H1*        U  22  -7.669  -4.119 -12.495
  238    H3     U  22           H3         U  22  -5.274  -3.248  -8.746
  239    H5     U  22           H5         U  22  -6.019   0.554 -10.405
  240    H6     U  22           H6         U  22  -7.464  -0.513 -12.035
  241   1H5*    G  23          2H5*        G  23 -13.907  -4.385  -9.862
  242   2H5*    G  23          1H5*        G  23 -12.475  -3.412  -9.468
  243    H4*    G  23           H4*        G  23 -12.842  -6.403  -9.055
  244    H3*    G  23           H3*        G  23 -12.720  -3.969  -7.261
  245    H2*    G  23           H2*        G  23 -11.410  -5.110  -5.684
  246   2HO*    G  23          2HO*        G  23 -12.868  -7.241  -6.610
  247    H1*    G  23           H1*        G  23  -9.962  -6.752  -7.415
  248    H8     G  23           H8         G  23  -9.935  -3.156  -8.545
  249    H1     G  23           H1         G  23  -5.782  -4.298  -3.843
  250   1H2     G  23          H21         G  23  -6.133  -6.316  -2.994
  251   2H2     G  23          H22         G  23  -7.391  -7.379  -3.586
  252   1H5*    U  24          2H5*        U  24 -14.427  -7.733  -4.081
  253   2H5*    U  24          1H5*        U  24 -14.988  -6.386  -3.068
  254    H4*    U  24           H4*        U  24 -12.991  -8.189  -2.392
  255    H3*    U  24           H3*        U  24 -13.788  -5.435  -1.415
  256    H2*    U  24           H2*        U  24 -11.834  -5.273  -0.122
  257   2HO*    U  24          2HO*        U  24 -11.022  -7.931  -0.426
  258    H1*    U  24           H1*        U  24 -10.101  -6.697  -1.785
  259    H3     U  24           H3         U  24  -8.459  -2.475  -1.284
  260    H5     U  24           H5         U  24 -11.565  -2.103  -4.110
  261    H6     U  24           H6         U  24 -12.168  -4.408  -3.653
  262   1H5*    C  25          2H5*        C  25 -12.775  -8.182   3.108
  263   2H5*    C  25          1H5*        C  25 -14.046  -7.083   3.681
  264    H4*    C  25           H4*        C  25 -11.452  -7.101   4.603
  265    H3*    C  25           H3*        C  25 -13.709  -5.115   4.625
  266    H2*    C  25           H2*        C  25 -12.306  -3.294   4.801
  267   2HO*    C  25          2HO*        C  25 -10.279  -3.756   6.220
  268    H1*    C  25           H1*        C  25  -9.772  -4.763   4.454
  269   1H4     C  25          H41         C  25  -9.093   0.607   1.120
  270   2H4     C  25          H42         C  25 -10.385   0.136   0.038
  271    H5     C  25           H5         C  25 -11.704  -1.855   0.349
  272    H6     C  25           H6         C  25 -12.068  -3.827   1.760
  273   1H5*    C  26          2H5*        C  26 -10.876  -6.218   7.998
  274   2H5*    C  26          1H5*        C  26 -11.473  -5.986   9.654
  275    H4*    C  26           H4*        C  26  -9.012  -5.399   9.223
  276    H3*    C  26           H3*        C  26 -10.870  -4.318  10.969
  277    H2*    C  26           H2*        C  26 -11.413  -2.436   9.683
  278   2HO*    C  26          2HO*        C  26  -9.477  -1.970  11.566
  279    H1*    C  26           H1*        C  26  -8.511  -2.125   8.875
  280   1H4     C  26          H41         C  26 -11.154   2.171   5.015
  281   2H4     C  26          H42         C  26 -12.496   1.106   4.657
  282    H5     C  26           H5         C  26 -12.753  -1.073   5.652
  283    H6     C  26           H6         C  26 -11.781  -2.702   7.204
  284    H3T    C  26           H3T        C  26  -8.265  -3.226  10.875
  Start of MODEL   10
    1   1H5*    G   1          2H5*        G   1  -8.082  10.921   4.997
    2   2H5*    G   1          1H5*        G   1  -6.789  12.123   5.177
    3    H4*    G   1           H4*        G   1  -6.225  11.047   7.077
    4    H3*    G   1           H3*        G   1  -4.753   9.836   5.081
    5    H2*    G   1           H2*        G   1  -6.245   7.972   4.742
    6   2HO*    G   1          2HO*        G   1  -5.135   6.288   5.537
    7    H1*    G   1           H1*        G   1  -6.654   7.763   7.732
    8    H8     G   1           H8         G   1  -9.521   8.468   5.411
    9    H1     G   1           H1         G   1  -8.801   2.237   6.553
   10   1H2     G   1          H21         G   1  -6.875   1.873   7.591
   11   2H2     G   1          H22         G   1  -5.770   3.165   8.001
   12    H5T    G   1           H5T        G   1  -5.881  11.299   3.502
   13   1H5*    G   2          2H5*        G   2  -0.961   6.791   6.588
   14   2H5*    G   2          1H5*        G   2  -2.032   7.098   5.205
   15    H4*    G   2           H4*        G   2  -2.174   4.786   7.173
   16    H3*    G   2           H3*        G   2  -1.266   5.143   4.339
   17    H2*    G   2           H2*        G   2  -2.826   3.680   3.495
   18   2HO*    G   2          2HO*        G   2  -1.888   2.063   5.646
   19    H1*    G   2           H1*        G   2  -4.046   3.042   6.142
   20    H8     G   2           H8         G   2  -5.289   5.707   3.711
   21    H1     G   2           H1         G   2  -8.274   0.105   3.106
   22   1H2     G   2          H21         G   2  -7.271  -1.426   4.359
   23   2H2     G   2          H22         G   2  -5.869  -1.065   5.340
   24   1H5*    A   3          2H5*        A   3   0.605   0.381   5.825
   25   2H5*    A   3          1H5*        A   3   1.481   0.347   4.282
   26    H4*    A   3           H4*        A   3  -0.423  -1.498   5.096
   27    H3*    A   3           H3*        A   3   0.844  -0.732   2.469
   28    H2*    A   3           H2*        A   3  -0.909  -1.587   1.238
   29   2HO*    A   3          2HO*        A   3  -0.277  -3.688   2.818
   30    H1*    A   3           H1*        A   3  -2.702  -2.106   3.524
   31    H8     A   3           H8         A   3  -2.349   1.297   1.831
   32   1H6     A   3          H61         A   3  -7.272  -0.239  -1.532
   33   2H6     A   3          H62         A   3  -6.158   1.048  -1.125
   34    H2     A   3           H2         A   3  -6.020  -3.848   0.835
   35   1H5*    C   4          2H5*        C   4   1.589  -5.811   0.525
   36   2H5*    C   4          1H5*        C   4   0.706  -4.313   0.171
   37    H4*    C   4           H4*        C   4  -0.555  -6.718   1.542
   38    H3*    C   4           H3*        C   4  -0.277  -6.008  -1.397
   39    H2*    C   4           H2*        C   4  -2.501  -6.685  -1.778
   40   2HO*    C   4          2HO*        C   4  -2.948  -8.549  -0.868
   41    H1*    C   4           H1*        C   4  -3.594  -5.833   0.638
   42   1H4     C   4          H41         C   4  -5.081  -1.833  -4.159
   43   2H4     C   4          H42         C   4  -3.870  -0.738  -3.533
   44    H5     C   4           H5         C   4  -2.358  -1.321  -1.750
   45    H6     C   4           H6         C   4  -1.682  -3.078  -0.182
   46   1H5*    A   5          2H5*        A   5  -1.257 -10.283  -2.143
   47   2H5*    A   5          1H5*        A   5   0.021 -10.742  -3.286
   48    H4*    A   5           H4*        A   5  -2.285 -10.999  -4.232
   49    H3*    A   5           H3*        A   5  -0.305  -9.051  -5.464
   50    H2*    A   5           H2*        A   5  -1.896  -8.452  -7.076
   51   2HO*    A   5          2HO*        A   5  -2.935 -11.038  -6.544
   52    H1*    A   5           H1*        A   5  -4.220  -8.920  -5.518
   53    H8     A   5           H8         A   5  -1.864  -6.489  -3.889
   54   1H6     A   5          H61         A   5  -4.271  -2.092  -7.467
   55   2H6     A   5          H62         A   5  -3.226  -2.418  -6.103
   56    H2     A   5           H2         A   5  -5.793  -6.062  -8.922
   57   1H5*    C   6          2H5*        C   6  -2.378 -11.675  -8.631
   58   2H5*    C   6          1H5*        C   6  -0.980 -12.320  -9.516
   59    H4*    C   6           H4*        C   6  -2.661 -11.539 -11.106
   60    H3*    C   6           H3*        C   6  -0.090  -9.950 -10.864
   61    H2*    C   6           H2*        C   6  -0.847  -8.420 -12.485
   62   2HO*    C   6          2HO*        C   6  -1.490 -10.012 -14.013
   63    H1*    C   6           H1*        C   6  -3.551  -8.426 -11.830
   64   1H4     C   6          H41         C   6  -1.200  -3.023  -9.453
   65   2H4     C   6          H42         C   6  -0.334  -3.902  -8.212
   66    H5     C   6           H5         C   6  -0.293  -6.308  -8.081
   67    H6     C   6           H6         C   6  -1.074  -8.390  -9.111
   68   1H5*    G   7          2H5*        G   7   0.764 -10.184 -15.625
   69   2H5*    G   7          1H5*        G   7   2.266  -9.392 -15.108
   70    H4*    G   7           H4*        G   7  -0.012  -8.167 -16.250
   71    H3*    G   7           H3*        G   7   2.568  -7.220 -14.972
   72    H2*    G   7           H2*        G   7   1.726  -4.984 -14.891
   73   2HO*    G   7          2HO*        G   7  -0.641  -5.561 -16.282
   74    H1*    G   7           H1*        G   7  -0.846  -5.564 -14.150
   75    H8     G   7           H8         G   7   1.244  -7.873 -12.132
   76    H1     G   7           H1         G   7   1.748  -1.861 -10.067
   77   1H2     G   7          H21         G   7   0.868  -0.471 -11.554
   78   2H2     G   7          H22         G   7   0.156  -1.025 -13.053
   79   1H5*    A   8          2H5*        A   8   3.337  -7.974 -19.828
   80   2H5*    A   8          1H5*        A   8   3.700  -6.609 -20.902
   81    H4*    A   8           H4*        A   8   1.227  -7.923 -20.613
   82    H3*    A   8           H3*        A   8   2.212  -5.406 -21.977
   83    H2*    A   8           H2*        A   8  -0.029  -4.665 -22.322
   84   2HO*    A   8          2HO*        A   8  -0.513  -7.135 -22.799
   85    H1*    A   8           H1*        A   8  -1.114  -5.505 -19.939
   86    H8     A   8           H8         A   8   1.513  -4.002 -18.259
   87   1H6     A   8          H61         A   8   0.180   1.592 -20.466
   88   2H6     A   8          H62         A   8   1.053   0.706 -19.235
   89    H2     A   8           H2         A   8  -1.917  -1.452 -23.023
   90   1H5*    A   9          2H5*        A   9   0.564  -6.216 -25.427
   91   2H5*    A   9          1H5*        A   9   1.816  -6.182 -26.687
   92    H4*    A   9           H4*        A   9   0.129  -4.183 -26.509
   93    H3*    A   9           H3*        A   9   3.109  -4.132 -26.954
   94    H2*    A   9           H2*        A   9   3.284  -1.886 -26.447
   95   2HO*    A   9          2HO*        A   9   1.522  -0.439 -27.138
   96    H1*    A   9           H1*        A   9   0.592  -1.529 -25.345
   97    H8     A   9           H8         A   9   2.768  -3.116 -22.866
   98   1H6     A   9          H61         A   9   5.177   2.387 -21.512
   99   2H6     A   9          H62         A   9   5.039   0.718 -21.006
  100    H2     A   9           H2         A   9   2.825   2.794 -25.320
  101   1H5*    A  10          2H5*        A  10   3.640  -1.015 -31.408
  102   2H5*    A  10          1H5*        A  10   4.605  -2.078 -30.362
  103    H4*    A  10           H4*        A  10   3.372   0.589 -29.568
  104    H3*    A  10           H3*        A  10   5.715   0.202 -30.997
  105    H2*    A  10           H2*        A  10   6.844  -1.100 -29.349
  106   2HO*    A  10          2HO*        A  10   8.047   0.496 -27.988
  107    H1*    A  10           H1*        A  10   5.707   0.634 -27.150
  108    H8     A  10           H8         A  10   5.259  -3.131 -27.700
  109   1H6     A  10          H61         A  10   9.140  -3.923 -22.984
  110   2H6     A  10          H62         A  10   8.065  -4.725 -24.107
  111    H2     A  10           H2         A  10   8.994   0.465 -23.949
  112   1H5*    U  11          2H5*        U  11   7.012   2.766 -33.610
  113   2H5*    U  11          1H5*        U  11   7.147   1.005 -33.436
  114    H4*    U  11           H4*        U  11   8.028   3.089 -31.401
  115    H3*    U  11           H3*        U  11   9.395   1.750 -33.638
  116    H2*    U  11           H2*        U  11  10.428   0.126 -32.347
  117   2HO*    U  11          2HO*        U  11  11.647   1.641 -30.487
  118    H1*    U  11           H1*        U  11   9.776   1.501 -29.752
  119    H3     U  11           H3         U  11  10.554  -2.234 -27.431
  120    H5     U  11           H5         U  11   9.163  -3.730 -31.118
  121    H6     U  11           H6         U  11   8.928  -1.440 -31.884
  122   1H5*    C  12          2H5*        C  12   9.997   7.659 -31.745
  123   2H5*    C  12          1H5*        C  12  11.100   6.598 -32.646
  124    H4*    C  12           H4*        C  12  10.780   6.876 -29.646
  125    H3*    C  12           H3*        C  12  12.576   8.078 -31.363
  126    H2*    C  12           H2*        C  12  13.529   6.040 -32.193
  127   2HO*    C  12          2HO*        C  12  15.519   5.808 -31.126
  128    H1*    C  12           H1*        C  12  13.498   4.926 -29.375
  129   1H4     C  12          H41         C  12  14.966  -0.469 -32.369
  130   2H4     C  12          H42         C  12  14.166   0.050 -33.835
  131    H5     C  12           H5         C  12  13.059   2.179 -34.053
  132    H6     C  12           H6         C  12  12.482   4.267 -32.913
  133   1H5*    C  13          2H5*        C  13  17.167   7.616 -28.573
  134   2H5*    C  13          1H5*        C  13  16.015   7.260 -29.872
  135    H4*    C  13           H4*        C  13  14.906   5.837 -27.816
  136    H3*    C  13           H3*        C  13  17.438   6.484 -26.758
  137    H2*    C  13           H2*        C  13  18.679   5.103 -28.247
  138   2HO*    C  13          2HO*        C  13  18.917   3.020 -27.214
  139    H1*    C  13           H1*        C  13  16.391   3.109 -28.202
  140   1H4     C  13          H41         C  13  20.415   0.595 -32.492
  141   2H4     C  13          H42         C  13  19.920   1.824 -33.635
  142    H5     C  13           H5         C  13  18.472   3.661 -33.051
  143    H6     C  13           H6         C  13  17.194   4.714 -31.247
  144   1H5*    C  14          2H5*        C  14  19.127   6.507 -25.409
  145   2H5*    C  14          1H5*        C  14  18.793   5.995 -23.742
  146    H4*    C  14           H4*        C  14  20.016   7.921 -23.342
  147    H3*    C  14           H3*        C  14  17.231   8.192 -22.932
  148    H2*    C  14           H2*        C  14  16.808   9.718 -24.674
  149   2HO*    C  14          2HO*        C  14  17.935  11.872 -23.575
  150    H1*    C  14           H1*        C  14  19.568  10.918 -24.427
  151   1H4     C  14          H41         C  14  17.755  13.391 -29.986
  152   2H4     C  14          H42         C  14  17.018  11.885 -30.484
  153    H5     C  14           H5         C  14  16.958   9.917 -29.089
  154    H6     C  14           H6         C  14  17.594   8.978 -26.915
  155   1H5*    G  15          2H5*        G  15  15.421   9.054 -19.675
  156   2H5*    G  15          1H5*        G  15  15.753   7.357 -19.268
  157    H4*    G  15           H4*        G  15  14.041   8.491 -21.478
  158    H3*    G  15           H3*        G  15  13.641   6.882 -19.045
  159    H2*    G  15           H2*        G  15  12.820   4.918 -19.990
  160   2HO*    G  15          2HO*        G  15  12.180   5.421 -22.490
  161    H1*    G  15           H1*        G  15  14.077   4.768 -22.374
  162    H8     G  15           H8         G  15  16.450   3.549 -22.010
  163    H1     G  15           H1         G  15  16.022   4.402 -15.706
  164   1H2     G  15          H21         G  15  14.360   5.795 -15.240
  165   2H2     G  15          H22         G  15  13.359   6.511 -16.483
  166   1H5*    A  16          2H5*        A  16  10.245   6.082 -20.675
  167   2H5*    A  16          1H5*        A  16   9.603   7.363 -21.722
  168    H4*    A  16           H4*        A  16   7.382   6.989 -20.366
  169    H3*    A  16           H3*        A  16   9.078   4.831 -19.314
  170    H2*    A  16           H2*        A  16   7.980   2.969 -20.213
  171   2HO*    A  16          2HO*        A  16   5.711   4.698 -20.353
  172    H1*    A  16           H1*        A  16   7.067   3.845 -22.578
  173    H8     A  16           H8         A  16  10.084   3.256 -20.468
  174   1H6     A  16          H61         A  16  13.507   2.808 -25.554
  175   2H6     A  16          H62         A  16  13.464   2.567 -23.821
  176    H2     A  16           H2         A  16   9.486   4.394 -26.760
  177   1H5*    A  17          2H5*        A  17   7.048   3.403 -17.754
  178   2H5*    A  17          1H5*        A  17   5.951   3.596 -16.371
  179    H4*    A  17           H4*        A  17   7.684   2.418 -14.949
  180    H3*    A  17           H3*        A  17   9.428   2.826 -17.054
  181    H2*    A  17           H2*        A  17   8.382   1.336 -18.593
  182   2HO*    A  17          2HO*        A  17   9.499  -0.890 -17.623
  183    H1*    A  17           H1*        A  17   7.847  -0.656 -16.385
  184    H8     A  17           H8         A  17   6.223   1.219 -19.374
  185   1H6     A  17          H61         A  17   3.766  -4.222 -20.874
  186   2H6     A  17          H62         A  17   3.916  -2.540 -21.331
  187    H2     A  17           H2         A  17   6.128  -4.757 -17.087
  188   1H5*    G  18          2H5*        G  18   9.548  -0.317 -12.567
  189   2H5*    G  18          1H5*        G  18   8.910  -0.041 -14.200
  190    H4*    G  18           H4*        G  18   6.775   0.665 -13.328
  191    H3*    G  18           H3*        G  18   8.176   1.524 -11.053
  192    H2*    G  18           H2*        G  18   8.317  -0.626 -10.040
  193   2HO*    G  18          2HO*        G  18   5.618  -0.046  -9.348
  194    H1*    G  18           H1*        G  18   5.535  -1.231 -11.100
  195    H8     G  18           H8         G  18   8.099  -2.422  -8.879
  196    H1     G  18           H1         G  18   5.812  -7.337 -12.233
  197   1H2     G  18          H21         G  18   4.667  -6.597 -13.983
  198   2H2     G  18          H22         G  18   4.468  -4.893 -14.323
  199   1H5*    U  19          2H5*        U  19   6.158   3.793 -14.007
  200   2H5*    U  19          1H5*        U  19   5.239   5.169 -13.362
  201    H4*    U  19           H4*        U  19   4.003   4.835 -15.265
  202    H3*    U  19           H3*        U  19   2.942   2.871 -13.211
  203    H2*    U  19           H2*        U  19   1.557   1.885 -14.819
  204   2HO*    U  19          2HO*        U  19   0.945   3.031 -16.734
  205    H1*    U  19           H1*        U  19   3.157   2.373 -17.096
  206    H3     U  19           H3         U  19   2.497  -2.089 -17.190
  207    H5     U  19           H5         U  19   4.875  -1.502 -13.759
  208    H6     U  19           H6         U  19   4.660   0.891 -14.101
  209   1H5*    A  20          2H5*        A  20   0.481   5.616 -15.332
  210   2H5*    A  20          1H5*        A  20  -0.794   6.555 -14.529
  211    H4*    A  20           H4*        A  20  -1.744   5.958 -16.607
  212    H3*    A  20           H3*        A  20  -2.616   4.197 -14.317
  213    H2*    A  20           H2*        A  20  -3.790   2.738 -15.743
  214   2HO*    A  20          2HO*        A  20  -3.513   4.590 -17.895
  215    H1*    A  20           H1*        A  20  -2.085   2.729 -17.897
  216    H8     A  20           H8         A  20  -0.687   2.579 -14.300
  217   1H6     A  20          H61         A  20  -0.608  -3.536 -15.034
  218   2H6     A  20          H62         A  20  -0.183  -2.213 -13.970
  219    H2     A  20           H2         A  20  -2.516  -1.720 -18.675
  220   1H5*    G  21          2H5*        G  21  -7.856   4.037 -14.331
  221   2H5*    G  21          1H5*        G  21  -6.346   3.481 -13.578
  222    H4*    G  21           H4*        G  21  -7.301   2.767 -16.381
  223    H3*    G  21           H3*        G  21  -7.493   1.391 -13.698
  224    H2*    G  21           H2*        G  21  -6.845  -0.682 -14.620
  225   2HO*    G  21          2HO*        G  21  -7.272  -1.226 -16.659
  226    H1*    G  21           H1*        G  21  -4.946   0.195 -16.389
  227    H8     G  21           H8         G  21  -3.991   2.224 -13.560
  228    H1     G  21           H1         G  21  -3.143  -3.934 -12.145
  229   1H2     G  21          H21         G  21  -4.210  -5.206 -13.616
  230   2H2     G  21          H22         G  21  -5.129  -4.535 -14.945
  231   1H5*    U  22          2H5*        U  22 -10.929  -1.261 -14.953
  232   2H5*    U  22          1H5*        U  22 -11.667  -1.227 -13.339
  233    H4*    U  22           H4*        U  22 -10.277  -3.354 -14.312
  234    H3*    U  22           H3*        U  22 -10.712  -2.320 -11.494
  235    H2*    U  22           H2*        U  22  -9.212  -3.909 -10.642
  236   2HO*    U  22          2HO*        U  22  -9.927  -5.341 -12.977
  237    H1*    U  22           H1*        U  22  -7.493  -4.091 -12.861
  238    H3     U  22           H3         U  22  -5.432  -3.024  -8.832
  239    H5     U  22           H5         U  22  -6.435   0.606 -10.724
  240    H6     U  22           H6         U  22  -7.757  -0.665 -12.315
  241   1H5*    G  23          2H5*        G  23 -13.985  -5.756  -9.951
  242   2H5*    G  23          1H5*        G  23 -14.009  -4.530  -8.668
  243    H4*    G  23           H4*        G  23 -12.921  -7.127  -8.516
  244    H3*    G  23           H3*        G  23 -12.869  -4.643  -6.781
  245    H2*    G  23           H2*        G  23 -11.171  -5.566  -5.438
  246   2HO*    G  23          2HO*        G  23 -10.700  -7.980  -5.945
  247    H1*    G  23           H1*        G  23  -9.769  -6.932  -7.410
  248    H8     G  23           H8         G  23 -10.416  -3.513  -8.714
  249    H1     G  23           H1         G  23  -5.914  -3.498  -4.199
  250   1H2     G  23          H21         G  23  -5.881  -5.453  -3.153
  251   2H2     G  23          H22         G  23  -6.968  -6.760  -3.569
  252   1H5*    U  24          2H5*        U  24 -13.170  -8.216  -4.366
  253   2H5*    U  24          1H5*        U  24 -14.295  -8.020  -3.007
  254    H4*    U  24           H4*        U  24 -11.970  -8.792  -2.358
  255    H3*    U  24           H3*        U  24 -13.253  -6.271  -1.265
  256    H2*    U  24           H2*        U  24 -11.321  -5.756  -0.061
  257   2HO*    U  24          2HO*        U  24  -9.804  -7.911  -0.025
  258    H1*    U  24           H1*        U  24  -9.434  -7.102  -1.717
  259    H3     U  24           H3         U  24  -7.843  -2.898  -1.010
  260    H5     U  24           H5         U  24 -10.999  -2.405  -3.760
  261    H6     U  24           H6         U  24 -11.565  -4.742  -3.428
  262   1H5*    C  25          2H5*        C  25 -11.523  -8.626   2.037
  263   2H5*    C  25          1H5*        C  25 -12.478  -8.339   3.506
  264    H4*    C  25           H4*        C  25  -9.922  -7.641   3.401
  265    H3*    C  25           H3*        C  25 -12.288  -6.331   4.700
  266    H2*    C  25           H2*        C  25 -11.325  -4.235   4.708
  267   2HO*    C  25          2HO*        C  25  -8.739  -4.650   5.194
  268    H1*    C  25           H1*        C  25  -8.846  -5.029   3.278
  269   1H4     C  25          H41         C  25 -10.215   0.879   1.316
  270   2H4     C  25          H42         C  25 -11.586   0.270   0.416
  271    H5     C  25           H5         C  25 -12.311  -2.025   0.508
  272    H6     C  25           H6         C  25 -11.878  -4.232   1.482
  273   1H5*    C  26          2H5*        C  26  -8.570  -6.203   6.416
  274   2H5*    C  26          1H5*        C  26  -8.297  -7.190   7.866
  275    H4*    C  26           H4*        C  26  -6.883  -5.518   8.469
  276    H3*    C  26           H3*        C  26  -9.625  -4.357   9.019
  277    H2*    C  26           H2*        C  26  -8.661  -2.304   9.599
  278   2HO*    C  26          2HO*        C  26  -6.180  -2.318   9.683
  279    H1*    C  26           H1*        C  26  -6.653  -2.308   7.683
  280   1H4     C  26          H41         C  26 -11.227   1.487   5.428
  281   2H4     C  26          H42         C  26 -12.244   0.109   5.074
  282    H5     C  26           H5         C  26 -11.646  -2.154   5.644
  283    H6     C  26           H6         C  26  -9.945  -3.582   6.678
  284    H3T    C  26           H3T        C  26  -7.611  -4.659  10.931
  Start of MODEL   11
    1   1H5*    G   1          2H5*        G   1  -5.495  10.653   2.746
    2   2H5*    G   1          1H5*        G   1  -4.691   9.454   1.712
    3    H4*    G   1           H4*        G   1  -3.787   9.713   4.103
    4    H3*    G   1           H3*        G   1  -4.531   7.152   2.706
    5    H2*    G   1           H2*        G   1  -4.227   5.846   4.680
    6   2HO*    G   1          2HO*        G   1  -3.308   7.161   6.598
    7    H1*    G   1           H1*        G   1  -5.341   7.520   6.499
    8    H8     G   1           H8         G   1  -7.563   7.984   3.591
    9    H1     G   1           H1         G   1  -8.324   2.193   6.149
   10   1H2     G   1          H21         G   1  -6.676   1.768   7.570
   11   2H2     G   1          H22         G   1  -5.389   2.912   7.886
   12    H5T    G   1           H5T        G   1  -7.237   9.611   2.292
   13   1H5*    G   2          2H5*        G   2  -0.462   6.158   4.749
   14   2H5*    G   2          1H5*        G   2   0.182   4.935   3.636
   15    H4*    G   2           H4*        G   2  -0.378   4.293   6.135
   16    H3*    G   2           H3*        G   2  -0.812   2.742   3.583
   17    H2*    G   2           H2*        G   2  -2.013   1.042   4.703
   18   2HO*    G   2          2HO*        G   2  -0.343   1.557   6.653
   19    H1*    G   2           H1*        G   2  -3.495   2.580   6.379
   20    H8     G   2           H8         G   2  -3.277   4.450   3.135
   21    H1     G   2           H1         G   2  -7.406  -0.398   2.864
   22   1H2     G   2          H21         G   2  -7.176  -1.692   4.652
   23   2H2     G   2          H22         G   2  -6.006  -1.358   5.908
   24   1H5*    A   3          2H5*        A   3  -0.904  -0.345   6.045
   25   2H5*    A   3          1H5*        A   3   0.532  -1.326   5.692
   26    H4*    A   3           H4*        A   3  -1.532  -2.672   5.517
   27    H3*    A   3           H3*        A   3   0.226  -2.164   3.131
   28    H2*    A   3           H2*        A   3  -1.427  -2.720   1.622
   29   2HO*    A   3          2HO*        A   3  -1.142  -4.945   3.013
   30    H1*    A   3           H1*        A   3  -3.554  -3.129   3.656
   31    H8     A   3           H8         A   3  -2.796   0.214   1.978
   32   1H6     A   3          H61         A   3  -7.323  -1.113  -1.978
   33   2H6     A   3          H62         A   3  -6.195   0.115  -1.448
   34    H2     A   3           H2         A   3  -6.606  -4.735   0.585
   35   1H5*    C   4          2H5*        C   4  -0.027  -7.194   3.726
   36   2H5*    C   4          1H5*        C   4   0.956  -7.663   2.323
   37    H4*    C   4           H4*        C   4  -1.737  -8.196   2.623
   38    H3*    C   4           H3*        C   4   0.189  -8.120   0.315
   39    H2*    C   4           H2*        C   4  -1.458  -7.665  -1.232
   40   2HO*    C   4          2HO*        C   4  -2.128  -9.973  -0.551
   41    H1*    C   4           H1*        C   4  -3.664  -7.380   0.726
   42   1H4     C   4          H41         C   4  -4.633  -3.079  -3.902
   43   2H4     C   4          H42         C   4  -3.422  -2.049  -3.174
   44    H5     C   4           H5         C   4  -2.059  -2.727  -1.308
   45    H6     C   4           H6         C   4  -1.559  -4.542   0.263
   46   1H5*    A   5          2H5*        A   5   0.027 -10.946  -2.879
   47   2H5*    A   5          1H5*        A   5  -0.296  -9.300  -2.297
   48    H4*    A   5           H4*        A   5  -2.645 -10.860  -3.293
   49    H3*    A   5           H3*        A   5  -0.262 -10.172  -4.985
   50    H2*    A   5           H2*        A   5  -1.435  -8.707  -6.325
   51   2HO*    A   5          2HO*        A   5  -3.850 -10.111  -6.287
   52    H1*    A   5           H1*        A   5  -3.981  -8.836  -4.822
   53    H8     A   5           H8         A   5  -1.508  -6.357  -3.572
   54   1H6     A   5          H61         A   5  -3.696  -2.316  -7.669
   55   2H6     A   5          H62         A   5  -2.673  -2.524  -6.266
   56    H2     A   5           H2         A   5  -5.394  -6.359  -8.657
   57   1H5*    C   6          2H5*        C   6  -0.344 -12.092  -9.310
   58   2H5*    C   6          1H5*        C   6   0.268 -10.523  -8.748
   59    H4*    C   6           H4*        C   6  -2.119 -11.084 -10.531
   60    H3*    C   6           H3*        C   6   0.522  -9.620 -10.760
   61    H2*    C   6           H2*        C   6  -0.459  -7.898 -11.988
   62   2HO*    C   6          2HO*        C   6  -1.318  -9.501 -13.518
   63    H1*    C   6           H1*        C   6  -3.119  -8.131 -11.012
   64   1H4     C   6          H41         C   6  -0.828  -2.456  -9.237
   65   2H4     C   6          H42         C   6  -0.027  -3.206  -7.874
   66    H5     C   6           H5         C   6   0.027  -5.590  -7.521
   67    H6     C   6           H6         C   6  -0.673  -7.767  -8.401
   68   1H5*    G   7          2H5*        G   7   2.633  -8.580 -13.977
   69   2H5*    G   7          1H5*        G   7   1.585  -8.480 -12.549
   70    H4*    G   7           H4*        G   7   0.339  -7.667 -15.130
   71    H3*    G   7           H3*        G   7   2.761  -6.271 -13.971
   72    H2*    G   7           H2*        G   7   1.698  -4.140 -14.201
   73   2HO*    G   7          2HO*        G   7  -0.308  -5.485 -15.743
   74    H1*    G   7           H1*        G   7  -0.771  -4.831 -13.318
   75    H8     G   7           H8         G   7   1.385  -6.834 -11.109
   76    H1     G   7           H1         G   7   1.921  -0.623  -9.777
   77   1H2     G   7          H21         G   7   1.009   0.582 -11.400
   78   2H2     G   7          H22         G   7   0.269  -0.144 -12.808
   79   1H5*    A   8          2H5*        A   8   3.535  -7.394 -18.662
   80   2H5*    A   8          1H5*        A   8   3.703  -6.187 -19.953
   81    H4*    A   8           H4*        A   8   1.478  -7.803 -19.492
   82    H3*    A   8           H3*        A   8   2.063  -5.341 -21.136
   83    H2*    A   8           H2*        A   8  -0.259  -4.931 -21.507
   84   2HO*    A   8          2HO*        A   8  -1.010  -7.382 -20.299
   85    H1*    A   8           H1*        A   8  -1.204  -5.527 -19.025
   86    H8     A   8           H8         A   8   1.461  -3.736 -17.646
   87   1H6     A   8          H61         A   8  -0.273   1.522 -20.340
   88   2H6     A   8          H62         A   8   0.721   0.811 -19.088
   89    H2     A   8           H2         A   8  -2.403  -1.864 -22.391
   90   1H5*    A   9          2H5*        A   9  -0.057  -6.475 -23.307
   91   2H5*    A   9          1H5*        A   9   0.183  -7.184 -24.917
   92    H4*    A   9           H4*        A   9  -1.152  -5.281 -25.335
   93    H3*    A   9           H3*        A   9   1.794  -4.763 -25.814
   94    H2*    A   9           H2*        A   9   1.390  -2.503 -26.239
   95   2HO*    A   9          2HO*        A   9  -1.379  -2.992 -26.671
   96    H1*    A   9           H1*        A   9  -0.972  -2.197 -24.690
   97    H8     A   9           H8         A   9   1.566  -3.239 -22.299
   98   1H6     A   9          H61         A   9   4.071   2.382 -22.529
   99   2H6     A   9          H62         A   9   4.025   0.867 -21.655
  100    H2     A   9           H2         A   9   1.215   1.989 -25.975
  101   1H5*    A  10          2H5*        A  10   2.729  -3.092 -30.357
  102   2H5*    A  10          1H5*        A  10   3.712  -4.056 -29.236
  103    H4*    A  10           H4*        A  10   3.114  -1.096 -29.178
  104    H3*    A  10           H3*        A  10   5.406  -2.734 -29.799
  105    H2*    A  10           H2*        A  10   6.215  -2.896 -27.605
  106   2HO*    A  10          2HO*        A  10   6.964  -0.459 -27.085
  107    H1*    A  10           H1*        A  10   4.804  -0.340 -26.814
  108    H8     A  10           H8         A  10   3.990  -3.776 -25.424
  109   1H6     A  10          H61         A  10   7.322  -2.263 -20.472
  110   2H6     A  10          H62         A  10   6.234  -3.446 -21.161
  111    H2     A  10           H2         A  10   7.899   0.940 -23.572
  112   1H5*    U  11          2H5*        U  11   9.782  -0.447 -30.554
  113   2H5*    U  11          1H5*        U  11   8.723  -1.825 -30.919
  114    H4*    U  11           H4*        U  11   8.912  -0.884 -28.072
  115    H3*    U  11           H3*        U  11  11.267  -1.671 -29.558
  116    H2*    U  11           H2*        U  11  10.921  -3.980 -29.361
  117   2HO*    U  11          2HO*        U  11  11.562  -3.200 -26.687
  118    H1*    U  11           H1*        U  11   9.243  -3.576 -26.876
  119    H3     U  11           H3         U  11   9.425  -8.161 -27.160
  120    H5     U  11           H5         U  11   7.098  -6.905 -30.443
  121    H6     U  11           H6         U  11   7.729  -4.618 -29.931
  122   1H5*    C  12          2H5*        C  12  14.840  -2.957 -27.761
  123   2H5*    C  12          1H5*        C  12  14.981  -1.394 -26.931
  124    H4*    C  12           H4*        C  12  16.835  -1.310 -28.321
  125    H3*    C  12           H3*        C  12  14.681   0.334 -29.115
  126    H2*    C  12           H2*        C  12  14.137  -0.861 -31.087
  127   2HO*    C  12          2HO*        C  12  15.789  -0.054 -32.780
  128    H1*    C  12           H1*        C  12  17.051  -1.575 -31.485
  129   1H4     C  12          H41         C  12  14.538  -5.521 -35.772
  130   2H4     C  12          H42         C  12  13.050  -5.662 -34.864
  131    H5     C  12           H5         C  12  12.663  -4.520 -32.779
  132    H6     C  12           H6         C  12  13.618  -2.997 -31.113
  133   1H5*    C  13          2H5*        C  13  15.459   4.091 -31.053
  134   2H5*    C  13          1H5*        C  13  15.646   2.448 -31.700
  135    H4*    C  13           H4*        C  13  17.742   4.526 -32.311
  136    H3*    C  13           H3*        C  13  14.923   4.693 -33.144
  137    H2*    C  13           H2*        C  13  15.222   3.661 -35.191
  138   2HO*    C  13          2HO*        C  13  15.465   5.585 -36.166
  139    H1*    C  13           H1*        C  13  18.223   3.890 -35.056
  140   1H4     C  13          H41         C  13  17.454  -0.757 -39.326
  141   2H4     C  13          H42         C  13  16.447  -1.663 -38.219
  142    H5     C  13           H5         C  13  15.796  -0.840 -36.050
  143    H6     C  13           H6         C  13  15.972   1.029 -34.474
  144   1H5*    C  14          2H5*        C  14  15.432   7.655 -30.650
  145   2H5*    C  14          1H5*        C  14  14.987   6.251 -31.638
  146    H4*    C  14           H4*        C  14  13.026   8.496 -31.092
  147    H3*    C  14           H3*        C  14  14.031   6.638 -29.092
  148    H2*    C  14           H2*        C  14  12.569   4.892 -29.638
  149   2HO*    C  14          2HO*        C  14  10.630   5.123 -28.571
  150    H1*    C  14           H1*        C  14  10.622   6.824 -30.911
  151   1H4     C  14          H41         C  14   8.315   1.368 -33.184
  152   2H4     C  14          H42         C  14   9.922   0.736 -33.465
  153    H5     C  14           H5         C  14  11.930   1.944 -32.904
  154    H6     C  14           H6         C  14  12.832   4.015 -31.954
  155   1H5*    G  15          2H5*        G  15  11.059   8.549 -26.934
  156   2H5*    G  15          1H5*        G  15  11.417   9.022 -25.261
  157    H4*    G  15           H4*        G  15  10.423   6.659 -25.695
  158    H3*    G  15           H3*        G  15  12.478   7.588 -23.798
  159    H2*    G  15           H2*        G  15  13.691   5.611 -23.543
  160   2HO*    G  15          2HO*        G  15  11.419   4.542 -23.269
  161    H1*    G  15           H1*        G  15  13.501   4.434 -25.967
  162    H8     G  15           H8         G  15  15.495   5.352 -27.500
  163    H1     G  15           H1         G  15  16.517  10.183 -23.467
  164   1H2     G  15          H21         G  15  14.852  10.320 -22.010
  165   2H2     G  15          H22         G  15  13.490   9.221 -22.032
  166   1H5*    A  16          2H5*        A  16   8.315   7.066 -23.527
  167   2H5*    A  16          1H5*        A  16   7.969   8.384 -22.390
  168    H4*    A  16           H4*        A  16   5.983   7.463 -21.889
  169    H3*    A  16           H3*        A  16   7.826   5.501 -20.758
  170    H2*    A  16           H2*        A  16   6.819   3.495 -21.395
  171   2HO*    A  16          2HO*        A  16   4.642   4.840 -20.663
  172    H1*    A  16           H1*        A  16   5.590   4.056 -23.713
  173    H8     A  16           H8         A  16   8.852   3.918 -21.901
  174   1H6     A  16          H61         A  16  11.731   3.046 -27.260
  175   2H6     A  16          H62         A  16  11.892   3.022 -25.519
  176    H2     A  16           H2         A  16   7.493   4.218 -28.170
  177   1H5*    A  17          2H5*        A  17   8.698   4.843 -18.404
  178   2H5*    A  17          1H5*        A  17   7.367   3.853 -19.038
  179    H4*    A  17           H4*        A  17   8.095   3.848 -16.095
  180    H3*    A  17           H3*        A  17   9.949   3.051 -17.962
  181    H2*    A  17           H2*        A  17   8.560   1.455 -19.080
  182   2HO*    A  17          2HO*        A  17  10.110   0.049 -18.571
  183    H1*    A  17           H1*        A  17   7.477   0.491 -16.428
  184    H8     A  17           H8         A  17   5.947   1.922 -19.690
  185   1H6     A  17          H61         A  17   3.129  -3.526 -20.236
  186   2H6     A  17          H62         A  17   3.313  -1.930 -20.929
  187    H2     A  17           H2         A  17   5.782  -3.685 -16.611
  188   1H5*    G  18          2H5*        G  18  10.116   0.805 -12.908
  189   2H5*    G  18          1H5*        G  18   9.266   0.974 -14.457
  190    H4*    G  18           H4*        G  18   7.386   2.093 -13.306
  191    H3*    G  18           H3*        G  18   9.238   2.565 -11.225
  192    H2*    G  18           H2*        G  18   9.072   0.396 -10.274
  193   2HO*    G  18          2HO*        G  18   8.238   1.176  -8.484
  194    H1*    G  18           H1*        G  18   6.135   0.352 -11.050
  195    H8     G  18           H8         G  18   8.639  -1.379  -9.135
  196    H1     G  18           H1         G  18   5.156  -5.656 -12.331
  197   1H2     G  18          H21         G  18   4.001  -4.651 -13.934
  198   2H2     G  18          H22         G  18   4.086  -2.927 -14.218
  199   1H5*    U  19          2H5*        U  19   4.544   4.724 -12.025
  200   2H5*    U  19          1H5*        U  19   4.913   3.130 -12.717
  201    H4*    U  19           H4*        U  19   4.484   5.652 -14.367
  202    H3*    U  19           H3*        U  19   2.564   3.537 -13.368
  203    H2*    U  19           H2*        U  19   1.527   3.390 -15.478
  204   2HO*    U  19          2HO*        U  19   2.787   5.409 -16.825
  205    H1*    U  19           H1*        U  19   3.755   3.680 -17.076
  206    H3     U  19           H3         U  19   1.865  -0.498 -17.482
  207    H5     U  19           H5         U  19   4.555  -0.748 -14.247
  208    H6     U  19           H6         U  19   4.800   1.663 -14.350
  209   1H5*    A  20          2H5*        A  20   0.799   5.950 -15.838
  210   2H5*    A  20          1H5*        A  20  -0.339   7.105 -15.114
  211    H4*    A  20           H4*        A  20  -1.452   6.475 -17.071
  212    H3*    A  20           H3*        A  20  -2.357   4.901 -14.671
  213    H2*    A  20           H2*        A  20  -3.637   3.398 -15.955
  214   2HO*    A  20          2HO*        A  20  -3.329   4.732 -18.395
  215    H1*    A  20           H1*        A  20  -1.992   3.088 -18.104
  216    H8     A  20           H8         A  20  -0.537   3.356 -14.528
  217   1H6     A  20          H61         A  20  -0.477  -2.801 -14.554
  218   2H6     A  20          H62         A  20  -0.045  -1.366 -13.651
  219    H2     A  20           H2         A  20  -2.388  -1.409 -18.377
  220   1H5*    G  21          2H5*        G  21  -7.271   4.250 -14.798
  221   2H5*    G  21          1H5*        G  21  -5.688   3.895 -14.075
  222    H4*    G  21           H4*        G  21  -6.585   2.885 -16.801
  223    H3*    G  21           H3*        G  21  -6.878   1.730 -14.022
  224    H2*    G  21           H2*        G  21  -6.173  -0.398 -14.757
  225   2HO*    G  21          2HO*        G  21  -7.562   0.045 -16.814
  226    H1*    G  21           H1*        G  21  -4.213   0.378 -16.513
  227    H8     G  21           H8         G  21  -3.379   2.598 -13.795
  228    H1     G  21           H1         G  21  -2.583  -3.447 -11.927
  229   1H2     G  21          H21         G  21  -3.587  -4.819 -13.350
  230   2H2     G  21          H22         G  21  -4.453  -4.244 -14.758
  231   1H5*    U  22          2H5*        U  22  -8.949  -1.141 -15.731
  232   2H5*    U  22          1H5*        U  22 -10.575  -1.305 -15.036
  233    H4*    U  22           H4*        U  22  -9.185  -3.357 -14.729
  234    H3*    U  22           H3*        U  22 -10.223  -1.765 -12.375
  235    H2*    U  22           H2*        U  22  -8.984  -3.018 -10.870
  236   2HO*    U  22          2HO*        U  22  -8.455  -5.331 -12.070
  237    H1*    U  22           H1*        U  22  -7.114  -4.174 -12.769
  238    H3     U  22           H3         U  22  -4.858  -3.268  -8.885
  239    H5     U  22           H5         U  22  -5.394   0.464 -10.772
  240    H6     U  22           H6         U  22  -6.854  -0.629 -12.372
  241   1H5*    G  23          2H5*        G  23 -13.500  -4.803  -9.790
  242   2H5*    G  23          1H5*        G  23 -12.088  -3.818  -9.359
  243    H4*    G  23           H4*        G  23 -12.310  -6.850  -9.307
  244    H3*    G  23           H3*        G  23 -12.147  -4.653  -7.230
  245    H2*    G  23           H2*        G  23 -10.724  -5.956  -5.882
  246   2HO*    G  23          2HO*        G  23 -12.236  -7.932  -6.786
  247    H1*    G  23           H1*        G  23  -9.273  -7.212  -7.883
  248    H8     G  23           H8         G  23  -9.397  -3.618  -8.793
  249    H1     G  23           H1         G  23  -5.462  -4.662  -3.886
  250   1H2     G  23          H21         G  23  -5.764  -6.709  -3.091
  251   2H2     G  23          H22         G  23  -6.935  -7.817  -3.771
  252   1H5*    U  24          2H5*        U  24 -13.832  -8.193  -4.640
  253   2H5*    U  24          1H5*        U  24 -14.759  -7.251  -3.455
  254    H4*    U  24           H4*        U  24 -12.732  -8.714  -2.645
  255    H3*    U  24           H3*        U  24 -13.438  -5.881  -1.830
  256    H2*    U  24           H2*        U  24 -11.517  -5.752  -0.482
  257   2HO*    U  24          2HO*        U  24 -11.914  -8.506  -0.336
  258    H1*    U  24           H1*        U  24  -9.812  -7.336  -2.031
  259    H3     U  24           H3         U  24  -8.015  -3.157  -1.587
  260    H5     U  24           H5         U  24 -10.915  -2.794  -4.625
  261    H6     U  24           H6         U  24 -11.648  -5.048  -4.104
  262   1H5*    C  25          2H5*        C  25 -12.589  -8.234   2.406
  263   2H5*    C  25          1H5*        C  25 -13.854  -7.327   3.260
  264    H4*    C  25           H4*        C  25 -11.297  -7.249   4.044
  265    H3*    C  25           H3*        C  25 -13.490  -5.194   4.100
  266    H2*    C  25           H2*        C  25 -12.024  -3.416   4.208
  267   2HO*    C  25          2HO*        C  25  -9.987  -4.002   5.639
  268    H1*    C  25           H1*        C  25  -9.551  -5.017   3.902
  269   1H4     C  25          H41         C  25  -8.573   0.377   0.659
  270   2H4     C  25          H42         C  25  -9.785  -0.087  -0.514
  271    H5     C  25           H5         C  25 -11.147  -2.062  -0.294
  272    H6     C  25           H6         C  25 -11.639  -4.020   1.097
  273   1H5*    C  26          2H5*        C  26 -10.704  -5.964   7.886
  274   2H5*    C  26          1H5*        C  26 -11.608  -5.499   9.342
  275    H4*    C  26           H4*        C  26  -9.268  -4.685   9.416
  276    H3*    C  26           H3*        C  26 -11.533  -2.683   9.213
  277    H2*    C  26           H2*        C  26  -9.997  -0.917   9.357
  278   2HO*    C  26          2HO*        C  26  -8.734  -1.661  11.081
  279    H1*    C  26           H1*        C  26  -8.017  -2.059   7.796
  280   1H4     C  26          H41         C  26 -11.215   2.013   4.088
  281   2H4     C  26          H42         C  26 -12.458   0.812   3.818
  282    H5     C  26           H5         C  26 -12.494  -1.324   4.930
  283    H6     C  26           H6         C  26 -11.345  -2.771   6.541
  284    H3T    C  26           H3T        C  26 -10.685  -4.227  11.097
  Start of MODEL   12
    1   1H5*    G   1          2H5*        G   1  -8.648  10.916   5.669
    2   2H5*    G   1          1H5*        G   1  -7.295  10.677   4.544
    3    H4*    G   1           H4*        G   1  -6.563  10.113   6.795
    4    H3*    G   1           H3*        G   1  -6.883   7.901   4.768
    5    H2*    G   1           H2*        G   1  -6.372   6.224   6.389
    6   2HO*    G   1          2HO*        G   1  -4.658   7.866   7.267
    7    H1*    G   1           H1*        G   1  -7.761   7.232   8.498
    8    H8     G   1           H8         G   1  -9.990   7.937   5.630
    9    H1     G   1           H1         G   1  -9.797   1.696   6.926
   10   1H2     G   1          H21         G   1  -8.128   1.263   8.322
   11   2H2     G   1          H22         G   1  -7.065   2.513   8.932
   12    H5T    G   1           H5T        G   1  -8.231   8.866   3.775
   13   1H5*    G   2          2H5*        G   2  -2.731   7.079   6.911
   14   2H5*    G   2          1H5*        G   2  -1.905   6.223   5.595
   15    H4*    G   2           H4*        G   2  -2.417   5.021   7.914
   16    H3*    G   2           H3*        G   2  -2.462   3.954   5.087
   17    H2*    G   2           H2*        G   2  -3.320   1.870   5.811
   18   2HO*    G   2          2HO*        G   2  -2.117   2.641   8.190
   19    H1*    G   2           H1*        G   2  -5.126   2.765   7.633
   20    H8     G   2           H8         G   2  -5.184   5.184   4.766
   21    H1     G   2           H1         G   2  -8.274  -0.231   3.436
   22   1H2     G   2          H21         G   2  -7.847  -1.751   4.993
   23   2H2     G   2          H22         G   2  -6.801  -1.430   6.358
   24   1H5*    A   3          2H5*        A   3  -2.139   0.448   7.111
   25   2H5*    A   3          1H5*        A   3  -0.533  -0.178   6.688
   26    H4*    A   3           H4*        A   3  -2.329  -1.816   6.186
   27    H3*    A   3           H3*        A   3  -0.564  -0.665   4.041
   28    H2*    A   3           H2*        A   3  -2.007  -1.267   2.345
   29   2HO*    A   3          2HO*        A   3  -3.052  -3.525   2.731
   30    H1*    A   3           H1*        A   3  -4.129  -2.327   4.136
   31    H8     A   3           H8         A   3  -3.875   1.302   2.966
   32   1H6     A   3          H61         A   3  -7.956  -0.174  -1.402
   33   2H6     A   3          H62         A   3  -7.071   1.134  -0.648
   34    H2     A   3           H2         A   3  -6.747  -3.953   0.708
   35   1H5*    C   4          2H5*        C   4   0.401  -5.851   3.750
   36   2H5*    C   4          1H5*        C   4   1.074  -5.680   2.116
   37    H4*    C   4           H4*        C   4  -1.327  -6.988   2.858
   38    H3*    C   4           H3*        C   4   0.017  -6.213   0.252
   39    H2*    C   4           H2*        C   4  -1.949  -6.630  -0.933
   40   2HO*    C   4          2HO*        C   4  -2.029  -8.721   0.731
   41    H1*    C   4           H1*        C   4  -3.801  -6.198   1.200
   42   1H4     C   4          H41         C   4  -4.764  -1.941  -3.483
   43   2H4     C   4          H42         C   4  -3.712  -0.832  -2.630
   44    H5     C   4           H5         C   4  -2.447  -1.451  -0.676
   45    H6     C   4           H6         C   4  -1.915  -3.266   0.883
   46   1H5*    A   5          2H5*        A   5   0.575  -9.861  -2.763
   47   2H5*    A   5          1H5*        A   5   0.334  -8.135  -3.098
   48    H4*    A   5           H4*        A   5  -1.617 -10.422  -3.483
   49    H3*    A   5           H3*        A   5  -0.213  -8.392  -5.229
   50    H2*    A   5           H2*        A   5  -2.121  -8.117  -6.579
   51   2HO*    A   5          2HO*        A   5  -3.881  -9.675  -6.441
   52    H1*    A   5           H1*        A   5  -4.076  -8.350  -4.639
   53    H8     A   5           H8         A   5  -1.748  -6.042  -3.045
   54   1H6     A   5          H61         A   5  -3.526  -1.593  -6.913
   55   2H6     A   5          H62         A   5  -2.660  -1.947  -5.435
   56    H2     A   5           H2         A   5  -5.054  -5.511  -8.497
   57   1H5*    C   6          2H5*        C   6  -2.060 -10.479  -7.787
   58   2H5*    C   6          1H5*        C   6  -1.089 -11.702  -8.631
   59    H4*    C   6           H4*        C   6  -2.284 -10.844 -10.416
   60    H3*    C   6           H3*        C   6   0.248  -9.213 -10.077
   61    H2*    C   6           H2*        C   6  -0.427  -7.740 -11.783
   62   2HO*    C   6          2HO*        C   6  -2.339  -8.429 -13.129
   63    H1*    C   6           H1*        C   6  -3.169  -7.764 -11.299
   64   1H4     C   6          H41         C   6  -1.006  -2.261  -8.968
   65   2H4     C   6          H42         C   6  -0.286  -3.086  -7.603
   66    H5     C   6           H5         C   6  -0.278  -5.483  -7.362
   67    H6     C   6           H6         C   6  -0.961  -7.607  -8.377
   68   1H5*    G   7          2H5*        G   7  -0.510  -9.737 -14.195
   69   2H5*    G   7          1H5*        G   7   0.995  -9.693 -15.136
   70    H4*    G   7           H4*        G   7  -0.700  -7.763 -15.479
   71    H3*    G   7           H3*        G   7   2.273  -7.483 -14.951
   72    H2*    G   7           H2*        G   7   2.063  -5.101 -15.031
   73   2HO*    G   7          2HO*        G   7   0.281  -4.090 -15.947
   74    H1*    G   7           H1*        G   7  -0.318  -4.886 -13.679
   75    H8     G   7           H8         G   7   1.752  -7.481 -11.939
   76    H1     G   7           H1         G   7   3.762  -1.557 -10.703
   77   1H2     G   7          H21         G   7   2.762  -0.117 -12.064
   78   2H2     G   7          H22         G   7   1.601  -0.619 -13.273
   79   1H5*    A   8          2H5*        A   8   2.628  -8.044 -20.395
   80   2H5*    A   8          1H5*        A   8   2.955  -6.316 -20.632
   81    H4*    A   8           H4*        A   8   0.386  -7.703 -19.941
   82    H3*    A   8           H3*        A   8   1.323  -5.486 -21.790
   83    H2*    A   8           H2*        A   8  -0.817  -4.451 -21.651
   84   2HO*    A   8          2HO*        A   8  -1.667  -7.025 -20.766
   85    H1*    A   8           H1*        A   8  -1.369  -5.023 -18.996
   86    H8     A   8           H8         A   8   1.639  -3.636 -18.093
   87   1H6     A   8          H61         A   8   0.300   1.860 -20.524
   88   2H6     A   8          H62         A   8   1.345   0.997 -19.418
   89    H2     A   8           H2         A   8  -2.529  -1.164 -22.274
   90   1H5*    A   9          2H5*        A   9  -1.146  -6.733 -24.845
   91   2H5*    A   9          1H5*        A   9  -0.116  -7.031 -26.261
   92    H4*    A   9           H4*        A   9  -1.621  -4.949 -26.347
   93    H3*    A   9           H3*        A   9   1.360  -5.005 -26.859
   94    H2*    A   9           H2*        A   9   1.474  -2.689 -26.977
   95   2HO*    A   9          2HO*        A   9  -0.328  -2.933 -28.675
   96    H1*    A   9           H1*        A   9  -0.940  -2.075 -25.536
   97    H8     A   9           H8         A   9   1.647  -3.704 -23.393
   98   1H6     A   9          H61         A   9   4.260   1.822 -22.662
   99   2H6     A   9          H62         A   9   4.233   0.163 -22.109
  100    H2     A   9           H2         A   9   1.181   2.157 -25.921
  101   1H5*    A  10          2H5*        A  10   0.678  -1.893 -29.766
  102   2H5*    A  10          1H5*        A  10   1.769  -2.503 -31.026
  103    H4*    A  10           H4*        A  10   2.399  -0.341 -29.640
  104    H3*    A  10           H3*        A  10   3.978  -2.460 -30.913
  105    H2*    A  10           H2*        A  10   5.406  -2.821 -29.119
  106   2HO*    A  10          2HO*        A  10   6.353  -0.332 -28.731
  107    H1*    A  10           H1*        A  10   4.602  -0.272 -27.735
  108    H8     A  10           H8         A  10   4.000  -4.015 -26.975
  109   1H6     A  10          H61         A  10   7.703  -3.190 -22.122
  110   2H6     A  10          H62         A  10   6.666  -4.323 -22.958
  111    H2     A  10           H2         A  10   7.609   0.640 -24.475
  112   1H5*    U  11          2H5*        U  11   8.448  -0.434 -32.856
  113   2H5*    U  11          1H5*        U  11   7.294  -1.778 -32.966
  114    H4*    U  11           H4*        U  11   8.284  -0.745 -30.294
  115    H3*    U  11           H3*        U  11   9.810  -2.246 -32.318
  116    H2*    U  11           H2*        U  11   9.427  -4.341 -31.418
  117   2HO*    U  11          2HO*        U  11  10.490  -4.750 -29.463
  118    H1*    U  11           H1*        U  11   8.296  -3.264 -28.850
  119    H3     U  11           H3         U  11   6.757  -7.374 -27.984
  120    H5     U  11           H5         U  11   5.853  -6.889 -32.072
  121    H6     U  11           H6         U  11   6.955  -4.728 -31.992
  122   1H5*    C  12          2H5*        C  12  11.799  -2.336 -26.266
  123   2H5*    C  12          1H5*        C  12  11.866  -0.657 -26.838
  124    H4*    C  12           H4*        C  12  14.087  -1.879 -26.176
  125    H3*    C  12           H3*        C  12  13.502   0.239 -27.992
  126    H2*    C  12           H2*        C  12  14.010  -0.951 -29.963
  127   2HO*    C  12          2HO*        C  12  16.428  -0.109 -28.769
  128    H1*    C  12           H1*        C  12  16.034  -2.636 -28.470
  129   1H4     C  12          H41         C  12  15.666  -6.135 -33.752
  130   2H4     C  12          H42         C  12  14.017  -5.631 -34.047
  131    H5     C  12           H5         C  12  12.820  -4.119 -32.604
  132    H6     C  12           H6         C  12  12.944  -2.764 -30.567
  133   1H5*    C  13          2H5*        C  13  17.030   3.757 -27.676
  134   2H5*    C  13          1H5*        C  13  16.609   2.487 -28.844
  135    H4*    C  13           H4*        C  13  19.333   2.501 -27.545
  136    H3*    C  13           H3*        C  13  18.321   4.630 -29.252
  137    H2*    C  13           H2*        C  13  18.879   3.615 -31.279
  138   2HO*    C  13          2HO*        C  13  21.590   3.558 -30.558
  139    H1*    C  13           H1*        C  13  20.868   1.779 -29.939
  140   1H4     C  13          H41         C  13  20.091  -0.965 -35.634
  141   2H4     C  13          H42         C  13  18.374  -1.139 -35.346
  142    H5     C  13           H5         C  13  17.268  -0.267 -33.392
  143    H6     C  13           H6         C  13  17.570   0.962 -31.293
  144   1H5*    C  14          2H5*        C  14  19.091   6.900 -26.431
  145   2H5*    C  14          1H5*        C  14  18.232   5.565 -27.228
  146    H4*    C  14           H4*        C  14  17.477   8.500 -27.126
  147    H3*    C  14           H3*        C  14  16.466   6.025 -25.879
  148    H2*    C  14           H2*        C  14  14.673   5.764 -27.328
  149   2HO*    C  14          2HO*        C  14  13.098   6.796 -26.381
  150    H1*    C  14           H1*        C  14  14.930   8.561 -28.417
  151   1H4     C  14          H41         C  14  11.466   5.517 -32.823
  152   2H4     C  14          H42         C  14  12.835   4.498 -33.206
  153    H5     C  14           H5         C  14  14.906   4.552 -31.980
  154    H6     C  14           H6         C  14  16.115   5.595 -30.120
  155   1H5*    G  15          2H5*        G  15  14.049   8.775 -23.874
  156   2H5*    G  15          1H5*        G  15  13.573   8.191 -22.266
  157    H4*    G  15           H4*        G  15  12.165   7.568 -24.438
  158    H3*    G  15           H3*        G  15  12.632   6.237 -21.850
  159    H2*    G  15           H2*        G  15  12.415   4.012 -22.515
  160   2HO*    G  15          2HO*        G  15  10.421   4.054 -23.457
  161    H1*    G  15           H1*        G  15  13.380   4.005 -25.038
  162    H8     G  15           H8         G  15  16.045   3.658 -24.924
  163    H1     G  15           H1         G  15  16.050   5.026 -18.697
  164   1H2     G  15          H21         G  15  14.085   5.861 -18.102
  165   2H2     G  15          H22         G  15  12.773   6.081 -19.239
  166   1H5*    A  16          2H5*        A  16   8.683   5.763 -23.210
  167   2H5*    A  16          1H5*        A  16   7.985   7.334 -23.654
  168    H4*    A  16           H4*        A  16   6.012   6.856 -22.238
  169    H3*    A  16           H3*        A  16   7.724   4.653 -21.269
  170    H2*    A  16           H2*        A  16   6.326   2.841 -21.808
  171   2HO*    A  16          2HO*        A  16   4.470   4.372 -20.917
  172    H1*    A  16           H1*        A  16   5.254   3.591 -24.136
  173    H8     A  16           H8         A  16   8.387   2.830 -22.308
  174   1H6     A  16          H61         A  16  11.288   1.942 -27.655
  175   2H6     A  16          H62         A  16  11.378   1.746 -25.918
  176    H2     A  16           H2         A  16   7.334   3.871 -28.553
  177   1H5*    A  17          2H5*        A  17   8.864   3.850 -19.029
  178   2H5*    A  17          1H5*        A  17   7.869   2.676 -19.914
  179    H4*    A  17           H4*        A  17   8.556   2.544 -16.949
  180    H3*    A  17           H3*        A  17  10.286   1.907 -18.982
  181    H2*    A  17           H2*        A  17   8.835   0.361 -20.101
  182   2HO*    A  17          2HO*        A  17  10.531  -0.967 -19.782
  183    H1*    A  17           H1*        A  17   8.009  -0.821 -17.444
  184    H8     A  17           H8         A  17   6.109   0.797 -20.404
  185   1H6     A  17          H61         A  17   3.485  -4.717 -21.172
  186   2H6     A  17          H62         A  17   3.525  -3.058 -21.724
  187    H2     A  17           H2         A  17   6.522  -5.066 -17.875
  188   1H5*    G  18          2H5*        G  18  10.637  -0.616 -14.095
  189   2H5*    G  18          1H5*        G  18   9.720  -0.335 -15.590
  190    H4*    G  18           H4*        G  18   7.974   0.852 -14.211
  191    H3*    G  18           H3*        G  18   9.929   0.774 -12.165
  192    H2*    G  18           H2*        G  18   9.562  -1.493 -11.571
  193   2HO*    G  18          2HO*        G  18   8.845  -0.246  -9.766
  194    H1*    G  18           H1*        G  18   6.622  -1.142 -12.250
  195    H8     G  18           H8         G  18   8.985  -3.390 -10.743
  196    H1     G  18           H1         G  18   5.082  -6.717 -14.528
  197   1H2     G  18          H21         G  18   4.004  -5.351 -15.903
  198   2H2     G  18          H22         G  18   4.248  -3.619 -15.887
  199   1H5*    U  19          2H5*        U  19   8.273   4.253 -14.534
  200   2H5*    U  19          1H5*        U  19   7.247   5.358 -13.597
  201    H4*    U  19           H4*        U  19   6.482   5.135 -15.953
  202    H3*    U  19           H3*        U  19   4.781   4.385 -13.601
  203    H2*    U  19           H2*        U  19   3.404   3.005 -14.834
  204   2HO*    U  19          2HO*        U  19   3.438   4.761 -17.054
  205    H1*    U  19           H1*        U  19   4.859   3.367 -17.406
  206    H3     U  19           H3         U  19   2.503  -0.481 -18.076
  207    H5     U  19           H5         U  19   5.328  -1.444 -15.099
  208    H6     U  19           H6         U  19   5.912   0.907 -14.985
  209   1H5*    A  20          2H5*        A  20   0.465   6.833 -13.572
  210   2H5*    A  20          1H5*        A  20   1.162   5.212 -13.764
  211    H4*    A  20           H4*        A  20  -0.357   6.722 -15.928
  212    H3*    A  20           H3*        A  20  -1.221   4.735 -13.822
  213    H2*    A  20           H2*        A  20  -2.504   3.519 -15.388
  214   2HO*    A  20          2HO*        A  20  -2.428   4.786 -17.667
  215    H1*    A  20           H1*        A  20  -0.809   3.652 -17.533
  216    H8     A  20           H8         A  20   1.174   3.100 -14.365
  217   1H6     A  20          H61         A  20  -0.142  -2.893 -14.882
  218   2H6     A  20          H62         A  20   0.810  -1.701 -14.024
  219    H2     A  20           H2         A  20  -2.597  -0.660 -17.914
  220   1H5*    G  21          2H5*        G  21  -4.799   5.308 -16.406
  221   2H5*    G  21          1H5*        G  21  -6.123   5.100 -15.241
  222    H4*    G  21           H4*        G  21  -5.744   3.315 -17.150
  223    H3*    G  21           H3*        G  21  -6.444   2.884 -14.237
  224    H2*    G  21           H2*        G  21  -6.307   0.550 -14.490
  225   2HO*    G  21          2HO*        G  21  -7.599   0.703 -16.520
  226    H1*    G  21           H1*        G  21  -4.212   0.433 -16.302
  227    H8     G  21           H8         G  21  -3.399   2.822 -13.511
  228    H1     G  21           H1         G  21  -2.658  -3.276 -11.807
  229   1H2     G  21          H21         G  21  -3.521  -4.609 -13.357
  230   2H2     G  21          H22         G  21  -4.278  -3.993 -14.809
  231   1H5*    U  22          2H5*        U  22 -10.222  -0.238 -14.126
  232   2H5*    U  22          1H5*        U  22  -9.272   0.416 -12.776
  233    H4*    U  22           H4*        U  22  -8.799  -2.130 -14.354
  234    H3*    U  22           H3*        U  22  -9.414  -1.388 -11.483
  235    H2*    U  22           H2*        U  22  -8.012  -3.091 -10.685
  236   2HO*    U  22          2HO*        U  22  -7.923  -4.981 -11.658
  237    H1*    U  22           H1*        U  22  -6.095  -3.060 -12.723
  238    H3     U  22           H3         U  22  -4.548  -2.285  -8.386
  239    H5     U  22           H5         U  22  -5.210   1.460 -10.205
  240    H6     U  22           H6         U  22  -6.357   0.307 -12.006
  241   1H5*    G  23          2H5*        G  23 -13.102  -4.496  -9.563
  242   2H5*    G  23          1H5*        G  23 -11.723  -3.474  -9.108
  243    H4*    G  23           H4*        G  23 -11.758  -6.507  -9.341
  244    H3*    G  23           H3*        G  23 -11.744  -4.528  -7.056
  245    H2*    G  23           H2*        G  23 -10.173  -5.811  -5.855
  246   2HO*    G  23          2HO*        G  23 -11.436  -7.844  -7.113
  247    H1*    G  23           H1*        G  23  -8.606  -6.664  -7.951
  248    H8     G  23           H8         G  23  -9.077  -3.119  -8.741
  249    H1     G  23           H1         G  23  -5.465  -3.788  -3.530
  250   1H2     G  23          H21         G  23  -5.598  -5.869  -2.776
  251   2H2     G  23          H22         G  23  -6.577  -7.091  -3.557
  252   1H5*    U  24          2H5*        U  24 -13.767  -8.187  -4.350
  253   2H5*    U  24          1H5*        U  24 -14.123  -6.980  -3.097
  254    H4*    U  24           H4*        U  24 -12.208  -8.996  -2.933
  255    H3*    U  24           H3*        U  24 -12.796  -6.453  -1.410
  256    H2*    U  24           H2*        U  24 -10.723  -6.539  -0.298
  257   2HO*    U  24          2HO*        U  24 -10.099  -8.432   0.395
  258    H1*    U  24           H1*        U  24  -9.155  -7.495  -2.350
  259    H3     U  24           H3         U  24  -8.149  -3.175  -0.992
  260    H5     U  24           H5         U  24 -10.888  -2.851  -4.179
  261    H6     U  24           H6         U  24 -11.250  -5.246  -4.025
  262   1H5*    C  25          2H5*        C  25 -11.588  -8.849   1.532
  263   2H5*    C  25          1H5*        C  25 -12.720  -9.016   2.889
  264    H4*    C  25           H4*        C  25 -10.462  -8.176   3.579
  265    H3*    C  25           H3*        C  25 -13.030  -6.707   4.066
  266    H2*    C  25           H2*        C  25 -11.999  -4.664   4.329
  267   2HO*    C  25          2HO*        C  25  -9.840  -4.889   5.653
  268    H1*    C  25           H1*        C  25  -9.247  -5.647   3.783
  269   1H4     C  25          H41         C  25  -9.496   0.280   1.452
  270   2H4     C  25          H42         C  25 -10.540  -0.266   0.159
  271    H5     C  25           H5         C  25 -11.416  -2.506   0.024
  272    H6     C  25           H6         C  25 -11.475  -4.709   1.099
  273   1H5*    C  26          2H5*        C  26  -9.903  -6.807   6.851
  274   2H5*    C  26          1H5*        C  26 -10.232  -7.606   8.402
  275    H4*    C  26           H4*        C  26  -8.772  -5.986   9.140
  276    H3*    C  26           H3*        C  26 -11.520  -4.715   9.061
  277    H2*    C  26           H2*        C  26 -10.612  -2.680   9.786
  278   2HO*    C  26          2HO*        C  26  -8.370  -4.259  10.564
  279    H1*    C  26           H1*        C  26  -8.271  -2.804   8.311
  280   1H4     C  26          H41         C  26 -12.237   0.994   5.094
  281   2H4     C  26          H42         C  26 -13.142  -0.390   4.523
  282    H5     C  26           H5         C  26 -12.683  -2.649   5.226
  283    H6     C  26           H6         C  26 -11.251  -4.068   6.627
  284    H3T    C  26           H3T        C  26 -11.353  -6.056  10.765
  Start of MODEL   13
    1   1H5*    G   1          2H5*        G   1  -7.004  10.273   1.733
    2   2H5*    G   1          1H5*        G   1  -5.597  11.286   2.113
    3    H4*    G   1           H4*        G   1  -5.459  10.281   4.120
    4    H3*    G   1           H3*        G   1  -4.893   7.916   2.315
    5    H2*    G   1           H2*        G   1  -5.183   6.414   4.148
    6   2HO*    G   1          2HO*        G   1  -5.541   8.246   6.170
    7    H1*    G   1           H1*        G   1  -7.304   7.672   5.359
    8    H8     G   1           H8         G   1  -7.389   7.489   1.530
    9    H1     G   1           H1         G   1  -9.875   2.379   4.421
   10   1H2     G   1          H21         G   1  -9.532   2.503   6.607
   11   2H2     G   1          H22         G   1  -8.692   3.845   7.353
   12    H5T    G   1           H5T        G   1  -4.849  10.258   0.425
   13   1H5*    G   2          2H5*        G   2  -0.972   5.527   4.847
   14   2H5*    G   2          1H5*        G   2  -2.217   5.011   3.692
   15    H4*    G   2           H4*        G   2  -2.355   4.872   6.727
   16    H3*    G   2           H3*        G   2  -2.011   2.856   4.492
   17    H2*    G   2           H2*        G   2  -3.416   1.321   5.604
   18   2HO*    G   2          2HO*        G   2  -3.414   2.916   7.959
   19    H1*    G   2           H1*        G   2  -5.246   3.106   6.643
   20    H8     G   2           H8         G   2  -4.685   4.123   3.108
   21    H1     G   2           H1         G   2  -8.232  -1.157   3.516
   22   1H2     G   2          H21         G   2  -8.149  -1.970   5.579
   23   2H2     G   2          H22         G   2  -7.222  -1.210   6.853
   24   1H5*    A   3          2H5*        A   3  -2.095   0.196   6.954
   25   2H5*    A   3          1H5*        A   3  -0.590  -0.745   6.980
   26    H4*    A   3           H4*        A   3  -2.418  -2.227   6.379
   27    H3*    A   3           H3*        A   3  -0.380  -1.501   4.288
   28    H2*    A   3           H2*        A   3  -1.726  -2.172   2.540
   29   2HO*    A   3          2HO*        A   3  -1.402  -4.384   3.799
   30    H1*    A   3           H1*        A   3  -4.123  -2.745   4.181
   31    H8     A   3           H8         A   3  -3.203   0.674   2.724
   32   1H6     A   3          H61         A   3  -7.045  -0.652  -1.903
   33   2H6     A   3          H62         A   3  -6.035   0.585  -1.186
   34    H2     A   3           H2         A   3  -6.662  -4.308   0.681
   35   1H5*    C   4          2H5*        C   4  -0.432  -6.652   4.472
   36   2H5*    C   4          1H5*        C   4   0.727  -6.826   3.139
   37    H4*    C   4           H4*        C   4  -1.953  -7.596   3.094
   38    H3*    C   4           H3*        C   4   0.216  -7.188   1.039
   39    H2*    C   4           H2*        C   4  -1.301  -6.830  -0.664
   40   2HO*    C   4          2HO*        C   4  -3.432  -8.249  -0.225
   41    H1*    C   4           H1*        C   4  -3.704  -6.743   1.056
   42   1H4     C   4          H41         C   4  -4.353  -2.235  -3.423
   43   2H4     C   4          H42         C   4  -3.333  -1.176  -2.477
   44    H5     C   4           H5         C   4  -2.181  -1.890  -0.482
   45    H6     C   4           H6         C   4  -1.760  -3.772   1.031
   46   1H5*    A   5          2H5*        A   5  -0.001 -11.110  -2.020
   47   2H5*    A   5          1H5*        A   5   0.711  -9.540  -2.443
   48    H4*    A   5           H4*        A   5  -1.996 -10.663  -3.190
   49    H3*    A   5           H3*        A   5   0.483  -9.739  -4.605
   50    H2*    A   5           H2*        A   5  -0.635  -8.190  -5.893
   51   2HO*    A   5          2HO*        A   5  -2.655 -10.192  -6.183
   52    H1*    A   5           H1*        A   5  -3.310  -8.653  -4.685
   53    H8     A   5           H8         A   5  -1.062  -6.085  -3.130
   54   1H6     A   5          H61         A   5  -3.561  -1.911  -6.905
   55   2H6     A   5          H62         A   5  -2.530  -2.151  -5.512
   56    H2     A   5           H2         A   5  -4.915  -5.986  -8.239
   57   1H5*    C   6          2H5*        C   6   1.036 -12.096  -9.002
   58   2H5*    C   6          1H5*        C   6   1.391 -10.462  -8.407
   59    H4*    C   6           H4*        C   6  -0.554 -11.339 -10.540
   60    H3*    C   6           H3*        C   6   1.682  -9.313 -10.243
   61    H2*    C   6           H2*        C   6   0.581  -7.824 -11.681
   62   2HO*    C   6          2HO*        C   6  -0.433 -10.203 -12.735
   63    H1*    C   6           H1*        C   6  -2.064  -8.490 -11.042
   64   1H4     C   6          H41         C   6  -0.832  -2.775  -8.507
   65   2H4     C   6          H42         C   6  -0.105  -3.547  -7.115
   66    H5     C   6           H5         C   6   0.243  -5.925  -6.957
   67    H6     C   6           H6         C   6  -0.032  -8.077  -8.095
   68   1H5*    G   7          2H5*        G   7   1.437 -10.015 -14.674
   69   2H5*    G   7          1H5*        G   7   2.924  -9.313 -15.342
   70    H4*    G   7           H4*        G   7   0.592  -8.108 -15.691
   71    H3*    G   7           H3*        G   7   3.334  -6.972 -15.154
   72    H2*    G   7           H2*        G   7   2.467  -4.761 -14.887
   73   2HO*    G   7          2HO*        G   7   0.090  -5.823 -16.076
   74    H1*    G   7           H1*        G   7   0.253  -5.344 -13.435
   75    H8     G   7           H8         G   7   2.730  -7.745 -12.099
   76    H1     G   7           H1         G   7   4.072  -1.781 -10.286
   77   1H2     G   7          H21         G   7   2.879  -0.340 -11.477
   78   2H2     G   7          H22         G   7   1.754  -0.849 -12.716
   79   1H5*    A   8          2H5*        A   8   2.001  -8.127 -19.211
   80   2H5*    A   8          1H5*        A   8   2.167  -7.442 -20.840
   81    H4*    A   8           H4*        A   8  -0.190  -7.537 -19.472
   82    H3*    A   8           H3*        A   8   0.885  -5.672 -21.603
   83    H2*    A   8           H2*        A   8  -0.913  -4.180 -21.278
   84   2HO*    A   8          2HO*        A   8  -2.522  -5.687 -21.760
   85    H1*    A   8           H1*        A   8  -1.601  -4.964 -18.606
   86    H8     A   8           H8         A   8   1.494  -3.494 -17.891
   87   1H6     A   8          H61         A   8  -0.502   2.114 -19.464
   88   2H6     A   8          H62         A   8   0.742   1.218 -18.622
   89    H2     A   8           H2         A   8  -3.376  -0.909 -21.139
   90   1H5*    A   9          2H5*        A   9  -2.294  -6.251 -24.866
   91   2H5*    A   9          1H5*        A   9  -0.964  -5.881 -25.982
   92    H4*    A   9           H4*        A   9  -2.947  -4.105 -25.152
   93    H3*    A   9           H3*        A   9  -0.257  -3.857 -26.505
   94    H2*    A   9           H2*        A   9  -0.065  -1.622 -25.945
   95   2HO*    A   9          2HO*        A   9  -1.610  -0.670 -27.076
   96    H1*    A   9           H1*        A   9  -2.213  -1.545 -23.964
   97    H8     A   9           H8         A   9   0.888  -3.168 -22.722
   98   1H6     A   9          H61         A   9   3.128   2.422 -21.437
   99   2H6     A   9          H62         A   9   3.354   0.702 -21.218
  100    H2     A   9           H2         A   9  -0.570   2.943 -23.937
  101   1H5*    A  10          2H5*        A  10  -0.094  -1.977 -30.952
  102   2H5*    A  10          1H5*        A  10   0.868  -3.103 -29.972
  103    H4*    A  10           H4*        A  10   0.911  -0.080 -29.981
  104    H3*    A  10           H3*        A  10   2.580  -2.026 -31.137
  105    H2*    A  10           H2*        A  10   3.540  -2.805 -29.111
  106   2HO*    A  10          2HO*        A  10   5.392  -1.269 -28.634
  107    H1*    A  10           H1*        A  10   3.409  -0.011 -27.954
  108    H8     A  10           H8         A  10   2.017  -3.448 -26.847
  109   1H6     A  10          H61         A  10   5.779  -2.930 -21.999
  110   2H6     A  10          H62         A  10   4.532  -3.900 -22.749
  111    H2     A  10           H2         A  10   6.513   0.576 -24.713
  112   1H5*    U  11          2H5*        U  11   5.753   1.494 -30.991
  113   2H5*    U  11          1H5*        U  11   6.577   1.312 -32.552
  114    H4*    U  11           H4*        U  11   7.976   1.053 -30.378
  115    H3*    U  11           H3*        U  11   8.215  -0.114 -32.965
  116    H2*    U  11           H2*        U  11   7.742  -2.330 -32.305
  117   2HO*    U  11          2HO*        U  11  10.234  -2.354 -30.997
  118    H1*    U  11           H1*        U  11   8.895  -1.798 -29.558
  119    H3     U  11           H3         U  11   7.669  -5.815 -28.036
  120    H5     U  11           H5         U  11   4.661  -4.959 -30.861
  121    H6     U  11           H6         U  11   5.786  -2.860 -31.325
  122   1H5*    C  12          2H5*        C  12   9.833  -1.326 -35.449
  123   2H5*    C  12          1H5*        C  12  11.517  -0.978 -35.006
  124    H4*    C  12           H4*        C  12  11.696   0.234 -36.889
  125    H3*    C  12           H3*        C  12  10.551   2.007 -35.065
  126    H2*    C  12           H2*        C  12   8.312   1.802 -35.852
  127   2HO*    C  12          2HO*        C  12   8.067   3.767 -36.595
  128    H1*    C  12           H1*        C  12   9.325   1.614 -38.699
  129   1H4     C  12          H41         C  12   3.295  -0.052 -39.752
  130   2H4     C  12          H42         C  12   3.137  -0.736 -38.150
  131    H5     C  12           H5         C  12   4.928  -0.750 -36.538
  132    H6     C  12           H6         C  12   7.256  -0.112 -36.115
  133   1H5*    C  13          2H5*        C  13  10.780   6.665 -37.391
  134   2H5*    C  13          1H5*        C  13  12.446   6.370 -36.851
  135    H4*    C  13           H4*        C  13  11.814   8.186 -35.525
  136    H3*    C  13           H3*        C  13  12.147   5.736 -34.203
  137    H2*    C  13           H2*        C  13   9.839   5.348 -33.773
  138   2HO*    C  13          2HO*        C  13  10.186   7.285 -31.735
  139    H1*    C  13           H1*        C  13   9.417   8.317 -33.354
  140   1H4     C  13          H41         C  13   3.385   6.322 -33.298
  141   2H4     C  13          H42         C  13   3.642   5.350 -34.730
  142    H5     C  13           H5         C  13   5.781   5.137 -35.816
  143    H6     C  13           H6         C  13   8.138   5.810 -35.765
  144   1H5*    C  14          2H5*        C  14  11.919   5.737 -31.513
  145   2H5*    C  14          1H5*        C  14  12.737   6.843 -30.393
  146    H4*    C  14           H4*        C  14  12.492   4.706 -29.291
  147    H3*    C  14           H3*        C  14  14.975   5.962 -29.597
  148    H2*    C  14           H2*        C  14  15.830   4.466 -31.240
  149   2HO*    C  14          2HO*        C  14  17.199   3.090 -30.178
  150    H1*    C  14           H1*        C  14  14.417   2.162 -29.873
  151   1H4     C  14          H41         C  14  16.867  -0.376 -35.222
  152   2H4     C  14          H42         C  14  15.536   0.326 -36.115
  153    H5     C  14           H5         C  14  13.940   1.839 -35.133
  154    H6     C  14           H6         C  14  13.273   3.006 -33.083
  155   1H5*    G  15          2H5*        G  15  14.163   7.732 -26.225
  156   2H5*    G  15          1H5*        G  15  13.445   7.164 -24.706
  157    H4*    G  15           H4*        G  15  12.053   8.427 -26.702
  158    H3*    G  15           H3*        G  15  11.352   6.807 -24.336
  159    H2*    G  15           H2*        G  15   9.855   5.434 -25.417
  160   2HO*    G  15          2HO*        G  15   8.740   7.982 -25.485
  161    H1*    G  15           H1*        G  15   9.771   7.152 -27.879
  162    H8     G  15           H8         G  15   7.873   5.426 -28.564
  163    H1     G  15           H1         G  15  11.988   0.567 -28.304
  164   1H2     G  15          H21         G  15  13.883   1.233 -27.368
  165   2H2     G  15          H22         G  15  14.131   2.872 -26.809
  166   1H5*    A  16          2H5*        A  16   9.016   7.983 -21.111
  167   2H5*    A  16          1H5*        A  16   9.741   6.492 -21.743
  168    H4*    A  16           H4*        A  16   6.858   7.125 -21.175
  169    H3*    A  16           H3*        A  16   8.754   5.464 -19.970
  170    H2*    A  16           H2*        A  16   8.894   3.927 -21.793
  171   2HO*    A  16          2HO*        A  16   7.970   2.154 -20.987
  172    H1*    A  16           H1*        A  16   5.892   4.229 -22.150
  173    H8     A  16           H8         A  16   8.744   2.272 -23.165
  174   1H6     A  16          H61         A  16   6.542   1.834 -28.894
  175   2H6     A  16          H62         A  16   7.705   1.201 -27.750
  176    H2     A  16           H2         A  16   4.263   5.079 -26.779
  177   1H5*    A  17          2H5*        A  17   9.364   4.200 -17.802
  178   2H5*    A  17          1H5*        A  17   8.619   3.259 -19.109
  179    H4*    A  17           H4*        A  17   9.310   2.384 -16.299
  180    H3*    A  17           H3*        A  17  10.656   2.040 -18.686
  181    H2*    A  17           H2*        A  17   8.954   0.784 -19.795
  182   2HO*    A  17          2HO*        A  17  10.396  -0.787 -19.982
  183    H1*    A  17           H1*        A  17   8.364  -0.728 -17.245
  184    H8     A  17           H8         A  17   6.074   1.493 -19.390
  185   1H6     A  17          H61         A  17   3.269  -3.711 -21.110
  186   2H6     A  17          H62         A  17   3.232  -1.965 -21.198
  187    H2     A  17           H2         A  17   6.854  -4.814 -18.631
  188   1H5*    G  18          2H5*        G  18  10.958   2.267 -13.002
  189   2H5*    G  18          1H5*        G  18  11.444   0.711 -13.703
  190    H4*    G  18           H4*        G  18   8.678   1.613 -14.345
  191    H3*    G  18           H3*        G  18   9.499   1.625 -11.563
  192    H2*    G  18           H2*        G  18   9.301  -0.696 -11.264
  193   2HO*    G  18          2HO*        G  18   7.381  -1.006 -10.377
  194    H1*    G  18           H1*        G  18   7.298  -0.838 -13.533
  195    H8     G  18           H8         G  18  10.383  -2.502 -11.871
  196    H1     G  18           H1         G  18   6.305  -6.560 -14.619
  197   1H2     G  18          H21         G  18   4.691  -5.435 -15.643
  198   2H2     G  18          H22         G  18   4.620  -3.688 -15.648
  199   1H5*    U  19          2H5*        U  19   7.714   4.235 -14.179
  200   2H5*    U  19          1H5*        U  19   6.951   5.755 -13.672
  201    H4*    U  19           H4*        U  19   5.863   5.308 -15.694
  202    H3*    U  19           H3*        U  19   4.305   4.367 -13.306
  203    H2*    U  19           H2*        U  19   3.064   2.852 -14.523
  204   2HO*    U  19          2HO*        U  19   2.815   4.308 -16.863
  205    H1*    U  19           H1*        U  19   4.457   3.324 -17.105
  206    H3     U  19           H3         U  19   2.309  -0.754 -17.359
  207    H5     U  19           H5         U  19   5.755  -1.371 -15.009
  208    H6     U  19           H6         U  19   6.065   1.035 -14.951
  209   1H5*    A  20          2H5*        A  20   0.618   5.951 -12.184
  210   2H5*    A  20          1H5*        A  20   1.734   4.960 -13.147
  211    H4*    A  20           H4*        A  20  -0.260   6.581 -14.669
  212    H3*    A  20           H3*        A  20  -1.017   4.404 -12.715
  213    H2*    A  20           H2*        A  20  -2.373   3.321 -14.313
  214   2HO*    A  20          2HO*        A  20  -2.277   5.002 -16.429
  215    H1*    A  20           H1*        A  20  -0.803   3.662 -16.528
  216    H8     A  20           H8         A  20   1.185   2.849 -13.377
  217   1H6     A  20          H61         A  20   0.235  -3.088 -14.703
  218   2H6     A  20          H62         A  20   1.083  -1.968 -13.660
  219    H2     A  20           H2         A  20  -2.226  -0.616 -17.540
  220   1H5*    G  21          2H5*        G  21  -4.720   5.173 -15.264
  221   2H5*    G  21          1H5*        G  21  -5.978   4.741 -14.089
  222    H4*    G  21           H4*        G  21  -5.497   3.225 -16.230
  223    H3*    G  21           H3*        G  21  -6.305   2.500 -13.414
  224    H2*    G  21           H2*        G  21  -6.002   0.200 -13.800
  225   2HO*    G  21          2HO*        G  21  -6.299  -0.706 -15.739
  226    H1*    G  21           H1*        G  21  -3.795   0.289 -15.440
  227    H8     G  21           H8         G  21  -3.499   2.699 -12.530
  228    H1     G  21           H1         G  21  -1.959  -3.295 -10.995
  229   1H2     G  21          H21         G  21  -2.500  -4.665 -12.653
  230   2H2     G  21          H22         G  21  -3.238  -4.102 -14.135
  231   1H5*    U  22          2H5*        U  22  -8.432  -0.627 -15.384
  232   2H5*    U  22          1H5*        U  22 -10.000  -0.624 -14.553
  233    H4*    U  22           H4*        U  22  -8.423  -2.696 -14.283
  234    H3*    U  22           H3*        U  22 -10.052  -1.252 -12.207
  235    H2*    U  22           H2*        U  22  -8.839  -2.118 -10.447
  236   2HO*    U  22          2HO*        U  22  -8.484  -4.570 -11.843
  237    H1*    U  22           H1*        U  22  -6.757  -3.429 -12.079
  238    H3     U  22           H3         U  22  -4.604  -2.663  -8.158
  239    H5     U  22           H5         U  22  -5.432   1.184  -9.669
  240    H6     U  22           H6         U  22  -6.755   0.142 -11.416
  241   1H5*    G  23          2H5*        G  23 -12.690  -4.632  -9.672
  242   2H5*    G  23          1H5*        G  23 -11.128  -3.790  -9.669
  243    H4*    G  23           H4*        G  23 -11.290  -6.802  -9.944
  244    H3*    G  23           H3*        G  23 -11.603  -5.104  -7.464
  245    H2*    G  23           H2*        G  23 -10.036  -6.382  -6.279
  246   2HO*    G  23          2HO*        G  23 -11.231  -8.370  -7.224
  247    H1*    G  23           H1*        G  23  -8.349  -7.109  -8.378
  248    H8     G  23           H8         G  23  -8.584  -3.488  -8.740
  249    H1     G  23           H1         G  23  -5.341  -4.987  -3.459
  250   1H2     G  23          H21         G  23  -5.646  -7.126  -2.961
  251   2H2     G  23          H22         G  23  -6.648  -8.183  -3.930
  252   1H5*    U  24          2H5*        U  24 -14.217  -8.303  -4.011
  253   2H5*    U  24          1H5*        U  24 -13.565  -6.652  -3.954
  254    H4*    U  24           H4*        U  24 -12.224  -9.248  -3.165
  255    H3*    U  24           H3*        U  24 -12.940  -6.620  -1.844
  256    H2*    U  24           H2*        U  24 -10.961  -6.636  -0.587
  257   2HO*    U  24          2HO*        U  24  -9.958  -9.106  -1.035
  258    H1*    U  24           H1*        U  24  -9.288  -7.933  -2.415
  259    H3     U  24           H3         U  24  -7.843  -3.723  -1.099
  260    H5     U  24           H5         U  24 -10.180  -3.204  -4.569
  261    H6     U  24           H6         U  24 -10.884  -5.517  -4.362
  262   1H5*    C  25          2H5*        C  25 -12.291  -9.211   2.696
  263   2H5*    C  25          1H5*        C  25 -13.796  -8.311   2.977
  264    H4*    C  25           H4*        C  25 -11.522  -7.836   4.363
  265    H3*    C  25           H3*        C  25 -13.860  -6.116   3.578
  266    H2*    C  25           H2*        C  25 -12.686  -4.146   3.817
  267   2HO*    C  25          2HO*        C  25 -12.697  -4.370   6.069
  268    H1*    C  25           H1*        C  25 -10.031  -5.355   4.230
  269   1H4     C  25          H41         C  25  -9.080  -0.412   0.346
  270   2H4     C  25          H42         C  25  -9.991  -1.198  -0.922
  271    H5     C  25           H5         C  25 -11.141  -3.295  -0.616
  272    H6     C  25           H6         C  25 -11.658  -5.090   0.971
  273   1H5*    C  26          2H5*        C  26 -14.399  -4.493   9.077
  274   2H5*    C  26          1H5*        C  26 -14.310  -3.335   7.733
  275    H4*    C  26           H4*        C  26 -12.124  -4.017   9.733
  276    H3*    C  26           H3*        C  26 -14.158  -2.164   9.919
  277    H2*    C  26           H2*        C  26 -13.607  -0.933   8.000
  278   2HO*    C  26          2HO*        C  26 -13.472   0.632   9.574
  279    H1*    C  26           H1*        C  26 -10.662  -1.166   8.656
  280   1H4     C  26          H41         C  26 -10.577   1.544   2.887
  281   2H4     C  26          H42         C  26 -11.347   0.134   2.197
  282    H5     C  26           H5         C  26 -12.125  -1.725   3.517
  283    H6     C  26           H6         C  26 -12.326  -2.638   5.781
  284    H3T    C  26           H3T        C  26 -11.436  -1.948  10.765
  Start of MODEL   14
    1   1H5*    G   1          2H5*        G   1  -6.723  10.590   4.341
    2   2H5*    G   1          1H5*        G   1  -5.073  10.716   3.696
    3    H4*    G   1           H4*        G   1  -4.615   9.687   5.711
    4    H3*    G   1           H3*        G   1  -5.157   7.573   3.622
    5    H2*    G   1           H2*        G   1  -5.083   5.838   5.260
    6   2HO*    G   1          2HO*        G   1  -3.703   7.804   6.776
    7    H1*    G   1           H1*        G   1  -6.391   7.117   7.291
    8    H8     G   1           H8         G   1  -8.165   8.004   4.112
    9    H1     G   1           H1         G   1  -9.505   2.080   6.048
   10   1H2     G   1          H21         G   1  -8.125   1.485   7.678
   11   2H2     G   1          H22         G   1  -6.876   2.546   8.288
   12    H5T    G   1           H5T        G   1  -6.503   9.859   2.160
   13   1H5*    G   2          2H5*        G   2  -1.443   6.671   5.946
   14   2H5*    G   2          1H5*        G   2  -0.237   5.831   4.950
   15    H4*    G   2           H4*        G   2  -0.904   4.611   7.066
   16    H3*    G   2           H3*        G   2  -1.075   3.451   4.285
   17    H2*    G   2           H2*        G   2  -2.099   1.473   5.065
   18   2HO*    G   2          2HO*        G   2  -2.066   1.851   7.758
   19    H1*    G   2           H1*        G   2  -3.772   2.538   6.932
   20    H8     G   2           H8         G   2  -3.601   4.781   3.886
   21    H1     G   2           H1         G   2  -7.564  -0.159   3.144
   22   1H2     G   2          H21         G   2  -7.314  -1.590   4.821
   23   2H2     G   2          H22         G   2  -6.171  -1.326   6.119
   24   1H5*    A   3          2H5*        A   3  -1.162  -0.012   6.601
   25   2H5*    A   3          1H5*        A   3   0.466  -0.681   6.366
   26    H4*    A   3           H4*        A   3  -1.123  -2.432   5.881
   27    H3*    A   3           H3*        A   3   0.352  -1.199   3.561
   28    H2*    A   3           H2*        A   3  -1.133  -2.046   2.011
   29   2HO*    A   3          2HO*        A   3  -1.755  -4.422   3.292
   30    H1*    A   3           H1*        A   3  -3.033  -3.164   3.996
   31    H8     A   3           H8         A   3  -2.929   0.372   2.462
   32   1H6     A   3          H61         A   3  -7.550  -1.486  -1.154
   33   2H6     A   3          H62         A   3  -6.553  -0.128  -0.682
   34    H2     A   3           H2         A   3  -6.158  -5.020   1.253
   35   1H5*    C   4          2H5*        C   4   1.692  -5.677   0.972
   36   2H5*    C   4          1H5*        C   4   0.625  -4.259   0.947
   37    H4*    C   4           H4*        C   4  -0.438  -6.923   1.895
   38    H3*    C   4           H3*        C   4   0.140  -6.077  -0.963
   39    H2*    C   4           H2*        C   4  -1.948  -6.892  -1.646
   40   2HO*    C   4          2HO*        C   4  -1.495  -8.962  -0.533
   41    H1*    C   4           H1*        C   4  -3.358  -6.453   0.765
   42   1H4     C   4          H41         C   4  -5.440  -2.506  -3.833
   43   2H4     C   4          H42         C   4  -4.376  -1.276  -3.190
   44    H5     C   4           H5         C   4  -2.767  -1.701  -1.448
   45    H6     C   4           H6         C   4  -1.833  -3.393   0.057
   46   1H5*    A   5          2H5*        A   5  -0.362 -10.850  -2.318
   47   2H5*    A   5          1H5*        A   5   0.750 -10.380  -3.619
   48    H4*    A   5           H4*        A   5  -1.863 -11.054  -4.024
   49    H3*    A   5           H3*        A   5   0.038  -9.236  -5.536
   50    H2*    A   5           H2*        A   5  -1.702  -8.537  -6.939
   51   2HO*    A   5          2HO*        A   5  -3.183 -10.842  -6.118
   52    H1*    A   5           H1*        A   5  -3.840  -8.832  -5.110
   53    H8     A   5           H8         A   5  -1.199  -6.598  -3.699
   54   1H6     A   5          H61         A   5  -3.561  -2.003  -7.045
   55   2H6     A   5          H62         A   5  -2.444  -2.417  -5.765
   56    H2     A   5           H2         A   5  -5.448  -5.843  -8.421
   57   1H5*    C   6          2H5*        C   6  -2.341 -11.392  -8.323
   58   2H5*    C   6          1H5*        C   6  -1.257 -12.471  -9.225
   59    H4*    C   6           H4*        C   6  -2.653 -11.570 -10.897
   60    H3*    C   6           H3*        C   6  -0.030 -10.064 -10.677
   61    H2*    C   6           H2*        C   6  -0.719  -8.561 -12.348
   62   2HO*    C   6          2HO*        C   6  -2.590 -10.600 -13.050
   63    H1*    C   6           H1*        C   6  -3.448  -8.503 -11.748
   64   1H4     C   6          H41         C   6  -1.067  -3.002  -9.645
   65   2H4     C   6          H42         C   6  -0.186  -3.821  -8.374
   66    H5     C   6           H5         C   6  -0.152  -6.216  -8.123
   67    H6     C   6           H6         C   6  -0.956  -8.345  -9.034
   68   1H5*    G   7          2H5*        G   7   1.881  -9.355 -14.961
   69   2H5*    G   7          1H5*        G   7   1.660  -8.700 -13.325
   70    H4*    G   7           H4*        G   7  -0.063  -7.979 -15.732
   71    H3*    G   7           H3*        G   7   2.429  -6.719 -14.559
   72    H2*    G   7           H2*        G   7   1.473  -4.536 -14.773
   73   2HO*    G   7          2HO*        G   7  -0.501  -5.819 -16.405
   74    H1*    G   7           H1*        G   7  -1.032  -5.115 -13.900
   75    H8     G   7           H8         G   7   1.033  -7.235 -11.706
   76    H1     G   7           H1         G   7   1.826  -1.068 -10.296
   77   1H2     G   7          H21         G   7   0.964   0.197 -11.897
   78   2H2     G   7          H22         G   7   0.192  -0.475 -13.314
   79   1H5*    A   8          2H5*        A   8   3.362  -7.880 -19.534
   80   2H5*    A   8          1H5*        A   8   3.683  -6.426 -20.499
   81    H4*    A   8           H4*        A   8   1.195  -7.774 -20.118
   82    H3*    A   8           H3*        A   8   2.156  -5.286 -21.563
   83    H2*    A   8           H2*        A   8  -0.101  -4.565 -21.850
   84   2HO*    A   8          2HO*        A   8  -1.472  -6.676 -20.819
   85    H1*    A   8           H1*        A   8  -1.078  -5.345 -19.400
   86    H8     A   8           H8         A   8   1.741  -3.796 -17.992
   87   1H6     A   8          H61         A   8   0.035   1.749 -20.061
   88   2H6     A   8          H62         A   8   1.070   0.892 -18.940
   89    H2     A   8           H2         A   8  -2.299  -1.360 -22.317
   90   1H5*    A   9          2H5*        A   9   0.105  -5.962 -23.776
   91   2H5*    A   9          1H5*        A   9  -0.216  -7.088 -25.111
   92    H4*    A   9           H4*        A   9  -0.815  -5.307 -26.354
   93    H3*    A   9           H3*        A   9   2.166  -4.856 -26.070
   94    H2*    A   9           H2*        A   9   1.973  -2.666 -26.895
   95   2HO*    A   9          2HO*        A   9   0.597  -2.185 -28.448
   96    H1*    A   9           H1*        A   9  -0.527  -2.024 -25.846
   97    H8     A   9           H8         A   9   1.984  -3.613 -23.444
   98   1H6     A   9          H61         A   9   3.917   2.109 -22.238
   99   2H6     A   9          H62         A   9   4.051   0.425 -21.785
  100    H2     A   9           H2         A   9   0.988   2.313 -25.641
  101   1H5*    A  10          2H5*        A  10   3.227  -2.904 -30.984
  102   2H5*    A  10          1H5*        A  10   4.279  -3.827 -29.891
  103    H4*    A  10           H4*        A  10   3.161  -1.035 -29.512
  104    H3*    A  10           H3*        A  10   5.645  -1.994 -30.473
  105    H2*    A  10           H2*        A  10   6.496  -2.699 -28.382
  106   2HO*    A  10          2HO*        A  10   7.336  -0.627 -27.293
  107    H1*    A  10           H1*        A  10   4.981  -0.486 -26.980
  108    H8     A  10           H8         A  10   4.461  -4.195 -26.377
  109   1H6     A  10          H61         A  10   7.874  -3.557 -21.289
  110   2H6     A  10          H62         A  10   6.844  -4.640 -22.199
  111    H2     A  10           H2         A  10   8.103   0.283 -23.615
  112   1H5*    U  11          2H5*        U  11   9.327  -0.080 -31.617
  113   2H5*    U  11          1H5*        U  11   7.979  -1.236 -31.640
  114    H4*    U  11           H4*        U  11   9.401  -0.636 -29.047
  115    H3*    U  11           H3*        U  11  10.713  -1.771 -31.365
  116    H2*    U  11           H2*        U  11   9.974  -3.965 -31.034
  117   2HO*    U  11          2HO*        U  11  11.969  -3.415 -29.161
  118    H1*    U  11           H1*        U  11   9.477  -3.461 -28.097
  119    H3     U  11           H3         U  11   7.326  -7.344 -27.587
  120    H5     U  11           H5         U  11   6.514  -6.378 -31.609
  121    H6     U  11           H6         U  11   7.829  -4.358 -31.321
  122   1H5*    C  12          2H5*        C  12  12.505   1.268 -27.628
  123   2H5*    C  12          1H5*        C  12  12.543   0.233 -29.069
  124    H4*    C  12           H4*        C  12  14.814   0.611 -27.077
  125    H3*    C  12           H3*        C  12  14.068   2.313 -29.174
  126    H2*    C  12           H2*        C  12  14.524   0.789 -30.941
  127   2HO*    C  12          2HO*        C  12  16.016   2.468 -31.261
  128    H1*    C  12           H1*        C  12  16.890  -0.308 -29.406
  129   1H4     C  12          H41         C  12  16.584  -4.674 -34.001
  130   2H4     C  12          H42         C  12  14.837  -4.581 -34.058
  131    H5     C  12           H5         C  12  13.547  -3.098 -32.665
  132    H6     C  12           H6         C  12  13.655  -1.381 -30.918
  133   1H5*    C  13          2H5*        C  13  16.280   6.238 -29.414
  134   2H5*    C  13          1H5*        C  13  16.131   4.798 -30.441
  135    H4*    C  13           H4*        C  13  18.760   6.190 -29.805
  136    H3*    C  13           H3*        C  13  16.677   6.919 -31.712
  137    H2*    C  13           H2*        C  13  17.480   5.637 -33.475
  138   2HO*    C  13          2HO*        C  13  18.431   7.767 -33.864
  139    H1*    C  13           H1*        C  13  20.218   5.388 -32.230
  140   1H4     C  13          H41         C  13  20.310   0.743 -36.576
  141   2H4     C  13          H42         C  13  18.856   0.039 -35.905
  142    H5     C  13           H5         C  13  17.618   1.037 -34.097
  143    H6     C  13           H6         C  13  17.506   2.927 -32.540
  144   1H5*    C  14          2H5*        C  14  16.958   9.831 -29.105
  145   2H5*    C  14          1H5*        C  14  16.625   8.475 -30.199
  146    H4*    C  14           H4*        C  14  15.085  11.084 -30.359
  147    H3*    C  14           H3*        C  14  14.902   9.106 -28.210
  148    H2*    C  14           H2*        C  14  13.316   7.767 -29.273
  149   2HO*    C  14          2HO*        C  14  11.432   8.434 -28.568
  150    H1*    C  14           H1*        C  14  12.521  10.020 -31.123
  151   1H4     C  14          H41         C  14   9.941   5.129 -34.240
  152   2H4     C  14          H42         C  14  11.345   4.127 -33.946
  153    H5     C  14           H5         C  14  13.245   4.861 -32.660
  154    H6     C  14           H6         C  14  14.211   6.714 -31.378
  155   1H5*    G  15          2H5*        G  15  12.906  10.856 -24.718
  156   2H5*    G  15          1H5*        G  15  14.003   9.623 -24.068
  157    H4*    G  15           H4*        G  15  11.323   9.332 -25.282
  158    H3*    G  15           H3*        G  15  12.783   8.255 -23.023
  159    H2*    G  15           H2*        G  15  13.113   6.040 -23.609
  160   2HO*    G  15          2HO*        G  15  11.494   4.940 -24.922
  161    H1*    G  15           H1*        G  15  12.958   5.938 -26.314
  162    H8     G  15           H8         G  15  15.435   6.243 -27.277
  163    H1     G  15           H1         G  15  17.453   8.560 -21.690
  164   1H2     G  15          H21         G  15  15.715   8.982 -20.375
  165   2H2     G  15          H22         G  15  14.065   8.693 -20.878
  166   1H5*    A  16          2H5*        A  16   8.697   6.754 -23.374
  167   2H5*    A  16          1H5*        A  16   7.678   8.198 -23.203
  168    H4*    A  16           H4*        A  16   6.200   7.137 -21.721
  169    H3*    A  16           H3*        A  16   8.608   5.650 -20.878
  170    H2*    A  16           H2*        A  16   7.750   3.464 -20.995
  171   2HO*    A  16          2HO*        A  16   5.311   4.809 -20.579
  172    H1*    A  16           H1*        A  16   6.183   3.561 -23.155
  173    H8     A  16           H8         A  16   9.629   3.962 -21.852
  174   1H6     A  16          H61         A  16  11.866   3.234 -27.531
  175   2H6     A  16          H62         A  16  12.259   3.305 -25.828
  176    H2     A  16           H2         A  16   7.428   3.817 -27.879
  177   1H5*    A  17          2H5*        A  17   7.193   4.042 -18.777
  178   2H5*    A  17          1H5*        A  17   6.055   4.309 -17.440
  179    H4*    A  17           H4*        A  17   7.900   3.424 -15.891
  180    H3*    A  17           H3*        A  17   9.560   3.580 -18.075
  181    H2*    A  17           H2*        A  17   8.434   1.945 -19.409
  182   2HO*    A  17          2HO*        A  17   9.600  -0.073 -19.069
  183    H1*    A  17           H1*        A  17   8.054   0.171 -16.993
  184    H8     A  17           H8         A  17   5.943   1.809 -19.817
  185   1H6     A  17          H61         A  17   4.007  -3.908 -21.045
  186   2H6     A  17          H62         A  17   3.875  -2.222 -21.492
  187    H2     A  17           H2         A  17   6.934  -4.127 -17.641
  188   1H5*    G  18          2H5*        G  18  10.289   0.652 -13.478
  189   2H5*    G  18          1H5*        G  18   9.407   0.872 -15.003
  190    H4*    G  18           H4*        G  18   7.382   1.499 -13.785
  191    H3*    G  18           H3*        G  18   9.097   2.209 -11.671
  192    H2*    G  18           H2*        G  18   9.414  -0.010 -10.872
  193   2HO*    G  18          2HO*        G  18   6.893   0.828  -9.804
  194    H1*    G  18           H1*        G  18   6.527  -0.610 -11.599
  195    H8     G  18           H8         G  18   9.414  -1.915  -9.880
  196    H1     G  18           H1         G  18   6.731  -6.575 -13.303
  197   1H2     G  18          H21         G  18   5.323  -5.718 -14.786
  198   2H2     G  18          H22         G  18   5.044  -3.998 -14.930
  199   1H5*    U  19          2H5*        U  19   6.563   3.494 -14.159
  200   2H5*    U  19          1H5*        U  19   6.416   5.251 -13.963
  201    H4*    U  19           H4*        U  19   4.369   5.279 -14.927
  202    H3*    U  19           H3*        U  19   3.823   2.929 -13.084
  203    H2*    U  19           H2*        U  19   2.002   2.276 -14.418
  204   2HO*    U  19          2HO*        U  19   1.702   4.216 -16.219
  205    H1*    U  19           H1*        U  19   3.046   3.019 -16.900
  206    H3     U  19           H3         U  19   2.540  -1.422 -17.380
  207    H5     U  19           H5         U  19   5.422  -1.104 -14.320
  208    H6     U  19           H6         U  19   5.131   1.304 -14.389
  209   1H5*    A  20          2H5*        A  20   0.331   7.455 -15.021
  210   2H5*    A  20          1H5*        A  20  -0.869   7.042 -13.780
  211    H4*    A  20           H4*        A  20  -1.324   6.713 -16.424
  212    H3*    A  20           H3*        A  20  -2.295   5.154 -14.010
  213    H2*    A  20           H2*        A  20  -3.342   3.583 -15.410
  214   2HO*    A  20          2HO*        A  20  -3.628   4.148 -17.727
  215    H1*    A  20           H1*        A  20  -1.527   3.653 -17.540
  216    H8     A  20           H8         A  20  -0.127   3.196 -14.008
  217   1H6     A  20          H61         A  20  -0.758  -2.863 -14.938
  218   2H6     A  20          H62         A  20  -0.136  -1.636 -13.857
  219    H2     A  20           H2         A  20  -2.638  -0.716 -18.407
  220   1H5*    G  21          2H5*        G  21  -5.463   4.769 -16.847
  221   2H5*    G  21          1H5*        G  21  -6.938   4.805 -15.860
  222    H4*    G  21           H4*        G  21  -6.358   2.584 -17.047
  223    H3*    G  21           H3*        G  21  -7.045   2.924 -14.117
  224    H2*    G  21           H2*        G  21  -6.573   0.694 -13.677
  225   2HO*    G  21          2HO*        G  21  -8.160   0.154 -15.434
  226    H1*    G  21           H1*        G  21  -4.847   0.181 -15.907
  227    H8     G  21           H8         G  21  -3.577   2.702 -13.412
  228    H1     G  21           H1         G  21  -2.544  -3.317 -11.581
  229   1H2     G  21          H21         G  21  -3.645  -4.712 -12.909
  230   2H2     G  21          H22         G  21  -4.631  -4.159 -14.243
  231   1H5*    U  22          2H5*        U  22 -11.292  -0.059 -13.645
  232   2H5*    U  22          1H5*        U  22 -10.168   0.336 -12.330
  233    H4*    U  22           H4*        U  22 -10.431  -2.232 -13.902
  234    H3*    U  22           H3*        U  22 -10.485  -1.380 -10.995
  235    H2*    U  22           H2*        U  22  -9.455  -3.385 -10.337
  236   2HO*    U  22          2HO*        U  22 -11.009  -4.612 -11.711
  237    H1*    U  22           H1*        U  22  -7.832  -3.786 -12.573
  238    H3     U  22           H3         U  22  -5.370  -3.457  -8.696
  239    H5     U  22           H5         U  22  -5.953   0.492 -10.051
  240    H6     U  22           H6         U  22  -7.529  -0.371 -11.681
  241   1H5*    G  23          2H5*        G  23 -12.504  -5.914 -11.051
  242   2H5*    G  23          1H5*        G  23 -13.809  -5.393  -9.966
  243    H4*    G  23           H4*        G  23 -12.492  -7.453  -9.224
  244    H3*    G  23           H3*        G  23 -12.912  -4.973  -7.535
  245    H2*    G  23           H2*        G  23 -11.611  -5.879  -5.798
  246   2HO*    G  23          2HO*        G  23 -12.520  -8.268  -6.895
  247    H1*    G  23           H1*        G  23  -9.758  -7.278  -7.336
  248    H8     G  23           H8         G  23 -10.443  -3.678  -8.396
  249    H1     G  23           H1         G  23  -6.027  -4.206  -3.828
  250   1H2     G  23          H21         G  23  -5.942  -6.296  -3.093
  251   2H2     G  23          H22         G  23  -6.973  -7.559  -3.728
  252   1H5*    U  24          2H5*        U  24 -14.793  -7.611  -3.328
  253   2H5*    U  24          1H5*        U  24 -14.172  -5.954  -3.193
  254    H4*    U  24           H4*        U  24 -12.761  -8.567  -2.646
  255    H3*    U  24           H3*        U  24 -13.324  -5.982  -1.174
  256    H2*    U  24           H2*        U  24 -11.242  -6.068  -0.097
  257   2HO*    U  24          2HO*        U  24 -10.137  -7.985   0.244
  258    H1*    U  24           H1*        U  24  -9.752  -7.298  -2.115
  259    H3     U  24           H3         U  24  -8.018  -3.202  -0.936
  260    H5     U  24           H5         U  24 -10.979  -2.427  -3.835
  261    H6     U  24           H6         U  24 -11.668  -4.747  -3.656
  262   1H5*    C  25          2H5*        C  25 -11.569  -7.990   1.615
  263   2H5*    C  25          1H5*        C  25 -12.674  -8.434   2.931
  264    H4*    C  25           H4*        C  25 -10.785  -7.443   3.997
  265    H3*    C  25           H3*        C  25 -13.234  -5.708   3.788
  266    H2*    C  25           H2*        C  25 -12.073  -3.761   4.212
  267   2HO*    C  25          2HO*        C  25 -10.070  -4.506   5.833
  268    H1*    C  25           H1*        C  25  -9.369  -4.928   4.105
  269   1H4     C  25          H41         C  25  -8.871   0.571   0.962
  270   2H4     C  25          H42         C  25 -10.067   0.056  -0.207
  271    H5     C  25           H5         C  25 -11.258  -2.031  -0.045
  272    H6     C  25           H6         C  25 -11.557  -4.079   1.269
  273   1H5*    C  26          2H5*        C  26 -11.529  -6.431   8.675
  274   2H5*    C  26          1H5*        C  26 -12.762  -5.440   9.483
  275    H4*    C  26           H4*        C  26 -10.203  -5.025   9.971
  276    H3*    C  26           H3*        C  26 -12.370  -2.973   9.470
  277    H2*    C  26           H2*        C  26 -10.823  -1.232   9.762
  278   2HO*    C  26          2HO*        C  26  -8.715  -1.638  10.616
  279    H1*    C  26           H1*        C  26  -8.728  -2.402   8.412
  280   1H4     C  26          H41         C  26 -11.691   1.557   4.381
  281   2H4     C  26          H42         C  26 -12.818   0.287   3.957
  282    H5     C  26           H5         C  26 -12.860  -1.860   5.052
  283    H6     C  26           H6         C  26 -11.828  -3.252   6.788
  284    H3T    C  26           H3T        C  26 -11.701  -2.692  11.815
  Start of MODEL   15
    1   1H5*    G   1          2H5*        G   1  -6.361  11.283   3.621
    2   2H5*    G   1          1H5*        G   1  -4.671  10.750   3.515
    3    H4*    G   1           H4*        G   1  -5.639  10.549   5.820
    4    H3*    G   1           H3*        G   1  -3.938   8.778   4.562
    5    H2*    G   1           H2*        G   1  -5.645   7.236   3.836
    6   2HO*    G   1          2HO*        G   1  -5.831   5.741   5.894
    7    H1*    G   1           H1*        G   1  -7.053   7.546   6.495
    8    H8     G   1           H8         G   1  -8.739   8.505   3.282
    9    H1     G   1           H1         G   1  -9.969   2.476   4.951
   10   1H2     G   1          H21         G   1  -8.637   1.863   6.616
   11   2H2     G   1          H22         G   1  -7.448   2.940   7.313
   12    H5T    G   1           H5T        G   1  -5.772   9.875   1.808
   13   1H5*    G   2          2H5*        G   2  -1.220   5.760   6.380
   14   2H5*    G   2          1H5*        G   2  -2.168   6.299   4.978
   15    H4*    G   2           H4*        G   2  -2.596   3.774   6.619
   16    H3*    G   2           H3*        G   2  -1.336   4.399   3.974
   17    H2*    G   2           H2*        G   2  -2.876   3.165   2.783
   18   2HO*    G   2          2HO*        G   2  -1.951   1.240   3.070
   19    H1*    G   2           H1*        G   2  -4.361   2.255   5.221
   20    H8     G   2           H8         G   2  -5.027   5.065   2.653
   21    H1     G   2           H1         G   2  -8.893   0.019   2.147
   22   1H2     G   2          H21         G   2  -8.268  -1.560   3.572
   23   2H2     G   2          H22         G   2  -6.900  -1.368   4.645
   24   1H5*    A   3          2H5*        A   3  -2.162   0.748   5.663
   25   2H5*    A   3          1H5*        A   3  -0.727   0.041   6.431
   26    H4*    A   3           H4*        A   3  -1.707  -1.976   6.194
   27    H3*    A   3           H3*        A   3  -1.117  -1.276   3.304
   28    H2*    A   3           H2*        A   3  -2.458  -3.051   2.559
   29   2HO*    A   3          2HO*        A   3  -1.784  -4.132   5.070
   30    H1*    A   3           H1*        A   3  -4.353  -3.046   4.631
   31    H8     A   3           H8         A   3  -3.697   0.304   2.950
   32   1H6     A   3          H61         A   3  -8.032  -1.254  -1.136
   33   2H6     A   3          H62         A   3  -6.986   0.030  -0.573
   34    H2     A   3           H2         A   3  -7.205  -4.835   1.453
   35   1H5*    C   4          2H5*        C   4  -0.769  -5.434   4.162
   36   2H5*    C   4          1H5*        C   4   0.407  -6.290   3.143
   37    H4*    C   4           H4*        C   4  -2.133  -6.959   3.030
   38    H3*    C   4           H3*        C   4  -0.134  -6.627   0.798
   39    H2*    C   4           H2*        C   4  -1.769  -6.563  -0.832
   40   2HO*    C   4          2HO*        C   4  -2.470  -8.790   0.523
   41    H1*    C   4           H1*        C   4  -4.075  -6.291   0.960
   42   1H4     C   4          H41         C   4  -4.880  -2.090  -3.762
   43   2H4     C   4          H42         C   4  -3.609  -1.087  -3.102
   44    H5     C   4           H5         C   4  -2.260  -1.738  -1.214
   45    H6     C   4           H6         C   4  -1.837  -3.492   0.444
   46   1H5*    A   5          2H5*        A   5   0.517 -10.429  -1.868
   47   2H5*    A   5          1H5*        A   5   0.395  -8.730  -2.369
   48    H4*    A   5           H4*        A   5  -1.416 -11.051  -3.049
   49    H3*    A   5           H3*        A   5   0.184  -8.955  -4.540
   50    H2*    A   5           H2*        A   5  -1.448  -8.839  -6.235
   51   2HO*    A   5          2HO*        A   5  -3.008 -10.480  -6.518
   52    H1*    A   5           H1*        A   5  -3.707  -9.126  -4.673
   53    H8     A   5           H8         A   5  -1.348  -6.720  -3.008
   54   1H6     A   5          H61         A   5  -3.483  -2.354  -6.786
   55   2H6     A   5          H62         A   5  -2.504  -2.675  -5.373
   56    H2     A   5           H2         A   5  -5.055  -6.317  -8.208
   57   1H5*    C   6          2H5*        C   6  -1.329 -11.990  -7.755
   58   2H5*    C   6          1H5*        C   6   0.275 -12.502  -8.321
   59    H4*    C   6           H4*        C   6  -1.132 -11.976 -10.244
   60    H3*    C   6           H3*        C   6   1.158 -10.101  -9.598
   61    H2*    C   6           H2*        C   6   0.575  -8.694 -11.388
   62   2HO*    C   6          2HO*        C   6  -1.339 -10.361 -12.541
   63    H1*    C   6           H1*        C   6  -2.191  -8.994 -11.283
   64   1H4     C   6          H41         C   6  -0.952  -3.313  -8.720
   65   2H4     C   6          H42         C   6  -0.257  -4.062  -7.300
   66    H5     C   6           H5         C   6   0.015  -6.444  -7.063
   67    H6     C   6           H6         C   6  -0.322  -8.622  -8.136
   68   1H5*    G   7          2H5*        G   7   1.309 -10.731 -14.391
   69   2H5*    G   7          1H5*        G   7   2.960 -10.100 -14.553
   70    H4*    G   7           H4*        G   7   0.686  -8.792 -15.389
   71    H3*    G   7           H3*        G   7   3.507  -7.957 -14.724
   72    H2*    G   7           H2*        G   7   2.926  -5.644 -14.700
   73   2HO*    G   7          2HO*        G   7   0.352  -5.612 -15.441
   74    H1*    G   7           H1*        G   7   0.504  -5.806 -13.466
   75    H8     G   7           H8         G   7   2.746  -8.294 -11.782
   76    H1     G   7           H1         G   7   4.035  -2.302 -10.020
   77   1H2     G   7          H21         G   7   2.969  -0.877 -11.342
   78   2H2     G   7          H22         G   7   1.940  -1.401 -12.656
   79   1H5*    A   8          2H5*        A   8   3.879  -7.039 -20.113
   80   2H5*    A   8          1H5*        A   8   3.597  -5.302 -19.875
   81    H4*    A   8           H4*        A   8   1.670  -7.607 -19.565
   82    H3*    A   8           H3*        A   8   1.852  -5.050 -21.153
   83    H2*    A   8           H2*        A   8  -0.464  -4.572 -20.863
   84   2HO*    A   8          2HO*        A   8  -0.825  -7.204 -19.805
   85    H1*    A   8           H1*        A   8  -0.761  -5.327 -18.270
   86    H8     A   8           H8         A   8   2.315  -3.709 -17.627
   87   1H6     A   8          H61         A   8  -0.012   1.781 -19.166
   88   2H6     A   8          H62         A   8   1.305   0.955 -18.364
   89    H2     A   8           H2         A   8  -2.794  -1.394 -20.711
   90   1H5*    A   9          2H5*        A   9  -0.897  -5.933 -22.907
   91   2H5*    A   9          1H5*        A   9  -0.861  -6.703 -24.507
   92    H4*    A   9           H4*        A   9  -2.254  -4.878 -24.907
   93    H3*    A   9           H3*        A   9   0.620  -4.172 -25.548
   94    H2*    A   9           H2*        A   9   0.027  -1.941 -26.011
   95   2HO*    A   9          2HO*        A   9  -2.740  -2.308 -25.872
   96    H1*    A   9           H1*        A   9  -1.939  -1.611 -24.087
   97    H8     A   9           H8         A   9   0.987  -3.275 -22.465
   98   1H6     A   9          H61         A   9   3.715   2.235 -22.130
   99   2H6     A   9          H62         A   9   3.784   0.566 -21.610
  100    H2     A   9           H2         A   9   0.092   2.633 -24.761
  101   1H5*    A  10          2H5*        A  10  -1.019  -1.629 -30.327
  102   2H5*    A  10          1H5*        A  10   0.591  -2.062 -29.714
  103    H4*    A  10           H4*        A  10  -1.278   0.094 -28.676
  104    H3*    A  10           H3*        A  10   0.681   0.253 -30.627
  105    H2*    A  10           H2*        A  10   2.534  -0.329 -29.254
  106   2HO*    A  10          2HO*        A  10   2.572   2.226 -28.194
  107    H1*    A  10           H1*        A  10   1.399   1.217 -26.923
  108    H8     A  10           H8         A  10   2.308  -2.507 -27.440
  109   1H6     A  10          H61         A  10   6.800  -1.554 -23.340
  110   2H6     A  10          H62         A  10   5.988  -2.748 -24.328
  111    H2     A  10           H2         A  10   4.779   2.382 -24.129
  112   1H5*    U  11          2H5*        U  11  -0.209   3.935 -33.091
  113   2H5*    U  11          1H5*        U  11   1.193   2.846 -33.131
  114    H4*    U  11           H4*        U  11   0.350   4.581 -30.778
  115    H3*    U  11           H3*        U  11   2.033   5.114 -33.115
  116    H2*    U  11           H2*        U  11   4.050   4.562 -32.119
  117   2HO*    U  11          2HO*        U  11   4.548   6.065 -30.251
  118    H1*    U  11           H1*        U  11   2.919   4.627 -29.334
  119    H3     U  11           H3         U  11   6.989   2.987 -28.247
  120    H5     U  11           H5         U  11   5.553   0.276 -31.138
  121    H6     U  11           H6         U  11   3.647   1.740 -31.469
  122   1H5*    C  12          2H5*        C  12   2.485   9.519 -29.824
  123   2H5*    C  12          1H5*        C  12   2.991   8.621 -31.269
  124    H4*    C  12           H4*        C  12   4.636   9.061 -28.748
  125    H3*    C  12           H3*        C  12   4.295  10.782 -30.952
  126    H2*    C  12           H2*        C  12   5.409   9.390 -32.529
  127   2HO*    C  12          2HO*        C  12   7.002  10.743 -32.836
  128    H1*    C  12           H1*        C  12   7.313   8.496 -30.348
  129   1H4     C  12          H41         C  12   9.064   4.291 -34.762
  130   2H4     C  12          H42         C  12   7.488   4.332 -35.522
  131    H5     C  12           H5         C  12   5.672   5.695 -34.718
  132    H6     C  12           H6         C  12   4.972   7.311 -33.016
  133   1H5*    C  13          2H5*        C  13   9.381  12.870 -31.114
  134   2H5*    C  13          1H5*        C  13   7.975  12.036 -31.801
  135    H4*    C  13           H4*        C  13   8.856  10.192 -29.958
  136    H3*    C  13           H3*        C  13  11.177  11.919 -30.541
  137    H2*    C  13           H2*        C  13  12.052  10.557 -32.205
  138   2HO*    C  13          2HO*        C  13  13.084   8.768 -31.432
  139    H1*    C  13           H1*        C  13  10.266   8.243 -31.495
  140   1H4     C  13          H41         C  13  12.357   7.176 -37.464
  141   2H4     C  13          H42         C  13  10.935   8.028 -38.023
  142    H5     C  13           H5         C  13   9.444   9.217 -36.552
  143    H6     C  13           H6         C  13   8.994   9.845 -34.227
  144   1H5*    C  14          2H5*        C  14  14.418   9.449 -28.832
  145   2H5*    C  14          1H5*        C  14  12.717   9.162 -29.242
  146    H4*    C  14           H4*        C  14  13.132   8.148 -26.602
  147    H3*    C  14           H3*        C  14  15.625   8.055 -27.760
  148    H2*    C  14           H2*        C  14  14.975   6.829 -29.711
  149   2HO*    C  14          2HO*        C  14  16.335   5.524 -27.914
  150    H1*    C  14           H1*        C  14  13.239   5.031 -28.013
  151   1H4     C  14          H41         C  14  12.105   3.440 -34.136
  152   2H4     C  14          H42         C  14  10.867   4.677 -34.143
  153    H5     C  14           H5         C  14  10.539   6.226 -32.325
  154    H6     C  14           H6         C  14  11.315   6.920 -30.115
  155   1H5*    G  15          2H5*        G  15  14.120   9.313 -24.648
  156   2H5*    G  15          1H5*        G  15  13.851   8.971 -22.927
  157    H4*    G  15           H4*        G  15  11.794   9.275 -24.537
  158    H3*    G  15           H3*        G  15  12.242   7.595 -22.164
  159    H2*    G  15           H2*        G  15  10.843   5.801 -22.667
  160   2HO*    G  15          2HO*        G  15   9.301   7.811 -23.611
  161    H1*    G  15           H1*        G  15  10.938   5.639 -25.362
  162    H8     G  15           H8         G  15  13.038   4.106 -26.043
  163    H1     G  15           H1         G  15  15.446   4.620 -20.163
  164   1H2     G  15          H21         G  15  14.358   6.186 -19.032
  165   2H2     G  15          H22         G  15  13.039   7.102 -19.727
  166   1H5*    A  16          2H5*        A  16   8.668   7.290 -21.995
  167   2H5*    A  16          1H5*        A  16   7.881   8.834 -22.377
  168    H4*    A  16           H4*        A  16   6.474   8.394 -20.229
  169    H3*    A  16           H3*        A  16   8.068   5.916 -20.381
  170    H2*    A  16           H2*        A  16   6.334   4.380 -20.757
  171   2HO*    A  16          2HO*        A  16   4.045   5.446 -20.396
  172    H1*    A  16           H1*        A  16   4.643   5.745 -22.321
  173    H8     A  16           H8         A  16   8.085   4.386 -21.968
  174   1H6     A  16          H61         A  16   8.722   4.470 -28.082
  175   2H6     A  16          H62         A  16   9.402   3.906 -26.571
  176    H2     A  16           H2         A  16   5.015   6.790 -27.068
  177   1H5*    A  17          2H5*        A  17   9.526   4.340 -18.918
  178   2H5*    A  17          1H5*        A  17   7.922   3.727 -19.370
  179    H4*    A  17           H4*        A  17   9.392   2.614 -16.970
  180    H3*    A  17           H3*        A  17  10.513   2.475 -19.533
  181    H2*    A  17           H2*        A  17   8.765   1.191 -20.517
  182   2HO*    A  17          2HO*        A  17   9.442  -1.180 -19.732
  183    H1*    A  17           H1*        A  17   8.447  -0.337 -17.920
  184    H8     A  17           H8         A  17   6.134   1.660 -20.315
  185   1H6     A  17          H61         A  17   3.002  -3.606 -20.948
  186   2H6     A  17          H62         A  17   3.067  -1.914 -21.390
  187    H2     A  17           H2         A  17   6.542  -4.400 -18.298
  188   1H5*    G  18          2H5*        G  18  11.618   2.307 -13.863
  189   2H5*    G  18          1H5*        G  18  12.056   0.854 -14.783
  190    H4*    G  18           H4*        G  18   9.176   1.557 -14.879
  191    H3*    G  18           H3*        G  18  10.500   1.421 -12.251
  192    H2*    G  18           H2*        G  18  10.139  -0.856 -11.952
  193   2HO*    G  18          2HO*        G  18   7.702  -1.290 -11.813
  194    H1*    G  18           H1*        G  18   8.035  -0.923 -14.117
  195    H8     G  18           H8         G  18  11.288  -2.542 -12.760
  196    H1     G  18           H1         G  18   7.118  -6.637 -15.308
  197   1H2     G  18          H21         G  18   5.390  -5.533 -16.154
  198   2H2     G  18          H22         G  18   5.267  -3.789 -16.090
  199   1H5*    U  19          2H5*        U  19   8.304   3.648 -14.828
  200   2H5*    U  19          1H5*        U  19   8.176   5.385 -14.480
  201    H4*    U  19           H4*        U  19   6.286   5.409 -15.709
  202    H3*    U  19           H3*        U  19   5.415   3.787 -13.310
  203    H2*    U  19           H2*        U  19   3.625   2.872 -14.458
  204   2HO*    U  19          2HO*        U  19   3.488   5.493 -15.434
  205    H1*    U  19           H1*        U  19   4.493   3.594 -17.149
  206    H3     U  19           H3         U  19   2.427  -0.438 -17.579
  207    H5     U  19           H5         U  19   6.019  -1.281 -15.542
  208    H6     U  19           H6         U  19   6.389   1.109 -15.340
  209   1H5*    A  20          2H5*        A  20   0.516   6.235 -12.660
  210   2H5*    A  20          1H5*        A  20   1.124   4.569 -12.742
  211    H4*    A  20           H4*        A  20  -0.213   6.119 -14.995
  212    H3*    A  20           H3*        A  20  -1.132   4.026 -13.026
  213    H2*    A  20           H2*        A  20  -2.242   2.789 -14.695
  214   2HO*    A  20          2HO*        A  20  -1.980   4.373 -16.879
  215    H1*    A  20           H1*        A  20  -0.457   3.094 -16.752
  216    H8     A  20           H8         A  20   1.353   2.506 -13.480
  217   1H6     A  20          H61         A  20   0.510  -3.519 -14.420
  218   2H6     A  20          H62         A  20   1.316  -2.319 -13.434
  219    H2     A  20           H2         A  20  -1.900  -1.279 -17.484
  220   1H5*    G  21          2H5*        G  21  -6.552   4.168 -14.187
  221   2H5*    G  21          1H5*        G  21  -5.498   3.446 -12.954
  222    H4*    G  21           H4*        G  21  -5.703   2.731 -15.896
  223    H3*    G  21           H3*        G  21  -6.355   1.404 -13.265
  224    H2*    G  21           H2*        G  21  -5.514  -0.675 -13.992
  225   2HO*    G  21          2HO*        G  21  -6.416   0.210 -16.368
  226    H1*    G  21           H1*        G  21  -3.350   0.188 -15.431
  227    H8     G  21           H8         G  21  -3.075   2.306 -12.473
  228    H1     G  21           H1         G  21  -1.994  -3.787 -10.941
  229   1H2     G  21          H21         G  21  -2.654  -5.112 -12.592
  230   2H2     G  21          H22         G  21  -3.359  -4.495 -14.068
  231   1H5*    U  22          2H5*        U  22  -9.079  -1.151 -15.353
  232   2H5*    U  22          1H5*        U  22 -10.525  -1.188 -14.322
  233    H4*    U  22           H4*        U  22  -9.062  -3.331 -14.449
  234    H3*    U  22           H3*        U  22 -10.095  -1.985 -11.940
  235    H2*    U  22           H2*        U  22  -8.889  -3.442 -10.587
  236   2HO*    U  22          2HO*        U  22  -9.984  -5.271 -11.581
  237    H1*    U  22           H1*        U  22  -6.911  -4.240 -12.521
  238    H3     U  22           H3         U  22  -4.923  -3.483  -8.448
  239    H5     U  22           H5         U  22  -5.493   0.320 -10.176
  240    H6     U  22           H6         U  22  -6.830  -0.737 -11.903
  241   1H5*    G  23          2H5*        G  23 -12.451  -6.222 -11.052
  242   2H5*    G  23          1H5*        G  23 -13.671  -5.288 -10.163
  243    H4*    G  23           H4*        G  23 -12.160  -7.078  -8.912
  244    H3*    G  23           H3*        G  23 -13.100  -4.350  -8.007
  245    H2*    G  23           H2*        G  23 -11.678  -4.365  -6.181
  246   2HO*    G  23          2HO*        G  23 -12.757  -6.798  -5.947
  247    H1*    G  23           H1*        G  23  -9.913  -6.495  -7.075
  248    H8     G  23           H8         G  23  -9.909  -3.027  -8.674
  249    H1     G  23           H1         G  23  -5.852  -3.612  -3.791
  250   1H2     G  23          H21         G  23  -6.157  -5.560  -2.779
  251   2H2     G  23          H22         G  23  -7.361  -6.714  -3.308
  252   1H5*    U  24          2H5*        U  24 -13.933  -8.220  -5.057
  253   2H5*    U  24          1H5*        U  24 -15.098  -7.589  -3.875
  254    H4*    U  24           H4*        U  24 -12.935  -8.760  -3.000
  255    H3*    U  24           H3*        U  24 -14.101  -6.124  -2.056
  256    H2*    U  24           H2*        U  24 -12.306  -5.811  -0.588
  257   2HO*    U  24          2HO*        U  24 -11.067  -8.216  -0.588
  258    H1*    U  24           H1*        U  24 -10.330  -7.219  -2.045
  259    H3     U  24           H3         U  24  -8.733  -3.053  -1.094
  260    H5     U  24           H5         U  24 -11.393  -2.499  -4.317
  261    H6     U  24           H6         U  24 -12.087  -4.810  -4.056
  262   1H5*    C  25          2H5*        C  25 -13.045  -8.553   1.527
  263   2H5*    C  25          1H5*        C  25 -14.208  -8.117   2.795
  264    H4*    C  25           H4*        C  25 -11.641  -7.651   3.155
  265    H3*    C  25           H3*        C  25 -14.046  -6.012   3.882
  266    H2*    C  25           H2*        C  25 -12.875  -4.027   3.934
  267   2HO*    C  25          2HO*        C  25 -11.215  -5.652   5.522
  268    H1*    C  25           H1*        C  25 -10.269  -5.192   3.104
  269   1H4     C  25          H41         C  25 -10.393   0.597   0.462
  270   2H4     C  25          H42         C  25 -11.777   0.154  -0.512
  271    H5     C  25           H5         C  25 -12.905  -1.967  -0.314
  272    H6     C  25           H6         C  25 -12.949  -4.119   0.859
  273   1H5*    C  26          2H5*        C  26 -11.771  -5.684   9.312
  274   2H5*    C  26          1H5*        C  26 -12.292  -4.317   8.305
  275    H4*    C  26           H4*        C  26  -9.432  -5.280   8.699
  276    H3*    C  26           H3*        C  26 -10.923  -3.694  10.387
  277    H2*    C  26           H2*        C  26 -11.422  -2.005   8.837
  278   2HO*    C  26          2HO*        C  26  -9.553  -1.402  10.585
  279    H1*    C  26           H1*        C  26  -8.609  -2.138   7.729
  280   1H4     C  26          H41         C  26 -11.521   1.828   3.674
  281   2H4     C  26          H42         C  26 -12.599   0.545   3.174
  282    H5     C  26           H5         C  26 -12.624  -1.634   4.201
  283    H6     C  26           H6         C  26 -11.623  -3.053   5.931
  284    H3T    C  26           H3T        C  26  -8.982  -3.883  11.216
  Start of MODEL   16
    1   1H5*    G   1          2H5*        G   1  -6.382  10.285   3.655
    2   2H5*    G   1          1H5*        G   1  -5.032  11.425   3.829
    3    H4*    G   1           H4*        G   1  -4.725  10.681   5.928
    4    H3*    G   1           H3*        G   1  -3.334   8.839   4.455
    5    H2*    G   1           H2*        G   1  -5.138   7.261   4.185
    6   2HO*    G   1          2HO*        G   1  -4.674   6.140   6.619
    7    H1*    G   1           H1*        G   1  -5.958   7.633   7.066
    8    H8     G   1           H8         G   1  -8.345   8.656   4.407
    9    H1     G   1           H1         G   1  -8.998   2.494   5.907
   10   1H2     G   1          H21         G   1  -7.288   1.833   7.155
   11   2H2     G   1          H22         G   1  -5.989   2.910   7.616
   12    H5T    G   1           H5T        G   1  -4.991   9.776   2.061
   13   1H5*    G   2          2H5*        G   2  -0.315   5.746   5.971
   14   2H5*    G   2          1H5*        G   2  -1.381   6.309   4.668
   15    H4*    G   2           H4*        G   2  -1.774   3.860   6.429
   16    H3*    G   2           H3*        G   2  -0.804   4.332   3.634
   17    H2*    G   2           H2*        G   2  -2.547   3.167   2.677
   18   2HO*    G   2          2HO*        G   2  -1.396   1.264   3.169
   19    H1*    G   2           H1*        G   2  -3.793   2.431   5.297
   20    H8     G   2           H8         G   2  -4.689   5.312   2.915
   21    H1     G   2           H1         G   2  -8.579   0.275   2.511
   22   1H2     G   2          H21         G   2  -7.806  -1.381   3.764
   23   2H2     G   2          H22         G   2  -6.334  -1.245   4.697
   24   1H5*    A   3          2H5*        A   3  -1.427   0.455   5.356
   25   2H5*    A   3          1H5*        A   3   0.126  -0.368   5.611
   26    H4*    A   3           H4*        A   3  -1.179  -2.231   5.291
   27    H3*    A   3           H3*        A   3  -0.395  -1.240   2.535
   28    H2*    A   3           H2*        A   3  -1.801  -2.811   1.528
   29   2HO*    A   3          2HO*        A   3  -1.722  -4.804   2.218
   30    H1*    A   3           H1*        A   3  -3.700  -3.067   3.624
   31    H8     A   3           H8         A   3  -2.899   0.295   1.931
   32   1H6     A   3          H61         A   3  -7.733  -0.846  -1.709
   33   2H6     A   3          H62         A   3  -6.511   0.328  -1.272
   34    H2     A   3           H2         A   3  -7.046  -4.463   0.870
   35   1H5*    C   4          2H5*        C   4  -0.250  -5.569   3.127
   36   2H5*    C   4          1H5*        C   4   1.142  -6.301   2.304
   37    H4*    C   4           H4*        C   4  -1.058  -7.408   1.773
   38    H3*    C   4           H3*        C   4   0.757  -6.200  -0.310
   39    H2*    C   4           H2*        C   4  -0.872  -6.270  -1.943
   40   2HO*    C   4          2HO*        C   4  -0.677  -8.671  -1.665
   41    H1*    C   4           H1*        C   4  -3.120  -6.956  -0.177
   42   1H4     C   4          H41         C   4  -5.339  -2.431  -4.049
   43   2H4     C   4          H42         C   4  -4.171  -1.282  -3.436
   44    H5     C   4           H5         C   4  -2.467  -1.859  -1.832
   45    H6     C   4           H6         C   4  -1.515  -3.664  -0.473
   46   1H5*    A   5          2H5*        A   5   1.232 -10.627  -3.497
   47   2H5*    A   5          1H5*        A   5   1.062  -8.903  -3.884
   48    H4*    A   5           H4*        A   5  -1.029 -11.092  -4.068
   49    H3*    A   5           H3*        A   5   0.355  -9.187  -5.973
   50    H2*    A   5           H2*        A   5  -1.620  -8.885  -7.203
   51   2HO*    A   5          2HO*        A   5  -3.418 -10.566  -6.481
   52    H1*    A   5           H1*        A   5  -3.474  -9.142  -5.123
   53    H8     A   5           H8         A   5  -0.892  -6.660  -4.101
   54   1H6     A   5          H61         A   5  -3.808  -2.470  -7.549
   55   2H6     A   5          H62         A   5  -2.574  -2.719  -6.335
   56    H2     A   5           H2         A   5  -5.516  -6.511  -8.523
   57   1H5*    C   6          2H5*        C   6  -1.538 -11.147  -8.408
   58   2H5*    C   6          1H5*        C   6  -0.707 -12.530  -9.152
   59    H4*    C   6           H4*        C   6  -1.577 -11.758 -11.099
   60    H3*    C   6           H3*        C   6   0.739  -9.891 -10.542
   61    H2*    C   6           H2*        C   6   0.075  -8.448 -12.273
   62   2HO*    C   6          2HO*        C   6  -0.187 -10.338 -13.737
   63    H1*    C   6           H1*        C   6  -2.684  -8.748 -12.062
   64   1H4     C   6          H41         C   6  -1.443  -3.134  -9.368
   65   2H4     C   6          H42         C   6  -0.542  -3.901  -8.079
   66    H5     C   6           H5         C   6  -0.141  -6.270  -7.974
   67    H6     C   6           H6         C   6  -0.511  -8.421  -9.086
   68   1H5*    G   7          2H5*        G   7   1.480 -10.163 -15.163
   69   2H5*    G   7          1H5*        G   7   3.038  -9.329 -14.995
   70    H4*    G   7           H4*        G   7   0.636  -8.167 -15.800
   71    H3*    G   7           H3*        G   7   3.321  -7.154 -14.860
   72    H2*    G   7           H2*        G   7   2.468  -4.943 -14.567
   73   2HO*    G   7          2HO*        G   7   0.150  -4.627 -15.367
   74    H1*    G   7           H1*        G   7   0.031  -5.563 -13.506
   75    H8     G   7           H8         G   7   2.351  -7.984 -11.921
   76    H1     G   7           H1         G   7   3.186  -2.094  -9.625
   77   1H2     G   7          H21         G   7   2.128  -0.623 -10.904
   78   2H2     G   7          H22         G   7   1.218  -1.092 -12.324
   79   1H5*    A   8          2H5*        A   8   3.014  -8.320 -19.399
   80   2H5*    A   8          1H5*        A   8   3.475  -7.333 -20.801
   81    H4*    A   8           H4*        A   8   0.900  -8.000 -20.192
   82    H3*    A   8           H3*        A   8   2.124  -5.647 -21.658
   83    H2*    A   8           H2*        A   8  -0.011  -4.606 -21.804
   84   2HO*    A   8          2HO*        A   8  -1.391  -6.076 -22.546
   85    H1*    A   8           H1*        A   8  -1.047  -5.471 -19.368
   86    H8     A   8           H8         A   8   1.810  -4.090 -17.920
   87   1H6     A   8          H61         A   8   0.378   1.596 -19.799
   88   2H6     A   8          H62         A   8   1.363   0.652 -18.704
   89    H2     A   8           H2         A   8  -2.085  -1.319 -22.177
   90   1H5*    A   9          2H5*        A   9  -0.433  -6.414 -24.452
   91   2H5*    A   9          1H5*        A   9   0.233  -6.630 -26.084
   92    H4*    A   9           H4*        A   9  -1.214  -4.575 -25.812
   93    H3*    A   9           H3*        A   9   1.636  -4.549 -26.779
   94    H2*    A   9           H2*        A   9   1.883  -2.281 -26.439
   95   2HO*    A   9          2HO*        A   9   0.686  -1.130 -27.731
   96    H1*    A   9           H1*        A   9  -0.661  -1.848 -25.019
   97    H8     A   9           H8         A   9   1.918  -3.088 -22.732
   98   1H6     A   9          H61         A   9   4.226   2.606 -22.308
   99   2H6     A   9          H62         A   9   4.244   0.997 -21.622
  100    H2     A   9           H2         A   9   1.337   2.525 -25.751
  101   1H5*    A  10          2H5*        A  10   2.346  -2.055 -30.948
  102   2H5*    A  10          1H5*        A  10   3.130  -3.227 -29.869
  103    H4*    A  10           H4*        A  10   2.777  -0.242 -29.438
  104    H3*    A  10           H3*        A  10   4.926  -1.861 -30.468
  105    H2*    A  10           H2*        A  10   5.841  -2.446 -28.389
  106   2HO*    A  10          2HO*        A  10   6.594   0.139 -29.053
  107    H1*    A  10           H1*        A  10   4.650   0.008 -27.086
  108    H8     A  10           H8         A  10   3.773  -3.623 -26.320
  109   1H6     A  10          H61         A  10   7.234  -3.066 -21.257
  110   2H6     A  10          H62         A  10   6.117  -4.096 -22.124
  111    H2     A  10           H2         A  10   7.776   0.646 -23.731
  112   1H5*    U  11          2H5*        U  11   9.264   0.065 -31.442
  113   2H5*    U  11          1H5*        U  11   8.010  -1.184 -31.592
  114    H4*    U  11           H4*        U  11   9.006  -0.327 -28.871
  115    H3*    U  11           H3*        U  11  10.740  -1.436 -30.825
  116    H2*    U  11           H2*        U  11   9.787  -3.603 -30.819
  117   2HO*    U  11          2HO*        U  11  11.853  -3.333 -29.182
  118    H1*    U  11           H1*        U  11   9.078  -3.296 -27.890
  119    H3     U  11           H3         U  11   7.249  -7.384 -27.901
  120    H5     U  11           H5         U  11   6.001  -5.799 -31.602
  121    H6     U  11           H6         U  11   7.300  -3.810 -31.113
  122   1H5*    C  12          2H5*        C  12  14.101  -3.712 -29.058
  123   2H5*    C  12          1H5*        C  12  14.488  -2.288 -28.071
  124    H4*    C  12           H4*        C  12  16.489  -3.109 -29.247
  125    H3*    C  12           H3*        C  12  15.649  -0.452 -29.168
  126    H2*    C  12           H2*        C  12  14.818  -0.361 -31.398
  127   2HO*    C  12          2HO*        C  12  16.323   1.167 -31.675
  128    H1*    C  12           H1*        C  12  17.093  -2.126 -32.329
  129   1H4     C  12          H41         C  12  13.555  -2.296 -37.592
  130   2H4     C  12          H42         C  12  12.074  -2.113 -36.679
  131    H5     C  12           H5         C  12  12.020  -1.906 -34.280
  132    H6     C  12           H6         C  12  13.373  -1.828 -32.238
  133   1H5*    C  13          2H5*        C  13  18.285   2.648 -28.240
  134   2H5*    C  13          1H5*        C  13  17.469   2.099 -29.718
  135    H4*    C  13           H4*        C  13  20.331   3.112 -29.705
  136    H3*    C  13           H3*        C  13  17.952   4.682 -29.265
  137    H2*    C  13           H2*        C  13  17.320   4.850 -31.515
  138   2HO*    C  13          2HO*        C  13  18.679   6.454 -32.626
  139    H1*    C  13           H1*        C  13  20.156   4.377 -32.444
  140   1H4     C  13          H41         C  13  16.460   3.917 -37.672
  141   2H4     C  13          H42         C  13  16.111   2.263 -37.216
  142    H5     C  13           H5         C  13  16.807   1.297 -35.123
  143    H6     C  13           H6         C  13  17.989   1.705 -33.014
  144   1H5*    C  14          2H5*        C  14  17.566   6.951 -29.864
  145   2H5*    C  14          1H5*        C  14  18.880   8.118 -29.617
  146    H4*    C  14           H4*        C  14  17.489   9.660 -28.710
  147    H3*    C  14           H3*        C  14  16.788   7.388 -26.979
  148    H2*    C  14           H2*        C  14  14.496   7.522 -27.102
  149   2HO*    C  14          2HO*        C  14  14.119  10.214 -27.298
  150    H1*    C  14           H1*        C  14  14.143   9.601 -29.073
  151   1H4     C  14          H41         C  14  10.485   4.932 -31.305
  152   2H4     C  14          H42         C  14  11.660   3.713 -30.866
  153    H5     C  14           H5         C  14  13.762   4.228 -29.809
  154    H6     C  14           H6         C  14  15.192   6.018 -28.945
  155   1H5*    G  15          2H5*        G  15  14.490   9.404 -24.605
  156   2H5*    G  15          1H5*        G  15  14.679   8.537 -23.068
  157    H4*    G  15           H4*        G  15  12.694   7.958 -24.736
  158    H3*    G  15           H3*        G  15  14.205   6.407 -22.744
  159    H2*    G  15           H2*        G  15  14.082   4.290 -23.711
  160   2HO*    G  15          2HO*        G  15  11.699   4.567 -23.875
  161    H1*    G  15           H1*        G  15  14.069   4.797 -26.367
  162    H8     G  15           H8         G  15  16.606   4.913 -27.205
  163    H1     G  15           H1         G  15  18.679   5.522 -21.208
  164   1H2     G  15          H21         G  15  16.970   5.921 -19.852
  165   2H2     G  15          H22         G  15  15.322   6.036 -20.427
  166   1H5*    A  16          2H5*        A  16   9.419   7.786 -22.432
  167   2H5*    A  16          1H5*        A  16   9.093   8.013 -20.701
  168    H4*    A  16           H4*        A  16   7.117   7.030 -21.585
  169    H3*    A  16           H3*        A  16   8.511   5.715 -19.596
  170    H2*    A  16           H2*        A  16   9.616   4.180 -21.061
  171   2HO*    A  16          2HO*        A  16   7.581   3.225 -19.648
  172    H1*    A  16           H1*        A  16   7.008   3.856 -22.579
  173    H8     A  16           H8         A  16  10.332   2.530 -22.209
  174   1H6     A  16          H61         A  16  10.727   1.533 -28.269
  175   2H6     A  16          H62         A  16  11.428   1.175 -26.707
  176    H2     A  16           H2         A  16   7.251   4.286 -27.541
  177   1H5*    A  17          2H5*        A  17   7.166   4.583 -16.171
  178   2H5*    A  17          1H5*        A  17   8.744   4.716 -16.974
  179    H4*    A  17           H4*        A  17   8.476   2.921 -15.127
  180    H3*    A  17           H3*        A  17  10.150   3.038 -17.331
  181    H2*    A  17           H2*        A  17   8.811   1.688 -18.773
  182   2HO*    A  17          2HO*        A  17  10.596   0.116 -17.253
  183    H1*    A  17           H1*        A  17   8.134  -0.148 -16.468
  184    H8     A  17           H8         A  17   6.447   1.878 -19.332
  185   1H6     A  17          H61         A  17   3.513  -3.369 -20.677
  186   2H6     A  17          H62         A  17   3.726  -1.690 -21.120
  187    H2     A  17           H2         A  17   6.186  -4.132 -17.144
  188   1H5*    G  18          2H5*        G  18   9.720   3.102 -11.707
  189   2H5*    G  18          1H5*        G  18  10.499   1.604 -12.254
  190    H4*    G  18           H4*        G  18   7.705   1.891 -13.173
  191    H3*    G  18           H3*        G  18   8.278   2.357 -10.309
  192    H2*    G  18           H2*        G  18   7.907   0.164  -9.660
  193   2HO*    G  18          2HO*        G  18   5.587   1.305 -10.002
  194    H1*    G  18           H1*        G  18   6.617  -0.564 -12.285
  195    H8     G  18           H8         G  18   9.411  -1.421  -9.734
  196    H1     G  18           H1         G  18   6.643  -6.475 -12.466
  197   1H2     G  18          H21         G  18   5.182  -5.807 -13.995
  198   2H2     G  18          H22         G  18   4.890  -4.116 -14.340
  199   1H5*    U  19          2H5*        U  19   6.835   3.891 -13.655
  200   2H5*    U  19          1H5*        U  19   6.517   5.634 -13.769
  201    H4*    U  19           H4*        U  19   5.012   5.218 -15.388
  202    H3*    U  19           H3*        U  19   3.676   3.852 -13.047
  203    H2*    U  19           H2*        U  19   2.408   2.499 -14.433
  204   2HO*    U  19          2HO*        U  19   2.384   4.792 -16.119
  205    H1*    U  19           H1*        U  19   3.907   2.966 -16.893
  206    H3     U  19           H3         U  19   2.562  -1.363 -17.178
  207    H5     U  19           H5         U  19   5.403  -1.337 -14.064
  208    H6     U  19           H6         U  19   5.430   1.087 -14.199
  209   1H5*    A  20          2H5*        A  20  -1.333   6.564 -13.313
  210   2H5*    A  20          1H5*        A  20  -0.682   4.970 -12.881
  211    H4*    A  20           H4*        A  20  -1.840   5.869 -15.533
  212    H3*    A  20           H3*        A  20  -2.523   3.835 -13.397
  213    H2*    A  20           H2*        A  20  -3.261   2.294 -15.016
  214   2HO*    A  20          2HO*        A  20  -3.902   2.888 -17.059
  215    H1*    A  20           H1*        A  20  -1.379   2.811 -16.969
  216    H8     A  20           H8         A  20   0.201   2.633 -13.534
  217   1H6     A  20          H61         A  20   0.340  -3.488 -14.215
  218   2H6     A  20          H62         A  20   0.867  -2.143 -13.229
  219    H2     A  20           H2         A  20  -2.076  -1.765 -17.590
  220   1H5*    G  21          2H5*        G  21  -7.307   4.605 -15.406
  221   2H5*    G  21          1H5*        G  21  -5.887   4.212 -14.415
  222    H4*    G  21           H4*        G  21  -6.704   2.658 -16.902
  223    H3*    G  21           H3*        G  21  -7.442   2.326 -13.979
  224    H2*    G  21           H2*        G  21  -7.132   0.004 -14.135
  225   2HO*    G  21          2HO*        G  21  -8.139   0.414 -16.590
  226    H1*    G  21           H1*        G  21  -5.070  -0.011 -16.033
  227    H8     G  21           H8         G  21  -4.458   2.288 -13.082
  228    H1     G  21           H1         G  21  -2.961  -3.794 -11.885
  229   1H2     G  21          H21         G  21  -3.682  -5.091 -13.533
  230   2H2     G  21          H22         G  21  -4.532  -4.457 -14.925
  231   1H5*    U  22          2H5*        U  22 -11.570  -0.096 -13.459
  232   2H5*    U  22          1H5*        U  22 -10.447   0.254 -12.129
  233    H4*    U  22           H4*        U  22 -10.830  -2.287 -13.694
  234    H3*    U  22           H3*        U  22 -10.605  -1.452 -10.789
  235    H2*    U  22           H2*        U  22  -9.572  -3.486 -10.232
  236   2HO*    U  22          2HO*        U  22  -9.777  -5.338 -11.518
  237    H1*    U  22           H1*        U  22  -8.130  -3.898 -12.576
  238    H3     U  22           H3         U  22  -5.415  -3.532  -8.864
  239    H5     U  22           H5         U  22  -6.022   0.393 -10.275
  240    H6     U  22           H6         U  22  -7.712  -0.479 -11.780
  241   1H5*    G  23          2H5*        G  23 -12.289  -5.210 -10.825
  242   2H5*    G  23          1H5*        G  23 -13.937  -5.269 -10.166
  243    H4*    G  23           H4*        G  23 -12.812  -7.082  -9.134
  244    H3*    G  23           H3*        G  23 -13.029  -4.624  -7.384
  245    H2*    G  23           H2*        G  23 -11.755  -5.634  -5.683
  246   2HO*    G  23          2HO*        G  23 -12.253  -8.121  -7.008
  247    H1*    G  23           H1*        G  23  -9.985  -7.074  -7.252
  248    H8     G  23           H8         G  23 -10.680  -3.436  -8.241
  249    H1     G  23           H1         G  23  -5.942  -4.130  -4.030
  250   1H2     G  23          H21         G  23  -5.831  -6.240  -3.356
  251   2H2     G  23          H22         G  23  -6.924  -7.473  -3.943
  252   1H5*    U  24          2H5*        U  24 -14.714  -8.231  -4.122
  253   2H5*    U  24          1H5*        U  24 -15.348  -6.856  -3.195
  254    H4*    U  24           H4*        U  24 -13.239  -8.526  -2.436
  255    H3*    U  24           H3*        U  24 -14.254  -5.814  -1.535
  256    H2*    U  24           H2*        U  24 -12.329  -5.466  -0.260
  257   2HO*    U  24          2HO*        U  24 -11.347  -8.062  -0.260
  258    H1*    U  24           H1*        U  24 -10.542  -7.094  -1.761
  259    H3     U  24           H3         U  24  -8.536  -3.047  -1.195
  260    H5     U  24           H5         U  24 -11.499  -2.382  -4.118
  261    H6     U  24           H6         U  24 -12.328  -4.624  -3.694
  262   1H5*    C  25          2H5*        C  25 -12.703  -8.276   1.973
  263   2H5*    C  25          1H5*        C  25 -13.741  -7.817   3.339
  264    H4*    C  25           H4*        C  25 -11.118  -7.451   3.457
  265    H3*    C  25           H3*        C  25 -13.402  -5.805   4.495
  266    H2*    C  25           H2*        C  25 -12.182  -3.850   4.546
  267   2HO*    C  25          2HO*        C  25  -9.724  -4.835   5.275
  268    H1*    C  25           H1*        C  25  -9.710  -4.985   3.361
  269   1H4     C  25          H41         C  25 -10.142   0.941   1.071
  270   2H4     C  25          H42         C  25 -11.609   0.529   0.212
  271    H5     C  25           H5         C  25 -12.691  -1.616   0.399
  272    H6     C  25           H6         C  25 -12.598  -3.829   1.450
  273   1H5*    C  26          2H5*        C  26  -9.664  -6.153   6.592
  274   2H5*    C  26          1H5*        C  26  -9.839  -6.918   8.185
  275    H4*    C  26           H4*        C  26  -8.149  -5.454   8.707
  276    H3*    C  26           H3*        C  26 -10.725  -3.876   8.924
  277    H2*    C  26           H2*        C  26  -9.514  -1.946   9.462
  278   2HO*    C  26          2HO*        C  26  -7.904  -3.656  10.681
  279    H1*    C  26           H1*        C  26  -7.371  -2.397   7.750
  280   1H4     C  26          H41         C  26 -11.071   1.875   4.839
  281   2H4     C  26          H42         C  26 -12.261   0.645   4.474
  282    H5     C  26           H5         C  26 -12.083  -1.631   5.238
  283    H6     C  26           H6         C  26 -10.728  -3.222   6.518
  284    H3T    C  26           H3T        C  26 -10.451  -5.277  10.597
  Start of MODEL   17
    1   1H5*    G   1          2H5*        G   1  -8.624  10.576   4.820
    2   2H5*    G   1          1H5*        G   1  -7.172   9.958   4.008
    3    H4*    G   1           H4*        G   1  -7.108  10.232   6.591
    4    H3*    G   1           H3*        G   1  -5.629   8.654   4.947
    5    H2*    G   1           H2*        G   1  -7.118   6.760   4.912
    6   2HO*    G   1          2HO*        G   1  -5.788   5.350   5.759
    7    H1*    G   1           H1*        G   1  -7.587   6.936   7.880
    8    H8     G   1           H8         G   1 -10.481   7.660   5.686
    9    H1     G   1           H1         G   1  -9.855   1.397   6.706
   10   1H2     G   1          H21         G   1  -7.884   0.971   7.627
   11   2H2     G   1          H22         G   1  -6.724   2.230   7.991
   12    H5T    G   1           H5T        G   1  -8.131   7.932   3.914
   13   1H5*    G   2          2H5*        G   2  -2.597   6.032   7.808
   14   2H5*    G   2          1H5*        G   2  -1.690   6.238   6.296
   15    H4*    G   2           H4*        G   2  -2.777   3.871   7.137
   16    H3*    G   2           H3*        G   2  -1.893   4.981   4.499
   17    H2*    G   2           H2*        G   2  -3.452   3.770   3.308
   18   2HO*    G   2          2HO*        G   2  -3.085   1.407   4.769
   19    H1*    G   2           H1*        G   2  -4.517   2.372   5.738
   20    H8     G   2           H8         G   2  -5.856   5.392   3.738
   21    H1     G   2           H1         G   2  -9.057  -0.044   2.798
   22   1H2     G   2          H21         G   2  -8.050  -1.707   3.861
   23   2H2     G   2          H22         G   2  -6.593  -1.478   4.800
   24   1H5*    A   3          2H5*        A   3  -1.813   0.848   5.879
   25   2H5*    A   3          1H5*        A   3  -0.145   0.240   5.936
   26    H4*    A   3           H4*        A   3  -1.202  -1.768   5.598
   27    H3*    A   3           H3*        A   3  -0.848  -0.508   2.863
   28    H2*    A   3           H2*        A   3  -2.099  -2.223   1.869
   29   2HO*    A   3          2HO*        A   3  -0.972  -3.681   3.917
   30    H1*    A   3           H1*        A   3  -3.832  -2.778   4.014
   31    H8     A   3           H8         A   3  -3.514   0.839   2.811
   32   1H6     A   3          H61         A   3  -8.159  -0.407  -1.033
   33   2H6     A   3          H62         A   3  -7.119   0.850  -0.400
   34    H2     A   3           H2         A   3  -6.926  -4.245   0.955
   35   1H5*    C   4          2H5*        C   4   0.172  -5.265   3.257
   36   2H5*    C   4          1H5*        C   4   1.169  -5.508   1.808
   37    H4*    C   4           H4*        C   4  -1.104  -6.875   2.214
   38    H3*    C   4           H3*        C   4   0.143  -5.815  -0.337
   39    H2*    C   4           H2*        C   4  -1.729  -6.459  -1.579
   40   2HO*    C   4          2HO*        C   4  -2.483  -8.217   0.543
   41    H1*    C   4           H1*        C   4  -3.683  -6.251   0.455
   42   1H4     C   4          H41         C   4  -4.886  -1.717  -3.851
   43   2H4     C   4          H42         C   4  -3.616  -0.722  -3.174
   44    H5     C   4           H5         C   4  -2.142  -1.473  -1.422
   45    H6     C   4           H6         C   4  -1.567  -3.340   0.057
   46   1H5*    A   5          2H5*        A   5   0.020 -10.766  -2.254
   47   2H5*    A   5          1H5*        A   5   1.073  -9.820  -3.326
   48    H4*    A   5           H4*        A   5  -1.489 -10.856  -3.923
   49    H3*    A   5           H3*        A   5   0.465  -8.969  -5.270
   50    H2*    A   5           H2*        A   5  -1.174  -8.297  -6.802
   51   2HO*    A   5          2HO*        A   5  -2.744 -10.575  -6.091
   52    H1*    A   5           H1*        A   5  -3.437  -8.588  -5.156
   53    H8     A   5           H8         A   5  -0.767  -6.467  -3.560
   54   1H6     A   5          H61         A   5  -2.947  -1.705  -6.801
   55   2H6     A   5          H62         A   5  -1.859  -2.190  -5.518
   56    H2     A   5           H2         A   5  -4.926  -5.446  -8.316
   57   1H5*    C   6          2H5*        C   6  -1.694 -10.789  -8.025
   58   2H5*    C   6          1H5*        C   6  -0.826 -12.170  -8.724
   59    H4*    C   6           H4*        C   6  -1.829 -11.458 -10.652
   60    H3*    C   6           H3*        C   6   0.646  -9.750 -10.302
   61    H2*    C   6           H2*        C   6   0.030  -8.384 -12.116
   62   2HO*    C   6          2HO*        C   6  -0.807  -9.286 -13.835
   63    H1*    C   6           H1*        C   6  -2.717  -8.392 -11.748
   64   1H4     C   6          H41         C   6  -0.811  -2.819  -9.388
   65   2H4     C   6          H42         C   6   0.081  -3.609  -8.107
   66    H5     C   6           H5         C   6   0.265  -6.002  -7.910
   67    H6     C   6           H6         C   6  -0.365  -8.154  -8.896
   68   1H5*    G   7          2H5*        G   7   1.096 -10.381 -14.727
   69   2H5*    G   7          1H5*        G   7   2.753  -9.754 -14.846
   70    H4*    G   7           H4*        G   7   0.483  -8.319 -15.445
   71    H3*    G   7           H3*        G   7   3.329  -7.615 -14.746
   72    H2*    G   7           H2*        G   7   2.785  -5.314 -14.407
   73   2HO*    G   7          2HO*        G   7   1.472  -4.604 -15.932
   74    H1*    G   7           H1*        G   7   0.455  -5.618 -13.062
   75    H8     G   7           H8         G   7   2.486  -8.445 -11.797
   76    H1     G   7           H1         G   7   4.668  -2.869  -9.603
   77   1H2     G   7          H21         G   7   3.734  -1.197 -10.720
   78   2H2     G   7          H22         G   7   2.575  -1.455 -12.004
   79   1H5*    A   8          2H5*        A   8   2.934  -8.248 -19.720
   80   2H5*    A   8          1H5*        A   8   3.169  -6.839 -20.773
   81    H4*    A   8           H4*        A   8   0.713  -7.971 -19.953
   82    H3*    A   8           H3*        A   8   1.585  -5.477 -21.437
   83    H2*    A   8           H2*        A   8  -0.602  -4.550 -21.231
   84   2HO*    A   8          2HO*        A   8  -1.450  -6.853 -21.735
   85    H1*    A   8           H1*        A   8  -1.177  -5.419 -18.684
   86    H8     A   8           H8         A   8   1.889  -4.199 -17.631
   87   1H6     A   8          H61         A   8   0.571   1.578 -19.311
   88   2H6     A   8          H62         A   8   1.628   0.570 -18.349
   89    H2     A   8           H2         A   8  -2.335  -1.170 -21.366
   90   1H5*    A   9          2H5*        A   9  -0.921  -5.814 -23.157
   91   2H5*    A   9          1H5*        A   9  -1.641  -6.792 -24.452
   92    H4*    A   9           H4*        A   9  -2.309  -4.873 -25.421
   93    H3*    A   9           H3*        A   9   0.686  -4.718 -25.781
   94    H2*    A   9           H2*        A   9   0.596  -2.437 -26.339
   95   2HO*    A   9          2HO*        A   9  -1.520  -1.470 -26.860
   96    H1*    A   9           H1*        A   9  -1.467  -1.643 -24.680
   97    H8     A   9           H8         A   9   0.971  -3.829 -22.811
   98   1H6     A   9          H61         A   9   4.405   1.206 -21.933
   99   2H6     A   9          H62         A   9   4.182  -0.472 -21.493
  100    H2     A   9           H2         A   9   1.170   2.222 -24.883
  101   1H5*    A  10          2H5*        A  10  -1.006  -2.336 -28.491
  102   2H5*    A  10          1H5*        A  10  -0.419  -2.589 -30.147
  103    H4*    A  10           H4*        A  10  -0.129  -0.238 -29.352
  104    H3*    A  10           H3*        A  10   1.974  -1.972 -30.464
  105    H2*    A  10           H2*        A  10   3.828  -1.045 -29.438
  106   2HO*    A  10          2HO*        A  10   2.451   1.444 -29.232
  107    H1*    A  10           H1*        A  10   2.776   0.314 -27.249
  108    H8     A  10           H8         A  10   2.406  -3.446 -28.172
  109   1H6     A  10          H61         A  10   6.600  -4.444 -23.782
  110   2H6     A  10          H62         A  10   5.558  -5.198 -24.968
  111    H2     A  10           H2         A  10   5.924  -0.014 -24.080
  112   1H5*    U  11          2H5*        U  11   2.574   1.347 -33.990
  113   2H5*    U  11          1H5*        U  11   4.020   0.345 -34.221
  114    H4*    U  11           H4*        U  11   3.023   1.696 -31.713
  115    H3*    U  11           H3*        U  11   5.075   2.286 -33.541
  116    H2*    U  11           H2*        U  11   6.518   0.506 -32.920
  117   2HO*    U  11          2HO*        U  11   8.055   1.369 -31.599
  118    H1*    U  11           H1*        U  11   5.613   0.746 -30.041
  119    H3     U  11           H3         U  11   8.723  -2.439 -29.254
  120    H5     U  11           H5         U  11   6.299  -4.122 -32.264
  121    H6     U  11           H6         U  11   5.127  -2.002 -32.413
  122   1H5*    C  12          2H5*        C  12   7.722   6.619 -31.270
  123   2H5*    C  12          1H5*        C  12   7.804   5.271 -32.423
  124    H4*    C  12           H4*        C  12   8.394   5.024 -29.449
  125    H3*    C  12           H3*        C  12  10.039   6.295 -31.326
  126    H2*    C  12           H2*        C  12  10.455   4.370 -32.664
  127   2HO*    C  12          2HO*        C  12  12.235   3.823 -30.501
  128    H1*    C  12           H1*        C  12  10.481   2.650 -30.170
  129   1H4     C  12          H41         C  12  10.419  -2.002 -34.487
  130   2H4     C  12          H42         C  12   9.525  -1.020 -35.625
  131    H5     C  12           H5         C  12   8.842   1.243 -35.165
  132    H6     C  12           H6         C  12   8.865   3.054 -33.513
  133   1H5*    C  13          2H5*        C  13  14.930   6.427 -28.345
  134   2H5*    C  13          1H5*        C  13  14.592   5.999 -30.035
  135    H4*    C  13           H4*        C  13  15.038   3.941 -27.841
  136    H3*    C  13           H3*        C  13  17.025   5.650 -28.854
  137    H2*    C  13           H2*        C  13  17.006   4.800 -31.072
  138   2HO*    C  13          2HO*        C  13  18.468   2.731 -29.748
  139    H1*    C  13           H1*        C  13  16.435   2.024 -29.997
  140   1H4     C  13          H41         C  13  15.715   1.005 -36.229
  141   2H4     C  13          H42         C  13  14.659   2.392 -36.379
  142    H5     C  13           H5         C  13  14.154   3.871 -34.546
  143    H6     C  13           H6         C  13  14.553   4.339 -32.173
  144   1H5*    C  14          2H5*        C  14  18.656   6.994 -28.290
  145   2H5*    C  14          1H5*        C  14  19.457   7.040 -26.708
  146    H4*    C  14           H4*        C  14  18.605   9.123 -26.521
  147    H3*    C  14           H3*        C  14  16.477   7.278 -25.707
  148    H2*    C  14           H2*        C  14  14.824   8.242 -27.039
  149   2HO*    C  14          2HO*        C  14  13.895   9.903 -26.021
  150    H1*    C  14           H1*        C  14  16.449  10.757 -27.430
  151   1H4     C  14          H41         C  14  12.113  11.242 -32.062
  152   2H4     C  14          H42         C  14  12.617   9.708 -32.736
  153    H5     C  14           H5         C  14  14.272   8.294 -31.706
  154    H6     C  14           H6         C  14  15.801   8.043 -29.807
  155   1H5*    G  15          2H5*        G  15  14.333   9.779 -24.042
  156   2H5*    G  15          1H5*        G  15  13.511   8.912 -22.729
  157    H4*    G  15           H4*        G  15  12.472   9.063 -25.193
  158    H3*    G  15           H3*        G  15  12.233   7.150 -22.965
  159    H2*    G  15           H2*        G  15  11.869   5.184 -24.165
  160   2HO*    G  15          2HO*        G  15  10.358   5.324 -25.634
  161    H1*    G  15           H1*        G  15  13.341   5.525 -26.397
  162    H8     G  15           H8         G  15  15.879   4.778 -25.877
  163    H1     G  15           H1         G  15  14.718   4.858 -19.608
  164   1H2     G  15          H21         G  15  12.766   5.834 -19.211
  165   2H2     G  15          H22         G  15  11.752   6.464 -20.491
  166   1H5*    A  16          2H5*        A  16   9.252   6.064 -23.069
  167   2H5*    A  16          1H5*        A  16   8.265   6.909 -24.276
  168    H4*    A  16           H4*        A  16   6.496   6.886 -22.239
  169    H3*    A  16           H3*        A  16   8.530   4.890 -21.439
  170    H2*    A  16           H2*        A  16   7.218   2.951 -21.621
  171   2HO*    A  16          2HO*        A  16   4.731   3.978 -22.012
  172    H1*    A  16           H1*        A  16   5.707   3.450 -23.766
  173    H8     A  16           H8         A  16   9.161   3.056 -22.474
  174   1H6     A  16          H61         A  16  11.155   1.910 -28.172
  175   2H6     A  16          H62         A  16  11.559   1.869 -26.471
  176    H2     A  16           H2         A  16   6.966   3.488 -28.487
  177   1H5*    A  17          2H5*        A  17   9.724   3.671 -19.020
  178   2H5*    A  17          1H5*        A  17   8.805   2.494 -19.981
  179    H4*    A  17           H4*        A  17   9.334   2.428 -16.989
  180    H3*    A  17           H3*        A  17  10.907   1.423 -19.013
  181    H2*    A  17           H2*        A  17   9.244   0.001 -19.982
  182   2HO*    A  17          2HO*        A  17   9.576  -2.143 -18.934
  183    H1*    A  17           H1*        A  17   8.303  -0.825 -17.232
  184    H8     A  17           H8         A  17   6.408   0.891 -20.112
  185   1H6     A  17          H61         A  17   3.360  -4.428 -20.724
  186   2H6     A  17          H62         A  17   3.467  -2.767 -21.261
  187    H2     A  17           H2         A  17   6.614  -5.031 -17.686
  188   1H5*    G  18          2H5*        G  18  10.910   2.574 -13.244
  189   2H5*    G  18          1H5*        G  18  11.445   0.962 -13.761
  190    H4*    G  18           H4*        G  18   8.628   1.606 -14.431
  191    H3*    G  18           H3*        G  18   9.544   2.043 -11.667
  192    H2*    G  18           H2*        G  18   9.107  -0.135 -10.964
  193   2HO*    G  18          2HO*        G  18   6.703  -0.562 -10.994
  194    H1*    G  18           H1*        G  18   7.321  -0.637 -13.351
  195    H8     G  18           H8         G  18  10.259  -1.984 -11.205
  196    H1     G  18           H1         G  18   6.423  -6.474 -13.610
  197   1H2     G  18          H21         G  18   4.886  -5.542 -14.909
  198   2H2     G  18          H22         G  18   4.807  -3.816 -15.182
  199   1H5*    U  19          2H5*        U  19   7.831   3.641 -14.243
  200   2H5*    U  19          1H5*        U  19   7.904   5.401 -14.454
  201    H4*    U  19           H4*        U  19   6.031   5.377 -15.705
  202    H3*    U  19           H3*        U  19   4.914   4.005 -13.253
  203    H2*    U  19           H2*        U  19   3.257   2.955 -14.488
  204   2HO*    U  19          2HO*        U  19   2.772   4.311 -16.644
  205    H1*    U  19           H1*        U  19   4.421   3.378 -17.122
  206    H3     U  19           H3         U  19   2.490  -0.719 -17.386
  207    H5     U  19           H5         U  19   5.734  -1.247 -14.747
  208    H6     U  19           H6         U  19   6.065   1.157 -14.777
  209   1H5*    A  20          2H5*        A  20  -0.019   7.322 -13.756
  210   2H5*    A  20          1H5*        A  20   0.519   6.064 -12.625
  211    H4*    A  20           H4*        A  20  -0.049   5.726 -15.591
  212    H3*    A  20           H3*        A  20  -1.545   5.146 -13.061
  213    H2*    A  20           H2*        A  20  -1.555   2.874 -13.387
  214   2HO*    A  20          2HO*        A  20  -2.700   2.114 -15.071
  215    H1*    A  20           H1*        A  20  -0.112   2.981 -15.996
  216    H8     A  20           H8         A  20   1.880   2.433 -12.879
  217   1H6     A  20          H61         A  20   1.058  -3.624 -13.626
  218   2H6     A  20          H62         A  20   1.924  -2.393 -12.734
  219    H2     A  20           H2         A  20  -1.634  -1.484 -16.520
  220   1H5*    G  21          2H5*        G  21  -5.281   4.968 -16.608
  221   2H5*    G  21          1H5*        G  21  -4.472   4.406 -15.131
  222    H4*    G  21           H4*        G  21  -5.795   2.774 -17.309
  223    H3*    G  21           H3*        G  21  -6.069   3.136 -14.317
  224    H2*    G  21           H2*        G  21  -6.530   0.861 -14.012
  225   2HO*    G  21          2HO*        G  21  -6.892   0.251 -16.722
  226    H1*    G  21           H1*        G  21  -4.980  -0.198 -16.080
  227    H8     G  21           H8         G  21  -3.661   2.339 -13.486
  228    H1     G  21           H1         G  21  -2.562  -3.768 -12.015
  229   1H2     G  21          H21         G  21  -3.524  -5.092 -13.512
  230   2H2     G  21          H22         G  21  -4.435  -4.471 -14.870
  231   1H5*    U  22          2H5*        U  22 -10.733   0.823 -13.482
  232   2H5*    U  22          1H5*        U  22  -9.334   1.408 -12.558
  233    H4*    U  22           H4*        U  22  -9.436  -1.257 -14.030
  234    H3*    U  22           H3*        U  22 -10.101  -0.467 -11.182
  235    H2*    U  22           H2*        U  22  -8.841  -2.226 -10.330
  236   2HO*    U  22          2HO*        U  22  -9.303  -3.576 -12.807
  237    H1*    U  22           H1*        U  22  -7.154  -2.664 -12.623
  238    H3     U  22           H3         U  22  -4.824  -2.899  -8.633
  239    H5     U  22           H5         U  22  -5.017   1.179  -9.686
  240    H6     U  22           H6         U  22  -6.611   0.588 -11.418
  241   1H5*    G  23          2H5*        G  23 -12.983  -4.643 -10.997
  242   2H5*    G  23          1H5*        G  23 -13.831  -3.772  -9.703
  243    H4*    G  23           H4*        G  23 -12.492  -6.074  -9.270
  244    H3*    G  23           H3*        G  23 -12.944  -3.652  -7.506
  245    H2*    G  23           H2*        G  23 -11.490  -4.493  -5.884
  246   2HO*    G  23          2HO*        G  23 -12.529  -6.892  -6.789
  247    H1*    G  23           H1*        G  23  -9.825  -6.051  -7.575
  248    H8     G  23           H8         G  23 -10.019  -2.387  -8.475
  249    H1     G  23           H1         G  23  -5.847  -3.595  -3.807
  250   1H2     G  23          H21         G  23  -6.082  -5.686  -3.103
  251   2H2     G  23          H22         G  23  -7.267  -6.779  -3.781
  252   1H5*    U  24          2H5*        U  24 -13.128  -7.768  -5.289
  253   2H5*    U  24          1H5*        U  24 -14.402  -7.499  -4.082
  254    H4*    U  24           H4*        U  24 -12.047  -8.312  -3.278
  255    H3*    U  24           H3*        U  24 -13.786  -6.138  -2.098
  256    H2*    U  24           H2*        U  24 -12.106  -5.442  -0.655
  257   2HO*    U  24          2HO*        U  24 -10.544  -7.745  -0.728
  258    H1*    U  24           H1*        U  24  -9.849  -6.515  -2.074
  259    H3     U  24           H3         U  24  -8.527  -2.350  -0.915
  260    H5     U  24           H5         U  24 -11.588  -1.706  -3.740
  261    H6     U  24           H6         U  24 -12.032  -4.092  -3.704
  262   1H5*    C  25          2H5*        C  25 -11.895  -8.872   1.217
  263   2H5*    C  25          1H5*        C  25 -13.079  -8.771   2.537
  264    H4*    C  25           H4*        C  25 -10.577  -7.996   2.922
  265    H3*    C  25           H3*        C  25 -13.171  -6.873   3.927
  266    H2*    C  25           H2*        C  25 -12.306  -4.768   4.296
  267   2HO*    C  25          2HO*        C  25  -9.774  -5.343   5.112
  268    H1*    C  25           H1*        C  25  -9.608  -5.331   3.204
  269   1H4     C  25          H41         C  25 -10.829   0.640   1.412
  270   2H4     C  25          H42         C  25 -12.262   0.132   0.547
  271    H5     C  25           H5         C  25 -13.068  -2.141   0.549
  272    H6     C  25           H6         C  25 -12.673  -4.412   1.381
  273   1H5*    C  26          2H5*        C  26  -9.460  -7.125   6.400
  274   2H5*    C  26          1H5*        C  26  -9.759  -7.729   8.042
  275    H4*    C  26           H4*        C  26  -8.097  -6.041   8.284
  276    H3*    C  26           H3*        C  26 -10.884  -5.029   8.917
  277    H2*    C  26           H2*        C  26  -9.989  -2.942   9.492
  278   2HO*    C  26          2HO*        C  26  -7.305  -3.529   9.261
  279    H1*    C  26           H1*        C  26  -8.023  -2.869   7.522
  280   1H4     C  26          H41         C  26 -12.738   0.870   5.466
  281   2H4     C  26          H42         C  26 -13.752  -0.521   5.153
  282    H5     C  26           H5         C  26 -13.100  -2.777   5.684
  283    H6     C  26           H6         C  26 -11.335  -4.190   6.630
  284    H3T    C  26           H3T        C  26  -9.744  -5.120  11.062