*HEADER    RNA                                     01-SEP-03   1QWA              
*TITLE     NMR STRUCTURE OF 5'-R(GGAUGCCUCCCGAGUGCAUCC): AN RNA                  
*TITLE    2 HAIRPIN DERIVED FROM THE MOUSE 5'ETS THAT BINDS NUCLEOLIN            
*TITLE    3 RBD12.                                                               
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: 18S RIBOSOMAL RNA, 5'ETS;                                  
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 FRAGMENT: B2NRE;                                                     
*COMPND   5 ENGINEERED: YES;                                                     
*COMPND   6 OTHER_DETAILS: B2: A RNA HAIRPIN DERIVED FROM NTS 394-410            
*COMPND   7 OF THE MOUSE 5' ETS.                                                 
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES;                                                      
*SOURCE   3 OTHER_DETAILS: THE RNA WAS CHEMICALLY SYNTHESIZED IN VITRO           
*SOURCE   4 USING T7 RNA POLYMERASE AND SYNTHETIC DNA TEMPLATES. THE             
*SOURCE   5 SEQUENCE OF THE RNA IS NATURALLY FOUND IN MUS MUSCULUS               
*SOURCE   6 (MOUSE).                                                             
*KEYWDS    TETRALOOP, UNCG, UUCG, YNMG, BULGED NUCLEOTIDE, HAIRPIN, A-           
*KEYWDS   2 FORM HELIX                                                           
*EXPDTA    NMR, 17 STRUCTURES                                                    
*AUTHOR    L.D.FINGER, L.TRANTIREK, C.JOHANSSON, J.FEIGON                        
*REVDAT   1   25-NOV-03 1QWA    0                                                

!G1 intra
assign (resid   1 and  name   H4')(resid   1 and  name    H8) 7.0 2.5 0.0 !3D sug
assign (resid   1 and  name   H4')(resid   1 and  name   H3') 3.0 1.4 0.0 !3D sug
assign (resid   1 and  name   H2')(resid   1 and  name  H5'*) 5.5 2.0 0.0 !3D sug
assign (resid   1 and  name   H2')(resid   1 and  name   H4') 5.5 2.0 0.0 !3D sug
assign (resid   1 and  name   H3')(resid   1 and  name  H5'*) 4.5 1.5 0.0 !3D sug
assign (resid   1 and  name  H5'*)(resid   1 and  name   H4') 3.0 1.4 1.0 !3D sug
assign (resid   1 and  name  H5'*)(resid   1 and  name    H8) 5.5 3.0 1.0 !3D sug
assign (resid   1 and  name   H2')(resid   1 and  name   H3') 3.0 1.4 0.0 !noebuh1h5
assign (resid   1 and  name   H1')(resid   1 and  name   H4') 5.5 2.0 0.0 !noebuh1h5
assign (resid   1 and  name   H2')(resid   1 and  name  H5'') 5.5 2.0 0.0 !noebuh1h5
assign (resid   1 and  name   H1')(resid   1 and  name   H3') 7.0 3.5 0.0 !noebuh1h5
assign (resid   1 and  name   H2')(resid   1 and  name   H1') 4.5 2.5 0.0 !noebuh1h5
assign (resid   1 and  name    H8)(resid   1 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid   1 and  name    H8)(resid   1 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid   1 and  name    H8)(resid   1 and  name   H3') 5.5 2.0 0.0 !noebuaro
assign (resid   1 and  name    H8)(resid   1 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid   1 and  name   H1')(resid   1 and  name  H5'') 4.5 1.5 0.0
assign (resid   1 and  name   H2')(resid   1 and  name   H5') 5.5 2.0 0.0
assign (resid   1 and  name   H1')(resid   1 and  name   H5') 5.5 2.0 0.0
assign (resid   1 and  name   H5')(resid   1 and  name    H8) 5.5 2.0 0.0
!G1 inter
assign (resid   1 and  name   H3')(resid   2 and  name    H8) 5.5 2.0 0.0 !3D sug
assign (resid   1 and  name   H2')(resid   2 and  name   H5') 4.5 1.5 1.0 !noebuh1h5
assign (resid   1 and  name   H2')(resid   2 and  name   H3') 5.5 2.0 0.0 !noebuh1h5
assign (resid   1 and  name    H1)(resid  21 and  name   H41) 3.0 1.4 0.0
assign (resid   1 and  name    H1)(resid  21 and  name   H42) 4.5 1.5 0.0
assign (resid   1 and  name    H8)(resid   2 and  name    H8) 7.0 2.5 0.0 
assign (resid   1 and  name   H1')(resid   2 and  name   H5') 5.5 2.0 0.0
!G2 intra
assign (resid   2 and  name    H8)(resid   2 and  name   H3') 4.5 1.5 0.0 !3D aro
assign (resid   2 and  name   H4')(resid   2 and  name    H8) 7.0 2.5 0.0 !3D sug
assign (resid   2 and  name   H4')(resid   2 and  name   H1') 7.0 3.5 0.0 !3D sug
assign (resid   2 and  name   H4')(resid   2 and  name  H5'*) 3.0 1.4 1.0 !3D sug
assign (resid   2 and  name   H3')(resid   2 and  name  H5'*) 3.0 1.4 1.0 !3D sug
assign (resid   2 and  name   H1')(resid   2 and  name   H2') 4.5 2.5 0.0 !noebuh1h5
assign (resid   2 and  name   H1')(resid   2 and  name   H3') 4.5 1.5 0.0 !noebuh1h5
assign (resid   2 and  name    H8)(resid   2 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid   2 and  name    H8)(resid   2 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid   2 and  name    H8)(resid   2 and  name   H5') 4.5 1.5 0.0 !noebuaro
assign (resid   2 and  name    H1)(resid   2 and  name   H21) 3.0 1.4 0.0
assign (resid   2 and  name    H8)(resid   2 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid   2 and  name    H1)(resid   2 and  name   H22) 5.5 2.5 0.0
assign (resid   2 and  name   H1')(resid   2 and  name   H5') 5.5 2.0 0.0
assign (resid   2 and  name   H1')(resid   2 and  name  H5'') 5.5 2.0 0.0
!G2 inter
assign (resid   2 and  name    H8)(resid   1 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid   2 and  name    H8)(resid   1 and  name   H1') 4.5 1.5 0.0 !noebuaro
assign (resid   2 and  name   H1')(resid   1 and  name   H2') 7.0 2.5 0.0 !noebuh1h5
assign (resid   2 and  name    H1)(resid  21 and  name    N4) 5.5 3.0 1.0
assign (resid   2 and  name    H1)(resid   3 and  name    N6) 5.5 3.0 1.0
assign (resid   2 and  name    H1)(resid  20 and  name   H41) 3.0 1.4 0.0
assign (resid   2 and  name    H1)(resid  20 and  name   H42) 4.5 1.5 0.0
assign (resid   2 and  name    H1)(resid   3 and  name    H2) 5.5 2.0 0.0
assign (resid   2 and  name    H1)(resid  20 and  name    H5) 5.5 2.0 0.0
assign (resid   2 and  name    H1)(resid  21 and  name   H41) 5.5 2.0 0.0
assign (resid   2 and  name    H1)(resid  21 and  name   H1') 5.5 2.0 0.0
assign (resid   2 and  name    H1)(resid  21 and  name    H5) 7.0 2.5 0.0
assign (resid   2 and  name    H1)(resid  19 and  name    H3) 7.0 2.5 0.0
assign (resid   2 and  name    H8)(resid   3 and  name    H8) 7.0 2.5 0.0
assign (resid   2 and  name   H1')(resid   3 and  name  H5'') 5.5 2.0 0.0
assign (resid   2 and  name  H5'')(resid   1 and  name   H1') 5.5 2.0 0.0
!A3 intra
assign (resid   3 and  name   H4')(resid   3 and  name    H8) 5.5 2.0 0.0 !3D sug
assign (resid   3 and  name   H3')(resid   3 and  name  H5'*) 3.0 1.4 0.0 !3D sug
assign (resid   3 and  name   H3')(resid   3 and  name    H8) 3.0 0.5 0.5 !3D sug
assign (resid   3 and  name   H1')(resid   3 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid   3 and  name   H1')(resid   3 and  name   H3') 5.5 2.0 0.0 !noebuh1h5
assign (resid   3 and  name    H8)(resid   3 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid   3 and  name    H8)(resid   3 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid   3 and  name    H8)(resid   3 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid   3 and  name   H1')(resid   3 and  name  H5'') 5.5 2.0 0.0
assign (resid   3 and  name   H5')(resid   3 and  name   H1') 4.5 1.5 0.0
assign (resid   3 and  name   H1')(resid   3 and  name    H2) 7.0 2.5 0.0
!A3 inter
assign (resid   3 and  name   H1')(resid   2 and  name   H2') 7.0 2.5 0.0 !noebuh1h5
assign (resid   3 and  name    H8)(resid   2 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid   3 and  name    H2)(resid   4 and  name   H1') 4.5 1.5 0.0 !noebuaro
assign (resid   3 and  name    H8)(resid   2 and  name   H1') 7.0 2.5 0.0 !noebuaro
assign (resid   3 and  name    H2)(resid   2 and  name    N2) 7.0 3.5 1.0
assign (resid   3 and  name    H8)(resid   4 and  name    H6) 7.0 2.5 0.0
assign (resid   3 and  name   H1')(resid   4 and  name    H5) 7.0 2.5 0.0
assign (resid   3 and  name    H2)(resid   4 and  name    H6) 7.0 2.5 0.0
assign (resid   3 and  name    H2)(resid  18 and  name    H2) 7.0 2.5 0.0
assign (resid   3 and  name   H1')(resid   4 and  name   H1') 7.0 2.5 0.0
!A4 intra
assign (resid   4 and  name   H1')(resid   4 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid   4 and  name   H3')(resid   4 and  name   H1') 7.0 3.5 0.0 !3D sug
assign (resid   4 and  name   H1')(resid   4 and  name   H4') 7.0 3.5 0.0 !noebuh1h5
assign (resid   4 and  name    H5)(resid   4 and  name   H3') 7.0 2.5 0.0 !noebuh1h5
assign (resid   4 and  name   H1')(resid   4 and  name    H5) 7.0 2.5 0.0 !noebuaro
assign (resid   4 and  name    H6)(resid   4 and  name    H5) 3.0 1.4 0.0 !noebuaro
assign (resid   4 and  name    H6)(resid   4 and  name   H3') 3.0 1.4 0.0 !noebuaro
assign (resid   4 and  name    H6)(resid   4 and  name  H5'') 5.5 2.0 0.0 !noebuaro
assign (resid   4 and  name    H6)(resid   4 and  name   H1') 7.0 3.5 0.0 !noebuaro
assign (resid   4 and  name    H6)(resid   4 and  name   H4') 4.5 1.5 0.0 !noebuaro
assign (resid   4 and  name   H1')(resid   4 and  name  H5'') 4.5 1.5 1.0
assign (resid   4 and  name   H4')(resid   4 and  name    H6) 4.5 1.5 0.0
!A4 inter
assign (resid   4 and  name   H3')(resid   5 and  name    H8) 4.5 1.5 0.0 !3D sug
assign (resid   4 and  name    H5)(resid   3 and  name   H3') 7.0 2.5 0.0 !noebuh1h5
assign (resid   4 and  name   H1')(resid   3 and  name   H2') 5.5 2.0 0.0 !noebuh1h5
assign (resid   4 and  name    H5)(resid   3 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid   4 and  name    H6)(resid   3 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid   4 and  name    H6)(resid   3 and  name   H3') 5.5 2.0 0.0 !noebuaro
assign (resid   4 and  name    H3)(resid  17 and  name    N4) 7.0 3.5 1.0
assign (resid   4 and  name    H3)(resid  18 and  name    H2) 3.0 1.4 0.0
assign (resid   4 and  name    H3)(resid  18 and  name   H61) 3.0 1.4 0.0
assign (resid   4 and  name    H3)(resid  18 and  name   H62) 4.5 1.5 0.0
assign (resid   4 and  name    H3)(resid   3 and  name    H2) 5.5 2.0 0.0
assign (resid   4 and  name    H3)(resid   4 and  name    H5) 7.0 2.5 0.0
assign (resid   4 and  name    H3)(resid  19 and  name   H1') 7.0 2.5 0.0
assign (resid   4 and  name    H3)(resid   5 and  name   H1') 7.0 2.5 0.0
assign (resid   4 and  name    H3)(resid  19 and  name    H3) 5.5 2.0 0.0
assign (resid   4 and  name    H5)(resid   3 and  name    H8) 5.5 2.0 0.0
assign (resid   4 and  name    H5)(resid   4 and  name  H5'') 7.0 2.5 0.0
assign (resid   4 and  name    H6)(resid   5 and  name    H8) 7.0 2.5 0.0
assign (resid   4 and  name    H6)(resid   3 and  name   H1') 7.0 2.5 0.0
!G5 intra
assign (resid   5 and  name   H3')(resid   5 and  name   H1') 3.0 1.4 1.0 !noebusug
assign (resid   5 and  name    H8)(resid   5 and  name  H5'*) 5.5 3.0 1.0 !3D aro
assign (resid   5 and  name   H1')(resid   5 and  name   H2') 4.5 2.5 0.0 !noebuh1h5
assign (resid   5 and  name   H1')(resid   5 and  name   H4') 4.5 1.5 0.0 !noebuh1h5
assign (resid   5 and  name    H8)(resid   5 and  name   H3') 3.0 1.4 1.0 !noebuaro
assign (resid   5 and  name    H8)(resid   5 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid   5 and  name    H8)(resid   5 and  name   H1') 7.0 3.5 0.0 !noebuaro
assign (resid   5 and  name    H1)(resid   5 and  name   H22) 4.5 1.5 0.0
assign (resid   5 and  name    H1)(resid   5 and  name   H21) 4.5 2.5 0.0
assign (resid   5 and  name  H5'')(resid   5 and  name   H1') 7.0 2.5 0.0
!G5 inter
assign (resid   5 and  name    H8)(resid   4 and  name   H1') 4.5 1.5 0.0 !3D aro
assign (resid   5 and  name   H1')(resid   6 and  name    H6) 7.0 3.5 0.0 !noebuh1h5
assign (resid   5 and  name    H1)(resid  18 and  name    N6) 5.5 1.0 1.0
assign (resid   5 and  name    H1)(resid  17 and  name   H41) 3.0 1.4 0.0
assign (resid   5 and  name    H1)(resid  17 and  name   H42) 4.5 1.5 0.0
assign (resid   5 and  name    H1)(resid   6 and  name   H1') 5.5 2.0 0.0
assign (resid   5 and  name    H1)(resid  17 and  name    H5) 7.0 2.5 0.0
assign (resid   5 and  name    H1)(resid  18 and  name    H2) 7.0 2.5 0.0
assign (resid   5 and  name    H1)(resid  18 and  name   H62) 7.0 3.5 0.0
assign (resid   5 and  name    H1)(resid  16 and  name    H1) 5.5 2.0 0.0
assign (resid   5 and  name    H1)(resid   4 and  name    H3) 7.0 2.5 0.0
assign (resid   5 and  name   H1')(resid   6 and  name  H5'') 5.5 2.0 1.0
assign (resid   5 and  name   H1')(resid   6 and  name   H1') 7.0 2.5 0.0
assign (resid   5 and  name   H1')(resid   6 and  name    H5) 7.0 2.5 0.0
assign (resid   5 and  name   H1')(resid   4 and  name   H1') 7.0 2.5 0.0
!C6 intra
assign (resid   6 and  name   H2')(resid   6 and  name    H6) 3.0 1.4 1.0 !noebusug
assign (resid   6 and  name   H4')(resid   6 and  name    H6) 4.5 1.5 0.0 !3D sug
assign (resid   6 and  name  H5'*)(resid   6 and  name    H6) 7.0 3.5 0.0 !3D sug
assign (resid   6 and  name   H1')(resid   6 and  name   H2') 5.5 3.0 0.0 !noebuh1h5
assign (resid   6 and  name   H1')(resid   6 and  name   H5') 4.5 1.5 0.0 !noebuh1h5
assign (resid   6 and  name   H1')(resid   6 and  name    H6) 7.0 3.5 0.0 !noebuh1h5
assign (resid   6 and  name    H6)(resid   6 and  name   H5') 4.5 1.5 0.0 !noebuaro
assign (resid   6 and  name    H6)(resid   6 and  name    H5) 3.0 1.4 0.0!noebuaro
assign (resid   6 and  name    H6)(resid   6 and  name   H3') 4.5 1.5 0.0 !noebuaro
assign (resid   6 and  name    H6)(resid   6 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid   6 and  name    H5)(resid   6 and  name   H3') 4.5 1.5 1.0
assign (resid   6 and  name   H1')(resid   6 and  name  H5'') 4.5 1.5 0.0
!C6 inter
assign (resid   6 and  name    H5)(resid   5 and  name   H2') 5.5 2.0 0.0 !3D sug
assign (resid   6 and  name    H6)(resid   5 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid   6 and  name    H6)(resid   7 and  name    H5) 7.0 2.5 0.0
assign (resid   6 and  name   H1')(resid   7 and  name    H6) 7.0 3.5 0.0
assign (resid   6 and  name   H1')(resid   5 and  name   H2') 4.5 1.5 0.0
assign (resid   6 and  name    H6)(resid   5 and  name    H8) 5.5 2.0 0.0
assign (resid   6 and  name    H5)(resid   5 and  name    H8) 7.0 2.5 0.0
assign (resid   6 and  name    H6)(resid   5 and  name    H8) 7.0 3.5 0.0
assign (resid   6 and  name    H6)(resid   7 and  name    H6) 7.0 2.5 0.0
!C7 intra
assign (resid   7 and  name    H5)(resid   7 and  name   H3') 7.0 2.5 0.0 !3D sug
assign (resid   7 and  name   H4')(resid   7 and  name   H1') 4.5 1.5 0.0 !3D sug
assign (resid   7 and  name   H4')(resid   7 and  name    H6) 3.0 1.4 1.5 !3D sug
assign (resid   7 and  name   H2')(resid   7 and  name  H5'*) 3.0 1.4 2.0 !3D sug
assign (resid   7 and  name   H3')(resid   7 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid   7 and  name   H1')(resid   7 and  name   H2') 4.5 2.5 0.0 !noebuh1h5
assign (resid   7 and  name   H1')(resid   7 and  name   H3') 5.5 2.0 0.0 !noebuh1h5
assign (resid   7 and  name    H6)(resid   7 and  name   H3') 3.0 1.4 0.0 !noebuaro
assign (resid   7 and  name    H6)(resid   7 and  name    H5) 3.0 1.4 0.0 !noebuaro
assign (resid   7 and  name    H6)(resid   7 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid   7 and  name    H6)(resid   7 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid   7 and  name    H6)(resid   7 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid   7 and  name   H1')(resid   7 and  name  H5'') 4.5 1.5 1.0
assign (resid   7 and  name    H5)(resid   7 and  name  H5'') 7.0 2.5 0.0
!C7 inter
assign (resid   7 and  name    H5)(resid   6 and  name   H3') 5.5 2.0 0.0 !noebuh1h5
assign (resid   7 and  name    H5)(resid   6 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid   7 and  name    H6)(resid   6 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid   7 and  name    H6)(resid   6 and  name   H3') 4.5 0.5 0.5 !noebuaro
assign (resid   7 and  name   H42)(resid   6 and  name    N4) 5.5 1.0 1.0
assign (resid   7 and  name   H42)(resid  13 and  name    N6) 7.0 3.5 1.0
assign (resid   7 and  name   H41)(resid  13 and  name    N6) 7.0 3.5 1.0
assign (resid   7 and  name   H1')(resid   6 and  name   H2') 4.5 1.5 0.0
assign (resid   7 and  name    H5)(resid   6 and  name    H5) 5.5 2.0 0.0
!assign (resid   7 and  name    H5)(resid   6 and  name   H1') 6.0 0.0 9.0!anti
!U8 intra
assign (resid   8 and  name   H1')(resid   8 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid   8 and  name   H3')(resid   8 and  name    H6) 3.0 1.4 0.0 !3D sug
assign (resid   8 and  name   H3')(resid   8 and  name   H1') 3.0 1.4 1.0 !3D sug
assign (resid   8 and  name    H5)(resid   8 and  name   H3') 4.5 1.5 0.0 !noebuh1h5
assign (resid   8 and  name   H1')(resid   8 and  name   H4') 5.5 2.0 0.0 !noebuh1h5
assign (resid   8 and  name   H1')(resid   8 and  name    H6) 5.5 2.0 0.0 !noebuh1h5
assign (resid   8 and  name    H6)(resid   8 and  name    H5) 3.0 1.4 0.0
assign (resid   8 and  name   H1')(resid   8 and  name  H5'') 4.5 1.5 1.0
!U8 inter
assign (resid   8 and  name   H3')(resid   9 and  name    H5) 3.0 1.4 0.0 !noebusug
assign (resid   8 and  name    H5)(resid   7 and  name   H2') 5.5 2.0 0.0 !3D sug
assign (resid   8 and  name   H3')(resid   9 and  name    H6) 3.0 1.4 0.0 !3D sug
assign (resid   8 and  name   H1')(resid   7 and  name   H2') 7.0 2.5 0.0 !noebuh1h5
assign (resid   8 and  name   H1')(resid   9 and  name    H6) 5.5 2.0 0.0 !noebuh1h5
assign (resid   8 and  name    H6)(resid   7 and  name   H2') 3.0 1.4 0.0
assign (resid   8 and  name    H5)(resid   7 and  name    H6) 5.5 2.0 0.0
assign (resid   8 and  name   H1')(resid   9 and  name    H5) 7.0 2.5 0.0
!assign (resid   8 and  name    H5)(resid   6 and  name    H6) 7.0 0.0 9.0 !anti
!assign (resid   8 and  name    H5)(resid   6 and  name    H5) 7.0 0.0 9.0 !anti
!C9 intra
assign (resid   9 and  name   H4')(resid   9 and  name   H2') 4.5 1.5 0.0 !3D sug
assign (resid   9 and  name   H3')(resid   9 and  name    H6) 7.0 3.5 0.0!3D sug
assign (resid   9 and  name   H3')(resid   9 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid   9 and  name   H3')(resid   9 and  name   H4') 3.0 1.4 0.0 !3D sug
assign (resid   9 and  name   H1')(resid   9 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid   9 and  name    H5)(resid   9 and  name    H6) 3.0 1.4 0.0 !noebuh1h5
assign (resid   9 and  name    H6)(resid   9 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid   9 and  name    H5)(resid   9 and  name   H2') 7.0 2.5 0.0
!C9 inter
assign (resid   9 and  name    H5)(resid   8 and  name    H5) 5.5 2.0 0.0 !3D sug
assign (resid   9 and  name   H2')(resid  10 and  name    H6) 7.0 2.5 0.0 !3D sug
assign (resid   9 and  name   H2')(resid  10 and  name   H4') 7.0 2.5 0.0 !3D sug
assign (resid   9 and  name   H2')(resid  11 and  name    H6) 7.0 2.5 0.0 !3D sug
assign (resid   9 and  name   H3')(resid  10 and  name    H6) 7.0 2.5 0.0 !3D sug
assign (resid   9 and  name    H5)(resid   8 and  name   H2') 5.5 2.0 0.0 !noebuh1h5
assign (resid   9 and  name    H6)(resid   8 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid   9 and  name    H6)(resid   8 and  name  H5'') 4.5 1.5 2.0 !noebuaro
assign (resid   9 and  name    H5)(resid   8 and  name    H6) 5.5 2.0 0.0
assign (resid   9 and  name    H6)(resid   8 and  name    H6) 7.0 2.5 0.0
assign (resid   9 and  name    H6)(resid  10 and  name    H6) 7.0 2.5 0.0
!assign (resid   9 and  name    H5)(resid   6 and  name    H6) 7.0 0.0 9.0 !anti
!assign (resid   9 and  name    H5)(resid   6 and  name    H5) 7.0 0.0 9.0 !anti
!assign (resid   9 and  name    H5)(resid   7 and  name    H6) 7.0 0.0 9.0 !anti
!assign (resid   9 and  name    H5)(resid   7 and  name    H5) 7.0 0.0 9.0 !anti
!C10 intra
assign (resid  10 and  name    H5)(resid  10 and  name   H2') 7.0 2.5 0.0 !3D sug
assign (resid  10 and  name   H1')(resid  10 and  name   H3') 7.0 3.5 0.0 !3D sug
assign (resid  10 and  name   H3')(resid  10 and  name   H4') 4.5 1.5 0.0 !3D sug
assign (resid  10 and  name  H5'*)(resid  10 and  name   H4') 3.0 1.4 0.0 !3D sug
assign (resid  10 and  name   H1')(resid  10 and  name   H4') 5.5 2.0 0.0 !noebuh1h5
assign (resid  10 and  name   H1')(resid  10 and  name   H2') 4.5 2.0 0.0 !noebuh1h5
assign (resid  10 and  name    H6)(resid  10 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid  10 and  name    H6)(resid  10 and  name    H5) 4.5 2.0 0.0 !noebuaro
assign (resid  10 and  name    H6)(resid  10 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  10 and  name    H6)(resid  10 and  name   H3') 5.5 2.0 0.0 !noebuaro
assign (resid  10 and  name    H6)(resid  10 and  name  H5'*) 4.5 1.5 0.0 !noebuaro
assign (resid  10 and  name   H4')(resid  10 and  name    H6) 5.5 2.0 0.0
assign (resid  10 and  name   H1')(resid  10 and  name  H5'') 7.0 2.5 0.0
!C10 inter
assign (resid  10 and  name    H6)(resid   9 and  name   H4') 4.5 1.5 1.0 !3D aro
assign (resid  10 and  name   H4')(resid  11 and  name    H6) 7.0 2.5 0.0 !3D sug
assign (resid  10 and  name   H2')(resid   9 and  name   H2') 4.5 1.5 1.0 !3D sug
assign (resid  10 and  name  H5'*)(resid  11 and  name    H5) 5.5 3.0 1.0 !3D sug
assign (resid  10 and  name    H5)(resid   9 and  name   H5') 5.5 2.0 1.0 !noebuh1h5
assign (resid  10 and  name    H5)(resid   9 and  name   H4') 5.5 2.0 1.0 !noebuh1h5
assign (resid  10 and  name    H5)(resid   9 and  name  H5'*) 4.5 2.5 2.0
assign (resid  10 and  name   H4')(resid  11 and  name    H5) 4.5 1.5 1.0
assign (resid  10 and  name   H3')(resid  11 and  name  H5'*) 5.5 3.0 1.0
!C11 intra
assign (resid  11 and  name    H6)(resid  11 and  name   H4') 4.5 1.5 0.0 !noebusug
assign (resid  11 and  name   H1')(resid  11 and  name    H6) 7.0 3.5 0.0 !3D sug
assign (resid  11 and  name   H4')(resid  11 and  name   H1') 7.0 3.5 0.0 !3D sug
assign (resid  11 and  name   H3')(resid  11 and  name   H1') 7.0 3.5 0.0 !3D sug
assign (resid  11 and  name   H3')(resid  11 and  name   H4') 3.0 1.4 0.0 !3D sug
assign (resid  11 and  name   H2')(resid  11 and  name    H6) 3.0 1.4 0.0 !3D sug
assign (resid  11 and  name   H2')(resid  11 and  name  H5'*) 4.5 2.5 1.0 !3D sug
assign (resid  11 and  name   H2')(resid  11 and  name   H3') 3.0 1.4 0.0 !3D sug
assign (resid  11 and  name   H2')(resid  11 and  name   H1') 4.5 1.5 0.0 !3D sug
assign (resid  11 and  name  H5'*)(resid  11 and  name   H4') 3.0 1.4 0.0 !3D sug
assign (resid  11 and  name  H5'*)(resid  11 and  name   H3') 4.5 1.5 0.0 !3D sug
assign (resid  11 and  name  H5'*)(resid  11 and  name    H6) 7.0 3.5 0.0 !3D sug
assign (resid  11 and  name    H5)(resid  11 and  name   H2') 7.0 2.5 0.0 !noebuh1h5
assign (resid  11 and  name    H5)(resid  11 and  name    H6) 4.5 2.5 0.0 !noebuh1h5
assign (resid  11 and  name    H6)(resid  11 and  name   H3') 5.5 2.5 0.0 !noebuaro
assign (resid  11 and  name   H2')(resid  11 and  name   H4') 3.0 1.4 1.0
assign (resid  11 and  name    H5)(resid  11 and  name   H3') 7.0 2.5 0.0
assign (resid  11 and  name   H4')(resid  11 and  name  H5'*) 4.5 2.5 1.0
assign (resid  11 and  name   H3')(resid  11 and  name  H5'*) 3.0 1.4 1.0 !noebusug
!C11 inter
assign (resid  11 and  name   H4')(resid  12 and  name   H3') 3.0 1.4 1.5 !noebusug
assign (resid  11 and  name    H5)(resid   9 and  name   H3') 7.0 3.0 0.0 !3D sug
assign (resid  11 and  name    H5)(resid   9 and  name   H2') 4.5 2.0 0.0 !noebuh1h5
assign (resid  11 and  name    H5)(resid  10 and  name   H2') 5.5 2.0 0.0 !noebuh1h5
assign (resid  11 and  name    H5)(resid  10 and  name   H3') 4.5 1.5 0.0 !noebuh1h5
assign (resid  11 and  name    H6)(resid  10 and  name   H3') 3.0 1.4 0.0 !noebuaro
assign (resid  11 and  name    H6)(resid  10 and  name  H5'*) 5.5 2.0 0.0 !noebuaro
assign (resid  11 and  name    H6)(resid  10 and  name   H2') 5.5 2.0 0.0 !noebuaro
assign (resid  11 and  name   H4')(resid  10 and  name   H4') 7.0 2.5 0.0
assign (resid  11 and  name    H6)(resid  10 and  name    H6) 7.0 2.5 0.0
assign (resid  11 and  name   H41)(resid  12 and  name   H21) 5.5 2.0 1.5
assign (resid  11 and  name   H42)(resid  12 and  name   H22) 5.5 2.0 1.5
assign (resid  11 and  name   H41)(resid  12 and  name   H22) 5.5 2.0 1.5
assign (resid  11 and  name   H42)(resid  12 and  name   H21) 5.5 2.0 1.5
!G12 intra
assign (resid  12 and  name   H4')(resid  12 and  name    H8) 7.0 2.5 0.0 !noebusug
assign (resid  12 and  name  H5'*)(resid  12 and  name    H8) 7.0 2.5 1.0 !noebusug
assign (resid  12 and  name   H2')(resid  12 and  name   H4') 3.0 1.4 1.0 !3D sug
assign (resid  12 and  name  H5'*)(resid  12 and  name   H4') 3.0 1.4 1.0 !3D sug
assign (resid  12 and  name   H1')(resid  12 and  name   H4') 5.5 2.0 0.0 !noebuh1h5
assign (resid  12 and  name   H2')(resid  12 and  name  H5'*) 5.5 2.0 1.0 !noebuh1h5
!assign (resid  12 and  name   H3')(resid  12 and  name  H5'*) 4.5 1.5 1.0 !noebuh1h5
assign (resid  12 and  name   H2')(resid  12 and  name   H3') 3.0 1.4 0.0 !noebuh1h5
assign (resid  12 and  name   H2')(resid  12 and  name   H1') 4.5 1.5 0.0 !noebuh1h5
assign (resid  12 and  name    H8)(resid  12 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid  12 and  name    H8)(resid  12 and  name   H1') 3.0 1.4 0.0 !noebuaro
assign (resid  12 and  name  H5'*)(resid  12 and  name   H3') 3.0 1.4 1.0 !noebusug
assign (resid  12 and  name   H4')(resid  12 and  name   H3') 3.0 1.4 1.0 !noebusug
assign (resid  12 and  name    H8)(resid  12 and  name   H3') 5.5 2.0 0.0
assign (resid  12 and  name    H8)(resid  12 and  name  H5'*) 5.5 3.0 1.0
assign (resid  12 and  name   H1')(resid  12 and  name   H3') 4.5 1.5 0.0
assign (resid  12 and  name   H1')(resid  12 and  name  H5'*) 5.5 2.0 0.0
!G12 inter
assign (resid  12 and  name   H2')(resid  13 and  name   H2') 7.0 2.5 0.0 !noebusug
assign (resid  12 and  name   H4')(resid  11 and  name   H4') 5.5 2.0 0.0 !3D sug
assign (resid  12 and  name  H5'*)(resid  11 and  name   H4') 3.0 1.4 1.0 !3D sug
assign (resid  12 and  name    H8)(resid  11 and  name   H4') 7.0 2.5 0.0
assign (resid  12 and  name   H1')(resid  11 and  name   H4') 7.0 2.5 0.0
assign (resid  12 and  name    H8)(resid  13 and  name    H8) 7.0 2.5 0.5
assign (resid  12 and  name    H8)(resid  11 and  name  H5'*) 7.0 2.5 1.0
assign (resid  12 and  name  H5'*)(resid  11 and  name  H5'*) 5.5 3.0 1.0
assign (resid  12 and  name  H5'*)(resid  11 and  name  H5'*) 5.5 3.0 1.0
!A13 intra
assign (resid  13 and  name    H8)(resid  13 and  name   H2') 4.5 1.5 0.0 !3D aro
assign (resid  13 and  name   H1')(resid  13 and  name   H3') 7.0 3.5 0.0 !3D sug
assign (resid  13 and  name  H5'*)(resid  13 and  name   H4') 3.0 1.4 0.0 !3D sug
assign (resid  13 and  name    H8)(resid  13 and  name   H4') 4.5 1.5 0.0 !noebuaro
assign (resid  13 and  name    H8)(resid  13 and  name  H5'*) 4.5 1.5 1.0 !noebuaro
assign (resid  13 and  name   H3')(resid  13 and  name    H8) 4.5 2.5 0.0
assign (resid  13 and  name   H1')(resid  13 and  name    H8) 7.0 3.5 0.0
assign (resid  13 and  name    H2)(resid  13 and  name   H2') 7.0 2.5 0.0
!A13 inter
assign (resid  13 and  name    H8)(resid  12 and  name   H1') 5.5 2.5 0.5 !3D aro
assign (resid  13 and  name    H8)(resid  12 and  name   H2') 5.5 2.5 0.0
assign (resid  13 and  name    H2)(resid   9 and  name   H1') 4.5 1.5 0.0 !noebuaro
assign (resid  13 and  name   H3')(resid  14 and  name    H8) 5.5 2.0 0.0
assign (resid  13 and  name   H2')(resid  14 and  name   H1') 5.5 2.0 0.0
assign (resid  13 and  name    H2)(resid   9 and  name    H6) 7.0 2.5 0.0
assign (resid  13 and  name    H8)(resid  12 and  name   H3') 4.5 1.5 0.0
assign (resid  13 and  name    H2)(resid  14 and  name    H8) 7.0 2.5 0.0
!G14 intra
assign (resid  14 and  name   H1')(resid  14 and  name   H3') 7.0 3.5 0.0 !3D sug
assign (resid  14 and  name   H4')(resid  14 and  name   H1') 7.0 3.5 0.0 !3D sug
assign (resid  14 and  name   H4')(resid  14 and  name    H8) 7.0 2.5 0.0 !3D sug
assign (resid  14 and  name   H4')(resid  14 and  name  H5'*) 3.0 1.4 1.0 !3D sug
assign (resid  14 and  name   H2')(resid  14 and  name    H8) 4.5 1.5 0.0 !3D sug
assign (resid  14 and  name   H2')(resid  14 and  name   H3') 4.5 2.5 0.0 !3D sug
assign (resid  14 and  name   H1')(resid  14 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid  14 and  name    H8)(resid  14 and  name   H3') 4.5 1.5 0.0 !noebuaro
assign (resid  14 and  name   H1')(resid  14 and  name    H8) 5.5 2.0 0.0
assign (resid  14 and  name  H5'*)(resid  14 and  name    H8) 5.5 3.0 1.0
!G14 inter
assign (resid  14 and  name   H1')(resid  15 and  name  H5'*) 5.5 3.0 1.0 !noebuh1h5
assign (resid  14 and  name   H1')(resid  13 and  name    H2) 4.5 1.5 0.0 !noebuh1h5
assign (resid  14 and  name    H8)(resid  13 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid  14 and  name    H1)(resid   7 and  name   H41) 3.0 1.4 0.0
assign (resid  14 and  name    H1)(resid   7 and  name   H42) 4.5 1.5 0.0
assign (resid  14 and  name    H1)(resid   7 and  name    H5) 7.0 2.5 0.0
assign (resid  14 and  name   H1')(resid  15 and  name    H6) 7.0 2.5 0.0
!U15 intra
assign (resid  15 and  name   H4')(resid  15 and  name  H5'*) 3.0 1.4 2.0 !3D sug
assign (resid  15 and  name   H2')(resid  15 and  name   H3') 3.0 1.4 0.0!3D sug
assign (resid  15 and  name   H2')(resid  15 and  name  H5'*) 3.0 1.4 2.0 !3D sug
assign (resid  15 and  name   H2')(resid  15 and  name    H6) 4.5 2.5 1.0 !3D sug
assign (resid  15 and  name   H1')(resid  15 and  name    H6) 4.5 1.5 0.0 !noebuh1h5
assign (resid  15 and  name    H5)(resid  15 and  name    H6) 3.0 1.4 0.0 !noebuh1h5
assign (resid  15 and  name    H6)(resid  15 and  name   H3') 3.0 1.4 1.0 !noebuaro
assign (resid  15 and  name    H6)(resid  15 and  name   H4') 3.0 1.4 1.0 !noebuaro
assign (resid  15 and  name    H6)(resid  15 and  name  H5'*) 5.5 2.0 1.0 !noebuaro
assign (resid  15 and  name   H4')(resid  15 and  name   H1') 4.5 1.5 0.0
!U15 inter
assign (resid  15 and  name    H6)(resid  14 and  name   H2') 5.5 2.0 0.0 !noebuaro
assign (resid  15 and  name    H5)(resid  14 and  name   H2') 7.0 2.0 0.0
!G16 intra
assign (resid  16 and  name   H1')(resid  16 and  name    H8) 4.5 1.5 0.0 !3D sug
assign (resid  16 and  name   H4')(resid  16 and  name   H3') 5.5 2.0 0.0 !3D sug
assign (resid  16 and  name   H4')(resid  16 and  name    H8) 7.0 2.5 0.0 !3D sug
assign (resid  16 and  name   H2')(resid  16 and  name  H5'*) 4.5 2.5 1.0 !3D sug
assign (resid  16 and  name   H3')(resid  16 and  name  H5'*) 5.5 3.0 1.0 !3D sug
assign (resid  16 and  name   H3')(resid  16 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid  16 and  name   H3')(resid  16 and  name   H1') 3.0 1.4 1.0 !3D sug
assign (resid  16 and  name  H5'*)(resid  16 and  name   H4') 3.0 1.4 0.0 !3D sug
assign (resid  16 and  name  H5'*)(resid  16 and  name    H8) 7.0 3.5 0.0 !3D sug
assign (resid  16 and  name   H1')(resid  16 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid  16 and  name   H1')(resid  16 and  name   H4') 5.5 2.0 0.0 !noebuh1h5
assign (resid  16 and  name    H8)(resid  16 and  name   H3') 3.0 1.4 1.0 !noebuaro
assign (resid  16 and  name    H8)(resid  16 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid  16 and  name    H8)(resid  16 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid  16 and  name   H1')(resid  16 and  name  H5'') 4.5 1.5 1.0
assign (resid  16 and  name  H5'')(resid  16 and  name   H2') 4.5 1.5 1.0
assign (resid  16 and  name   H1')(resid  16 and  name   H5') 5.5 2.0 0.0
!G16 inter
assign (resid  16 and  name    H8)(resid  14 and  name   H2') 7.0 2.5 0.0 !3D aro
assign (resid  16 and  name   H1')(resid  15 and  name   H4') 7.0 2.5 0.0 !noebuh1h5
assign (resid  16 and  name    H1)(resid  17 and  name    N4) 7.0 2.5 0.0
assign (resid  16 and  name    H1)(resid   6 and  name   H41) 3.0 1.4 0.0
assign (resid  16 and  name    H1)(resid   6 and  name   H42) 4.5 1.5 0.0
assign (resid  16 and  name    H1)(resid   7 and  name   H1') 5.5 2.0 0.0
assign (resid  16 and  name    H1)(resid  17 and  name   H1') 7.0 2.5 0.0
assign (resid  16 and  name    H1)(resid  17 and  name   H42) 7.0 2.5 0.0
assign (resid  16 and  name    H8)(resid  14 and  name   H3') 4.5 1.5 0.0 !noebuaro
assign (resid  16 and  name   H1')(resid  17 and  name    H5) 5.5 2.0 0.0
assign (resid  16 and  name    H8)(resid  15 and  name   H3') 5.5 2.0 0.0
assign (resid  16 and  name    H8)(resid  17 and  name    H5) 5.5 2.0 0.0
assign (resid  16 and  name    H8)(resid  15 and  name   H4') 7.0 2.5 0.0
assign (resid  16 and  name    H8)(resid  15 and  name   H2') 7.0 2.5 0.0
assign (resid  16 and  name    H8)(resid  15 and  name   H3') 7.0 2.5 0.0
assign (resid  16 and  name   H1')(resid  15 and  name   H3') 7.0 2.5 0.0
assign (resid  16 and  name   H1')(resid  15 and  name   H2') 7.0 2.5 0.0
assign (resid  16 and  name   H1')(resid  15 and  name   H1') 5.5 2.0 0.0
!C17 intra
assign (resid  17 and  name    H6)(resid  17 and  name  H5'*) 3.0 1.4 2.0 !3D aro
assign (resid  17 and  name   H4')(resid  17 and  name    H6) 5.5 2.0 0.0 !3D sug
assign (resid  17 and  name   H4')(resid  17 and  name   H1') 7.0 3.5 0.0 !3D sug
assign (resid  17 and  name   H2')(resid  17 and  name    H6) 7.0 3.5 0.0 !3D sug
assign (resid  17 and  name   H1')(resid  17 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid  17 and  name    H6)(resid  17 and  name    H5) 3.0 1.4 0.0 !noebuaro
assign (resid  17 and  name    H6)(resid  17 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid  17 and  name    H5)(resid  17 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  17 and  name    H6)(resid  17 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  17 and  name    H5)(resid  17 and  name   H3') 7.0 2.5 0.0
assign (resid  17 and  name    H5)(resid  17 and  name   H5') 7.0 2.5 0.0
assign (resid  17 and  name    H5)(resid  17 and  name   H2') 7.0 2.5 0.0
assign (resid  17 and  name    H5)(resid  17 and  name  H5'') 7.0 2.5 0.0
!C17 inter
assign (resid  17 and  name    H6)(resid  16 and  name   H3') 4.5 1.5 0.0 !3D aro
assign (resid  17 and  name    H5)(resid  16 and  name   H2') 4.5 1.5 0.0 !3D sug
assign (resid  17 and  name    H5)(resid  16 and  name   H3') 7.0 2.5 0.0 !3D sug
assign (resid  17 and  name   H3')(resid  18 and  name    H8) 5.5 2.0 0.0 !3D sug
assign (resid  17 and  name   H2')(resid  18 and  name    H8) 3.0 1.4 0.0 !3D sug
assign (resid  17 and  name   H1')(resid  18 and  name  H5'') 5.5 2.0 0.0 !noebuh1h5
assign (resid  17 and  name    H6)(resid  16 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid  17 and  name    H6)(resid  16 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  17 and  name   H41)(resid  18 and  name    N6) 4.5 2.5 1.0
assign (resid  17 and  name   H41)(resid   6 and  name    N4) 7.0 3.5 1.0
assign (resid  17 and  name   H1')(resid  16 and  name   H2') 5.5 2.0 0.0
!A18 intra
assign (resid  18 and  name    H8)(resid  18 and  name  H5'*) 5.5 3.0 1.0 !3D aro
assign (resid  18 and  name   H1')(resid  18 and  name   H2') 3.0 1.4 1.0 !3D sug
assign (resid  18 and  name   H1')(resid  18 and  name   H3') 7.0 3.5 0.0 !3D sug
assign (resid  18 and  name   H4')(resid  18 and  name   H1') 5.5 2.0 0.0 !3D sug
assign (resid  18 and  name   H4')(resid  18 and  name  H5'*) 3.0 1.4 1.0 !3D sug
assign (resid  18 and  name    H8)(resid  18 and  name   H3') 3.0 1.4 0.0 !noebuaro
assign (resid  18 and  name    H8)(resid  18 and  name  H5'') 4.5 1.5 0.0 !noebuaro
assign (resid  18 and  name    H8)(resid  18 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  18 and  name    H8)(resid  18 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid  18 and  name   H4')(resid  18 and  name    H8) 3.0 1.4 1.0 !noebusug
assign (resid  18 and  name    H2)(resid  18 and  name   H1') 7.0 2.5 0.0
!A18 inter
assign (resid  18 and  name    H8)(resid  19 and  name    H6) 5.5 2.0 0.0 !3D aro
assign (resid  18 and  name    H8)(resid  17 and  name   H1') 5.5 2.0 0.0 !3D aro
assign (resid  18 and  name   H1')(resid  17 and  name   H2') 5.5 2.0 1.0 !noebuh1h5
assign (resid  18 and  name   H1')(resid  19 and  name    H6) 7.0 2.5 0.0 !noebuh1h5
assign (resid  18 and  name    H2)(resid   5 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  18 and  name    H2)(resid   5 and  name    N2) 7.0 3.5 1.0
assign (resid  18 and  name    H8)(resid  17 and  name    H6) 5.5 2.0 0.0
assign (resid  18 and  name    H8)(resid  17 and  name   H5') 7.0 2.5 0.0
assign (resid  18 and  name   H1')(resid  19 and  name    H5) 7.0 2.5 0.0
assign (resid  18 and  name    H8)(resid  17 and  name  H5'') 7.0 2.5 0.0
assign (resid  18 and  name   H1')(resid  17 and  name   H1') 7.0 2.5 0.0
assign (resid  18 and  name    H8)(resid  17 and  name    H5) 7.0 2.5 0.0
!U19 intra
assign (resid  19 and  name   H3')(resid  19 and  name   H1') 3.0 1.4 1.0 !3D sug
assign (resid  19 and  name  H5'*)(resid  19 and  name    H6) 5.5 3.0 1.0 !3D sug
assign (resid  19 and  name   H4')(resid  19 and  name   H1') 4.5 1.5 0.0 !noebusug
assign (resid  19 and  name   H1')(resid  19 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid  19 and  name    H5)(resid  19 and  name    H6) 3.0 1.4 0.0 !noebuh1h5
assign (resid  19 and  name    H6)(resid  19 and  name   H4') 3.0 1.4 1.0 !noebuaro
assign (resid  19 and  name    H6)(resid  19 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  19 and  name    H6)(resid  19 and  name  H5'') 5.5 2.0 0.0 !noebuaro
assign (resid  19 and  name    H3)(resid  19 and  name    H5) 7.0 2.5 0.0
assign (resid  19 and  name    H5)(resid  19 and  name   H3') 5.5 2.0 0.0
assign (resid  19 and  name   H1')(resid  19 and  name  H5'') 5.5 2.0 0.0
assign (resid  19 and  name   H1')(resid  19 and  name    H5) 7.0 2.5 0.0
!U19 inter
assign (resid  19 and  name   H2')(resid  20 and  name   H1') 3.0 1.4 3.0 !noebusug
assign (resid  19 and  name    H5)(resid  18 and  name   H2') 7.0 3.5 0.0 !noebuh1h5
assign (resid  19 and  name   H1')(resid  18 and  name    H2) 5.5 2.0 0.0 !noebuh1h5
assign (resid  19 and  name    H6)(resid  18 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid  19 and  name    H6)(resid  18 and  name   H3') 4.5 1.5 0.0 !noebuaro
assign (resid  19 and  name    H3)(resid   3 and  name    H2) 3.0 1.4 0.0
assign (resid  19 and  name    H3)(resid   3 and  name   H61) 4.5 2.5 0.0
assign (resid  19 and  name    H3)(resid  20 and  name   H41) 7.0 2.5 0.0
assign (resid  19 and  name    H3)(resid   3 and  name   H62) 4.5 1.5 0.0
assign (resid  19 and  name    H3)(resid  20 and  name   H42) 7.0 2.5 0.0
assign (resid  19 and  name    H3)(resid  18 and  name    H2) 4.5 1.5 0.0
assign (resid  19 and  name    H3)(resid  20 and  name    H5) 5.5 2.0 0.0
assign (resid  19 and  name    H3)(resid   4 and  name   H1') 7.0 2.5 0.0
assign (resid  19 and  name    H5)(resid  18 and  name   H3') 4.5 1.5 0.0
assign (resid  19 and  name    H5)(resid  18 and  name    H8) 7.0 2.5 0.0
!C20 intra
assign (resid  20 and  name   H1')(resid  20 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid  20 and  name   H1')(resid  20 and  name    H6) 5.5 2.0 0.0 !3D sug
assign (resid  20 and  name   H3')(resid  20 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid  20 and  name   H1')(resid  20 and  name   H5') 5.5 2.0 0.0 !noebuh1h5
assign (resid  20 and  name   H1')(resid  20 and  name   H4') 5.5 2.0 0.0 !noebuh1h5
assign (resid  20 and  name    H6)(resid  20 and  name   H4') 4.5 1.5 0.0 !noebuaro
assign (resid  20 and  name    H6)(resid  20 and  name   H5') 3.0 1.4 1.0 !noebuaro
assign (resid  20 and  name    H6)(resid  20 and  name    H5) 3.0 1.4 0.0 !noebuaro
assign (resid  20 and  name    H6)(resid  20 and  name   H2') 5.5 2.0 0.0 !noebuaro
assign (resid  20 and  name   H1')(resid  20 and  name   H3') 3.0 1.4 1.0
assign (resid  20 and  name   H1')(resid  20 and  name  H5'') 4.5 1.5 1.0
!C20 inter
assign (resid  20 and  name    H5)(resid  19 and  name    H5) 7.0 3.5 0.0 !3D sug
assign (resid  20 and  name    H5)(resid  19 and  name   H2') 5.5 2.0 0.0 !noebuh1h5
assign (resid  20 and  name   H1')(resid   3 and  name    H2) 4.5 1.5 0.0 !noebuh1h5
assign (resid  20 and  name   H1')(resid  21 and  name    H6) 5.5 2.0 0.0 !noebuh1h5
assign (resid  20 and  name    H6)(resid  19 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid  20 and  name   H41)(resid   3 and  name    N6) 4.5 2.5 1.0
assign (resid  20 and  name    H6)(resid  21 and  name    H6) 5.5 2.0 0.0
assign (resid  20 and  name    H6)(resid  19 and  name    H6) 5.5 2.0 0.0
!C21 intra
assign (resid  21 and  name   H3')(resid  21 and  name    H5) 3.0 1.4 2.0 !noebusug
assign (resid  21 and  name    H5)(resid  21 and  name   H2') 7.0 2.5 0.0 !3D sug
assign (resid  21 and  name   H4')(resid  21 and  name   H1') 4.5 1.5 0.0 !3D sug
assign (resid  21 and  name   H4')(resid  21 and  name    H6) 5.5 2.0 0.0 !3D sug
assign (resid  21 and  name   H2')(resid  21 and  name   H4') 3.0 1.4 1.0 !3D sug
assign (resid  21 and  name   H3')(resid  21 and  name   H2') 3.0 1.4 0.0 !3D sug
assign (resid  21 and  name   H3')(resid  21 and  name   H1') 5.5 2.0 0.0 !3D sug
assign (resid  21 and  name  H5'*)(resid  21 and  name   H4') 3.0 1.4 1.0 !3D sug
assign (resid  21 and  name   H1')(resid  21 and  name   H2') 4.5 1.5 0.0 !noebuh1h5
assign (resid  21 and  name   H1')(resid  21 and  name  H5'') 7.0 2.5 0.0 !noebuh1h5
assign (resid  21 and  name    H6)(resid  21 and  name   H3') 3.0 1.4 0.0 !noebuaro
assign (resid  21 and  name    H6)(resid  21 and  name   H1') 5.5 2.0 0.0 !noebuaro
assign (resid  21 and  name    H6)(resid  21 and  name    H5) 3.0 1.4 0.0 !noebuaro
assign (resid  21 and  name    H6)(resid  21 and  name   H2') 4.5 1.5 0.0 !noebuaro
assign (resid  21 and  name    H6)(resid  21 and  name   H5') 4.5 1.5 0.0 !noebuaro
assign (resid  21 and  name   H1')(resid  21 and  name   H5') 5.5 2.0 0.0
assign (resid  21 and  name  H5'')(resid  21 and  name    H6) 5.5 2.0 0.0
!C21 inter
assign (resid  21 and  name    H5)(resid  20 and  name    H6) 7.0 2.5 0.0 !3D sug
assign (resid  21 and  name    H5)(resid  20 and  name   H3') 7.0 2.5 0.0 !3D sug
assign (resid  21 and  name    H5)(resid  20 and  name   H2') 7.0 3.5 0.0 !noebuh1h5
assign (resid  21 and  name   H1')(resid  20 and  name   H2') 7.0 2.5 0.0 !noebuh1h5
assign (resid  21 and  name    H6)(resid  20 and  name   H2') 3.0 1.4 0.0 !noebuaro
assign (resid  21 and  name   H41)(resid  20 and  name    N4) 4.5 2.5 1.0
     {GAU                        CYT}
assi (resi   1 and name   H1) (resi  21 and name   N3)  2.00  0.20  0.00
assi (resi   1 and name   N1) (resi  21 and name   N3)  2.90  0.30  0.00
assi (resi   1 and name   O6) (resi  21 and name  H41)  2.00  0.20  0.00
assi (resi   1 and name   O6) (resi  21 and name   N4)  2.90  0.30  0.00
assi (resi   1 and name  H21) (resi  21 and name   O2)  2.00  0.20  0.00
assi (resi   1 and name   N2) (resi  21 and name   O2)  2.90  0.30  0.00

     {GAU                        CYT}
assi (resi   2 and name   H1) (resi  20 and name   N3)  2.00  0.20  0.00
assi (resi   2 and name   N1) (resi  20 and name   N3)  2.90  0.30  0.00
assi (resi   2 and name   O6) (resi  20 and name  H41)  2.00  0.20  0.00
assi (resi   2 and name   O6) (resi  20 and name   N4)  2.90  0.30  0.00
assi (resi   2 and name  H21) (resi  20 and name   O2)  2.00  0.20  0.00
assi (resi   2 and name   N2) (resi  20 and name   O2)  2.90  0.30  0.00

     {URI                        ADE}
assi (resi  19 and name   H3) (resi  3 and name   N1)  2.00  0.20  0.00
assi (resi  19 and name   N3) (resi  3 and name   N1)  2.90  0.30  0.00
assi (resi  19 and name   O4) (resi  3 and name  H61)  2.00  0.20  0.00
assi (resi  19 and name   O4) (resi  3 and name   N6)  2.90  0.30  0.00

     {URI                        ADE}
assi (resi   4 and name   H3) (resi  18 and name   N1)  2.00  0.20  0.00
assi (resi   4 and name   N3) (resi  18 and name   N1)  2.90  0.30  0.00
assi (resi   4 and name   O4) (resi  18 and name  H61)  2.00  0.20  0.00
assi (resi   4 and name   O4) (resi  18 and name   N6)  2.90  0.30  0.00

     {GAU                        CYT}
assi (resi   5 and name   H1) (resi  17 and name   N3)  2.00  0.20  0.00
assi (resi   5 and name   N1) (resi  17 and name   N3)  2.90  0.30  0.00
assi (resi   5 and name   O6) (resi  17 and name  H41)  2.00  0.20  0.00
assi (resi   5 and name   O6) (resi  17 and name   N4)  2.90  0.30  0.00
assi (resi   5 and name  H21) (resi  17 and name   O2)  2.00  0.20  0.00
assi (resi   5 and name   N2) (resi  17 and name   O2)  2.90  0.30  0.00

     {GAU                        CYT}
assi (resi  16 and name   H1) (resi   6 and name   N3)  2.00  0.20  0.00
assi (resi  16 and name   N1) (resi   6 and name   N3)  2.90  0.30  0.00
assi (resi  16 and name   O6) (resi   6 and name  H41)  2.00  0.20  0.00
assi (resi  16 and name   O6) (resi   6 and name   N4)  2.90  0.30  0.00
assi (resi  16 and name  H21) (resi   6 and name   O2)  2.00  0.20  0.00
assi (resi  16 and name   N2) (resi   6 and name   O2)  2.90  0.30  0.00

     {GAU                        CYT}
assi (resi   14 and name   H1) (resi  7 and name   N3)  2.00  0.20  0.00
assi (resi   14 and name   N1) (resi  7 and name   N3)  2.90  0.30  0.00
assi (resi   14 and name   O6) (resi  7 and name  H41)  2.00  0.20  0.00
assi (resi   14 and name   O6) (resi  7 and name   N4)  2.90  0.30  0.00
assi (resi   14 and name  H21) (resi  7 and name   O2)  2.00  0.20  0.00
assi (resi   14 and name   N2) (resi  7 and name   O2)  2.90  0.30  0.00

     {URI                        ADE}
assi (resi   8 and name   H3) (resi  13 and name   N1)  2.00  0.20  0.00
assi (resi   8 and name   N3) (resi  13 and name   N1)  2.90  0.30  0.00
assi (resi   8 and name   O4) (resi  13 and name  H61)  2.00  0.20  0.00
assi (resi   8 and name   O4) (resi  13 and name   N6)  2.90  0.30  0.00

assi (resi  12 and name   H1) (resi   9 and name   O2)  2.00  0.20  0.00
assi (resi  12 and name   N1) (resi   9 and name   O2)  2.90  0.30  0.00
assi (resi  12 and name  H21) (resi   9 and name   O2)  2.00  0.20  0.00
assi (resi  12 and name   N2) (resi   9 and name   O2)  2.90  0.30  0.00
!b2_xchidi.dihe{*all bases except G12 and loosely constrinaed to anti*}
 assign (resi 1 and name O4'  )
        (resi 1 and name C1'  )
        (resi 1 and name N9   )
        (resi 1 and name C4   )   1.0   -160.0  60.0  2 !{full anti range}
        !{-60 to -180}
 assign (resi 2 and name O4'  )
        (resi 2 and name C1'  )
        (resi 2 and name N9   )
        (resi 2 and name C4   )   1.0   -158.0  20.0  2

 assign (resi 3 and name O4'  )
        (resi 3 and name C1'  )
        (resi 3 and name N9   )
        (resi 3 and name C4   )   1.0   -158.0  20.0  2

 assign (resi 4 and name O4'  )
        (resi 4 and name C1'  )
        (resi 4 and name N1   )
        (resi 4 and name C2   )   1.0   -159.0  21.0  2

 assign (resi 5 and name O4'  )
        (resi 5 and name C1'  )
        (resi 5 and name N9   )
        (resi 5 and name C4   )   1.0   -158.0  20.0  2

 assign (resi 6 and name O4'  )
        (resi 6 and name C1'  )
        (resi 6 and name N1   )
        (resi 6 and name C2   )   1.0   -159.0  21.0  2

 assign (resi 7 and name O4'  )
        (resi 7 and name C1'  )
        (resi 7 and name N1   )
        (resi 7 and name C2   )   1.0   -159.0  21.0  2
 
 assign (resi 8 and name O4'  )
        (resi 8 and name C1'  )
        (resi 8 and name N1   )
        (resi 8 and name C2   )   1.0   -159.0  21.0  2 

 assign (resi 9 and name O4'  )
        (resi 9 and name C1'  )
        (resi 9 and name N1   )
        (resi 9 and name C2   )   1.0   -120.0  60.0  2

 assign (resi 10 and name O4'  )
        (resi 10 and name C1'  )
        (resi 10 and name N1   )
        (resi 10 and name C2   )   1.0  -120.0  60.0  2

 assign (resi 11 and name O4'  )
        (resi 11 and name C1'  )
        (resi 11 and name N1   )
        (resi 11 and name C2   )   1.0  -120.0  60.0  2

 assign (resi 12 and name O4'  )
        (resi 12 and name C1'  )
        (resi 12 and name N9   )
        (resi 12 and name C4   )   1.0   60.0  30.0  2

 assign (resi 13 and name O4'  )
        (resi 13 and name C1'  )
        (resi 13 and name N9   )
        (resi 13 and name C4   )   1.0   -120.0  60.0  2

 assign (resi 14 and name O4'  )
        (resi 14 and name C1'  )
        (resi 14 and name N9   )
        (resi 14 and name C4   )   1.0   -120.0  60.0  2

 assign (resi 15 and name O4'  )
        (resi 15 and name C1'  )
        (resi 15 and name N1   )
        (resi 15 and name C2   )   1.0   -120.0  60.0 2

 assign (resi 16 and name O4'  )
        (resi 16 and name C1'  )
        (resi 16 and name N9   )
        (resi 16 and name C4   )   1.0   -120.0  60.0  2

 assign (resi 17 and name O4'  )
        (resi 17 and name C1'  )
        (resi 17 and name N1   )
        (resi 17 and name C2   )   1.0   -159.0  21.0  2

 assign (resi 18 and name O4'  )
        (resi 18 and name C1'  )
        (resi 18 and name N9   )
        (resi 18 and name C4   )   1.0   -158.0  20.0  2

 assign (resi 19 and name O4'  )
        (resi 19 and name C1'  )
        (resi 19 and name N1   )
        (resi 19 and name C2   )   1.0   -159.0  21.0  2

 assign (resi 20 and name O4'  )
        (resi 20 and name C1'  )
        (resi 20 and name N1   )
        (resi 20 and name C2   )   1.0   -159.0  21.0 2

 assign (resi 21 and name O4'  )
        (resi 21 and name C1'  )
        (resi 21 and name N1   )
        (resi 21 and name C2   )   1.0   -147.5  32.5 2

 assign (resi 2 and name  P   )
        (resi 2 and name O5'  )
        (resi 2 and name C5'  )
        (resi 2 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 3 and name  P   )
        (resi 3 and name O5'  )
        (resi 3 and name C5'  )
        (resi 3 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 4 and name  P   )
        (resi 4 and name O5'  )
        (resi 4 and name C5'  )
        (resi 4 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 5 and name  P   )
        (resi 5 and name O5'  )
        (resi 5 and name C5'  )
        (resi 5 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 6 and name  P   )
        (resi 6 and name O5'  )
        (resi 6 and name C5'  )
        (resi 6 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 7 and name  P   )
        (resi 7 and name O5'  )
        (resi 7 and name C5'  )
        (resi 7 and name C4'  )   1.0   180.0  30.0  2

assign  (resi 8 and name  P   )
        (resi 8 and name O5'  )
        (resi 8 and name C5'  )
        (resi 8 and name C4'  )   1.0  180.0  30.0  2 

assign  (resi 9 and name  P   )
        (resi 9 and name O5'  )
        (resi 9 and name C5'  )
        (resi 9 and name C4'  )   1.0   180.0  30.0  2

 assign (resi 11 and name  P   )
        (resi 11 and name O5'  )
        (resi 11 and name C5'  )
        (resi 11 and name  C4' )   1.0   180.0  30.0  2 

 assign (resi 15 and name  P   )
        (resi 15 and name O5'  )
        (resi 15 and name C5'  )
        (resi 15 and name  C4' )   1.0   180.0  60.0  2 
 
 assign (resi 16 and name  P   )
        (resi 16 and name O5'  )
        (resi 16 and name C5'  )
        (resi 16 and name  C4' )   1.0   120.0  30.0  2 

 assign (resi 17 and name  P   )
        (resi 17 and name O5'  )
        (resi 17 and name C5'  )
        (resi 17 and name C4'  )   1.0   180.0   30.0  2

assign  (resi 18 and name  P   )
        (resi 18 and name O5'  )
        (resi 18 and name C5'  )
        (resi 18 and name C4'  )   1.0   180.0  30.0  2

assign  (resi 19 and name  P   )
        (resi 19 and name O5'  )
        (resi 19 and name C5'  )
        (resi 19 and name C4'  )   1.0   180.0  30.0  2

assign (resi 20 and name  P   )
       (resi 20 and name O5'  )
       (resi 20 and name C5'  )
       (resi 20 and name C4'  )   1.0   180.0  30.0  2

assign (resi 21 and name  P   )
        (resi 21 and name O5'  )
        (resi 21 and name C5'  )
        (resi 21 and name C4'  )   1.0   180.0  30.0  2
 assign (resi 1 and name C4'  )
        (resi 1 and name C3'  )
        (resi 1 and name O3'  )
        (resi 2 and name  P   )   1.0   -153.0  30.0  2 

 assign (resi 2 and name C4'  )
        (resi 2 and name C3'  )
        (resi 2 and name O3'  )
        (resi 3 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 3 and name C4'  )
        (resi 3 and name C3'  )
        (resi 3 and name O3'  )
        (resi 4 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 4 and name C4'  )
        (resi 4 and name C3'  )
        (resi 4 and name O3'  )
        (resi 5 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 5 and name C4'  )
        (resi 5 and name C3'  )
        (resi 5 and name O3'  )
        (resi 6 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 6 and name C4'  )
        (resi 6 and name C3'  )
        (resi 6 and name O3'  )
        (resi 7 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 7 and name C4'  )
        (resi 7 and name C3'  )
        (resi 7 and name O3'  )
        (resi 8 and name  P   )   1.0   -153.0  30.0  2

assign (resi 8 and name C4'  )
        (resi 8 and name C3'  )
        (resi 8 and name O3'  )
        (resi 9 and name  P   )   1.0   -153.0  30.0  2 

assign (resi 9 and name C4'  )
        (resi 9 and name C3'  )
        (resi 9 and name O3'  )
        (resi 10 and name  P   )   1.0   -143.0  30.0  2

assign (resi 10 and name C4'  )
        (resi 10 and name C3'  )
        (resi 10 and name O3'  )
        (resi 11 and name  P   )   1.0   -98.0  30.0  2 

assign (resi 11 and name C4'  )
        (resi 11 and name C3'  )
        (resi 11 and name O3'  )
        (resi 12 and name  P   )   1.0   -100.0  30.0  2 
 
 assign (resi 12 and name C4'  )
        (resi 12 and name C3'  )
        (resi 12 and name O3'  )
        (resi 13 and name  P   )   1.0   -153.0   30.0  2

assign (resi 14 and name C4'  )
        (resi 14 and name C3'  )
        (resi 14 and name O3'  )
        (resi 15 and name  P   )   1.0   -118.0  30.0  2 

assign (resi 15 and name C4'  )
        (resi 15 and name C3'  )
        (resi 15 and name O3'  )
        (resi 16 and name  P   )   1.0   -117.0  40.0  2 

 assign (resi 16 and name C4'  )
        (resi 16 and name C3'  )
        (resi 16 and name O3'  )
        (resi 17 and name  P   )   1.0   -153.0   30.0  2

 assign (resi 17 and name C4'  )
        (resi 17 and name C3'  )
        (resi 17 and name O3'  )
        (resi 18 and name  P   )   1.0   -153.0   30.0  2

 assign (resi 18 and name C4'  )
        (resi 18 and name C3'  )
        (resi 18 and name O3'  )
        (resi 19 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 19 and name C4'  )
       (resi 19 and name C3'  )
       (resi 19 and name O3'  )
       (resi 20 and name  P   )   1.0   -153.0  30.0  2

 assign (resi 20 and name C4'  )
       (resi 20 and name C3'  )
       (resi 20 and name O3'  )
       (resi 21 and name  P   )   1.0   -153.0  30.0  2
 assign (resi 1 and name O5'  )
        (resi 1 and name C5'  )
        (resi 1 and name C4'  )
        (resi 1 and name C3'   )   1.0  54.0  30.0  2 

 assign (resi 2 and name O5'  )
        (resi 2 and name C5'  )
        (resi 2 and name C4'  )
        (resi 2 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 3 and name O5'  )
        (resi 3 and name C5'  )
        (resi 3 and name C4'  )
        (resi 3 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 4 and name O5'  )
        (resi 4 and name C5'  )
        (resi 4 and name C4'  )
        (resi 4 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 5 and name O5'  )
        (resi 5 and name C5'  )
        (resi 5 and name C4'  )
        (resi 5 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 6 and name O5'  )
        (resi 6 and name C5'  )
        (resi 6 and name C4'  )
        (resi 6 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 7 and name O5'  )
        (resi 7 and name C5'  )
        (resi 7 and name C4'  )
        (resi 7 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 8 and name O5'  )
        (resi 8 and name C5'  )
        (resi 8 and name C4'  )
        (resi 8 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 9 and name O5'  )
        (resi 9 and name C5'  )
        (resi 9 and name C4'  )
        (resi 9 and name C3'   )   1.0  54.0  30.0  2 
 
 !assign (resi 12 and name O5'  )
 !       (resi 12 and name C5'  )
 !      (resi 12 and name C4'  )
 !      (resi 12 and name C3'   )   1.0  180.0  30.0  2 

 !assign (resi 13 and name O5'  )
 !       (resi 13 and name C5'  )
 !       (resi 13 and name C4'  )
 !       (resi 13 and name C3'   )   1.0  180.0  30.0  2 
 
 assign (resi 14 and name O5'  )
        (resi 14 and name C5'  )
        (resi 14 and name C4'  )
        (resi 14 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 17 and name O5'  )
        (resi 17 and name C5'  )
        (resi 17 and name C4'  )
        (resi 17 and name C3'   )   1.0  54.0  30.0  2 

 assign (resi 18 and name O5'  )
        (resi 18 and name C5'  )
        (resi 18 and name C4'  )
        (resi 18 and name C3'   )   1.0  54.0  30.0  2 

 assign (resi 19 and name O5'  )
        (resi 19 and name C5'  )
        (resi 19 and name C4'  )
        (resi 19 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 20 and name O5'  )
        (resi 20 and name C5'  )
        (resi 20 and name C4'  )
        (resi 20 and name C3'   )   1.0  54.0  30.0  2 
 
 assign (resi 21 and name O5'  )
        (resi 21 and name C5'  )
        (resi 21 and name C4'  )
        (resi 21 and name C3'   )   1.0  54.0  30.0  2 
 



!{* select all base atoms: *}
vector identity (store1) 
           (not( name P   or name O1P or name O2P or name O5' or name H5T or
                name H1' or name H2' or name H3' or name H4' or name H5' or
                name H2'' or name H5'' or name O2' or name H7# or
                name O3' or name C1' or name C2' or name C3' or name C4' or
                name C5' or name O4' or name H3T or name HO2' ) )

!write coor output=test.pdb select=(store1) end stop !to test selection


!bases are kept flat
rest plan
   init
   group select  (store1 and (resi 1) )  weigh=300.0 end
   group select  (store1 and (resi 2) )  weigh=300.0 end
   group select  (store1 and (resi 3) )  weigh=300.0 end
   group select  (store1 and (resi 4) )  weigh=300.0 end
   group select  (store1 and (resi 5) )  weigh=300.0 end
   group select  (store1 and (resi 6) )  weigh=300.0 end
   group select  (store1 and (resi 7) )  weigh=300.0 end
   group select  (store1 and (resi 8) )  weigh=300.0 end
   group select  (store1 and (resi 9) )  weigh=300.0 end
   group select  (store1 and (resi 10))  weigh=300.0 end
   group select  (store1 and (resi 11))  weigh=300.0 end
   group select  (store1 and (resi 12))  weigh=300.0 end
   group select  (store1 and (resi 13))  weigh=300.0 end
   group select  (store1 and (resi 14))  weigh=300.0 end
   group select  (store1 and (resi 15))  weigh=300.0 end
   group select  (store1 and (resi 16))  weigh=300.0 end
   group select  (store1 and (resi 17))  weigh=300.0 end
   group select  (store1 and (resi 18))  weigh=300.0 end
   group select  (store1 and (resi 19))  weigh=300.0 end
   group select  (store1 and (resi 20))  weigh=300.0 end
   group select  (store1 and (resi 21))  weigh=300.0 end
 
!bases kept planar to one another  
   group select ( (store1 and (resi 1 or resi 21) ) ) weigh=3.0 end
   group select ( (store1 and (resi 2 or resi 20) ) ) weigh=3.0 end
   group select ( (store1 and (resi 3 or resi 19) ) ) weigh=3.0 end
   group select ( (store1 and (resi 4 or resi 18) ) ) weigh=3.0 end
   group select ( (store1 and (resi 5 or resi 17) ) ) weigh=3.0 end
   group select ( (store1 and (resi 6 or resi 16) ) ) weigh=3.0 end
   group select ( (store1 and (resi 7 or resi 14) ) ) weigh=3.0 end
   group select ( (store1 and (resi 8 or resi 13) ) ) weigh=3.0 end
   group select ( (store1 and (resi 9 or resi 12) ) ) weigh=2.0 end

end

assign  (resi   1 and name C5'  )
        (resi   1 and name C4'  )
        (resi   1 and name C3'  )
        (resi   1 and name O3'  )   1.0   120.0      60.0  2 {*delta*}

assign  (resi   2 and name C5'  )
        (resi   2 and name C4'  )
        (resi   2 and name C3'  )
        (resi   2 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   3 and name C5'  )
        (resi   3 and name C4'  )
        (resi   3 and name C3'  )
        (resi   3 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   4 and name C5'  )
        (resi   4 and name C4'  )
        (resi   4 and name C3'  )
        (resi   4 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   5 and name C5'  )
        (resi   5 and name C4'  )
        (resi   5 and name C3'  )
        (resi   5 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   6 and name C5'  )
        (resi   6 and name C4'  )
        (resi   6 and name C3'  )
        (resi   6 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   7 and name C5'  )
        (resi   7 and name C4'  )
        (resi   7 and name C3'  )
        (resi   7 and name O3'  )   1.0    82.0     20.0  2 {*delta*}

assign  (resi   8 and name C5'  )
        (resi   8 and name C4'  )
        (resi   8 and name C3'  )
        (resi   8 and name O3'  )   1.0    82.0     20.0  2 {*delta*}

assign  (resi   9 and name C5'  )
        (resi   9 and name C4'  )
        (resi   9 and name C3'  )
        (resi   9 and name O3'  )   1.0    120.0     60.0  2 {*delta*}

assign  (resi   10 and name C5'  )
        (resi   10 and name C4'  )
        (resi   10 and name C3'  )
        (resi   10 and name O3'  )   1.0    145.0    30.0  2 {*delta*}

assign  (resi   11 and name C5'  )
        (resi   11 and name C4'  )
        (resi   11 and name C3'  )
        (resi   11 and name O3'  )   1.0    145.0    30.0  2 {*delta*}

assign  (resi   12 and name C5'  )
        (resi   12 and name C4'  )
        (resi   12 and name C3'  )
        (resi   12 and name O3'  )   1.0    120.0    60.0  2 {*delta*}

assign  (resi   13 and name C5'  )
        (resi   13 and name C4'  )
        (resi   13 and name C3'  )
        (resi   13 and name O3'  )   1.0    120.0     60.0  2 {*delta*}

assign  (resi   14 and name C5'  )
        (resi   14 and name C4'  )
        (resi   14 and name C3'  )
        (resi   14 and name O3'  )   1.0    120.0     60.0  2 {*delta*}

assign  (resi   15 and name C5'  )
        (resi   15 and name C4'  )
        (resi   15 and name C3'  )
        (resi   15 and name O3'  )   1.0    120.0     60.0  2 {*delta*}

assign  (resi   16 and name C5'  )
        (resi   16 and name C4'  )
        (resi   16 and name C3'  )
        (resi   16 and name O3'  )   1.0    120.0     60.0  2 {*delta*}

assign  (resi   17 and name C5'  )
        (resi   17 and name C4'  )
        (resi   17 and name C3'  )
        (resi   17 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   18 and name C5'  )
        (resi   18 and name C4'  )
        (resi   18 and name C3'  )
        (resi   18 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   19 and name C5'  )
        (resi   19 and name C4'  )
        (resi   19 and name C3'  )
        (resi   19 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   20 and name C5'  )
        (resi   20 and name C4'  )
        (resi   20 and name C3'  )
        (resi   20 and name O3'  )   1.0    82.0      20.0  2 {*delta*}

assign  (resi   21 and name C5'  )
        (resi   21 and name C4'  )
        (resi   21 and name C3'  )
        (resi   21 and name O3'  )   1.0    120.0     60.0  2 {*delta*}
!artificialy insert restraint to keep A-form geometry at C21
 assign (resi 20 and name C3'  )
        (resi 20 and name O3'  )
 (resi 21 and name P    )
 (resi 21 and name C5'  )   1.0   -71.0  40.0  2 !{full anti range}
 
 assign (resi 20 and name O3'  )
        (resi 21 and name P    )
        (resi 21 and name O5'  )
        (resi 21 and name C5'  )   1.0   -67.0  40.0  2

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 1   and name H8  )
        ( resid 1   and name C8  )  15.53  1.5  1.5

!assign  ( resid 500 and name OO  )
!       ( resid 500 and name Z   )
!       ( resid 500 and name X   )
!       ( resid 500 and name Y   )
!       ( resid 1   and name H1' )
!       ( resid 1   and name C1' )  -9.47  2.0  2.0

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 2   and name H8  )
        ( resid 2   and name C8  )   4.52  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 3   and name H8  )
        ( resid 3   and name C8  )  11.52  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 3   and name H2  )
        ( resid 3   and name C2  )   7.01  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 4   and name H5  )
        ( resid 4   and name C5  )   9.02  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 5   and name H8  )
        ( resid 5   and name C8  )   32.54  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 6   and name H6  )
        ( resid 6   and name C6  )   29.05  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 8   and name H5  )
        ( resid 8   and name C5  )   19.52  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 10  and name H1' )
        ( resid 10  and name C1' )   -0.65  2.0  2.0

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 10  and name H6  )
        ( resid 10  and name C6  )    8.51  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 10  and name H5  )
        ( resid 10  and name C5  )    4.51  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 11  and name H6  )
        ( resid 11  and name C6  )   12.52  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 11  and name H1' )
        ( resid 11  and name C1' )  -33.09  2.0  2.0

!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 13  and name H8  )
!        ( resid 13  and name C8  )   21.52  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 13  and name H2  )
        ( resid 13  and name C2  )   22.02  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 14  and name H8  )
        ( resid 14  and name C8  )   13.52  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 14  and name H1' )
        ( resid 14  and name C1' )   -7.96  2.0  2.0

!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 15  and name H6  )
!        ( resid 15  and name C6  )   -4.49  2.5  2.5
!
!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 15  and name H5  )
!        ( resid 15  and name C5  )   -5.98  1.5  1.5
!
!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 15  and name H1' )
!        ( resid 15  and name C1' )   -12.17  2.0  2.0

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 16  and name H8  )
        ( resid 16  and name C8  )   13.02  1.5  1.5

!assign  ( resid 500 and name OO  )
!        ( resid 500 and name Z   )
!        ( resid 500 and name X   )
!        ( resid 500 and name Y   )
!        ( resid 18  and name H8  )
!        ( resid 18  and name C8  )   26.03   1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 18  and name H2  )
        ( resid 18  and name C2  )   25.03  1.5  1.5

assign  ( resid 500 and name OO  )
        ( resid 500 and name Z   )
        ( resid 500 and name X   )
        ( resid 500 and name Y   )
        ( resid 19  and name H5  )
        ( resid 19  and name C5  )  34.51  1.5  1.5


  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1   1H5*    G   1          2H5*        G   1   1.288 -16.359 -14.484
    2   2H5*    G   1          1H5*        G   1   1.384 -14.716 -15.150
    3    H4*    G   1           H4*        G   1  -0.742 -15.205 -15.848
    4    H3*    G   1           H3*        G   1  -0.951 -14.223 -12.996
    5    H2*    G   1           H2*        G   1  -3.243 -14.774 -12.905
    6   2HO*    G   1          2HO*        G   1  -3.042 -14.808 -15.740
    7    H1*    G   1           H1*        G   1  -3.172 -17.138 -14.264
    8    H8     G   1           H8         G   1  -0.263 -17.722 -12.219
    9    H1     G   1           H1         G   1  -5.399 -17.164  -8.481
   10   1H2     G   1          H21         G   1  -7.074 -16.263  -9.623
   11   2H2     G   1          H22         G   1  -6.925 -15.801 -11.303
   12    H5T    G   1           H5T        G   1   1.257 -15.577 -12.538
   13   1H5*    G   2          2H5*        G   2  -4.648 -13.628 -14.555
   14   2H5*    G   2          1H5*        G   2  -4.595 -11.944 -15.110
   15    H4*    G   2           H4*        G   2  -6.764 -12.157 -14.230
   16    H3*    G   2           H3*        G   2  -4.806 -10.890 -12.314
   17    H2*    G   2           H2*        G   2  -6.308 -10.934 -10.527
   18   2HO*    G   2          2HO*        G   2  -8.452 -11.299 -12.380
   19    H1*    G   2           H1*        G   2  -7.809 -13.203 -11.195
   20    H8     G   2           H8         G   2  -4.101 -13.927 -11.140
   21    H1     G   2           H1         G   2  -6.705 -13.807  -5.324
   22   1H2     G   2          H21         G   2  -8.768 -12.997  -5.433
   23   2H2     G   2          H22         G   2  -9.498 -12.489  -6.939
   24   1H5*    A   3          2H5*        A   3  -8.074  -9.178 -11.524
   25   2H5*    A   3          1H5*        A   3  -8.228  -7.441 -11.818
   26    H4*    A   3           H4*        A   3  -8.973  -7.867  -9.586
   27    H3*    A   3           H3*        A   3  -6.306  -6.494  -9.958
   28    H2*    A   3           H2*        A   3  -5.830  -6.677  -7.703
   29   2HO*    A   3          2HO*        A   3  -8.495  -6.698  -6.831
   30    H1*    A   3           H1*        A   3  -8.009  -8.573  -7.122
   31    H8     A   3           H8         A   3  -4.576  -9.287  -8.678
   32   1H6     A   3          H61         A   3  -2.779 -11.091  -3.077
   33   2H6     A   3          H62         A   3  -2.312 -10.949  -4.756
   34    H2     A   3           H2         A   3  -6.967  -9.498  -2.746
   35   1H5*    U   4          2H5*        U   4  -9.952  -3.954  -7.492
   36   2H5*    U   4          1H5*        U   4  -9.159  -2.382  -7.266
   37    H4*    U   4           H4*        U   4 -10.294  -3.606  -5.227
   38    H3*    U   4           H3*        U   4  -7.664  -2.104  -5.332
   39    H2*    U   4           H2*        U   4  -7.183  -2.663  -3.102
   40   2HO*    U   4          2HO*        U   4  -9.460  -3.818  -2.228
   41    H1*    U   4           H1*        U   4  -8.341  -5.195  -3.016
   42    H3     U   4           H3         U   4  -4.004  -5.928  -2.071
   43    H5     U   4           H5         U   4  -3.991  -4.894  -6.200
   44    H6     U   4           H6         U   4  -6.359  -4.381  -5.992
   45   1H5*    G   5          2H5*        G   5 -10.944  -1.264  -1.593
   46   2H5*    G   5          1H5*        G   5 -10.670   0.489  -1.548
   47    H4*    G   5           H4*        G   5 -10.809  -0.589   0.723
   48    H3*    G   5           H3*        G   5  -8.472   1.037  -0.253
   49    H2*    G   5           H2*        G   5  -7.147   0.535   1.635
   50   2HO*    G   5          2HO*        G   5  -8.234  -0.649   3.453
   51    H1*    G   5           H1*        G   5  -7.738  -2.093   1.929
   52    H8     G   5           H8         G   5  -7.605  -0.914  -1.709
   53    H1     G   5           H1         G   5  -1.924  -2.557   0.668
   54   1H2     G   5          H21         G   5  -2.099  -2.970   2.840
   55   2H2     G   5          H22         G   5  -3.615  -2.839   3.702
   56   1H5*    C   6          2H5*        C   6  -8.158   1.050   4.017
   57   2H5*    C   6          1H5*        C   6  -8.238   2.765   4.436
   58    H4*    C   6           H4*        C   6  -6.189   1.457   5.236
   59    H3*    C   6           H3*        C   6  -6.267   4.130   3.825
   60    H2*    C   6           H2*        C   6  -3.989   4.079   3.448
   61   2HO*    C   6          2HO*        C   6  -3.844   4.172   5.874
   62    H1*    C   6           H1*        C   6  -3.643   1.267   4.263
   63   1H4     C   6          H41         C   6  -0.178   1.945  -1.044
   64   2H4     C   6          H42         C   6  -1.579   2.510  -1.926
   65    H5     C   6           H5         C   6  -3.742   2.828  -0.910
   66    H6     C   6           H6         C   6  -5.030   2.674   1.172
   67   1H5*    C   7          2H5*        C   7  -4.059   4.960   8.176
   68   2H5*    C   7          1H5*        C   7  -3.880   6.723   8.072
   69    H4*    C   7           H4*        C   7  -1.744   5.161   8.195
   70    H3*    C   7           H3*        C   7  -2.176   7.598   6.427
   71    H2*    C   7           H2*        C   7   0.007   7.311   5.567
   72   2HO*    C   7          2HO*        C   7   1.397   6.911   7.140
   73    H1*    C   7           H1*        C   7  -0.005   4.538   5.467
   74   1H4     C   7          H41         C   7  -1.084   6.574  -0.449
   75   2H4     C   7          H42         C   7  -2.702   7.083  -0.023
   76    H5     C   7           H5         C   7  -3.579   6.958   2.220
   77    H6     C   7           H6         C   7  -3.083   6.323   4.539
   78   1H5*    U   8          2H5*        U   8   1.668   8.199   9.276
   79   2H5*    U   8          1H5*        U   8   1.881   9.960   9.250
   80    H4*    U   8           H4*        U   8   3.854   8.361   8.525
   81    H3*    U   8           H3*        U   8   2.956  10.974   7.263
   82    H2*    U   8           H2*        U   8   4.627  10.755   5.597
   83   2HO*    U   8          2HO*        U   8   5.976   8.554   6.231
   84    H1*    U   8           H1*        U   8   4.401   8.055   5.152
   85    H3     U   8           H3         U   8   2.905  10.179   1.426
   86    H5     U   8           H5         U   8  -0.288  10.478   4.158
   87    H6     U   8           H6         U   8   1.166   9.543   5.860
   88   1H5*    C   9          2H5*        C   9   7.475  11.109   6.616
   89   2H5*    C   9          1H5*        C   9   7.715  12.787   7.146
   90    H4*    C   9           H4*        C   9   8.207  12.108   4.645
   91    H3*    C   9           H3*        C   9   7.207  14.563   5.910
   92    H2*    C   9           H2*        C   9   5.664  15.168   4.322
   93   2HO*    C   9          2HO*        C   9   6.560  15.957   2.578
   94    H1*    C   9           H1*        C   9   6.108  12.996   2.381
   95   1H4     C   9          H41         C   9  -0.178  13.943   2.422
   96   2H4     C   9          H42         C   9  -0.262  13.552   4.126
   97    H5     C   9           H5         C   9   1.682  13.076   5.469
   98    H6     C   9           H6         C   9   4.121  12.879   5.469
   99   1H5*    C  10          2H5*        C  10   7.478  17.664   3.830
  100   2H5*    C  10          1H5*        C  10   8.279  16.222   3.172
  101    H4*    C  10           H4*        C  10   9.495  19.003   3.457
  102    H3*    C  10           H3*        C  10   7.825  17.980   1.408
  103    H2*    C  10           H2*        C  10   9.296  16.459   0.428
  104   2HO*    C  10          2HO*        C  10  10.340  17.426  -1.239
  105    H1*    C  10           H1*        C  10  11.794  17.937   1.153
  106   1H4     C  10          H41         C  10  13.901  12.072  -0.045
  107   2H4     C  10          H42         C  10  12.672  11.362   0.978
  108    H5     C  10           H5         C  10  10.976  12.652   2.095
  109    H6     C  10           H6         C  10  10.107  14.925   2.496
  110   1H5*    C  11          2H5*        C  11   8.170  18.587  -0.856
  111   2H5*    C  11          1H5*        C  11   8.224  20.152  -1.691
  112    H4*    C  11           H4*        C  11   7.068  18.554  -3.102
  113    H3*    C  11           H3*        C  11   6.019  21.016  -2.516
  114    H2*    C  11           H2*        C  11   4.628  20.284  -0.696
  115   2HO*    C  11          2HO*        C  11   3.346  20.495  -3.143
  116    H1*    C  11           H1*        C  11   3.775  17.875  -2.314
  117   1H4     C  11          H41         C  11   1.194  16.558   3.341
  118   2H4     C  11          H42         C  11   2.767  16.613   4.104
  119    H5     C  11           H5         C  11   4.779  17.240   2.936
  120    H6     C  11           H6         C  11   5.717  17.946   0.784
  121   1H5*    G  12          2H5*        G  12   5.375  17.368  -5.760
  122   2H5*    G  12          1H5*        G  12   6.044  16.935  -4.174
  123    H4*    G  12           H4*        G  12   7.314  16.454  -6.895
  124    H3*    G  12           H3*        G  12   5.854  14.755  -4.884
  125    H2*    G  12           H2*        G  12   7.439  13.051  -4.914
  126   2HO*    G  12          2HO*        G  12   8.421  14.065  -7.405
  127    H1*    G  12           H1*        G  12   9.761  14.541  -5.546
  128    H8     G  12           H8         G  12  11.137  14.184  -3.424
  129    H1     G  12           H1         G  12   6.035  13.918   0.386
  130   1H2     G  12          H21         G  12   4.197  14.334  -0.766
  131   2H2     G  12          H22         G  12   4.216  14.683  -2.480
  132   1H5*    A  13          2H5*        A  13   7.400  11.974  -7.696
  133   2H5*    A  13          1H5*        A  13   6.183  10.692  -7.862
  134    H4*    A  13           H4*        A  13   8.539  10.252  -6.664
  135    H3*    A  13           H3*        A  13   5.780   9.155  -6.168
  136    H2*    A  13           H2*        A  13   6.441   8.084  -4.154
  137   2HO*    A  13          2HO*        A  13   9.164   8.775  -4.610
  138    H1*    A  13           H1*        A  13   7.915  10.074  -3.087
  139    H8     A  13           H8         A  13   4.860  11.047  -5.235
  140   1H6     A  13          H61         A  13   1.629  10.925   0.014
  141   2H6     A  13          H62         A  13   1.563  11.269  -1.700
  142    H2     A  13           H2         A  13   5.827   9.627   0.929
  143   1H5*    G  14          2H5*        G  14   8.873   6.596  -5.451
  144   2H5*    G  14          1H5*        G  14   8.691   4.840  -5.615
  145    H4*    G  14           H4*        G  14   9.240   5.924  -3.273
  146    H3*    G  14           H3*        G  14   8.112   3.444  -4.038
  147    H2*    G  14           H2*        G  14   5.891   3.892  -3.437
  148   2HO*    G  14          2HO*        G  14   6.280   2.377  -1.909
  149    H1*    G  14           H1*        G  14   6.679   5.695  -1.165
  150    H8     G  14           H8         G  14   4.756   6.454  -4.414
  151    H1     G  14           H1         G  14   1.120   6.048   0.801
  152   1H2     G  14          H21         G  14   2.364   5.410   2.528
  153   2H2     G  14          H22         G  14   4.074   5.085   2.386
  154   1H5*    U  15          2H5*        U  15  10.533   4.151   0.132
  155   2H5*    U  15          1H5*        U  15  11.767   3.007  -0.437
  156    H4*    U  15           H4*        U  15  12.196   2.913   1.821
  157    H3*    U  15           H3*        U  15   9.949   0.951   1.319
  158    H2*    U  15           H2*        U  15  10.108   0.352   3.630
  159   2HO*    U  15          2HO*        U  15  12.630   1.139   3.334
  160    H1*    U  15           H1*        U  15  10.142   2.911   4.532
  161    H3     U  15           H3         U  15   5.910   1.779   5.492
  162    H5     U  15           H5         U  15   5.904   2.077   1.288
  163    H6     U  15           H6         U  15   8.304   2.398   1.369
  164   1H5*    G  16          2H5*        G  16   9.868  -2.585  -0.201
  165   2H5*    G  16          1H5*        G  16   8.766  -1.524  -1.100
  166    H4*    G  16           H4*        G  16   8.803  -2.041   1.914
  167    H3*    G  16           H3*        G  16   6.944  -2.781  -0.447
  168    H2*    G  16           H2*        G  16   5.053  -2.496   0.913
  169   2HO*    G  16          2HO*        G  16   5.867  -2.103   3.383
  170    H1*    G  16           H1*        G  16   5.979  -0.362   2.509
  171    H8     G  16           H8         G  16   6.472   0.121  -1.257
  172    H1     G  16           H1         G  16   0.603   1.587   0.799
  173   1H2     G  16          H21         G  16   0.359   0.955   2.909
  174   2H2     G  16          H22         G  16   1.641   0.179   3.812
  175   1H5*    C  17          2H5*        C  17   6.180  -4.314   3.649
  176   2H5*    C  17          1H5*        C  17   6.230  -6.083   3.520
  177    H4*    C  17           H4*        C  17   4.554  -5.485   5.157
  178    H3*    C  17           H3*        C  17   3.546  -6.519   2.490
  179    H2*    C  17           H2*        C  17   1.311  -6.287   3.191
  180   2HO*    C  17          2HO*        C  17   1.363  -5.576   5.732
  181    H1*    C  17           H1*        C  17   1.598  -3.926   4.684
  182   1H4     C  17          H41         C  17  -0.994  -2.343  -0.905
  183   2H4     C  17          H42         C  17   0.547  -2.531  -1.711
  184    H5     C  17           H5         C  17   2.526  -3.316  -0.597
  185    H6     C  17           H6         C  17   3.467  -4.094   1.530
  186   1H5*    A  18          2H5*        A  18   1.540  -9.084   6.281
  187   2H5*    A  18          1H5*        A  18   1.266 -10.567   5.345
  188    H4*    A  18           H4*        A  18  -0.734  -9.456   6.621
  189    H3*    A  18           H3*        A  18  -0.662 -10.674   3.869
  190    H2*    A  18           H2*        A  18  -2.853  -9.952   3.367
  191   2HO*    A  18          2HO*        A  18  -3.959  -8.845   5.372
  192    H1*    A  18           H1*        A  18  -2.774  -7.465   4.456
  193    H8     A  18           H8         A  18   0.571  -8.338   2.925
  194   1H6     A  18          H61         A  18  -1.723  -6.432  -2.473
  195   2H6     A  18          H62         A  18  -0.276  -6.942  -1.634
  196    H2     A  18           H2         A  18  -5.085  -6.581   0.505
  197   1H5*    U  19          2H5*        U  19  -4.140 -12.939   6.006
  198   2H5*    U  19          1H5*        U  19  -4.398 -14.384   5.007
  199    H4*    U  19           H4*        U  19  -6.243 -12.503   5.097
  200    H3*    U  19           H3*        U  19  -5.221 -14.059   2.711
  201    H2*    U  19           H2*        U  19  -6.589 -12.830   1.240
  202   2HO*    U  19          2HO*        U  19  -8.202 -12.733   3.395
  203    H1*    U  19           H1*        U  19  -6.289 -10.323   2.416
  204    H3     U  19           H3         U  19  -4.285 -10.434  -1.717
  205    H5     U  19           H5         U  19  -1.439 -12.088   0.987
  206    H6     U  19           H6         U  19  -3.167 -12.056   2.689
  207   1H5*    C  20          2H5*        C  20  -9.821 -14.934   2.880
  208   2H5*    C  20          1H5*        C  20 -10.016 -16.444   1.967
  209    H4*    C  20           H4*        C  20 -11.136 -14.213   1.107
  210    H3*    C  20           H3*        C  20  -9.717 -16.373  -0.475
  211    H2*    C  20           H2*        C  20 -10.003 -15.148  -2.476
  212   2HO*    C  20          2HO*        C  20 -11.424 -13.005  -1.800
  213    H1*    C  20           H1*        C  20  -9.511 -12.632  -1.490
  214   1H4     C  20          H41         C  20  -4.197 -14.978  -4.166
  215   2H4     C  20          H42         C  20  -3.662 -15.502  -2.585
  216    H5     C  20           H5         C  20  -5.043 -15.363  -0.612
  217    H6     C  20           H6         C  20  -7.231 -14.692   0.267
  218   1H5*    C  21          2H5*        C  21 -12.178 -14.701  -3.264
  219   2H5*    C  21          1H5*        C  21 -13.487 -15.884  -3.454
  220    H4*    C  21           H4*        C  21 -12.740 -15.241  -5.663
  221    H3*    C  21           H3*        C  21 -11.818 -17.967  -4.718
  222    H2*    C  21           H2*        C  21 -10.697 -18.318  -6.706
  223   2HO*    C  21          2HO*        C  21 -11.754 -17.952  -8.489
  224    H1*    C  21           H1*        C  21 -10.257 -15.534  -7.333
  225   1H4     C  21          H41         C  21  -4.473 -18.054  -6.586
  226   2H4     C  21          H42         C  21  -4.809 -18.445  -4.914
  227    H5     C  21           H5         C  21  -6.948 -18.058  -3.871
  228    H6     C  21           H6         C  21  -9.226 -17.210  -4.205
  229    H3T    C  21           H3T        C  21 -13.609 -17.460  -6.822
  Start of MODEL    2
    1   1H5*    G   1          2H5*        G   1   1.706 -16.446 -13.986
    2   2H5*    G   1          1H5*        G   1   1.611 -14.847 -14.754
    3    H4*    G   1           H4*        G   1  -0.490 -15.573 -15.306
    4    H3*    G   1           H3*        G   1  -0.660 -14.454 -12.501
    5    H2*    G   1           H2*        G   1  -2.885 -15.211 -12.274
    6   2HO*    G   1          2HO*        G   1  -2.893 -15.758 -15.078
    7    H1*    G   1           H1*        G   1  -2.643 -17.630 -13.504
    8    H8     G   1           H8         G   1   0.412 -17.720 -11.541
    9    H1     G   1           H1         G   1  -4.654 -17.715  -7.669
   10   1H2     G   1          H21         G   1  -6.471 -17.122  -8.793
   11   2H2     G   1          H22         G   1  -6.435 -16.725 -10.497
   12    H5T    G   1           H5T        G   1   2.298 -15.095 -12.416
   13   1H5*    G   2          2H5*        G   2  -4.482 -14.358 -13.950
   14   2H5*    G   2          1H5*        G   2  -4.652 -12.695 -14.547
   15    H4*    G   2           H4*        G   2  -6.738 -13.178 -13.545
   16    H3*    G   2           H3*        G   2  -4.878 -11.513 -11.855
   17    H2*    G   2           H2*        G   2  -6.208 -11.664  -9.951
   18   2HO*    G   2          2HO*        G   2  -8.552 -12.456 -10.414
   19    H1*    G   2           H1*        G   2  -7.466 -14.136 -10.394
   20    H8     G   2           H8         G   2  -3.685 -14.319 -10.520
   21    H1     G   2           H1         G   2  -6.000 -14.399  -4.585
   22   1H2     G   2          H21         G   2  -8.163 -13.909  -4.607
   23   2H2     G   2          H22         G   2  -9.034 -13.563  -6.084
   24   1H5*    A   3          2H5*        A   3  -8.439 -10.136 -11.052
   25   2H5*    A   3          1H5*        A   3  -8.754  -8.428 -11.385
   26    H4*    A   3           H4*        A   3  -9.382  -8.925  -9.107
   27    H3*    A   3           H3*        A   3  -6.981  -7.168  -9.644
   28    H2*    A   3           H2*        A   3  -6.395  -7.182  -7.406
   29   2HO*    A   3          2HO*        A   3  -8.103  -6.022  -6.645
   30    H1*    A   3           H1*        A   3  -8.197  -9.386  -6.664
   31    H8     A   3           H8         A   3  -4.800  -9.646  -8.412
   32   1H6     A   3          H61         A   3  -2.413 -10.921  -2.890
   33   2H6     A   3          H62         A   3  -2.080 -10.792  -4.601
   34    H2     A   3           H2         A   3  -6.754  -9.906  -2.324
   35   1H5*    U   4          2H5*        U   4 -10.171  -6.203  -6.842
   36   2H5*    U   4          1H5*        U   4 -10.814  -4.560  -7.041
   37    H4*    U   4           H4*        U   4 -10.908  -4.998  -4.710
   38    H3*    U   4           H3*        U   4  -8.558  -3.272  -5.544
   39    H2*    U   4           H2*        U   4  -7.767  -3.192  -3.333
   40   2HO*    U   4          2HO*        U   4  -9.930  -4.373  -2.068
   41    H1*    U   4           H1*        U   4  -8.528  -5.745  -2.502
   42    H3     U   4           H3         U   4  -4.113  -6.119  -2.015
   43    H5     U   4           H5         U   4  -4.537  -5.254  -6.160
   44    H6     U   4           H6         U   4  -6.928  -5.013  -5.778
   45   1H5*    G   5          2H5*        G   5 -11.734  -1.722  -1.915
   46   2H5*    G   5          1H5*        G   5 -11.391   0.018  -2.015
   47    H4*    G   5           H4*        G   5 -11.442  -1.018   0.335
   48    H3*    G   5           H3*        G   5  -9.290   0.738  -0.826
   49    H2*    G   5           H2*        G   5  -7.857   0.435   1.022
   50   2HO*    G   5          2HO*        G   5  -8.765  -0.695   2.957
   51    H1*    G   5           H1*        G   5  -8.263  -2.213   1.498
   52    H8     G   5           H8         G   5  -8.248  -1.238  -2.201
   53    H1     G   5           H1         G   5  -2.447  -2.373   0.182
   54   1H2     G   5          H21         G   5  -2.570  -2.668   2.376
   55   2H2     G   5          H22         G   5  -4.082  -2.584   3.251
   56   1H5*    C   6          2H5*        C   6  -8.911   1.070   3.440
   57   2H5*    C   6          1H5*        C   6  -9.039   2.806   3.748
   58    H4*    C   6           H4*        C   6  -6.911   1.562   4.532
   59    H3*    C   6           H3*        C   6  -7.123   4.220   3.088
   60    H2*    C   6           H2*        C   6  -4.837   4.268   2.748
   61   2HO*    C   6          2HO*        C   6  -3.800   4.395   4.579
   62    H1*    C   6           H1*        C   6  -4.397   1.458   3.490
   63   1H4     C   6          H41         C   6  -1.098   2.361  -1.894
   64   2H4     C   6          H42         C   6  -2.567   2.755  -2.758
   65    H5     C   6           H5         C   6  -4.725   2.898  -1.696
   66    H6     C   6           H6         C   6  -5.943   2.692   0.424
   67   1H5*    C   7          2H5*        C   7  -5.091   5.129   7.348
   68   2H5*    C   7          1H5*        C   7  -5.008   6.901   7.396
   69    H4*    C   7           H4*        C   7  -2.789   5.451   7.322
   70    H3*    C   7           H3*        C   7  -3.400   8.003   5.779
   71    H2*    C   7           H2*        C   7  -1.249   7.895   4.836
   72   2HO*    C   7          2HO*        C   7  -0.483   5.902   6.722
   73    H1*    C   7           H1*        C   7  -1.051   5.100   4.688
   74   1H4     C   7          H41         C   7  -1.834   7.263  -1.233
   75   2H4     C   7          H42         C   7  -3.487   7.724  -0.894
   76    H5     C   7           H5         C   7  -4.497   7.509   1.289
   77    H6     C   7           H6         C   7  -4.133   6.809   3.611
   78   1H5*    U   8          2H5*        U   8   0.431   7.649   8.452
   79   2H5*    U   8          1H5*        U   8   1.107   9.264   8.728
   80    H4*    U   8           H4*        U   8   2.607   7.340   7.718
   81    H3*    U   8           H3*        U   8   2.482  10.267   6.923
   82    H2*    U   8           H2*        U   8   4.106   9.886   5.239
   83   2HO*    U   8          2HO*        U   8   5.385   8.499   6.739
   84    H1*    U   8           H1*        U   8   3.171   7.471   4.331
   85    H3     U   8           H3         U   8   2.562  10.709   1.168
   86    H5     U   8           H5         U   8  -0.702  11.138   3.793
   87    H6     U   8           H6         U   8   0.353   9.516   5.263
   88   1H5*    C   9          2H5*        C   9   7.045   9.728   7.004
   89   2H5*    C   9          1H5*        C   9   7.445  11.301   7.724
   90    H4*    C   9           H4*        C   9   8.229  10.731   5.271
   91    H3*    C   9           H3*        C   9   7.419  13.223   6.600
   92    H2*    C   9           H2*        C   9   6.288  14.200   4.858
   93   2HO*    C   9          2HO*        C   9   7.417  14.632   2.993
   94    H1*    C   9           H1*        C   9   6.630  12.121   2.811
   95   1H4     C   9          H41         C   9   0.637  14.149   2.203
   96   2H4     C   9          H42         C   9   0.269  13.673   3.845
   97    H5     C   9           H5         C   9   1.913  12.776   5.360
   98    H6     C   9           H6         C   9   4.258  12.133   5.627
   99   1H5*    C  10          2H5*        C  10   8.360  16.087   5.503
  100   2H5*    C  10          1H5*        C  10   9.066  14.796   4.509
  101    H4*    C  10           H4*        C  10  10.288  17.526   5.098
  102    H3*    C  10           H3*        C  10   8.421  16.879   3.124
  103    H2*    C  10           H2*        C  10   9.693  15.216   2.014
  104   2HO*    C  10          2HO*        C  10   9.526  16.566   0.325
  105    H1*    C  10           H1*        C  10  12.269  16.735   2.351
  106   1H4     C  10          H41         C  10  14.425  11.021   0.625
  107   2H4     C  10          H42         C  10  13.366  10.218   1.763
  108    H5     C  10           H5         C  10  11.782  11.391   3.147
  109    H6     C  10           H6         C  10  10.863  13.594   3.734
  110   1H5*    C  11          2H5*        C  11  10.006  18.338   0.725
  111   2H5*    C  11          1H5*        C  11  10.226  19.975   0.074
  112    H4*    C  11           H4*        C  11   9.680  18.293  -1.687
  113    H3*    C  11           H3*        C  11   8.692  20.861  -1.534
  114    H2*    C  11           H2*        C  11   6.615  20.330  -0.489
  115   2HO*    C  11          2HO*        C  11   6.502  20.497  -3.234
  116    H1*    C  11           H1*        C  11   6.274  17.869  -2.200
  117   1H4     C  11          H41         C  11   1.688  17.130   2.137
  118   2H4     C  11          H42         C  11   2.846  17.268   3.441
  119    H5     C  11           H5         C  11   5.180  17.746   3.087
  120    H6     C  11           H6         C  11   6.909  18.195   1.409
  121   1H5*    G  12          2H5*        G  12   8.332  17.574  -4.820
  122   2H5*    G  12          1H5*        G  12   8.824  16.977  -3.223
  123    H4*    G  12           H4*        G  12   9.981  16.113  -5.903
  124    H3*    G  12           H3*        G  12   7.882  15.009  -4.063
  125    H2*    G  12           H2*        G  12   8.796  12.875  -3.972
  126   2HO*    G  12          2HO*        G  12  10.152  13.482  -6.422
  127    H1*    G  12           H1*        G  12  11.528  13.467  -4.426
  128    H8     G  12           H8         G  12  12.693  13.181  -2.093
  129    H1     G  12           H1         G  12   7.120  13.333   0.993
  130   1H2     G  12          H21         G  12   5.503  13.954  -0.383
  131   2H2     G  12          H22         G  12   5.791  14.334  -2.067
  132   1H5*    A  13          2H5*        A  13   7.354  12.867  -7.746
  133   2H5*    A  13          1H5*        A  13   5.853  11.919  -7.802
  134    H4*    A  13           H4*        A  13   8.156  10.887  -6.888
  135    H3*    A  13           H3*        A  13   5.277  10.396  -6.151
  136    H2*    A  13           H2*        A  13   5.844   9.137  -4.238
  137   2HO*    A  13          2HO*        A  13   8.356   8.917  -5.535
  138    H1*    A  13           H1*        A  13   7.889  10.636  -3.289
  139    H8     A  13           H8         A  13   5.587  13.217  -4.576
  140   1H6     A  13          H61         A  13   1.928  12.273   0.287
  141   2H6     A  13          H62         A  13   2.267  13.326  -1.069
  142    H2     A  13           H2         A  13   4.925   8.929   0.126
  143   1H5*    G  14          2H5*        G  14   7.734   7.337  -6.258
  144   2H5*    G  14          1H5*        G  14   7.500   5.587  -6.434
  145    H4*    G  14           H4*        G  14   8.113   6.638  -4.088
  146    H3*    G  14           H3*        G  14   6.919   4.201  -4.853
  147    H2*    G  14           H2*        G  14   4.712   4.641  -4.213
  148   2HO*    G  14          2HO*        G  14   6.213   3.908  -1.985
  149    H1*    G  14           H1*        G  14   5.439   6.526  -2.001
  150    H8     G  14           H8         G  14   3.798   7.352  -5.370
  151    H1     G  14           H1         G  14  -0.271   6.922  -0.484
  152   1H2     G  14          H21         G  14   0.787   6.197   1.311
  153   2H2     G  14          H22         G  14   2.493   5.816   1.315
  154   1H5*    U  15          2H5*        U  15   9.350   5.111  -0.977
  155   2H5*    U  15          1H5*        U  15  10.897   4.441  -1.537
  156    H4*    U  15           H4*        U  15  11.397   4.140   0.639
  157    H3*    U  15           H3*        U  15   9.226   2.064   0.302
  158    H2*    U  15           H2*        U  15   9.533   1.545   2.615
  159   2HO*    U  15          2HO*        U  15  11.849   1.751   2.606
  160    H1*    U  15           H1*        U  15   9.530   4.138   3.441
  161    H3     U  15           H3         U  15   5.434   2.887   4.762
  162    H5     U  15           H5         U  15   5.108   2.997   0.561
  163    H6     U  15           H6         U  15   7.491   3.412   0.450
  164   1H5*    G  16          2H5*        G  16   9.249  -1.561  -0.958
  165   2H5*    G  16          1H5*        G  16   8.031  -0.639  -1.860
  166    H4*    G  16           H4*        G  16   8.294  -0.878   1.181
  167    H3*    G  16           H3*        G  16   6.378  -1.997  -0.973
  168    H2*    G  16           H2*        G  16   4.532  -1.693   0.443
  169   2HO*    G  16          2HO*        G  16   5.338  -1.032   2.822
  170    H1*    G  16           H1*        G  16   5.378   0.635   1.798
  171    H8     G  16           H8         G  16   5.659   0.890  -1.993
  172    H1     G  16           H1         G  16  -0.243   1.952   0.198
  173   1H2     G  16          H21         G  16  -0.363   1.430   2.346
  174   2H2     G  16          H22         G  16   1.010   0.823   3.246
  175   1H5*    C  17          2H5*        C  17   5.775  -3.140   3.213
  176   2H5*    C  17          1H5*        C  17   6.035  -4.895   3.282
  177    H4*    C  17           H4*        C  17   4.288  -4.386   4.842
  178    H3*    C  17           H3*        C  17   3.371  -5.649   2.241
  179    H2*    C  17           H2*        C  17   1.130  -5.590   2.961
  180   2HO*    C  17          2HO*        C  17   2.290  -5.341   5.549
  181    H1*    C  17           H1*        C  17   1.210  -3.130   4.314
  182   1H4     C  17          H41         C  17  -1.573  -2.122  -1.325
  183   2H4     C  17          H42         C  17  -0.027  -2.211  -2.137
  184    H5     C  17           H5         C  17   2.022  -2.743  -1.008
  185    H6     C  17           H6         C  17   3.053  -3.307   1.145
  186   1H5*    A  18          2H5*        A  18   1.743  -7.380   5.916
  187   2H5*    A  18          1H5*        A  18   1.959  -9.142   5.918
  188    H4*    A  18           H4*        A  18  -0.266  -8.610   6.740
  189    H3*    A  18           H3*        A  18   0.015  -9.961   4.062
  190    H2*    A  18           H2*        A  18  -2.300  -9.814   3.615
  191   2HO*    A  18          2HO*        A  18  -2.702 -10.410   5.983
  192    H1*    A  18           H1*        A  18  -2.777  -7.305   4.518
  193    H8     A  18           H8         A  18   0.652  -7.741   2.895
  194   1H6     A  18          H61         A  18  -2.085  -6.351  -2.450
  195   2H6     A  18          H62         A  18  -0.553  -6.651  -1.660
  196    H2     A  18           H2         A  18  -5.274  -6.775   0.692
  197   1H5*    U  19          2H5*        U  19  -2.974 -12.590   6.448
  198   2H5*    U  19          1H5*        U  19  -3.072 -14.112   5.539
  199    H4*    U  19           H4*        U  19  -5.146 -12.472   5.624
  200    H3*    U  19           H3*        U  19  -4.052 -14.059   3.284
  201    H2*    U  19           H2*        U  19  -5.671 -13.136   1.842
  202   2HO*    U  19          2HO*        U  19  -7.082 -12.905   4.207
  203    H1*    U  19           H1*        U  19  -5.645 -10.533   2.842
  204    H3     U  19           H3         U  19  -3.940 -10.542  -1.407
  205    H5     U  19           H5         U  19  -0.734 -11.808   1.094
  206    H6     U  19           H6         U  19  -2.318 -11.906   2.929
  207   1H5*    C  20          2H5*        C  20  -8.451 -15.594   3.839
  208   2H5*    C  20          1H5*        C  20  -8.476 -17.161   3.005
  209    H4*    C  20           H4*        C  20  -9.954 -15.157   2.123
  210    H3*    C  20           H3*        C  20  -8.330 -17.176   0.550
  211    H2*    C  20           H2*        C  20  -8.897 -16.107  -1.482
  212   2HO*    C  20          2HO*        C  20 -10.557 -14.357  -1.387
  213    H1*    C  20           H1*        C  20  -8.723 -13.499  -0.635
  214   1H4     C  20          H41         C  20  -3.282 -15.160  -3.546
  215   2H4     C  20          H42         C  20  -2.590 -15.549  -1.986
  216    H5     C  20           H5         C  20  -3.864 -15.537   0.060
  217    H6     C  20           H6         C  20  -6.074 -15.152   1.051
  218   1H5*    C  21          2H5*        C  21 -11.181 -16.335  -2.001
  219   2H5*    C  21          1H5*        C  21 -12.276 -17.727  -2.119
  220    H4*    C  21           H4*        C  21 -11.718 -17.007  -4.367
  221    H3*    C  21           H3*        C  21 -10.353 -19.539  -3.417
  222    H2*    C  21           H2*        C  21  -9.254 -19.752  -5.436
  223   2HO*    C  21          2HO*        C  21 -10.380 -18.120  -7.165
  224    H1*    C  21           H1*        C  21  -9.267 -16.948  -6.120
  225   1H4     C  21          H41         C  21  -3.143 -18.535  -5.510
  226   2H4     C  21          H42         C  21  -3.363 -18.903  -3.815
  227    H5     C  21           H5         C  21  -5.502 -18.809  -2.710
  228    H6     C  21           H6         C  21  -7.892 -18.337  -2.991
  229    H3T    C  21           H3T        C  21 -12.060 -19.877  -5.409
  Start of MODEL    3
    1   1H5*    G   1          2H5*        G   1   1.930 -15.931 -14.103
    2   2H5*    G   1          1H5*        G   1   1.723 -14.358 -14.901
    3    H4*    G   1           H4*        G   1  -0.329 -15.232 -15.417
    4    H3*    G   1           H3*        G   1  -0.549 -14.064 -12.636
    5    H2*    G   1           H2*        G   1  -2.712 -14.963 -12.363
    6   2HO*    G   1          2HO*        G   1  -3.086 -16.024 -14.873
    7    H1*    G   1           H1*        G   1  -2.331 -17.385 -13.565
    8    H8     G   1           H8         G   1   0.728 -17.297 -11.634
    9    H1     G   1           H1         G   1  -4.291 -17.457  -7.704
   10   1H2     G   1          H21         G   1  -6.144 -16.958  -8.815
   11   2H2     G   1          H22         G   1  -6.144 -16.583 -10.523
   12    H5T    G   1           H5T        G   1   1.907 -14.988 -12.236
   13   1H5*    G   2          2H5*        G   2  -4.381 -14.219 -13.997
   14   2H5*    G   2          1H5*        G   2  -4.648 -12.593 -14.656
   15    H4*    G   2           H4*        G   2  -6.690 -13.085 -13.610
   16    H3*    G   2           H3*        G   2  -4.853 -11.396 -11.916
   17    H2*    G   2           H2*        G   2  -6.189 -11.580 -10.015
   18   2HO*    G   2          2HO*        G   2  -8.513 -12.513 -10.612
   19    H1*    G   2           H1*        G   2  -7.370 -14.083 -10.463
   20    H8     G   2           H8         G   2  -3.576 -14.119 -10.611
   21    H1     G   2           H1         G   2  -5.883 -14.392  -4.677
   22   1H2     G   2          H21         G   2  -8.069 -13.998  -4.695
   23   2H2     G   2          H22         G   2  -8.951 -13.669  -6.168
   24   1H5*    A   3          2H5*        A   3  -8.180 -10.146 -10.996
   25   2H5*    A   3          1H5*        A   3  -8.709  -8.507 -11.400
   26    H4*    A   3           H4*        A   3  -9.151  -8.738  -9.101
   27    H3*    A   3           H3*        A   3  -6.649  -7.192  -9.790
   28    H2*    A   3           H2*        A   3  -5.980  -7.174  -7.576
   29   2HO*    A   3          2HO*        A   3  -8.513  -6.291  -7.345
   30    H1*    A   3           H1*        A   3  -7.968  -9.173  -6.692
   31    H8     A   3           H8         A   3  -4.542  -9.643  -8.398
   32   1H6     A   3          H61         A   3  -2.389 -11.166  -2.846
   33   2H6     A   3          H62         A   3  -1.999 -11.009  -4.543
   34    H2     A   3           H2         A   3  -6.692  -9.964  -2.378
   35   1H5*    U   4          2H5*        U   4 -10.397  -4.888  -7.368
   36   2H5*    U   4          1H5*        U   4  -9.820  -3.226  -7.136
   37    H4*    U   4           H4*        U   4 -10.784  -4.591  -5.099
   38    H3*    U   4           H3*        U   4  -8.380  -2.753  -5.210
   39    H2*    U   4           H2*        U   4  -7.811  -3.248  -2.988
   40   2HO*    U   4          2HO*        U   4  -9.793  -4.688  -1.990
   41    H1*    U   4           H1*        U   4  -8.604  -5.912  -2.900
   42    H3     U   4           H3         U   4  -4.181  -5.961  -2.016
   43    H5     U   4           H5         U   4  -4.399  -5.094  -6.178
   44    H6     U   4           H6         U   4  -6.811  -4.903  -5.925
   45   1H5*    G   5          2H5*        G   5 -11.417  -2.615  -1.289
   46   2H5*    G   5          1H5*        G   5 -11.706  -0.870  -1.451
   47    H4*    G   5           H4*        G   5 -11.488  -1.461   0.913
   48    H3*    G   5           H3*        G   5  -9.407   0.261  -0.417
   49    H2*    G   5           H2*        G   5  -7.991   0.254   1.478
   50   2HO*    G   5          2HO*        G   5 -10.194  -0.880   2.921
   51    H1*    G   5           H1*        G   5  -8.184  -2.350   2.171
   52    H8     G   5           H8         G   5  -8.377  -1.583  -1.591
   53    H1     G   5           H1         G   5  -2.460  -2.515   0.581
   54   1H2     G   5          H21         G   5  -2.485  -2.727   2.788
   55   2H2     G   5          H22         G   5  -3.961  -2.638   3.724
   56   1H5*    C   6          2H5*        C   6  -9.147   1.053   3.631
   57   2H5*    C   6          1H5*        C   6  -9.254   2.804   3.857
   58    H4*    C   6           H4*        C   6  -7.143   1.579   4.701
   59    H3*    C   6           H3*        C   6  -7.307   4.154   3.104
   60    H2*    C   6           H2*        C   6  -5.010   4.166   2.834
   61   2HO*    C   6          2HO*        C   6  -3.764   4.046   4.562
   62    H1*    C   6           H1*        C   6  -4.630   1.382   3.677
   63   1H4     C   6          H41         C   6  -1.273   2.099  -1.706
   64   2H4     C   6          H42         C   6  -2.739   2.433  -2.601
   65    H5     C   6           H5         C   6  -4.911   2.593  -1.569
   66    H6     C   6           H6         C   6  -6.149   2.464   0.546
   67   1H5*    C   7          2H5*        C   7  -5.235   5.178   7.190
   68   2H5*    C   7          1H5*        C   7  -5.136   6.949   7.249
   69    H4*    C   7           H4*        C   7  -2.934   5.487   7.069
   70    H3*    C   7           H3*        C   7  -3.586   8.044   5.545
   71    H2*    C   7           H2*        C   7  -1.473   7.915   4.534
   72   2HO*    C   7          2HO*        C   7  -0.788   6.918   6.942
   73    H1*    C   7           H1*        C   7  -1.286   5.105   4.449
   74   1H4     C   7          H41         C   7  -2.036   7.173  -1.516
   75   2H4     C   7          H42         C   7  -3.687   7.647  -1.189
   76    H5     C   7           H5         C   7  -4.703   7.471   0.994
   77    H6     C   7           H6         C   7  -4.347   6.818   3.331
   78   1H5*    U   8          2H5*        U   8   0.219   7.769   8.252
   79   2H5*    U   8          1H5*        U   8   0.948   9.369   8.480
   80    H4*    U   8           H4*        U   8   2.383   7.369   7.528
   81    H3*    U   8           H3*        U   8   2.359  10.274   6.631
   82    H2*    U   8           H2*        U   8   3.989   9.763   4.982
   83   2HO*    U   8          2HO*        U   8   5.071   8.266   6.646
   84    H1*    U   8           H1*        U   8   2.937   7.391   4.127
   85    H3     U   8           H3         U   8   2.466  10.669   0.960
   86    H5     U   8           H5         U   8  -0.846  11.125   3.522
   87    H6     U   8           H6         U   8   0.165   9.488   5.009
   88   1H5*    C   9          2H5*        C   9   6.960   9.662   6.837
   89   2H5*    C   9          1H5*        C   9   7.319  11.239   7.570
   90    H4*    C   9           H4*        C   9   8.225  10.666   5.159
   91    H3*    C   9           H3*        C   9   7.222  13.191   6.373
   92    H2*    C   9           H2*        C   9   6.540  14.191   4.416
   93   2HO*    C   9          2HO*        C   9   8.487  12.945   2.810
   94    H1*    C   9           H1*        C   9   6.767  11.949   2.577
   95   1H4     C   9          H41         C   9   0.980  14.494   1.786
   96   2H4     C   9          H42         C   9   0.469  13.854   3.331
   97    H5     C   9           H5         C   9   1.955  12.704   4.844
   98    H6     C   9           H6         C   9   4.243  11.923   5.196
   99   1H5*    C  10          2H5*        C  10   8.483  16.064   5.652
  100   2H5*    C  10          1H5*        C  10   9.154  14.733   4.686
  101    H4*    C  10           H4*        C  10  10.530  17.364   5.376
  102    H3*    C  10           H3*        C  10   8.723  16.871   3.298
  103    H2*    C  10           H2*        C  10   9.948  15.161   2.206
  104   2HO*    C  10          2HO*        C  10  10.119  16.368   0.469
  105    H1*    C  10           H1*        C  10  12.591  16.501   2.728
  106   1H4     C  10          H41         C  10  14.462  10.715   0.906
  107   2H4     C  10          H42         C  10  13.372   9.951   2.042
  108    H5     C  10           H5         C  10  11.840  11.184   3.434
  109    H6     C  10           H6         C  10  11.014  13.419   4.031
  110   1H5*    C  11          2H5*        C  11  10.390  18.338   1.001
  111   2H5*    C  11          1H5*        C  11  10.615  19.980   0.366
  112    H4*    C  11           H4*        C  11   9.978  18.408  -1.427
  113    H3*    C  11           H3*        C  11   8.864  20.919  -1.039
  114    H2*    C  11           H2*        C  11   6.820  20.243  -0.054
  115   2HO*    C  11          2HO*        C  11   5.760  21.048  -1.712
  116    H1*    C  11           H1*        C  11   6.601  17.792  -1.789
  117   1H4     C  11          H41         C  11   2.247  16.718   2.715
  118   2H4     C  11          H42         C  11   3.451  16.895   3.972
  119    H5     C  11           H5         C  11   5.738  17.510   3.533
  120    H6     C  11           H6         C  11   7.365  18.088   1.794
  121   1H5*    G  12          2H5*        G  12   8.454  17.975  -4.455
  122   2H5*    G  12          1H5*        G  12   9.213  17.186  -3.059
  123    H4*    G  12           H4*        G  12  10.068  16.750  -5.944
  124    H3*    G  12           H3*        G  12   7.950  15.469  -4.247
  125    H2*    G  12           H2*        G  12   8.710  13.297  -4.574
  126   2HO*    G  12          2HO*        G  12  10.373  13.859  -6.762
  127    H1*    G  12           H1*        G  12  11.464  13.778  -5.029
  128    H8     G  12           H8         G  12  12.662  12.942  -2.867
  129    H1     G  12           H1         G  12   7.286  13.146   0.550
  130   1H2     G  12          H21         G  12   5.685  14.145  -0.601
  131   2H2     G  12          H22         G  12   5.933  14.765  -2.219
  132   1H5*    A  13          2H5*        A  13   6.629  11.865  -8.521
  133   2H5*    A  13          1H5*        A  13   5.608  12.411  -7.174
  134    H4*    A  13           H4*        A  13   8.152  10.762  -7.060
  135    H3*    A  13           H3*        A  13   5.234  10.367  -6.370
  136    H2*    A  13           H2*        A  13   5.793   9.121  -4.444
  137   2HO*    A  13          2HO*        A  13   8.558   9.134  -4.991
  138    H1*    A  13           H1*        A  13   7.860  10.647  -3.542
  139    H8     A  13           H8         A  13   5.529  13.217  -4.759
  140   1H6     A  13          H61         A  13   1.912  12.199   0.116
  141   2H6     A  13          H62         A  13   2.239  13.268  -1.230
  142    H2     A  13           H2         A  13   4.919   8.868  -0.098
  143   1H5*    G  14          2H5*        G  14   7.616   7.301  -6.416
  144   2H5*    G  14          1H5*        G  14   7.393   5.546  -6.559
  145    H4*    G  14           H4*        G  14   7.966   6.649  -4.225
  146    H3*    G  14           H3*        G  14   6.808   4.189  -4.959
  147    H2*    G  14           H2*        G  14   4.581   4.638  -4.397
  148   2HO*    G  14          2HO*        G  14   5.580   4.518  -1.735
  149    H1*    G  14           H1*        G  14   5.259   6.539  -2.183
  150    H8     G  14           H8         G  14   3.663   7.360  -5.574
  151    H1     G  14           H1         G  14  -0.472   6.885  -0.747
  152   1H2     G  14          H21         G  14   0.568   6.163   1.062
  153   2H2     G  14          H22         G  14   2.276   5.794   1.085
  154   1H5*    U  15          2H5*        U  15   9.206   5.200  -1.113
  155   2H5*    U  15          1H5*        U  15  10.709   4.382  -1.588
  156    H4*    U  15           H4*        U  15  11.145   4.324   0.632
  157    H3*    U  15           H3*        U  15   9.017   2.192   0.365
  158    H2*    U  15           H2*        U  15   9.250   1.831   2.718
  159   2HO*    U  15          2HO*        U  15  10.927   2.673   3.890
  160    H1*    U  15           H1*        U  15   9.163   4.469   3.369
  161    H3     U  15           H3         U  15   5.034   3.226   4.587
  162    H5     U  15           H5         U  15   4.899   3.043   0.379
  163    H6     U  15           H6         U  15   7.275   3.506   0.346
  164   1H5*    G  16          2H5*        G  16   9.108  -1.419  -0.856
  165   2H5*    G  16          1H5*        G  16   7.914  -0.502  -1.796
  166    H4*    G  16           H4*        G  16   8.101  -0.697   1.254
  167    H3*    G  16           H3*        G  16   6.254  -1.886  -0.923
  168    H2*    G  16           H2*        G  16   4.376  -1.595   0.451
  169   2HO*    G  16          2HO*        G  16   5.898  -0.987   2.762
  170    H1*    G  16           H1*        G  16   5.149   0.776   1.775
  171    H8     G  16           H8         G  16   5.501   0.959  -2.018
  172    H1     G  16           H1         G  16  -0.473   1.889   0.026
  173   1H2     G  16          H21         G  16  -0.622   1.420   2.186
  174   2H2     G  16          H22         G  16   0.750   0.881   3.128
  175   1H5*    C  17          2H5*        C  17   5.819  -3.053   3.408
  176   2H5*    C  17          1H5*        C  17   6.043  -4.814   3.416
  177    H4*    C  17           H4*        C  17   4.396  -4.228   5.098
  178    H3*    C  17           H3*        C  17   3.391  -5.625   2.602
  179    H2*    C  17           H2*        C  17   1.177  -5.570   3.406
  180   2HO*    C  17          2HO*        C  17   0.989  -4.732   5.764
  181    H1*    C  17           H1*        C  17   1.253  -3.042   4.611
  182   1H4     C  17          H41         C  17  -1.642  -2.350  -1.010
  183   2H4     C  17          H42         C  17  -0.117  -2.491  -1.854
  184    H5     C  17           H5         C  17   1.960  -2.960  -0.743
  185    H6     C  17           H6         C  17   3.039  -3.397   1.416
  186   1H5*    A  18          2H5*        A  18   1.378  -7.010   6.169
  187   2H5*    A  18          1H5*        A  18   1.814  -8.722   6.334
  188    H4*    A  18           H4*        A  18  -0.519  -8.552   6.843
  189    H3*    A  18           H3*        A  18   0.159  -9.737   4.153
  190    H2*    A  18           H2*        A  18  -2.126  -9.890   3.556
  191   2HO*    A  18          2HO*        A  18  -3.779  -9.785   5.068
  192    H1*    A  18           H1*        A  18  -2.977  -7.490   4.497
  193    H8     A  18           H8         A  18   0.564  -7.637   3.025
  194   1H6     A  18          H61         A  18  -2.030  -6.141  -2.369
  195   2H6     A  18          H62         A  18  -0.516  -6.415  -1.536
  196    H2     A  18           H2         A  18  -5.310  -6.792   0.637
  197   1H5*    U  19          2H5*        U  19  -2.841 -12.533   6.463
  198   2H5*    U  19          1H5*        U  19  -2.861 -14.065   5.566
  199    H4*    U  19           H4*        U  19  -5.035 -12.565   5.694
  200    H3*    U  19           H3*        U  19  -3.896 -14.097   3.343
  201    H2*    U  19           H2*        U  19  -5.602 -13.292   1.924
  202   2HO*    U  19          2HO*        U  19  -7.535 -12.573   2.667
  203    H1*    U  19           H1*        U  19  -5.674 -10.675   2.855
  204    H3     U  19           H3         U  19  -3.918 -10.604  -1.352
  205    H5     U  19           H5         U  19  -0.736 -11.972   1.127
  206    H6     U  19           H6         U  19  -2.320 -12.058   2.963
  207   1H5*    C  20          2H5*        C  20  -8.359 -15.580   3.765
  208   2H5*    C  20          1H5*        C  20  -8.279 -17.179   3.000
  209    H4*    C  20           H4*        C  20  -9.847 -15.306   2.003
  210    H3*    C  20           H3*        C  20  -8.063 -17.271   0.534
  211    H2*    C  20           H2*        C  20  -8.695 -16.324  -1.541
  212   2HO*    C  20          2HO*        C  20 -10.866 -15.274  -0.038
  213    H1*    C  20           H1*        C  20  -8.696 -13.680  -0.789
  214   1H4     C  20          H41         C  20  -3.144 -15.047  -3.632
  215   2H4     C  20          H42         C  20  -2.452 -15.435  -2.072
  216    H5     C  20           H5         C  20  -3.742 -15.507  -0.036
  217    H6     C  20           H6         C  20  -5.974 -15.222   0.941
  218   1H5*    C  21          2H5*        C  21 -11.108 -16.493  -1.976
  219   2H5*    C  21          1H5*        C  21 -12.058 -17.977  -2.185
  220    H4*    C  21           H4*        C  21 -11.565 -17.019  -4.376
  221    H3*    C  21           H3*        C  21 -10.056 -19.535  -3.617
  222    H2*    C  21           H2*        C  21  -8.965 -19.536  -5.652
  223   2HO*    C  21          2HO*        C  21 -10.848 -17.752  -6.816
  224    H1*    C  21           H1*        C  21  -9.144 -16.693  -6.122
  225   1H4     C  21          H41         C  21  -2.949 -18.080  -5.709
  226   2H4     C  21          H42         C  21  -3.113 -18.455  -4.008
  227    H5     C  21           H5         C  21  -5.226 -18.447  -2.851
  228    H6     C  21           H6         C  21  -7.638 -18.076  -3.074
  229    H3T    C  21           H3T        C  21 -12.520 -19.028  -4.256
  Start of MODEL    4
    1   1H5*    G   1          2H5*        G   1   0.199 -17.033 -14.263
    2   2H5*    G   1          1H5*        G   1   0.425 -15.436 -15.005
    3    H4*    G   1           H4*        G   1  -1.738 -15.779 -15.678
    4    H3*    G   1           H3*        G   1  -1.861 -14.672 -12.865
    5    H2*    G   1           H2*        G   1  -4.198 -15.019 -12.775
    6   2HO*    G   1          2HO*        G   1  -3.939 -14.961 -15.566
    7    H1*    G   1           H1*        G   1  -4.308 -17.444 -14.014
    8    H8     G   1           H8         G   1  -1.431 -18.111 -11.925
    9    H1     G   1           H1         G   1  -6.546 -17.103  -8.256
   10   1H2     G   1          H21         G   1  -8.166 -16.165  -9.447
   11   2H2     G   1          H22         G   1  -7.984 -15.787 -11.145
   12    H5T    G   1           H5T        G   1   0.003 -14.482 -13.042
   13   1H5*    G   2          2H5*        G   2  -5.507 -13.809 -14.365
   14   2H5*    G   2          1H5*        G   2  -5.368 -12.123 -14.900
   15    H4*    G   2           H4*        G   2  -7.499 -12.254 -13.887
   16    H3*    G   2           H3*        G   2  -5.351 -10.979 -12.219
   17    H2*    G   2           H2*        G   2  -6.568 -11.027 -10.248
   18   2HO*    G   2          2HO*        G   2  -8.694 -10.566 -10.192
   19    H1*    G   2           H1*        G   2  -8.379 -13.134 -10.778
   20    H8     G   2           H8         G   2  -4.723 -14.115 -10.911
   21    H1     G   2           H1         G   2  -7.069 -13.920  -4.986
   22   1H2     G   2          H21         G   2  -9.083 -12.986  -5.002
   23   2H2     G   2          H22         G   2  -9.841 -12.412  -6.469
   24   1H5*    A   3          2H5*        A   3  -8.385  -9.230 -11.403
   25   2H5*    A   3          1H5*        A   3  -8.863  -7.569 -11.778
   26    H4*    A   3           H4*        A   3  -9.292  -7.699  -9.505
   27    H3*    A   3           H3*        A   3  -6.573  -6.534 -10.106
   28    H2*    A   3           H2*        A   3  -5.966  -6.658  -7.873
   29   2HO*    A   3          2HO*        A   3  -7.685  -6.309  -6.232
   30    H1*    A   3           H1*        A   3  -8.237  -8.368  -7.083
   31    H8     A   3           H8         A   3  -4.885  -9.295  -8.752
   32   1H6     A   3          H61         A   3  -3.058 -11.222  -3.210
   33   2H6     A   3          H62         A   3  -2.626 -11.091  -4.899
   34    H2     A   3           H2         A   3  -7.151  -9.423  -2.766
   35   1H5*    U   4          2H5*        U   4  -9.551  -4.943  -7.404
   36   2H5*    U   4          1H5*        U   4  -9.856  -3.199  -7.529
   37    H4*    U   4           H4*        U   4 -10.149  -3.761  -5.231
   38    H3*    U   4           H3*        U   4  -7.523  -2.394  -5.884
   39    H2*    U   4           H2*        U   4  -6.811  -2.566  -3.649
   40   2HO*    U   4          2HO*        U   4  -8.944  -3.461  -2.308
   41    H1*    U   4           H1*        U   4  -8.005  -5.002  -2.994
   42    H3     U   4           H3         U   4  -3.719  -6.093  -2.400
   43    H5     U   4           H5         U   4  -3.879  -5.061  -6.525
   44    H6     U   4           H6         U   4  -6.206  -4.432  -6.191
   45   1H5*    G   5          2H5*        G   5 -10.560  -0.790  -2.378
   46   2H5*    G   5          1H5*        G   5 -10.108   0.919  -2.210
   47    H4*    G   5           H4*        G   5 -10.395  -0.379  -0.030
   48    H3*    G   5           H3*        G   5  -8.003   1.271  -0.820
   49    H2*    G   5           H2*        G   5  -6.748   0.595   1.060
   50   2HO*    G   5          2HO*        G   5  -9.294  -0.136   2.099
   51    H1*    G   5           H1*        G   5  -7.428  -2.035   1.142
   52    H8     G   5           H8         G   5  -7.076  -0.623  -2.395
   53    H1     G   5           H1         G   5  -1.562  -2.524   0.172
   54   1H2     G   5          H21         G   5  -1.861  -3.076   2.295
   55   2H2     G   5          H22         G   5  -3.420  -2.973   3.082
   56   1H5*    C   6          2H5*        C   6  -7.770   1.056   3.543
   57   2H5*    C   6          1H5*        C   6  -7.860   2.768   3.971
   58    H4*    C   6           H4*        C   6  -5.819   1.469   4.795
   59    H3*    C   6           H3*        C   6  -5.871   4.134   3.366
   60    H2*    C   6           H2*        C   6  -3.582   4.078   3.035
   61   2HO*    C   6          2HO*        C   6  -3.589   4.023   5.547
   62    H1*    C   6           H1*        C   6  -3.263   1.262   3.841
   63   1H4     C   6          H41         C   6   0.235   1.861  -1.444
   64   2H4     C   6          H42         C   6  -1.148   2.455  -2.335
   65    H5     C   6           H5         C   6  -3.307   2.824  -1.332
   66    H6     C   6           H6         C   6  -4.610   2.708   0.743
   67   1H5*    C   7          2H5*        C   7  -4.000   5.045   7.926
   68   2H5*    C   7          1H5*        C   7  -3.741   6.796   7.794
   69    H4*    C   7           H4*        C   7  -1.694   5.152   8.176
   70    H3*    C   7           H3*        C   7  -1.872   7.604   6.397
   71    H2*    C   7           H2*        C   7   0.336   7.231   5.633
   72   2HO*    C   7          2HO*        C   7   1.352   6.832   7.602
   73    H1*    C   7           H1*        C   7   0.224   4.493   5.425
   74   1H4     C   7          H41         C   7  -0.881   6.706  -0.419
   75   2H4     C   7          H42         C   7  -2.507   7.179   0.024
   76    H5     C   7           H5         C   7  -3.372   6.985   2.265
   77    H6     C   7           H6         C   7  -2.852   6.302   4.571
   78   1H5*    U   8          2H5*        U   8   1.686   8.605   9.619
   79   2H5*    U   8          1H5*        U   8   1.690  10.373   9.467
   80    H4*    U   8           H4*        U   8   3.883   8.980   8.979
   81    H3*    U   8           H3*        U   8   2.774  11.374   7.475
   82    H2*    U   8           H2*        U   8   4.552  11.233   5.913
   83   2HO*    U   8          2HO*        U   8   5.792   9.406   7.734
   84    H1*    U   8           H1*        U   8   4.637   8.511   5.642
   85    H3     U   8           H3         U   8   3.039  10.168   1.731
   86    H5     U   8           H5         U   8  -0.236  10.420   4.376
   87    H6     U   8           H6         U   8   1.248   9.737   6.172
   88   1H5*    C   9          2H5*        C   9   7.005  11.596   7.045
   89   2H5*    C   9          1H5*        C   9   7.435  13.274   7.426
   90    H4*    C   9           H4*        C   9   7.923  12.302   5.030
   91    H3*    C   9           H3*        C   9   7.380  14.946   6.021
   92    H2*    C   9           H2*        C   9   5.580  15.520   4.695
   93   2HO*    C   9          2HO*        C   9   6.137  15.705   2.393
   94    H1*    C   9           H1*        C   9   5.858  13.376   2.662
   95   1H4     C   9          H41         C   9  -0.384  14.555   2.814
   96   2H4     C   9          H42         C   9  -0.455  14.144   4.513
   97    H5     C   9           H5         C   9   1.492  13.586   5.822
   98    H6     C   9           H6         C   9   3.924  13.315   5.782
   99   1H5*    C  10          2H5*        C  10   7.583  17.940   4.058
  100   2H5*    C  10          1H5*        C  10   8.040  16.445   3.217
  101    H4*    C  10           H4*        C  10   9.558  19.078   3.301
  102    H3*    C  10           H3*        C  10   7.609  18.085   1.488
  103    H2*    C  10           H2*        C  10   8.892  16.478   0.392
  104   2HO*    C  10          2HO*        C  10  10.406  17.667  -1.158
  105    H1*    C  10           H1*        C  10  11.514  17.866   0.820
  106   1H4     C  10          H41         C  10  13.386  11.942  -0.447
  107   2H4     C  10          H42         C  10  12.165  11.265   0.608
  108    H5     C  10           H5         C  10  10.558  12.600   1.794
  109    H6     C  10           H6         C  10   9.778  14.897   2.241
  110   1H5*    C  11          2H5*        C  11   7.861  18.628  -0.962
  111   2H5*    C  11          1H5*        C  11   7.750  20.191  -1.792
  112    H4*    C  11           H4*        C  11   6.505  18.459  -3.012
  113    H3*    C  11           H3*        C  11   5.545  20.978  -2.509
  114    H2*    C  11           H2*        C  11   4.340  20.386  -0.508
  115   2HO*    C  11          2HO*        C  11   2.537  19.915  -2.684
  116    H1*    C  11           H1*        C  11   3.289  17.918  -1.914
  117   1H4     C  11          H41         C  11   1.137  16.952   3.985
  118   2H4     C  11          H42         C  11   2.765  17.029   4.619
  119    H5     C  11           H5         C  11   4.686  17.560   3.274
  120    H6     C  11           H6         C  11   5.466  18.130   1.021
  121   1H5*    G  12          2H5*        G  12   4.017  16.523  -5.359
  122   2H5*    G  12          1H5*        G  12   5.145  17.197  -4.167
  123    H4*    G  12           H4*        G  12   6.196  16.497  -6.892
  124    H3*    G  12           H3*        G  12   5.181  14.531  -4.839
  125    H2*    G  12           H2*        G  12   7.144  13.274  -4.867
  126   2HO*    G  12          2HO*        G  12   7.701  14.451  -7.420
  127    H1*    G  12           H1*        G  12   9.004  15.309  -5.550
  128    H8     G  12           H8         G  12  10.493  14.775  -3.567
  129    H1     G  12           H1         G  12   5.688  14.482   0.610
  130   1H2     G  12          H21         G  12   3.765  14.862  -0.403
  131   2H2     G  12          H22         G  12   3.650  15.195  -2.115
  132   1H5*    A  13          2H5*        A  13   7.694  11.740  -7.582
  133   2H5*    A  13          1H5*        A  13   6.431  10.498  -7.714
  134    H4*    A  13           H4*        A  13   8.756  10.065  -6.418
  135    H3*    A  13           H3*        A  13   5.955   9.028  -5.968
  136    H2*    A  13           H2*        A  13   6.606   7.953  -3.949
  137   2HO*    A  13          2HO*        A  13   9.250   8.379  -4.928
  138    H1*    A  13           H1*        A  13   8.132   9.942  -2.915
  139    H8     A  13           H8         A  13   4.983  10.878  -4.946
  140   1H6     A  13          H61         A  13   1.974  10.762   0.431
  141   2H6     A  13          H62         A  13   1.837  11.093  -1.281
  142    H2     A  13           H2         A  13   6.222   9.505   1.180
  143   1H5*    G  14          2H5*        G  14   9.107   6.433  -5.306
  144   2H5*    G  14          1H5*        G  14   8.906   4.676  -5.444
  145    H4*    G  14           H4*        G  14   9.578   5.782  -3.142
  146    H3*    G  14           H3*        G  14   8.429   3.298  -3.819
  147    H2*    G  14           H2*        G  14   6.219   3.766  -3.168
  148   2HO*    G  14          2HO*        G  14   6.225   3.491  -0.676
  149    H1*    G  14           H1*        G  14   7.084   5.572  -0.923
  150    H8     G  14           H8         G  14   5.081   6.323  -4.124
  151    H1     G  14           H1         G  14   1.572   6.009   1.183
  152   1H2     G  14          H21         G  14   2.851   5.369   2.890
  153   2H2     G  14          H22         G  14   4.553   5.023   2.708
  154   1H5*    U  15          2H5*        U  15  10.663   4.042   0.473
  155   2H5*    U  15          1H5*        U  15  12.014   3.081  -0.158
  156    H4*    U  15           H4*        U  15  12.457   2.781   2.060
  157    H3*    U  15           H3*        U  15  10.254   0.801   1.465
  158    H2*    U  15           H2*        U  15  10.429   0.076   3.734
  159   2HO*    U  15          2HO*        U  15  12.708   0.161   3.927
  160    H1*    U  15           H1*        U  15  10.449   2.580   4.792
  161    H3     U  15           H3         U  15   6.256   1.333   5.765
  162    H5     U  15           H5         U  15   6.165   1.866   1.586
  163    H6     U  15           H6         U  15   8.560   2.217   1.640
  164   1H5*    G  16          2H5*        G  16  10.278  -2.745  -0.058
  165   2H5*    G  16          1H5*        G  16   9.150  -1.738  -0.987
  166    H4*    G  16           H4*        G  16   9.142  -2.285   2.021
  167    H3*    G  16           H3*        G  16   7.327  -2.964  -0.393
  168    H2*    G  16           H2*        G  16   5.408  -2.710   0.936
  169   2HO*    G  16          2HO*        G  16   6.385  -2.376   3.436
  170    H1*    G  16           H1*        G  16   6.299  -0.618   2.602
  171    H8     G  16           H8         G  16   6.850  -0.116  -1.166
  172    H1     G  16           H1         G  16   1.001   1.466   0.845
  173   1H2     G  16          H21         G  16   0.730   0.847   2.956
  174   2H2     G  16          H22         G  16   1.991   0.050   3.870
  175   1H5*    C  17          2H5*        C  17   6.299  -4.579   3.658
  176   2H5*    C  17          1H5*        C  17   6.367  -6.338   3.439
  177    H4*    C  17           H4*        C  17   4.553  -5.829   4.952
  178    H3*    C  17           H3*        C  17   3.780  -6.710   2.154
  179    H2*    C  17           H2*        C  17   1.494  -6.529   2.684
  180   2HO*    C  17          2HO*        C  17   2.075  -6.179   5.452
  181    H1*    C  17           H1*        C  17   1.645  -4.264   4.346
  182   1H4     C  17          H41         C  17  -0.579  -2.325  -1.288
  183   2H4     C  17          H42         C  17   1.012  -2.459  -2.002
  184    H5     C  17           H5         C  17   2.919  -3.314  -0.814
  185    H6     C  17           H6         C  17   3.723  -4.229   1.315
  186   1H5*    A  18          2H5*        A  18   1.749  -9.215   5.827
  187   2H5*    A  18          1H5*        A  18   1.369 -10.746   5.016
  188    H4*    A  18           H4*        A  18  -0.519  -9.515   6.321
  189    H3*    A  18           H3*        A  18  -0.634 -10.835   3.623
  190    H2*    A  18           H2*        A  18  -2.793 -10.011   3.154
  191   2HO*    A  18          2HO*        A  18  -3.951 -10.413   4.958
  192    H1*    A  18           H1*        A  18  -2.571  -7.498   4.162
  193    H8     A  18           H8         A  18   0.675  -8.595   2.546
  194   1H6     A  18          H61         A  18  -1.694  -6.670  -2.814
  195   2H6     A  18          H62         A  18  -0.251  -7.248  -2.011
  196    H2     A  18           H2         A  18  -4.952  -6.556   0.281
  197   1H5*    U  19          2H5*        U  19  -4.125 -12.712   6.030
  198   2H5*    U  19          1H5*        U  19  -4.550 -14.213   5.180
  199    H4*    U  19           H4*        U  19  -6.258 -12.225   5.201
  200    H3*    U  19           H3*        U  19  -5.445 -13.980   2.873
  201    H2*    U  19           H2*        U  19  -6.801 -12.752   1.390
  202   2HO*    U  19          2HO*        U  19  -8.699 -12.614   2.542
  203    H1*    U  19           H1*        U  19  -6.317 -10.204   2.414
  204    H3     U  19           H3         U  19  -4.514 -10.547  -1.785
  205    H5     U  19           H5         U  19  -1.668 -12.354   0.819
  206    H6     U  19           H6         U  19  -3.303 -12.157   2.602
  207   1H5*    C  20          2H5*        C  20 -10.038 -14.727   3.389
  208   2H5*    C  20          1H5*        C  20 -10.366 -16.231   2.505
  209    H4*    C  20           H4*        C  20 -11.377 -13.941   1.664
  210    H3*    C  20           H3*        C  20 -10.169 -16.205   0.051
  211    H2*    C  20           H2*        C  20 -10.459 -14.983  -1.953
  212   2HO*    C  20          2HO*        C  20 -12.274 -13.432  -0.398
  213    H1*    C  20           H1*        C  20  -9.774 -12.492  -1.015
  214   1H4     C  20          H41         C  20  -4.737 -15.158  -3.912
  215   2H4     C  20          H42         C  20  -4.162 -15.709  -2.354
  216    H5     C  20           H5         C  20  -5.440 -15.483  -0.321
  217    H6     C  20           H6         C  20  -7.544 -14.682   0.654
  218   1H5*    C  21          2H5*        C  21 -12.841 -14.529  -2.631
  219   2H5*    C  21          1H5*        C  21 -14.138 -15.734  -2.763
  220    H4*    C  21           H4*        C  21 -13.433 -15.054  -5.001
  221    H3*    C  21           H3*        C  21 -12.626 -17.825  -4.085
  222    H2*    C  21           H2*        C  21 -11.539 -18.223  -6.078
  223   2HO*    C  21          2HO*        C  21 -13.494 -16.466  -7.114
  224    H1*    C  21           H1*        C  21 -11.020 -15.456  -6.739
  225   1H4     C  21          H41         C  21  -5.304 -18.170  -6.160
  226   2H4     C  21          H42         C  21  -5.597 -18.530  -4.473
  227    H5     C  21           H5         C  21  -7.685 -18.062  -3.366
  228    H6     C  21           H6         C  21  -9.943 -17.143  -3.637
  229    H3T    C  21           H3T        C  21 -14.668 -18.042  -4.587
  Start of MODEL    5
    1   1H5*    G   1          2H5*        G   1   1.108 -16.742 -13.705
    2   2H5*    G   1          1H5*        G   1   1.105 -15.116 -14.417
    3    H4*    G   1           H4*        G   1  -0.980 -15.762 -15.112
    4    H3*    G   1           H3*        G   1  -1.283 -14.718 -12.289
    5    H2*    G   1           H2*        G   1  -3.545 -15.397 -12.227
    6   2HO*    G   1          2HO*        G   1  -4.567 -16.151 -14.236
    7    H1*    G   1           H1*        G   1  -3.298 -17.798 -13.490
    8    H8     G   1           H8         G   1  -0.391 -18.154 -11.411
    9    H1     G   1           H1         G   1  -5.559 -17.688  -7.704
   10   1H2     G   1          H21         G   1  -7.270 -16.910  -8.881
   11   2H2     G   1          H22         G   1  -7.139 -16.505 -10.577
   12    H5T    G   1           H5T        G   1   0.231 -15.695 -11.779
   13   1H5*    G   2          2H5*        G   2  -4.965 -14.386 -13.958
   14   2H5*    G   2          1H5*        G   2  -5.054 -12.696 -14.492
   15    H4*    G   2           H4*        G   2  -7.208 -13.170 -13.630
   16    H3*    G   2           H3*        G   2  -5.417 -11.611 -11.765
   17    H2*    G   2           H2*        G   2  -6.914 -11.761  -9.980
   18   2HO*    G   2          2HO*        G   2  -9.192 -12.679 -11.045
   19    H1*    G   2           H1*        G   2  -8.144 -14.210 -10.566
   20    H8     G   2           H8         G   2  -4.392 -14.548 -10.464
   21    H1     G   2           H1         G   2  -7.021 -14.408  -4.661
   22   1H2     G   2          H21         G   2  -9.154 -13.807  -4.809
   23   2H2     G   2          H22         G   2  -9.923 -13.441  -6.336
   24   1H5*    A   3          2H5*        A   3  -8.806  -9.889 -11.292
   25   2H5*    A   3          1H5*        A   3  -9.001  -8.175 -11.677
   26    H4*    A   3           H4*        A   3  -9.739  -8.510  -9.424
   27    H3*    A   3           H3*        A   3  -7.123  -7.065  -9.876
   28    H2*    A   3           H2*        A   3  -6.628  -7.126  -7.620
   29   2HO*    A   3          2HO*        A   3  -8.180  -5.731  -6.935
   30    H1*    A   3           H1*        A   3  -8.751  -9.050  -6.928
   31    H8     A   3           H8         A   3  -5.297  -9.736  -8.452
   32   1H6     A   3          H61         A   3  -3.443 -11.198  -2.775
   33   2H6     A   3          H62         A   3  -2.982 -11.121  -4.459
   34    H2     A   3           H2         A   3  -7.681  -9.729  -2.513
   35   1H5*    U   4          2H5*        U   4 -10.516  -5.318  -7.188
   36   2H5*    U   4          1H5*        U   4 -10.487  -3.553  -7.361
   37    H4*    U   4           H4*        U   4 -10.881  -4.221  -5.022
   38    H3*    U   4           H3*        U   4  -8.340  -2.753  -5.776
   39    H2*    U   4           H2*        U   4  -7.532  -2.875  -3.580
   40   2HO*    U   4          2HO*        U   4  -9.779  -2.147  -2.852
   41    H1*    U   4           H1*        U   4  -8.654  -5.322  -2.815
   42    H3     U   4           H3         U   4  -4.325  -6.239  -2.247
   43    H5     U   4           H5         U   4  -4.582  -5.380  -6.407
   44    H6     U   4           H6         U   4  -6.925  -4.819  -6.060
   45   1H5*    G   5          2H5*        G   5 -11.353  -0.618  -2.066
   46   2H5*    G   5          1H5*        G   5 -10.482   0.929  -2.071
   47    H4*    G   5           H4*        G   5 -10.916  -0.341   0.201
   48    H3*    G   5           H3*        G   5  -8.514   1.200  -0.751
   49    H2*    G   5           H2*        G   5  -7.154   0.485   1.039
   50   2HO*    G   5          2HO*        G   5  -9.443   0.593   2.377
   51    H1*    G   5           H1*        G   5  -7.944  -2.108   1.230
   52    H8     G   5           H8         G   5  -7.814  -0.895  -2.375
   53    H1     G   5           H1         G   5  -2.148  -2.725  -0.105
   54   1H2     G   5          H21         G   5  -2.289  -3.116   2.071
   55   2H2     G   5          H22         G   5  -3.781  -2.927   2.964
   56   1H5*    C   6          2H5*        C   6  -7.946   0.941   3.532
   57   2H5*    C   6          1H5*        C   6  -7.997   2.643   4.007
   58    H4*    C   6           H4*        C   6  -5.911   1.338   4.666
   59    H3*    C   6           H3*        C   6  -5.997   4.002   3.216
   60    H2*    C   6           H2*        C   6  -3.698   3.934   2.910
   61   2HO*    C   6          2HO*        C   6  -3.700   3.741   5.423
   62    H1*    C   6           H1*        C   6  -3.431   1.087   3.553
   63   1H4     C   6          H41         C   6  -0.186   2.033  -1.858
   64   2H4     C   6          H42         C   6  -1.642   2.563  -2.671
   65    H5     C   6           H5         C   6  -3.771   2.779  -1.563
   66    H6     C   6           H6         C   6  -4.968   2.529   0.567
   67   1H5*    C   7          2H5*        C   7  -3.682   4.737   7.407
   68   2H5*    C   7          1H5*        C   7  -3.553   6.507   7.435
   69    H4*    C   7           H4*        C   7  -1.375   4.994   7.361
   70    H3*    C   7           H3*        C   7  -1.898   7.540   5.765
   71    H2*    C   7           H2*        C   7   0.300   7.355   4.919
   72   2HO*    C   7          2HO*        C   7   1.891   6.131   5.942
   73    H1*    C   7           H1*        C   7   0.367   4.544   4.802
   74   1H4     C   7          H41         C   7  -0.082   6.741  -1.139
   75   2H4     C   7          H42         C   7  -1.797   7.017  -0.935
   76    H5     C   7           H5         C   7  -2.941   6.705   1.170
   77    H6     C   7           H6         C   7  -2.674   6.066   3.524
   78   1H5*    U   8          2H5*        U   8   1.545   8.240   9.092
   79   2H5*    U   8          1H5*        U   8   1.771   9.999   9.146
   80    H4*    U   8           H4*        U   8   3.809   8.405   8.618
   81    H3*    U   8           H3*        U   8   3.079  11.064   7.357
   82    H2*    U   8           H2*        U   8   4.886  10.890   5.844
   83   2HO*    U   8          2HO*        U   8   5.869   9.027   7.744
   84    H1*    U   8           H1*        U   8   4.724   8.199   5.305
   85    H3     U   8           H3         U   8   3.616  10.428   1.513
   86    H5     U   8           H5         U   8   0.167  10.689   3.916
   87    H6     U   8           H6         U   8   1.435   9.683   5.727
   88   1H5*    C   9          2H5*        C   9   7.691  11.588   7.345
   89   2H5*    C   9          1H5*        C   9   7.634  13.222   8.039
   90    H4*    C   9           H4*        C   9   8.570  12.849   5.599
   91    H3*    C   9           H3*        C   9   7.082  15.049   6.872
   92    H2*    C   9           H2*        C   9   5.785  15.664   5.079
   93   2HO*    C   9          2HO*        C   9   7.997  15.317   3.328
   94    H1*    C   9           H1*        C   9   6.717  13.696   3.103
   95   1H4     C   9          H41         C   9   0.421  14.055   2.307
   96   2H4     C   9          H42         C   9   0.143  13.563   3.962
   97    H5     C   9           H5         C   9   1.920  13.182   5.544
   98    H6     C   9           H6         C   9   4.341  13.178   5.877
   99   1H5*    C  10          2H5*        C  10   7.501  18.698   5.678
  100   2H5*    C  10          1H5*        C  10   7.166  17.521   4.394
  101    H4*    C  10           H4*        C  10   7.832  20.327   4.158
  102    H3*    C  10           H3*        C  10   6.282  18.541   2.706
  103    H2*    C  10           H2*        C  10   8.040  17.259   1.758
  104   2HO*    C  10          2HO*        C  10   8.409  19.278  -0.129
  105    H1*    C  10           H1*        C  10   9.791  19.633   1.221
  106   1H4     C  10          H41         C  10  13.905  14.821   0.755
  107   2H4     C  10          H42         C  10  13.353  14.132   2.265
  108    H5     C  10           H5         C  10  11.549  15.065   3.559
  109    H6     C  10           H6         C  10   9.878  16.864   3.681
  110   1H5*    C  11          2H5*        C  11   6.927  20.331  -0.314
  111   2H5*    C  11          1H5*        C  11   6.108  21.684  -1.121
  112    H4*    C  11           H4*        C  11   6.456  19.586  -2.536
  113    H3*    C  11           H3*        C  11   4.388  21.409  -2.657
  114    H2*    C  11           H2*        C  11   2.847  20.230  -1.273
  115   2HO*    C  11          2HO*        C  11   1.341  19.452  -2.648
  116    H1*    C  11           H1*        C  11   3.617  17.574  -2.476
  117   1H4     C  11          H41         C  11   0.157  15.849   2.570
  118   2H4     C  11          H42         C  11   1.237  16.710   3.643
  119    H5     C  11           H5         C  11   3.080  18.049   2.866
  120    H6     C  11           H6         C  11   4.289  18.854   0.892
  121   1H5*    G  12          2H5*        G  12   5.715  17.753  -5.154
  122   2H5*    G  12          1H5*        G  12   6.526  17.663  -3.577
  123    H4*    G  12           H4*        G  12   7.866  17.347  -6.291
  124    H3*    G  12           H3*        G  12   6.757  15.415  -4.266
  125    H2*    G  12           H2*        G  12   8.672  14.088  -4.236
  126   2HO*    G  12          2HO*        G  12  10.181  14.151  -6.031
  127    H1*    G  12           H1*        G  12  10.633  16.038  -4.828
  128    H8     G  12           H8         G  12  11.981  15.932  -2.660
  129    H1     G  12           H1         G  12   6.877  14.803   0.989
  130   1H2     G  12          H21         G  12   5.033  14.876  -0.234
  131   2H2     G  12          H22         G  12   5.057  15.204  -1.953
  132   1H5*    A  13          2H5*        A  13   9.220  12.427  -7.063
  133   2H5*    A  13          1H5*        A  13   7.838  11.318  -7.175
  134    H4*    A  13           H4*        A  13  10.164  10.746  -5.851
  135    H3*    A  13           H3*        A  13   7.331   9.753  -5.687
  136    H2*    A  13           H2*        A  13   7.679   8.664  -3.620
  137   2HO*    A  13          2HO*        A  13  10.445   9.143  -3.541
  138    H1*    A  13           H1*        A  13   9.204  10.521  -2.368
  139    H8     A  13           H8         A  13   6.489  12.002  -4.628
  140   1H6     A  13          H61         A  13   2.686  11.514   0.202
  141   2H6     A  13          H62         A  13   2.854  12.112  -1.435
  142    H2     A  13           H2         A  13   6.587   9.571   1.291
  143   1H5*    G  14          2H5*        G  14  10.356   6.708  -4.950
  144   2H5*    G  14          1H5*        G  14   9.809   5.022  -5.041
  145    H4*    G  14           H4*        G  14  10.540   6.078  -2.727
  146    H3*    G  14           H3*        G  14   8.327   4.134  -3.388
  147    H2*    G  14           H2*        G  14   7.289   4.344  -1.322
  148   2HO*    G  14          2HO*        G  14   9.818   5.243  -0.332
  149    H1*    G  14           H1*        G  14   8.048   6.958  -0.602
  150    H8     G  14           H8         G  14   6.368   6.950  -3.967
  151    H1     G  14           H1         G  14   2.200   6.278   0.799
  152   1H2     G  14          H21         G  14   3.284   5.872   2.700
  153   2H2     G  14          H22         G  14   5.026   5.767   2.783
  154   1H5*    U  15          2H5*        U  15  10.509   3.061   0.550
  155   2H5*    U  15          1H5*        U  15  11.836   2.710  -0.577
  156    H4*    U  15           H4*        U  15  12.658   1.318   0.988
  157    H3*    U  15           H3*        U  15  10.173  -0.157   0.156
  158    H2*    U  15           H2*        U  15  10.478  -1.714   1.900
  159   2HO*    U  15          2HO*        U  15  12.722  -2.055   1.568
  160    H1*    U  15           H1*        U  15  11.313   0.070   3.822
  161    H3     U  15           H3         U  15   7.182  -1.940   4.583
  162    H5     U  15           H5         U  15   6.501   1.887   2.952
  163    H6     U  15           H6         U  15   8.867   1.998   2.401
  164   1H5*    G  16          2H5*        G  16   9.546  -3.090  -1.706
  165   2H5*    G  16          1H5*        G  16   8.380  -1.977  -2.447
  166    H4*    G  16           H4*        G  16   8.818  -2.513   0.536
  167    H3*    G  16           H3*        G  16   6.643  -3.146  -1.558
  168    H2*    G  16           H2*        G  16   4.920  -2.638  -0.067
  169   2HO*    G  16          2HO*        G  16   6.860  -3.206   1.937
  170    H1*    G  16           H1*        G  16   6.176  -0.638   1.485
  171    H8     G  16           H8         G  16   6.449   0.098  -2.217
  172    H1     G  16           H1         G  16   0.689   1.485   0.167
  173   1H2     G  16          H21         G  16   0.503   0.683   2.221
  174   2H2     G  16          H22         G  16   1.796  -0.190   3.011
  175   1H5*    C  17          2H5*        C  17   6.091  -4.576   2.862
  176   2H5*    C  17          1H5*        C  17   5.922  -6.322   2.595
  177    H4*    C  17           H4*        C  17   4.408  -5.526   4.376
  178    H3*    C  17           H3*        C  17   3.256  -6.609   1.788
  179    H2*    C  17           H2*        C  17   1.064  -6.243   2.553
  180   2HO*    C  17          2HO*        C  17   1.040  -7.115   4.558
  181    H1*    C  17           H1*        C  17   1.513  -3.858   3.969
  182   1H4     C  17          H41         C  17  -1.257  -2.370  -1.576
  183   2H4     C  17          H42         C  17   0.266  -2.563  -2.411
  184    H5     C  17           H5         C  17   2.262  -3.334  -1.337
  185    H6     C  17           H6         C  17   3.259  -4.094   0.771
  186   1H5*    A  18          2H5*        A  18   1.567  -9.060   5.777
  187   2H5*    A  18          1H5*        A  18   1.007 -10.530   4.956
  188    H4*    A  18           H4*        A  18  -0.645  -9.153   6.480
  189    H3*    A  18           H3*        A  18  -1.115 -10.560   3.865
  190    H2*    A  18           H2*        A  18  -3.263  -9.617   3.574
  191   2HO*    A  18          2HO*        A  18  -3.734  -8.181   5.748
  192    H1*    A  18           H1*        A  18  -2.769  -7.082   4.361
  193    H8     A  18           H8         A  18   0.335  -8.360   2.651
  194   1H6     A  18          H61         A  18  -2.329  -6.905  -2.712
  195   2H6     A  18          H62         A  18  -0.841  -7.407  -1.940
  196    H2     A  18           H2         A  18  -5.423  -6.544   0.526
  197   1H5*    U  19          2H5*        U  19  -4.545 -12.641   6.424
  198   2H5*    U  19          1H5*        U  19  -4.680 -14.147   5.493
  199    H4*    U  19           H4*        U  19  -6.685 -12.426   5.536
  200    H3*    U  19           H3*        U  19  -5.583 -14.029   3.215
  201    H2*    U  19           H2*        U  19  -7.095 -13.012   1.718
  202   2HO*    U  19          2HO*        U  19  -9.049 -12.923   2.593
  203    H1*    U  19           H1*        U  19  -6.957 -10.421   2.720
  204    H3     U  19           H3         U  19  -4.999 -10.610  -1.424
  205    H5     U  19           H5         U  19  -2.012 -11.928   1.311
  206    H6     U  19           H6         U  19  -3.716 -11.931   3.037
  207   1H5*    C  20          2H5*        C  20 -10.012 -15.468   3.584
  208   2H5*    C  20          1H5*        C  20 -10.057 -17.017   2.719
  209    H4*    C  20           H4*        C  20 -11.384 -14.930   1.788
  210    H3*    C  20           H3*        C  20  -9.760 -16.993   0.272
  211    H2*    C  20           H2*        C  20 -10.171 -15.864  -1.767
  212   2HO*    C  20          2HO*        C  20 -11.787 -13.839  -1.089
  213    H1*    C  20           H1*        C  20  -9.898 -13.288  -0.861
  214   1H4     C  20          H41         C  20  -4.394 -15.257  -3.452
  215   2H4     C  20          H42         C  20  -3.811 -15.648  -1.850
  216    H5     C  20           H5         C  20  -5.200 -15.545   0.121
  217    H6     C  20           H6         C  20  -7.445 -15.045   0.973
  218   1H5*    C  21          2H5*        C  21 -12.690 -15.811  -2.433
  219   2H5*    C  21          1H5*        C  21 -13.689 -17.253  -2.704
  220    H4*    C  21           H4*        C  21 -12.968 -16.223  -4.843
  221    H3*    C  21           H3*        C  21 -11.884 -18.950  -4.084
  222    H2*    C  21           H2*        C  21 -10.690 -19.059  -6.057
  223   2HO*    C  21          2HO*        C  21 -11.917 -16.982  -7.432
  224    H1*    C  21           H1*        C  21 -10.431 -16.208  -6.439
  225   1H4     C  21          H41         C  21  -4.534 -18.499  -5.757
  226   2H4     C  21          H42         C  21  -4.844 -18.887  -4.081
  227    H5     C  21           H5         C  21  -6.995 -18.598  -3.033
  228    H6     C  21           H6         C  21  -9.311 -17.873  -3.366
  229    H3T    C  21           H3T        C  21 -13.567 -19.603  -5.364
  Start of MODEL    6
    1   1H5*    G   1          2H5*        G   1   1.814 -17.300 -13.370
    2   2H5*    G   1          1H5*        G   1   1.805 -15.763 -14.259
    3    H4*    G   1           H4*        G   1  -0.297 -16.472 -14.834
    4    H3*    G   1           H3*        G   1  -0.525 -15.096 -12.150
    5    H2*    G   1           H2*        G   1  -2.785 -15.744 -11.946
    6   2HO*    G   1          2HO*        G   1  -2.975 -16.845 -14.517
    7    H1*    G   1           H1*        G   1  -2.602 -18.270 -12.966
    8    H8     G   1           H8         G   1   0.348 -18.319 -10.853
    9    H1     G   1           H1         G   1  -4.894 -17.797  -7.260
   10   1H2     G   1          H21         G   1  -6.625 -17.224  -8.523
   11   2H2     G   1          H22         G   1  -6.487 -16.968 -10.247
   12    H5T    G   1           H5T        G   1   1.600 -16.265 -11.521
   13   1H5*    G   2          2H5*        G   2  -4.263 -14.919 -13.712
   14   2H5*    G   2          1H5*        G   2  -4.312 -13.328 -14.495
   15    H4*    G   2           H4*        G   2  -6.451 -13.522 -13.550
   16    H3*    G   2           H3*        G   2  -4.538 -11.907 -11.875
   17    H2*    G   2           H2*        G   2  -5.944 -11.845 -10.020
   18   2HO*    G   2          2HO*        G   2  -8.340 -12.607 -10.790
   19    H1*    G   2           H1*        G   2  -7.399 -14.220 -10.383
   20    H8     G   2           H8         G   2  -3.626 -14.670 -10.322
   21    H1     G   2           H1         G   2  -6.238 -14.400  -4.517
   22   1H2     G   2          H21         G   2  -8.364 -13.778  -4.669
   23   2H2     G   2          H22         G   2  -9.135 -13.433  -6.201
   24   1H5*    A   3          2H5*        A   3  -7.911 -10.415 -11.195
   25   2H5*    A   3          1H5*        A   3  -8.271  -8.755 -11.687
   26    H4*    A   3           H4*        A   3  -8.932  -8.953  -9.412
   27    H3*    A   3           H3*        A   3  -6.393  -7.427  -9.993
   28    H2*    A   3           H2*        A   3  -5.849  -7.337  -7.748
   29   2HO*    A   3          2HO*        A   3  -8.667  -7.082  -7.356
   30    H1*    A   3           H1*        A   3  -7.894  -9.292  -6.904
   31    H8     A   3           H8         A   3  -4.399  -9.855  -8.409
   32   1H6     A   3          H61         A   3  -2.540 -11.162  -2.696
   33   2H6     A   3          H62         A   3  -2.067 -11.092  -4.378
   34    H2     A   3           H2         A   3  -6.835  -9.859  -2.492
   35   1H5*    U   4          2H5*        U   4 -10.216  -4.947  -7.796
   36   2H5*    U   4          1H5*        U   4  -9.569  -3.300  -7.667
   37    H4*    U   4           H4*        U   4 -10.620  -4.475  -5.559
   38    H3*    U   4           H3*        U   4  -8.119  -2.777  -5.752
   39    H2*    U   4           H2*        U   4  -7.613  -3.146  -3.494
   40   2HO*    U   4          2HO*        U   4 -10.391  -3.632  -3.296
   41    H1*    U   4           H1*        U   4  -8.575  -5.747  -3.231
   42    H3     U   4           H3         U   4  -4.210  -6.047  -2.190
   43    H5     U   4           H5         U   4  -4.206  -5.269  -6.376
   44    H6     U   4           H6         U   4  -6.615  -4.965  -6.235
   45   1H5*    G   5          2H5*        G   5 -11.603  -1.641  -2.033
   46   2H5*    G   5          1H5*        G   5 -11.186   0.081  -2.139
   47    H4*    G   5           H4*        G   5 -11.362  -0.934   0.218
   48    H3*    G   5           H3*        G   5  -9.123   0.752  -0.881
   49    H2*    G   5           H2*        G   5  -7.749   0.415   1.010
   50   2HO*    G   5          2HO*        G   5  -8.863  -0.835   2.858
   51    H1*    G   5           H1*        G   5  -8.214  -2.220   1.453
   52    H8     G   5           H8         G   5  -8.183  -1.333  -2.257
   53    H1     G   5           H1         G   5  -2.377  -2.357   0.164
   54   1H2     G   5          H21         G   5  -2.498  -2.579   2.364
   55   2H2     G   5          H22         G   5  -4.010  -2.472   3.238
   56   1H5*    C   6          2H5*        C   6  -8.762   1.015   3.388
   57   2H5*    C   6          1H5*        C   6  -8.884   2.748   3.716
   58    H4*    C   6           H4*        C   6  -6.769   1.497   4.506
   59    H3*    C   6           H3*        C   6  -6.971   4.157   3.072
   60    H2*    C   6           H2*        C   6  -4.692   4.193   2.693
   61   2HO*    C   6          2HO*        C   6  -4.438   4.353   5.045
   62    H1*    C   6           H1*        C   6  -4.246   1.392   3.474
   63   1H4     C   6          H41         C   6  -0.929   2.240  -1.906
   64   2H4     C   6          H42         C   6  -2.391   2.657  -2.774
   65    H5     C   6           H5         C   6  -4.551   2.826  -1.717
   66    H6     C   6           H6         C   6  -5.777   2.630   0.397
   67   1H5*    C   7          2H5*        C   7  -4.843   4.957   7.397
   68   2H5*    C   7          1H5*        C   7  -4.710   6.727   7.431
   69    H4*    C   7           H4*        C   7  -2.532   5.220   7.449
   70    H3*    C   7           H3*        C   7  -3.032   7.773   5.874
   71    H2*    C   7           H2*        C   7  -0.871   7.608   4.969
   72   2HO*    C   7          2HO*        C   7  -0.073   5.508   6.669
   73    H1*    C   7           H1*        C   7  -0.745   4.825   4.776
   74   1H4     C   7          H41         C   7  -1.612   7.108  -1.091
   75   2H4     C   7          H42         C   7  -3.274   7.516  -0.728
   76    H5     C   7           H5         C   7  -4.255   7.236   1.460
   77    H6     C   7           H6         C   7  -3.847   6.508   3.766
   78   1H5*    U   8          2H5*        U   8   0.875   7.315   8.450
   79   2H5*    U   8          1H5*        U   8   1.508   8.946   8.737
   80    H4*    U   8           H4*        U   8   3.042   7.087   7.657
   81    H3*    U   8           H3*        U   8   2.818  10.024   6.904
   82    H2*    U   8           H2*        U   8   4.425   9.695   5.187
   83   2HO*    U   8          2HO*        U   8   6.001   8.482   6.094
   84    H1*    U   8           H1*        U   8   3.501   7.301   4.246
   85    H3     U   8           H3         U   8   2.702  10.620   1.214
   86    H5     U   8           H5         U   8  -0.486  10.877   3.948
   87    H6     U   8           H6         U   8   0.662   9.241   5.336
   88   1H5*    C   9          2H5*        C   9   7.362   9.571   6.830
   89   2H5*    C   9          1H5*        C   9   7.778  11.133   7.567
   90    H4*    C   9           H4*        C   9   8.473  10.619   5.072
   91    H3*    C   9           H3*        C   9   7.609  13.101   6.445
   92    H2*    C   9           H2*        C   9   6.653  14.139   4.633
   93   2HO*    C   9          2HO*        C   9   8.984  13.142   3.354
   94    H1*    C   9           H1*        C   9   6.787  11.985   2.671
   95   1H4     C   9          H41         C   9   0.905  14.421   2.450
   96   2H4     C   9          H42         C   9   0.546  13.749   4.024
   97    H5     C   9           H5         C   9   2.182  12.597   5.376
   98    H6     C   9           H6         C   9   4.505  11.853   5.505
   99   1H5*    C  10          2H5*        C  10   8.871  16.018   5.864
  100   2H5*    C  10          1H5*        C  10   9.194  14.844   4.572
  101    H4*    C  10           H4*        C  10  10.603  17.487   5.085
  102    H3*    C  10           H3*        C  10   8.371  16.916   3.494
  103    H2*    C  10           H2*        C  10   9.402  15.404   1.999
  104   2HO*    C  10          2HO*        C  10   9.346  16.557   0.229
  105    H1*    C  10           H1*        C  10  11.994  16.927   1.956
  106   1H4     C  10          H41         C  10  13.724  11.392  -0.630
  107   2H4     C  10          H42         C  10  12.947  10.491   0.653
  108    H5     C  10           H5         C  10  11.701  11.534   2.432
  109    H6     C  10           H6         C  10  10.928  13.671   3.364
  110   1H5*    C  11          2H5*        C  11   9.580  18.731   0.940
  111   2H5*    C  11          1H5*        C  11   9.439  20.414   0.392
  112    H4*    C  11           H4*        C  11   8.845  18.785  -1.389
  113    H3*    C  11           H3*        C  11   7.468  21.117  -0.791
  114    H2*    C  11           H2*        C  11   5.673  20.141   0.415
  115   2HO*    C  11          2HO*        C  11   3.964  19.659  -1.173
  116    H1*    C  11           H1*        C  11   5.562  17.738  -1.404
  117   1H4     C  11          H41         C  11   1.886  16.048   3.507
  118   2H4     C  11          H42         C  11   3.248  16.179   4.598
  119    H5     C  11           H5         C  11   5.413  16.976   3.917
  120    H6     C  11           H6         C  11   6.747  17.818   2.039
  121   1H5*    G  12          2H5*        G  12   7.321  18.133  -4.261
  122   2H5*    G  12          1H5*        G  12   8.166  17.380  -2.894
  123    H4*    G  12           H4*        G  12   9.128  17.314  -5.777
  124    H3*    G  12           H3*        G  12   7.325  15.526  -4.174
  125    H2*    G  12           H2*        G  12   8.504  13.578  -4.661
  126   2HO*    G  12          2HO*        G  12   9.597  14.957  -6.921
  127    H1*    G  12           H1*        G  12  11.100  14.640  -5.030
  128    H8     G  12           H8         G  12  12.368  13.584  -3.072
  129    H1     G  12           H1         G  12   7.237  13.374   0.706
  130   1H2     G  12          H21         G  12   5.525  14.369  -0.274
  131   2H2     G  12          H22         G  12   5.638  15.090  -1.865
  132   1H5*    A  13          2H5*        A  13   6.889  11.895  -8.455
  133   2H5*    A  13          1H5*        A  13   5.594  12.245  -7.293
  134    H4*    A  13           H4*        A  13   8.202  10.798  -6.874
  135    H3*    A  13           H3*        A  13   5.267  10.353  -6.280
  136    H2*    A  13           H2*        A  13   5.795   9.171  -4.307
  137   2HO*    A  13          2HO*        A  13   7.952   8.457  -3.889
  138    H1*    A  13           H1*        A  13   7.859  10.741  -3.422
  139    H8     A  13           H8         A  13   5.444  13.243  -4.609
  140   1H6     A  13          H61         A  13   1.952  12.153   0.344
  141   2H6     A  13          H62         A  13   2.226  13.228  -1.009
  142    H2     A  13           H2         A  13   5.028   8.889   0.065
  143   1H5*    G  14          2H5*        G  14   7.806   7.276  -6.362
  144   2H5*    G  14          1H5*        G  14   7.582   5.521  -6.497
  145    H4*    G  14           H4*        G  14   8.274   6.616  -4.196
  146    H3*    G  14           H3*        G  14   7.062   4.162  -4.875
  147    H2*    G  14           H2*        G  14   4.881   4.601  -4.155
  148   2HO*    G  14          2HO*        G  14   5.540   3.160  -2.570
  149    H1*    G  14           H1*        G  14   5.680   6.530  -2.007
  150    H8     G  14           H8         G  14   3.928   7.312  -5.323
  151    H1     G  14           H1         G  14  -0.015   6.823  -0.339
  152   1H2     G  14          H21         G  14   1.101   6.117   1.435
  153   2H2     G  14          H22         G  14   2.813   5.765   1.394
  154   1H5*    U  15          2H5*        U  15   9.648   4.968  -0.948
  155   2H5*    U  15          1H5*        U  15  11.037   4.072  -1.597
  156    H4*    U  15           H4*        U  15  11.609   3.850   0.591
  157    H3*    U  15           H3*        U  15   9.399   1.814   0.251
  158    H2*    U  15           H2*        U  15   9.727   1.226   2.540
  159   2HO*    U  15          2HO*        U  15  12.211   2.123   2.060
  160    H1*    U  15           H1*        U  15   9.815   3.794   3.445
  161    H3     U  15           H3         U  15   5.768   2.427   4.840
  162    H5     U  15           H5         U  15   5.256   2.997   0.696
  163    H6     U  15           H6         U  15   7.642   3.372   0.515
  164   1H5*    G  16          2H5*        G  16   9.338  -1.765  -1.071
  165   2H5*    G  16          1H5*        G  16   8.132  -0.820  -1.967
  166    H4*    G  16           H4*        G  16   8.395  -1.092   1.071
  167    H3*    G  16           H3*        G  16   6.442  -2.128  -1.092
  168    H2*    G  16           H2*        G  16   4.612  -1.798   0.339
  169   2HO*    G  16          2HO*        G  16   4.760  -1.878   2.529
  170    H1*    G  16           H1*        G  16   5.518   0.496   1.709
  171    H8     G  16           H8         G  16   5.806   0.777  -2.081
  172    H1     G  16           H1         G  16  -0.083   1.904   0.111
  173   1H2     G  16          H21         G  16  -0.212   1.370   2.257
  174   2H2     G  16          H22         G  16   1.153   0.740   3.153
  175   1H5*    C  17          2H5*        C  17   5.970  -3.354   3.375
  176   2H5*    C  17          1H5*        C  17   5.893  -5.123   3.258
  177    H4*    C  17           H4*        C  17   4.308  -4.220   4.940
  178    H3*    C  17           H3*        C  17   3.285  -5.670   2.479
  179    H2*    C  17           H2*        C  17   1.059  -5.385   3.181
  180   2HO*    C  17          2HO*        C  17   0.582  -4.759   5.379
  181    H1*    C  17           H1*        C  17   1.316  -2.827   4.321
  182   1H4     C  17          H41         C  17  -1.502  -2.184  -1.356
  183   2H4     C  17          H42         C  17   0.040  -2.349  -2.162
  184    H5     C  17           H5         C  17   2.081  -2.842  -1.008
  185    H6     C  17           H6         C  17   3.111  -3.284   1.175
  186   1H5*    A  18          2H5*        A  18   1.164  -6.883   6.273
  187   2H5*    A  18          1H5*        A  18   1.462  -8.631   6.347
  188    H4*    A  18           H4*        A  18  -0.852  -8.179   6.952
  189    H3*    A  18           H3*        A  18  -0.255  -9.624   4.381
  190    H2*    A  18           H2*        A  18  -2.512  -9.603   3.695
  191   2HO*    A  18          2HO*        A  18  -4.042  -9.853   5.134
  192    H1*    A  18           H1*        A  18  -3.218  -7.099   4.481
  193    H8     A  18           H8         A  18   0.349  -7.454   3.138
  194   1H6     A  18          H61         A  18  -2.024  -6.223  -2.421
  195   2H6     A  18          H62         A  18  -0.546  -6.472  -1.520
  196    H2     A  18           H2         A  18  -5.420  -6.670   0.490
  197   1H5*    U  19          2H5*        U  19  -3.632 -11.980   6.694
  198   2H5*    U  19          1H5*        U  19  -3.626 -13.583   5.931
  199    H4*    U  19           H4*        U  19  -5.755 -12.024   5.746
  200    H3*    U  19           H3*        U  19  -4.474 -13.772   3.628
  201    H2*    U  19           H2*        U  19  -6.047 -13.052   2.023
  202   2HO*    U  19          2HO*        U  19  -7.747 -13.147   3.890
  203    H1*    U  19           H1*        U  19  -6.141 -10.367   2.757
  204    H3     U  19           H3         U  19  -4.140 -10.592  -1.329
  205    H5     U  19           H5         U  19  -1.134 -11.846   1.416
  206    H6     U  19           H6         U  19  -2.824 -11.794   3.157
  207   1H5*    C  20          2H5*        C  20  -9.062 -14.834   3.873
  208   2H5*    C  20          1H5*        C  20  -9.124 -16.490   3.236
  209    H4*    C  20           H4*        C  20 -10.477 -14.556   2.054
  210    H3*    C  20           H3*        C  20  -8.880 -16.809   0.805
  211    H2*    C  20           H2*        C  20  -9.326 -15.976  -1.361
  212   2HO*    C  20          2HO*        C  20 -11.644 -15.373  -0.354
  213    H1*    C  20           H1*        C  20  -9.106 -13.285  -0.822
  214   1H4     C  20          H41         C  20  -3.618 -15.325  -3.353
  215   2H4     C  20          H42         C  20  -3.020 -15.694  -1.751
  216    H5     C  20           H5         C  20  -4.377 -15.530   0.234
  217    H6     C  20           H6         C  20  -6.602 -14.974   1.109
  218   1H5*    C  21          2H5*        C  21 -11.862 -15.775  -2.078
  219   2H5*    C  21          1H5*        C  21 -12.879 -17.230  -2.128
  220    H4*    C  21           H4*        C  21 -12.211 -16.565  -4.402
  221    H3*    C  21           H3*        C  21 -11.018 -19.097  -3.244
  222    H2*    C  21           H2*        C  21  -9.810 -19.466  -5.172
  223   2HO*    C  21          2HO*        C  21 -10.506 -18.474  -7.209
  224    H1*    C  21           H1*        C  21  -9.701 -16.705  -6.032
  225   1H4     C  21          H41         C  21  -3.668 -18.480  -5.110
  226   2H4     C  21          H42         C  21  -3.956 -18.722  -3.402
  227    H5     C  21           H5         C  21  -6.124 -18.468  -2.380
  228    H6     C  21           H6         C  21  -8.481 -17.930  -2.775
  229    H3T    C  21           H3T        C  21 -12.757 -19.960  -4.171
  Start of MODEL    7
    1   1H5*    G   1          2H5*        G   1   1.492 -16.661 -13.526
    2   2H5*    G   1          1H5*        G   1   1.329 -15.176 -14.485
    3    H4*    G   1           H4*        G   1  -0.659 -16.142 -15.084
    4    H3*    G   1           H3*        G   1  -1.127 -14.720 -12.459
    5    H2*    G   1           H2*        G   1  -3.289 -15.643 -12.265
    6   2HO*    G   1          2HO*        G   1  -3.030 -16.373 -15.017
    7    H1*    G   1           H1*        G   1  -2.775 -18.158 -13.195
    8    H8     G   1           H8         G   1   0.116 -17.883 -11.069
    9    H1     G   1           H1         G   1  -5.159 -17.616  -7.497
   10   1H2     G   1          H21         G   1  -6.924 -17.209  -8.777
   11   2H2     G   1          H22         G   1  -6.802 -17.002 -10.510
   12    H5T    G   1           H5T        G   1   1.199 -15.570 -11.746
   13   1H5*    G   2          2H5*        G   2  -4.842 -14.881 -13.774
   14   2H5*    G   2          1H5*        G   2  -5.056 -13.358 -14.657
   15    H4*    G   2           H4*        G   2  -7.081 -13.482 -13.541
   16    H3*    G   2           H3*        G   2  -5.064 -11.939 -11.909
   17    H2*    G   2           H2*        G   2  -6.416 -11.897 -10.008
   18   2HO*    G   2          2HO*        G   2  -8.799 -12.737 -11.142
   19    H1*    G   2           H1*        G   2  -7.842 -14.285 -10.353
   20    H8     G   2           H8         G   2  -4.066 -14.694 -10.509
   21    H1     G   2           H1         G   2  -6.349 -14.474  -4.563
   22   1H2     G   2          H21         G   2  -8.489 -13.884  -4.593
   23   2H2     G   2          H22         G   2  -9.349 -13.545  -6.078
   24   1H5*    A   3          2H5*        A   3  -8.410 -10.445 -10.989
   25   2H5*    A   3          1H5*        A   3  -8.734  -8.757 -11.403
   26    H4*    A   3           H4*        A   3  -9.312  -9.073  -9.102
   27    H3*    A   3           H3*        A   3  -6.816  -7.496  -9.745
   28    H2*    A   3           H2*        A   3  -6.197  -7.458  -7.517
   29   2HO*    A   3          2HO*        A   3  -8.496  -7.667  -6.155
   30    H1*    A   3           H1*        A   3  -8.153  -9.489  -6.660
   31    H8     A   3           H8         A   3  -4.747  -9.984  -8.362
   32   1H6     A   3          H61         A   3  -2.500 -11.194  -2.760
   33   2H6     A   3          H62         A   3  -2.133 -11.122  -4.468
   34    H2     A   3           H2         A   3  -6.817 -10.026  -2.306
   35   1H5*    U   4          2H5*        U   4  -9.881  -6.321  -7.093
   36   2H5*    U   4          1H5*        U   4 -10.604  -4.716  -7.321
   37    H4*    U   4           H4*        U   4 -10.716  -5.036  -5.000
   38    H3*    U   4           H3*        U   4  -8.280  -3.418  -5.805
   39    H2*    U   4           H2*        U   4  -7.545  -3.320  -3.577
   40   2HO*    U   4          2HO*        U   4  -9.992  -2.901  -3.027
   41    H1*    U   4           H1*        U   4  -8.428  -5.826  -2.718
   42    H3     U   4           H3         U   4  -4.039  -6.307  -2.077
   43    H5     U   4           H5         U   4  -4.312  -5.561  -6.258
   44    H6     U   4           H6         U   4  -6.706  -5.247  -5.960
   45   1H5*    G   5          2H5*        G   5 -11.607  -1.546  -2.380
   46   2H5*    G   5          1H5*        G   5 -11.077   0.147  -2.463
   47    H4*    G   5           H4*        G   5 -11.402  -0.923  -0.120
   48    H3*    G   5           H3*        G   5  -9.137   0.784  -1.114
   49    H2*    G   5           H2*        G   5  -7.793   0.394   0.781
   50   2HO*    G   5          2HO*        G   5 -10.072   0.456   2.049
   51    H1*    G   5           H1*        G   5  -8.290  -2.244   1.191
   52    H8     G   5           H8         G   5  -8.162  -1.314  -2.506
   53    H1     G   5           H1         G   5  -2.422  -2.393   0.049
   54   1H2     G   5          H21         G   5  -2.604  -2.639   2.246
   55   2H2     G   5          H22         G   5  -4.137  -2.536   3.080
   56   1H5*    C   6          2H5*        C   6  -8.842   1.039   3.214
   57   2H5*    C   6          1H5*        C   6  -8.963   2.780   3.498
   58    H4*    C   6           H4*        C   6  -6.847   1.524   4.310
   59    H3*    C   6           H3*        C   6  -7.045   4.180   2.862
   60    H2*    C   6           H2*        C   6  -4.756   4.221   2.530
   61   2HO*    C   6          2HO*        C   6  -4.730   4.149   5.031
   62    H1*    C   6           H1*        C   6  -4.327   1.414   3.289
   63   1H4     C   6          H41         C   6  -0.965   2.315  -2.054
   64   2H4     C   6          H42         C   6  -2.425   2.695  -2.939
   65    H5     C   6           H5         C   6  -4.600   2.828  -1.905
   66    H6     C   6           H6         C   6  -5.843   2.622   0.200
   67   1H5*    C   7          2H5*        C   7  -4.876   4.895   7.191
   68   2H5*    C   7          1H5*        C   7  -4.718   6.663   7.250
   69    H4*    C   7           H4*        C   7  -2.563   5.119   7.262
   70    H3*    C   7           H3*        C   7  -3.013   7.708   5.731
   71    H2*    C   7           H2*        C   7  -0.851   7.526   4.824
   72   2HO*    C   7          2HO*        C   7  -0.161   6.772   7.153
   73    H1*    C   7           H1*        C   7  -0.770   4.749   4.574
   74   1H4     C   7          H41         C   7  -1.612   7.176  -1.238
   75   2H4     C   7          H42         C   7  -3.279   7.563  -0.874
   76    H5     C   7           H5         C   7  -4.268   7.226   1.303
   77    H6     C   7           H6         C   7  -3.866   6.450   3.594
   78   1H5*    U   8          2H5*        U   8   0.826   7.422   8.487
   79   2H5*    U   8          1H5*        U   8   1.391   9.081   8.758
   80    H4*    U   8           H4*        U   8   3.022   7.253   7.770
   81    H3*    U   8           H3*        U   8   2.722  10.167   6.959
   82    H2*    U   8           H2*        U   8   4.387   9.870   5.293
   83   2HO*    U   8          2HO*        U   8   5.642   8.467   6.887
   84    H1*    U   8           H1*        U   8   3.576   7.433   4.362
   85    H3     U   8           H3         U   8   2.722  10.683   1.260
   86    H5     U   8           H5         U   8  -0.539  10.845   3.920
   87    H6     U   8           H6         U   8   0.641   9.273   5.354
   88   1H5*    C   9          2H5*        C   9   7.314   9.820   6.966
   89   2H5*    C   9          1H5*        C   9   7.649  11.406   7.693
   90    H4*    C   9           H4*        C   9   8.434  10.887   5.227
   91    H3*    C   9           H3*        C   9   7.457  13.348   6.552
   92    H2*    C   9           H2*        C   9   6.471  14.321   4.719
   93   2HO*    C   9          2HO*        C   9   8.055  13.559   2.672
   94    H1*    C   9           H1*        C   9   6.771  12.169   2.767
   95   1H4     C   9          H41         C   9   0.780  14.266   2.283
   96   2H4     C   9          H42         C   9   0.411  13.662   3.883
   97    H5     C   9           H5         C   9   2.061  12.665   5.334
   98    H6     C   9           H6         C   9   4.412  12.036   5.559
   99   1H5*    C  10          2H5*        C  10   8.695  16.342   6.031
  100   2H5*    C  10          1H5*        C  10   9.028  15.126   4.779
  101    H4*    C  10           H4*        C  10  10.407  17.788   5.250
  102    H3*    C  10           H3*        C  10   8.339  17.058   3.501
  103    H2*    C  10           H2*        C  10   9.539  15.520   2.174
  104   2HO*    C  10          2HO*        C  10  10.034  16.554   0.316
  105    H1*    C  10           H1*        C  10  12.095  17.096   2.307
  106   1H4     C  10          H41         C  10  14.155  11.479   0.185
  107   2H4     C  10          H42         C  10  13.255  10.625   1.418
  108    H5     C  10           H5         C  10  11.818  11.724   3.006
  109    H6     C  10           H6         C  10  10.929  13.889   3.756
  110   1H5*    C  11          2H5*        C  11   9.746  18.854   0.975
  111   2H5*    C  11          1H5*        C  11   9.551  20.504   0.348
  112    H4*    C  11           H4*        C  11   9.219  18.714  -1.383
  113    H3*    C  11           H3*        C  11   7.819  21.064  -1.177
  114    H2*    C  11           H2*        C  11   6.005  20.185   0.125
  115   2HO*    C  11          2HO*        C  11   4.808  19.307  -2.208
  116    H1*    C  11           H1*        C  11   5.902  17.721  -1.624
  117   1H4     C  11          H41         C  11   1.860  16.229   3.057
  118   2H4     C  11          H42         C  11   3.138  16.381   4.240
  119    H5     C  11           H5         C  11   5.358  17.134   3.697
  120    H6     C  11           H6         C  11   6.838  17.902   1.899
  121   1H5*    G  12          2H5*        G  12   8.972  17.188  -2.915
  122   2H5*    G  12          1H5*        G  12  10.586  17.836  -3.263
  123    H4*    G  12           H4*        G  12  10.238  16.694  -5.609
  124    H3*    G  12           H3*        G  12   7.965  15.612  -3.997
  125    H2*    G  12           H2*        G  12   8.532  13.384  -4.196
  126   2HO*    G  12          2HO*        G  12   8.477  13.132  -6.364
  127    H1*    G  12           H1*        G  12  11.317  13.550  -4.689
  128    H8     G  12           H8         G  12  12.527  12.876  -2.439
  129    H1     G  12           H1         G  12   7.064  13.170   0.826
  130   1H2     G  12          H21         G  12   5.488  14.112  -0.399
  131   2H2     G  12          H22         G  12   5.772  14.675  -2.031
  132   1H5*    A  13          2H5*        A  13   6.860  12.002  -8.440
  133   2H5*    A  13          1H5*        A  13   5.706  12.591  -7.227
  134    H4*    A  13           H4*        A  13   8.272  11.038  -6.779
  135    H3*    A  13           H3*        A  13   5.313  10.596  -6.293
  136    H2*    A  13           H2*        A  13   5.790   9.426  -4.299
  137   2HO*    A  13          2HO*        A  13   8.500   9.366  -4.300
  138    H1*    A  13           H1*        A  13   7.857  11.000  -3.391
  139    H8     A  13           H8         A  13   5.381  13.465  -4.550
  140   1H6     A  13          H61         A  13   1.919  12.231   0.391
  141   2H6     A  13          H62         A  13   2.162  13.324  -0.953
  142    H2     A  13           H2         A  13   5.090   9.060   0.087
  143   1H5*    G  14          2H5*        G  14   7.888   7.496  -6.406
  144   2H5*    G  14          1H5*        G  14   7.690   5.738  -6.526
  145    H4*    G  14           H4*        G  14   8.318   6.876  -4.223
  146    H3*    G  14           H3*        G  14   7.178   4.383  -4.893
  147    H2*    G  14           H2*        G  14   4.972   4.788  -4.229
  148   2HO*    G  14          2HO*        G  14   5.023   3.566  -2.514
  149    H1*    G  14           H1*        G  14   5.691   6.754  -2.084
  150    H8     G  14           H8         G  14   3.979   7.516  -5.416
  151    H1     G  14           H1         G  14  -0.031   6.860  -0.507
  152   1H2     G  14          H21         G  14   1.070   6.145   1.271
  153   2H2     G  14          H22         G  14   2.789   5.825   1.251
  154   1H5*    U  15          2H5*        U  15   9.836   5.219  -0.895
  155   2H5*    U  15          1H5*        U  15  11.038   4.054  -1.487
  156    H4*    U  15           H4*        U  15  11.574   4.059   0.756
  157    H3*    U  15           H3*        U  15   9.366   2.029   0.382
  158    H2*    U  15           H2*        U  15   9.579   1.497   2.699
  159   2HO*    U  15          2HO*        U  15  11.580   3.329   3.264
  160    H1*    U  15           H1*        U  15   9.644   4.080   3.553
  161    H3     U  15           H3         U  15   5.513   2.755   4.745
  162    H5     U  15           H5         U  15   5.228   3.310   0.577
  163    H6     U  15           H6         U  15   7.625   3.653   0.522
  164   1H5*    G  16          2H5*        G  16   9.329  -1.562  -0.891
  165   2H5*    G  16          1H5*        G  16   8.177  -0.610  -1.847
  166    H4*    G  16           H4*        G  16   8.326  -0.791   1.205
  167    H3*    G  16           H3*        G  16   6.465  -1.945  -0.981
  168    H2*    G  16           H2*        G  16   4.578  -1.561   0.352
  169   2HO*    G  16          2HO*        G  16   5.599  -0.816   2.742
  170    H1*    G  16           H1*        G  16   5.414   0.792   1.667
  171    H8     G  16           H8         G  16   5.862   0.989  -2.106
  172    H1     G  16           H1         G  16  -0.145   2.016  -0.203
  173   1H2     G  16          H21         G  16  -0.358   1.510   1.943
  174   2H2     G  16          H22         G  16   0.979   0.925   2.909
  175   1H5*    C  17          2H5*        C  17   5.708  -2.917   3.370
  176   2H5*    C  17          1H5*        C  17   5.969  -4.672   3.403
  177    H4*    C  17           H4*        C  17   4.199  -4.140   4.961
  178    H3*    C  17           H3*        C  17   3.383  -5.513   2.383
  179    H2*    C  17           H2*        C  17   1.120  -5.485   3.026
  180   2HO*    C  17          2HO*        C  17   0.615  -5.839   5.051
  181    H1*    C  17           H1*        C  17   1.088  -2.988   4.307
  182   1H4     C  17          H41         C  17  -1.504  -2.172  -1.447
  183   2H4     C  17          H42         C  17   0.071  -2.254  -2.203
  184    H5     C  17           H5         C  17   2.092  -2.723  -0.989
  185    H6     C  17           H6         C  17   3.052  -3.215   1.212
  186   1H5*    A  18          2H5*        A  18   1.605  -7.373   6.308
  187   2H5*    A  18          1H5*        A  18   1.762  -9.118   6.017
  188    H4*    A  18           H4*        A  18  -0.482  -8.454   6.900
  189    H3*    A  18           H3*        A  18  -0.090  -9.871   4.274
  190    H2*    A  18           H2*        A  18  -2.377  -9.715   3.712
  191   2HO*    A  18          2HO*        A  18  -3.974  -9.341   5.232
  192    H1*    A  18           H1*        A  18  -2.887  -7.187   4.562
  193    H8     A  18           H8         A  18   0.596  -7.621   3.072
  194   1H6     A  18          H61         A  18  -1.965  -6.435  -2.411
  195   2H6     A  18          H62         A  18  -0.459  -6.686  -1.558
  196    H2     A  18           H2         A  18  -5.262  -6.812   0.626
  197   1H5*    U  19          2H5*        U  19  -3.238 -12.344   6.662
  198   2H5*    U  19          1H5*        U  19  -3.323 -13.913   5.837
  199    H4*    U  19           H4*        U  19  -5.395 -12.274   5.790
  200    H3*    U  19           H3*        U  19  -4.250 -13.967   3.553
  201    H2*    U  19           H2*        U  19  -5.841 -13.117   2.035
  202   2HO*    U  19          2HO*        U  19  -7.734 -12.109   2.706
  203    H1*    U  19           H1*        U  19  -5.837 -10.469   2.911
  204    H3     U  19           H3         U  19  -4.051 -10.699  -1.302
  205    H5     U  19           H5         U  19  -0.891 -11.824   1.323
  206    H6     U  19           H6         U  19  -2.509 -11.827   3.131
  207   1H5*    C  20          2H5*        C  20  -8.816 -15.037   3.952
  208   2H5*    C  20          1H5*        C  20  -8.914 -16.673   3.270
  209    H4*    C  20           H4*        C  20 -10.293 -14.697   2.194
  210    H3*    C  20           H3*        C  20  -8.749 -16.916   0.818
  211    H2*    C  20           H2*        C  20  -9.282 -16.015  -1.302
  212   2HO*    C  20          2HO*        C  20 -10.896 -14.281  -1.438
  213    H1*    C  20           H1*        C  20  -9.026 -13.343  -0.684
  214   1H4     C  20          H41         C  20  -3.668 -15.350  -3.515
  215   2H4     C  20          H42         C  20  -2.983 -15.701  -1.944
  216    H5     C  20           H5         C  20  -4.241 -15.544   0.106
  217    H6     C  20           H6         C  20  -6.424 -15.017   1.092
  218   1H5*    C  21          2H5*        C  21 -11.593 -15.843  -1.974
  219   2H5*    C  21          1H5*        C  21 -12.730 -17.206  -1.978
  220    H4*    C  21           H4*        C  21 -12.156 -16.748  -4.273
  221    H3*    C  21           H3*        C  21 -10.782 -19.161  -3.065
  222    H2*    C  21           H2*        C  21  -9.650 -19.564  -5.035
  223   2HO*    C  21          2HO*        C  21 -10.499 -19.143  -7.024
  224    H1*    C  21           H1*        C  21  -9.688 -16.846  -6.012
  225   1H4     C  21          H41         C  21  -3.547 -18.236  -5.177
  226   2H4     C  21          H42         C  21  -3.793 -18.509  -3.466
  227    H5     C  21           H5         C  21  -5.952 -18.391  -2.406
  228    H6     C  21           H6         C  21  -8.346 -17.983  -2.757
  229    H3T    C  21           H3T        C  21 -12.650 -19.235  -5.149
  Start of MODEL    8
    1   1H5*    G   1          2H5*        G   1   1.742 -16.513 -14.208
    2   2H5*    G   1          1H5*        G   1   1.594 -14.953 -15.044
    3    H4*    G   1           H4*        G   1  -0.508 -15.739 -15.498
    4    H3*    G   1           H3*        G   1  -0.615 -14.490 -12.744
    5    H2*    G   1           H2*        G   1  -2.818 -15.269 -12.413
    6   2HO*    G   1          2HO*        G   1  -2.832 -15.272 -15.203
    7    H1*    G   1           H1*        G   1  -2.575 -17.740 -13.554
    8    H8     G   1           H8         G   1   0.531 -17.637 -11.642
    9    H1     G   1           H1         G   1  -4.484 -17.734  -7.705
   10   1H2     G   1          H21         G   1  -6.340 -17.269  -8.828
   11   2H2     G   1          H22         G   1  -6.340 -16.934 -10.545
   12    H5T    G   1           H5T        G   1   2.397 -14.956 -12.797
   13   1H5*    G   2          2H5*        G   2  -4.463 -14.435 -13.987
   14   2H5*    G   2          1H5*        G   2  -4.647 -12.820 -14.700
   15    H4*    G   2           H4*        G   2  -6.681 -13.105 -13.589
   16    H3*    G   2           H3*        G   2  -4.675 -11.572 -11.937
   17    H2*    G   2           H2*        G   2  -5.978 -11.650 -10.007
   18   2HO*    G   2          2HO*        G   2  -8.364 -12.263 -10.381
   19    H1*    G   2           H1*        G   2  -7.387 -14.041 -10.439
   20    H8     G   2           H8         G   2  -3.610 -14.395 -10.629
   21    H1     G   2           H1         G   2  -5.876 -14.488  -4.673
   22   1H2     G   2          H21         G   2  -8.026 -13.914  -4.675
   23   2H2     G   2          H22         G   2  -8.889 -13.510  -6.141
   24   1H5*    A   3          2H5*        A   3  -7.922 -10.068 -11.182
   25   2H5*    A   3          1H5*        A   3  -8.438  -8.431 -11.610
   26    H4*    A   3           H4*        A   3  -8.958  -8.640  -9.330
   27    H3*    A   3           H3*        A   3  -6.416  -7.123  -9.929
   28    H2*    A   3           H2*        A   3  -5.832  -7.104  -7.689
   29   2HO*    A   3          2HO*        A   3  -8.333  -7.258  -6.538
   30    H1*    A   3           H1*        A   3  -7.865  -9.084  -6.875
   31    H8     A   3           H8         A   3  -4.392  -9.591  -8.468
   32   1H6     A   3          H61         A   3  -2.421 -11.092  -2.843
   33   2H6     A   3          H62         A   3  -1.978 -10.948  -4.527
   34    H2     A   3           H2         A   3  -6.726  -9.858  -2.514
   35   1H5*    U   4          2H5*        U   4 -10.172  -5.064  -7.571
   36   2H5*    U   4          1H5*        U   4  -9.823  -3.328  -7.451
   37    H4*    U   4           H4*        U   4 -10.651  -4.523  -5.325
   38    H3*    U   4           H3*        U   4  -8.220  -2.729  -5.546
   39    H2*    U   4           H2*        U   4  -7.652  -3.104  -3.303
   40   2HO*    U   4          2HO*        U   4 -10.220  -2.940  -2.937
   41    H1*    U   4           H1*        U   4  -8.518  -5.742  -3.052
   42    H3     U   4           H3         U   4  -4.133  -5.954  -2.106
   43    H5     U   4           H5         U   4  -4.227  -5.060  -6.268
   44    H6     U   4           H6         U   4  -6.639  -4.825  -6.076
   45   1H5*    G   5          2H5*        G   5 -11.765  -1.565  -1.736
   46   2H5*    G   5          1H5*        G   5 -11.257   0.130  -1.870
   47    H4*    G   5           H4*        G   5 -11.441  -0.915   0.502
   48    H3*    G   5           H3*        G   5  -9.247   0.802  -0.633
   49    H2*    G   5           H2*        G   5  -7.825   0.468   1.218
   50   2HO*    G   5          2HO*        G   5 -10.086  -0.633   2.590
   51    H1*    G   5           H1*        G   5  -8.275  -2.172   1.686
   52    H8     G   5           H8         G   5  -8.281  -1.323  -2.028
   53    H1     G   5           H1         G   5  -2.444  -2.261   0.351
   54   1H2     G   5          H21         G   5  -2.541  -2.451   2.556
   55   2H2     G   5          H22         G   5  -4.045  -2.345   3.443
   56   1H5*    C   6          2H5*        C   6  -8.862   1.095   3.669
   57   2H5*    C   6          1H5*        C   6  -8.981   2.833   3.972
   58    H4*    C   6           H4*        C   6  -6.857   1.572   4.753
   59    H3*    C   6           H3*        C   6  -7.075   4.241   3.333
   60    H2*    C   6           H2*        C   6  -4.797   4.287   2.958
   61   2HO*    C   6          2HO*        C   6  -4.595   4.370   5.353
   62    H1*    C   6           H1*        C   6  -4.344   1.478   3.699
   63   1H4     C   6          H41         C   6  -1.074   2.382  -1.700
   64   2H4     C   6          H42         C   6  -2.545   2.791  -2.555
   65    H5     C   6           H5         C   6  -4.698   2.944  -1.479
   66    H6     C   6           H6         C   6  -5.904   2.732   0.645
   67   1H5*    C   7          2H5*        C   7  -4.927   5.088   7.547
   68   2H5*    C   7          1H5*        C   7  -4.848   6.860   7.622
   69    H4*    C   7           H4*        C   7  -2.627   5.423   7.467
   70    H3*    C   7           H3*        C   7  -3.298   7.999   5.996
   71    H2*    C   7           H2*        C   7  -1.211   7.918   4.938
   72   2HO*    C   7          2HO*        C   7   0.077   5.922   6.219
   73    H1*    C   7           H1*        C   7  -0.952   5.114   4.810
   74   1H4     C   7          H41         C   7  -1.858   7.183  -1.123
   75   2H4     C   7          H42         C   7  -3.505   7.649  -0.758
   76    H5     C   7           H5         C   7  -4.471   7.468   1.447
   77    H6     C   7           H6         C   7  -4.059   6.807   3.773
   78   1H5*    U   8          2H5*        U   8   0.596   7.686   8.584
   79   2H5*    U   8          1H5*        U   8   1.284   9.298   8.848
   80    H4*    U   8           H4*        U   8   2.746   7.374   7.783
   81    H3*    U   8           H3*        U   8   2.608  10.310   7.024
   82    H2*    U   8           H2*        U   8   4.164   9.944   5.273
   83   2HO*    U   8          2HO*        U   8   5.738   8.577   5.607
   84    H1*    U   8           H1*        U   8   3.184   7.554   4.364
   85    H3     U   8           H3         U   8   2.430  10.864   1.307
   86    H5     U   8           H5         U   8  -0.727  11.210   4.069
   87    H6     U   8           H6         U   8   0.399   9.562   5.459
   88   1H5*    C   9          2H5*        C   9   7.220   9.617   6.802
   89   2H5*    C   9          1H5*        C   9   7.663  11.162   7.557
   90    H4*    C   9           H4*        C   9   8.353  10.665   5.061
   91    H3*    C   9           H3*        C   9   7.616  13.120   6.498
   92    H2*    C   9           H2*        C   9   6.430  14.160   4.831
   93   2HO*    C   9          2HO*        C   9   8.132  13.444   2.744
   94    H1*    C   9           H1*        C   9   6.703  12.144   2.706
   95   1H4     C   9          H41         C   9   0.722  14.260   2.302
   96   2H4     C   9          H42         C   9   0.388  13.750   3.940
   97    H5     C   9           H5         C   9   2.058  12.790   5.393
   98    H6     C   9           H6         C   9   4.398  12.107   5.583
   99   1H5*    C  10          2H5*        C  10   8.809  16.050   5.710
  100   2H5*    C  10          1H5*        C  10   9.172  14.784   4.519
  101    H4*    C  10           H4*        C  10  10.605  17.426   4.957
  102    H3*    C  10           H3*        C  10   8.540  16.751   3.190
  103    H2*    C  10           H2*        C  10   9.693  15.094   1.955
  104   2HO*    C  10          2HO*        C  10  10.543  16.091   0.081
  105    H1*    C  10           H1*        C  10  12.298  16.595   2.046
  106   1H4     C  10          H41         C  10  14.273  10.869   0.162
  107   2H4     C  10          H42         C  10  13.294  10.070   1.372
  108    H5     C  10           H5         C  10  11.827  11.250   2.873
  109    H6     C  10           H6         C  10  10.977  13.460   3.537
  110   1H5*    C  11          2H5*        C  11  10.015  18.238   0.634
  111   2H5*    C  11          1H5*        C  11  10.158  19.880  -0.024
  112    H4*    C  11           H4*        C  11   9.593  18.257  -1.796
  113    H3*    C  11           H3*        C  11   8.379  20.709  -1.471
  114    H2*    C  11           H2*        C  11   6.435  19.946  -0.324
  115   2HO*    C  11          2HO*        C  11   5.813  19.481  -3.080
  116    H1*    C  11           H1*        C  11   6.219  17.515  -2.096
  117   1H4     C  11          H41         C  11   2.013  16.266   2.509
  118   2H4     C  11          H42         C  11   3.270  16.356   3.723
  119    H5     C  11           H5         C  11   5.544  16.978   3.223
  120    H6     C  11           H6         C  11   7.103  17.646   1.452
  121   1H5*    G  12          2H5*        G  12   7.932  17.554  -4.849
  122   2H5*    G  12          1H5*        G  12   8.670  16.985  -3.338
  123    H4*    G  12           H4*        G  12   9.587  16.207  -6.135
  124    H3*    G  12           H3*        G  12   7.611  15.010  -4.213
  125    H2*    G  12           H2*        G  12   8.542  12.879  -4.290
  126   2HO*    G  12          2HO*        G  12   8.964  12.086  -6.197
  127    H1*    G  12           H1*        G  12  11.239  13.527  -4.848
  128    H8     G  12           H8         G  12  12.505  13.068  -2.613
  129    H1     G  12           H1         G  12   7.136  13.286   0.815
  130   1H2     G  12          H21         G  12   5.461  14.014  -0.434
  131   2H2     G  12          H22         G  12   5.662  14.449  -2.118
  132   1H5*    A  13          2H5*        A  13   6.920  12.876  -7.764
  133   2H5*    A  13          1H5*        A  13   5.419  11.928  -7.734
  134    H4*    A  13           H4*        A  13   7.779  10.930  -6.898
  135    H3*    A  13           H3*        A  13   4.927  10.397  -6.117
  136    H2*    A  13           H2*        A  13   5.512   9.199  -4.175
  137   2HO*    A  13          2HO*        A  13   8.236   9.183  -5.027
  138    H1*    A  13           H1*        A  13   7.569  10.715  -3.277
  139    H8     A  13           H8         A  13   5.246  13.274  -4.573
  140   1H6     A  13          H61         A  13   1.678  12.406   0.375
  141   2H6     A  13          H62         A  13   1.990  13.440  -1.002
  142    H2     A  13           H2         A  13   4.668   9.059   0.206
  143   1H5*    G  14          2H5*        G  14   7.509   7.319  -6.375
  144   2H5*    G  14          1H5*        G  14   7.284   5.567  -6.538
  145    H4*    G  14           H4*        G  14   8.023   6.628  -4.230
  146    H3*    G  14           H3*        G  14   6.855   4.168  -4.916
  147    H2*    G  14           H2*        G  14   4.655   4.584  -4.232
  148   2HO*    G  14          2HO*        G  14   4.400   3.974  -2.067
  149    H1*    G  14           H1*        G  14   5.404   6.464  -2.024
  150    H8     G  14           H8         G  14   3.688   7.259  -5.366
  151    H1     G  14           H1         G  14  -0.281   6.815  -0.401
  152   1H2     G  14          H21         G  14   0.822   6.120   1.382
  153   2H2     G  14          H22         G  14   2.533   5.762   1.354
  154   1H5*    U  15          2H5*        U  15   9.506   5.023  -1.063
  155   2H5*    U  15          1H5*        U  15  10.863   4.036  -1.645
  156    H4*    U  15           H4*        U  15  11.394   3.967   0.573
  157    H3*    U  15           H3*        U  15   9.208   1.898   0.276
  158    H2*    U  15           H2*        U  15   9.509   1.408   2.595
  159   2HO*    U  15          2HO*        U  15  11.271   3.033   3.539
  160    H1*    U  15           H1*        U  15   9.512   4.009   3.390
  161    H3     U  15           H3         U  15   5.408   2.745   4.686
  162    H5     U  15           H5         U  15   5.098   2.906   0.486
  163    H6     U  15           H6         U  15   7.484   3.313   0.388
  164   1H5*    G  16          2H5*        G  16   9.188  -1.702  -1.029
  165   2H5*    G  16          1H5*        G  16   7.993  -0.744  -1.926
  166    H4*    G  16           H4*        G  16   8.229  -1.029   1.112
  167    H3*    G  16           H3*        G  16   6.315  -2.094  -1.069
  168    H2*    G  16           H2*        G  16   4.455  -1.752   0.309
  169   2HO*    G  16          2HO*        G  16   4.610  -2.379   2.316
  170    H1*    G  16           H1*        G  16   5.350   0.518   1.745
  171    H8     G  16           H8         G  16   5.615   0.827  -2.053
  172    H1     G  16           H1         G  16  -0.219   2.065   0.228
  173   1H2     G  16          H21         G  16  -0.329   1.517   2.371
  174   2H2     G  16          H22         G  16   1.034   0.852   3.242
  175   1H5*    C  17          2H5*        C  17   5.903  -3.317   3.410
  176   2H5*    C  17          1H5*        C  17   5.852  -5.088   3.312
  177    H4*    C  17           H4*        C  17   4.297  -4.196   5.029
  178    H3*    C  17           H3*        C  17   3.251  -5.698   2.613
  179    H2*    C  17           H2*        C  17   1.030  -5.419   3.319
  180   2HO*    C  17          2HO*        C  17   0.469  -5.087   5.441
  181    H1*    C  17           H1*        C  17   1.261  -2.852   4.446
  182   1H4     C  17          H41         C  17  -1.607  -2.241  -1.203
  183   2H4     C  17          H42         C  17  -0.081  -2.444  -2.031
  184    H5     C  17           H5         C  17   1.972  -2.949  -0.897
  185    H6     C  17           H6         C  17   3.025  -3.370   1.279
  186   1H5*    A  18          2H5*        A  18   0.920  -6.648   6.155
  187   2H5*    A  18          1H5*        A  18   1.434  -8.307   6.519
  188    H4*    A  18           H4*        A  18  -0.896  -8.286   6.940
  189    H3*    A  18           H3*        A  18  -0.097  -9.543   4.324
  190    H2*    A  18           H2*        A  18  -2.339  -9.787   3.617
  191   2HO*    A  18          2HO*        A  18  -3.228  -9.045   6.229
  192    H1*    A  18           H1*        A  18  -3.338  -7.407   4.445
  193    H8     A  18           H8         A  18   0.287  -7.478   3.157
  194   1H6     A  18          H61         A  18  -2.060  -6.046  -2.358
  195   2H6     A  18          H62         A  18  -0.587  -6.291  -1.447
  196    H2     A  18           H2         A  18  -5.477  -6.753   0.476
  197   1H5*    U  19          2H5*        U  19  -3.293 -12.212   6.509
  198   2H5*    U  19          1H5*        U  19  -3.169 -13.793   5.710
  199    H4*    U  19           H4*        U  19  -5.400 -12.384   5.535
  200    H3*    U  19           H3*        U  19  -3.976 -13.981   3.388
  201    H2*    U  19           H2*        U  19  -5.576 -13.332   1.785
  202   2HO*    U  19          2HO*        U  19  -7.353 -13.722   3.370
  203    H1*    U  19           H1*        U  19  -5.912 -10.688   2.621
  204    H3     U  19           H3         U  19  -3.948 -10.522  -1.476
  205    H5     U  19           H5         U  19  -0.827 -11.750   1.154
  206    H6     U  19           H6         U  19  -2.490 -11.903   2.915
  207   1H5*    C  20          2H5*        C  20  -8.351 -15.532   3.764
  208   2H5*    C  20          1H5*        C  20  -8.390 -17.129   2.991
  209    H4*    C  20           H4*        C  20  -9.830 -15.140   2.019
  210    H3*    C  20           H3*        C  20  -8.214 -17.229   0.528
  211    H2*    C  20           H2*        C  20  -8.774 -16.226  -1.540
  212   2HO*    C  20          2HO*        C  20 -10.406 -14.363  -1.363
  213    H1*    C  20           H1*        C  20  -8.579 -13.591  -0.777
  214   1H4     C  20          H41         C  20  -3.162 -15.335  -3.659
  215   2H4     C  20          H42         C  20  -2.483 -15.769  -2.106
  216    H5     C  20           H5         C  20  -3.762 -15.754  -0.058
  217    H6     C  20           H6         C  20  -5.962 -15.320   0.934
  218   1H5*    C  21          2H5*        C  21 -11.326 -16.448  -2.086
  219   2H5*    C  21          1H5*        C  21 -12.287 -17.939  -2.124
  220    H4*    C  21           H4*        C  21 -11.830 -17.215  -4.409
  221    H3*    C  21           H3*        C  21 -10.334 -19.654  -3.416
  222    H2*    C  21           H2*        C  21  -9.245 -19.867  -5.436
  223   2HO*    C  21          2HO*        C  21 -11.073 -20.010  -6.744
  224    H1*    C  21           H1*        C  21  -9.448 -17.090  -6.222
  225   1H4     C  21          H41         C  21  -3.224 -18.303  -5.784
  226   2H4     C  21          H42         C  21  -3.368 -18.647  -4.075
  227    H5     C  21           H5         C  21  -5.471 -18.648  -2.900
  228    H6     C  21           H6         C  21  -7.892 -18.320  -3.109
  229    H3T    C  21           H3T        C  21 -11.954 -20.662  -4.650
  Start of MODEL    9
    1   1H5*    G   1          2H5*        G   1   0.329 -17.153 -13.790
    2   2H5*    G   1          1H5*        G   1   0.265 -15.615 -14.675
    3    H4*    G   1           H4*        G   1  -1.787 -16.415 -15.307
    4    H3*    G   1           H3*        G   1  -2.142 -15.082 -12.618
    5    H2*    G   1           H2*        G   1  -4.360 -15.865 -12.440
    6   2HO*    G   1          2HO*        G   1  -5.368 -16.875 -14.350
    7    H1*    G   1           H1*        G   1  -4.026 -18.367 -13.478
    8    H8     G   1           H8         G   1  -1.097 -18.370 -11.383
    9    H1     G   1           H1         G   1  -6.300 -17.885  -7.730
   10   1H2     G   1          H21         G   1  -8.051 -17.323  -8.971
   11   2H2     G   1          H22         G   1  -7.936 -17.067 -10.697
   12    H5T    G   1           H5T        G   1  -0.589 -15.956 -11.988
   13   1H5*    G   2          2H5*        G   2  -5.858 -14.932 -13.926
   14   2H5*    G   2          1H5*        G   2  -5.958 -13.371 -14.763
   15    H4*    G   2           H4*        G   2  -8.008 -13.422 -13.678
   16    H3*    G   2           H3*        G   2  -5.929 -11.978 -12.052
   17    H2*    G   2           H2*        G   2  -7.210 -11.935 -10.112
   18   2HO*    G   2          2HO*        G   2  -9.673 -12.554 -11.252
   19    H1*    G   2           H1*        G   2  -8.833 -14.201 -10.502
   20    H8     G   2           H8         G   2  -5.128 -14.959 -10.652
   21    H1     G   2           H1         G   2  -7.361 -14.525  -4.698
   22   1H2     G   2          H21         G   2  -9.428 -13.714  -4.721
   23   2H2     G   2          H22         G   2 -10.251 -13.281  -6.202
   24   1H5*    A   3          2H5*        A   3  -9.038 -10.288 -11.248
   25   2H5*    A   3          1H5*        A   3  -9.454  -8.632 -11.709
   26    H4*    A   3           H4*        A   3  -9.922  -8.734  -9.414
   27    H3*    A   3           H3*        A   3  -7.278  -7.448 -10.107
   28    H2*    A   3           H2*        A   3  -6.662  -7.399  -7.880
   29   2HO*    A   3          2HO*        A   3  -8.186  -6.842  -6.264
   30    H1*    A   3           H1*        A   3  -8.836  -9.184  -6.980
   31    H8     A   3           H8         A   3  -5.430 -10.036  -8.573
   32   1H6     A   3          H61         A   3  -3.479 -11.303  -2.883
   33   2H6     A   3          H62         A   3  -3.051 -11.291  -4.577
   34    H2     A   3           H2         A   3  -7.696  -9.788  -2.590
   35   1H5*    U   4          2H5*        U   4 -10.700  -4.557  -7.699
   36   2H5*    U   4          1H5*        U   4  -9.841  -3.005  -7.665
   37    H4*    U   4           H4*        U   4 -10.865  -4.000  -5.455
   38    H3*    U   4           H3*        U   4  -8.183  -2.646  -5.867
   39    H2*    U   4           H2*        U   4  -7.593  -3.019  -3.625
   40   2HO*    U   4          2HO*        U   4  -9.947  -2.303  -3.087
   41    H1*    U   4           H1*        U   4  -8.871  -5.470  -3.235
   42    H3     U   4           H3         U   4  -4.536  -6.323  -2.401
   43    H5     U   4           H5         U   4  -4.643  -5.647  -6.601
   44    H6     U   4           H6         U   4  -6.982  -5.022  -6.354
   45   1H5*    G   5          2H5*        G   5 -11.184  -1.140  -2.148
   46   2H5*    G   5          1H5*        G   5 -10.675   0.561  -2.121
   47    H4*    G   5           H4*        G   5 -10.852  -0.596   0.151
   48    H3*    G   5           H3*        G   5  -8.484   0.946  -0.889
   49    H2*    G   5           H2*        G   5  -7.116   0.347   0.940
   50   2HO*    G   5          2HO*        G   5  -9.608  -0.152   2.185
   51    H1*    G   5           H1*        G   5  -7.845  -2.254   1.227
   52    H8     G   5           H8         G   5  -7.740  -1.160  -2.421
   53    H1     G   5           H1         G   5  -2.038  -2.800  -0.093
   54   1H2     G   5          H21         G   5  -2.177  -3.130   2.094
   55   2H2     G   5          H22         G   5  -3.675  -2.945   2.979
   56   1H5*    C   6          2H5*        C   6  -8.005   0.883   3.407
   57   2H5*    C   6          1H5*        C   6  -8.052   2.601   3.819
   58    H4*    C   6           H4*        C   6  -6.001   1.276   4.578
   59    H3*    C   6           H3*        C   6  -6.029   3.923   3.098
   60    H2*    C   6           H2*        C   6  -3.721   3.836   2.844
   61   2HO*    C   6          2HO*        C   6  -2.423   3.375   4.532
   62    H1*    C   6           H1*        C   6  -3.490   0.999   3.559
   63   1H4     C   6          H41         C   6  -0.042   1.825  -1.746
   64   2H4     C   6          H42         C   6  -1.466   2.336  -2.625
   65    H5     C   6           H5         C   6  -3.635   2.576  -1.603
   66    H6     C   6           H6         C   6  -4.911   2.372   0.486
   67   1H5*    C   7          2H5*        C   7  -3.750   4.625   7.300
   68   2H5*    C   7          1H5*        C   7  -3.589   6.391   7.338
   69    H4*    C   7           H4*        C   7  -1.438   4.839   7.281
   70    H3*    C   7           H3*        C   7  -1.895   7.401   5.691
   71    H2*    C   7           H2*        C   7   0.290   7.169   4.842
   72   2HO*    C   7          2HO*        C   7   1.268   6.853   6.918
   73    H1*    C   7           H1*        C   7   0.337   4.335   4.836
   74   1H4     C   7          H41         C   7   0.249   6.277  -1.208
   75   2H4     C   7          H42         C   7  -1.481   6.523  -1.119
   76    H5     C   7           H5         C   7  -2.742   6.293   0.927
   77    H6     C   7           H6         C   7  -2.604   5.781   3.322
   78   1H5*    U   8          2H5*        U   8   1.307   8.388   9.236
   79   2H5*    U   8          1H5*        U   8   1.448  10.155   9.192
   80    H4*    U   8           H4*        U   8   3.573   8.631   8.814
   81    H3*    U   8           H3*        U   8   2.760  11.188   7.409
   82    H2*    U   8           H2*        U   8   4.585  11.024   5.923
   83   2HO*    U   8          2HO*        U   8   5.641   9.280   7.905
   84    H1*    U   8           H1*        U   8   4.584   8.301   5.530
   85    H3     U   8           H3         U   8   3.418  10.186   1.579
   86    H5     U   8           H5         U   8  -0.054  10.526   3.944
   87    H6     U   8           H6         U   8   1.229   9.690   5.826
   88   1H5*    C   9          2H5*        C   9   7.249  12.038   7.849
   89   2H5*    C   9          1H5*        C   9   7.106  13.751   8.295
   90    H4*    C   9           H4*        C   9   8.286  13.062   6.036
   91    H3*    C   9           H3*        C   9   6.663  15.381   6.841
   92    H2*    C   9           H2*        C   9   5.537  15.719   4.870
   93   2HO*    C   9          2HO*        C   9   7.578  15.172   3.102
   94    H1*    C   9           H1*        C   9   6.645  13.521   3.273
   95   1H4     C   9          H41         C   9   0.426  13.654   1.960
   96   2H4     C   9          H42         C   9   0.028  13.323   3.630
   97    H5     C   9           H5         C   9   1.685  13.152   5.375
   98    H6     C   9           H6         C   9   4.074  13.257   5.889
   99   1H5*    C  10          2H5*        C  10   7.332  18.883   5.922
  100   2H5*    C  10          1H5*        C  10   7.345  17.455   4.868
  101    H4*    C  10           H4*        C  10   8.151  20.253   4.299
  102    H3*    C  10           H3*        C  10   6.399  18.409   3.133
  103    H2*    C  10           H2*        C  10   8.042  16.912   2.297
  104   2HO*    C  10          2HO*        C  10   6.914  18.305   0.524
  105    H1*    C  10           H1*        C  10   9.885  19.164   1.516
  106   1H4     C  10          H41         C  10  13.785  14.186   0.977
  107   2H4     C  10          H42         C  10  13.318  13.586   2.553
  108    H5     C  10           H5         C  10  11.636  14.634   3.920
  109    H6     C  10           H6         C  10  10.024  16.481   4.066
  110   1H5*    C  11          2H5*        C  11   7.241  20.067  -0.103
  111   2H5*    C  11          1H5*        C  11   6.457  21.406  -0.967
  112    H4*    C  11           H4*        C  11   6.835  19.319  -2.352
  113    H3*    C  11           H3*        C  11   4.688  21.070  -2.461
  114    H2*    C  11           H2*        C  11   3.140  19.804  -1.195
  115   2HO*    C  11          2HO*        C  11   1.750  19.179  -2.679
  116    H1*    C  11           H1*        C  11   4.098  17.176  -2.300
  117   1H4     C  11          H41         C  11   0.552  15.482   2.702
  118   2H4     C  11          H42         C  11   1.600  16.376   3.782
  119    H5     C  11           H5         C  11   3.437  17.731   3.016
  120    H6     C  11           H6         C  11   4.668  18.523   1.051
  121   1H5*    G  12          2H5*        G  12   5.900  17.552  -5.055
  122   2H5*    G  12          1H5*        G  12   6.834  17.489  -3.548
  123    H4*    G  12           H4*        G  12   7.951  16.944  -6.325
  124    H3*    G  12           H3*        G  12   6.743  15.186  -4.206
  125    H2*    G  12           H2*        G  12   8.511  13.666  -4.209
  126   2HO*    G  12          2HO*        G  12   8.612  14.419  -6.876
  127    H1*    G  12           H1*        G  12  10.642  15.382  -4.893
  128    H8     G  12           H8         G  12  12.001  15.474  -2.699
  129    H1     G  12           H1         G  12   6.885  14.412   0.955
  130   1H2     G  12          H21         G  12   5.050  14.417  -0.284
  131   2H2     G  12          H22         G  12   5.083  14.683  -2.013
  132   1H5*    A  13          2H5*        A  13   8.864  12.257  -6.948
  133   2H5*    A  13          1H5*        A  13   7.592  11.022  -7.058
  134    H4*    A  13           H4*        A  13   9.972  10.635  -5.788
  135    H3*    A  13           H3*        A  13   7.236   9.417  -5.554
  136    H2*    A  13           H2*        A  13   7.705   8.375  -3.482
  137   2HO*    A  13          2HO*        A  13  10.455   9.093  -3.717
  138    H1*    A  13           H1*        A  13   9.035  10.372  -2.254
  139    H8     A  13           H8         A  13   6.256  11.529  -4.641
  140   1H6     A  13          H61         A  13   2.433  11.078   0.171
  141   2H6     A  13          H62         A  13   2.581  11.578  -1.499
  142    H2     A  13           H2         A  13   6.449   9.500   1.425
  143   1H5*    G  14          2H5*        G  14  10.542   6.696  -4.772
  144   2H5*    G  14          1H5*        G  14  10.163   4.963  -4.837
  145    H4*    G  14           H4*        G  14  10.822   6.101  -2.546
  146    H3*    G  14           H3*        G  14   8.804   3.942  -3.165
  147    H2*    G  14           H2*        G  14   7.741   4.092  -1.104
  148   2HO*    G  14          2HO*        G  14  10.168   4.140  -0.229
  149    H1*    G  14           H1*        G  14   8.224   6.772  -0.421
  150    H8     G  14           H8         G  14   6.640   6.494  -3.841
  151    H1     G  14           H1         G  14   2.404   5.822   0.857
  152   1H2     G  14          H21         G  14   3.446   5.578   2.801
  153   2H2     G  14          H22         G  14   5.190   5.583   2.938
  154   1H5*    U  15          2H5*        U  15  12.585   3.220  -0.789
  155   2H5*    U  15          1H5*        U  15  13.695   1.840  -0.927
  156    H4*    U  15           H4*        U  15  12.224   0.404   0.254
  157    H3*    U  15           H3*        U  15  10.137   2.382  -0.606
  158    H2*    U  15           H2*        U  15   9.170   2.518   1.479
  159   2HO*    U  15          2HO*        U  15   8.222   0.578   1.572
  160    H1*    U  15           H1*        U  15  11.209   1.035   2.973
  161    H3     U  15           H3         U  15   9.188   4.190   5.696
  162    H5     U  15           H5         U  15  12.021   6.241   3.339
  163    H6     U  15           H6         U  15  12.280   4.213   2.017
  164   1H5*    G  16          2H5*        G  16  10.185  -2.022  -0.849
  165   2H5*    G  16          1H5*        G  16   9.170  -3.212  -1.691
  166    H4*    G  16           H4*        G  16   8.796  -2.645   0.896
  167    H3*    G  16           H3*        G  16   6.774  -3.214  -1.365
  168    H2*    G  16           H2*        G  16   4.961  -2.740   0.042
  169   2HO*    G  16          2HO*        G  16   5.871  -2.486   2.499
  170    H1*    G  16           H1*        G  16   6.147  -0.756   1.667
  171    H8     G  16           H8         G  16   6.602  -0.034  -2.027
  172    H1     G  16           H1         G  16   0.761   1.432   0.107
  173   1H2     G  16          H21         G  16   0.484   0.650   2.160
  174   2H2     G  16          H22         G  16   1.736  -0.228   3.009
  175   1H5*    C  17          2H5*        C  17   6.149  -4.744   2.886
  176   2H5*    C  17          1H5*        C  17   5.898  -6.490   2.699
  177    H4*    C  17           H4*        C  17   4.462  -5.547   4.477
  178    H3*    C  17           H3*        C  17   3.219  -6.710   1.968
  179    H2*    C  17           H2*        C  17   1.054  -6.225   2.753
  180   2HO*    C  17          2HO*        C  17   0.619  -6.480   4.809
  181    H1*    C  17           H1*        C  17   1.616  -3.780   4.014
  182   1H4     C  17          H41         C  17  -1.150  -2.560  -1.599
  183   2H4     C  17          H42         C  17   0.381  -2.772  -2.415
  184    H5     C  17           H5         C  17   2.377  -3.490  -1.297
  185    H6     C  17           H6         C  17   3.358  -4.166   0.847
  186   1H5*    A  18          2H5*        A  18   1.209  -8.264   5.969
  187   2H5*    A  18          1H5*        A  18   0.914  -9.966   5.563
  188    H4*    A  18           H4*        A  18  -1.069  -8.684   6.523
  189    H3*    A  18           H3*        A  18  -1.076 -10.288   3.973
  190    H2*    A  18           H2*        A  18  -3.274  -9.611   3.426
  191   2HO*    A  18          2HO*        A  18  -3.480  -8.568   6.084
  192    H1*    A  18           H1*        A  18  -3.123  -6.993   4.119
  193    H8     A  18           H8         A  18   0.161  -8.230   2.676
  194   1H6     A  18          H61         A  18  -2.160  -6.935  -2.893
  195   2H6     A  18          H62         A  18  -0.722  -7.412  -2.017
  196    H2     A  18           H2         A  18  -5.446  -6.484   0.137
  197   1H5*    U  19          2H5*        U  19  -4.548 -12.315   6.423
  198   2H5*    U  19          1H5*        U  19  -4.626 -13.926   5.682
  199    H4*    U  19           H4*        U  19  -6.662 -12.287   5.424
  200    H3*    U  19           H3*        U  19  -5.377 -14.026   3.300
  201    H2*    U  19           H2*        U  19  -6.852 -13.198   1.664
  202   2HO*    U  19          2HO*        U  19  -8.865 -12.763   2.172
  203    H1*    U  19           H1*        U  19  -6.950 -10.539   2.532
  204    H3     U  19           H3         U  19  -4.968 -10.656  -1.580
  205    H5     U  19           H5         U  19  -1.932 -11.873   1.150
  206    H6     U  19           H6         U  19  -3.629 -11.918   2.881
  207   1H5*    C  20          2H5*        C  20  -9.863 -15.206   3.751
  208   2H5*    C  20          1H5*        C  20 -10.099 -16.780   2.966
  209    H4*    C  20           H4*        C  20 -11.329 -14.633   2.043
  210    H3*    C  20           H3*        C  20  -9.994 -16.881   0.512
  211    H2*    C  20           H2*        C  20 -10.443 -15.806  -1.545
  212   2HO*    C  20          2HO*        C  20 -11.839 -13.717  -1.246
  213    H1*    C  20           H1*        C  20  -9.931 -13.219  -0.779
  214   1H4     C  20          H41         C  20  -4.769 -15.649  -3.659
  215   2H4     C  20          H42         C  20  -4.128 -16.094  -2.093
  216    H5     C  20           H5         C  20  -5.378 -15.868  -0.043
  217    H6     C  20           H6         C  20  -7.511 -15.166   0.944
  218   1H5*    C  21          2H5*        C  21 -12.596 -15.664  -2.282
  219   2H5*    C  21          1H5*        C  21 -13.917 -16.845  -2.190
  220    H4*    C  21           H4*        C  21 -13.441 -16.672  -4.505
  221    H3*    C  21           H3*        C  21 -12.046 -19.038  -3.229
  222    H2*    C  21           H2*        C  21 -11.081 -19.612  -5.250
  223   2HO*    C  21          2HO*        C  21 -13.289 -19.450  -6.275
  224    H1*    C  21           H1*        C  21 -11.024 -16.962  -6.365
  225   1H4     C  21          H41         C  21  -4.923 -18.532  -5.579
  226   2H4     C  21          H42         C  21  -5.155 -18.796  -3.866
  227    H5     C  21           H5         C  21  -7.293 -18.588  -2.776
  228    H6     C  21           H6         C  21  -9.672 -18.083  -3.094
  229    H3T    C  21           H3T        C  21 -13.791 -19.890  -4.842
  Start of MODEL   10
    1   1H5*    G   1          2H5*        G   1   0.283 -17.599 -14.216
    2   2H5*    G   1          1H5*        G   1   0.306 -16.058 -15.097
    3    H4*    G   1           H4*        G   1  -1.891 -16.586 -15.473
    4    H3*    G   1           H3*        G   1  -1.758 -15.266 -12.755
    5    H2*    G   1           H2*        G   1  -4.019 -15.764 -12.328
    6   2HO*    G   1          2HO*        G   1  -4.150 -15.759 -15.105
    7    H1*    G   1           H1*        G   1  -4.141 -18.260 -13.452
    8    H8     G   1           H8         G   1  -1.009 -18.509 -11.580
    9    H1     G   1           H1         G   1  -5.953 -17.989  -7.587
   10   1H2     G   1          H21         G   1  -7.756 -17.321  -8.693
   11   2H2     G   1          H22         G   1  -7.739 -17.005 -10.413
   12    H5T    G   1           H5T        G   1   0.284 -14.969 -13.247
   13   1H5*    G   2          2H5*        G   2  -5.598 -14.802 -13.998
   14   2H5*    G   2          1H5*        G   2  -5.579 -13.212 -14.786
   15    H4*    G   2           H4*        G   2  -7.657 -13.194 -13.732
   16    H3*    G   2           H3*        G   2  -5.529 -11.877 -12.047
   17    H2*    G   2           H2*        G   2  -6.894 -11.734 -10.164
   18   2HO*    G   2          2HO*        G   2  -9.218 -11.779 -10.374
   19    H1*    G   2           H1*        G   2  -8.562 -13.950 -10.574
   20    H8     G   2           H8         G   2  -4.840 -14.725 -10.657
   21    H1     G   2           H1         G   2  -7.245 -14.463  -4.762
   22   1H2     G   2          H21         G   2  -9.317 -13.667  -4.824
   23   2H2     G   2          H22         G   2 -10.101 -13.204  -6.317
   24   1H5*    A   3          2H5*        A   3  -8.817  -9.999 -11.373
   25   2H5*    A   3          1H5*        A   3  -8.948  -8.275 -11.743
   26    H4*    A   3           H4*        A   3  -9.728  -8.638  -9.497
   27    H3*    A   3           H3*        A   3  -7.099  -7.208  -9.920
   28    H2*    A   3           H2*        A   3  -6.638  -7.262  -7.656
   29   2HO*    A   3          2HO*        A   3  -8.290  -6.883  -6.120
   30    H1*    A   3           H1*        A   3  -8.746  -9.205  -6.990
   31    H8     A   3           H8         A   3  -5.301  -9.904  -8.533
   32   1H6     A   3          H61         A   3  -3.400 -11.331  -2.866
   33   2H6     A   3          H62         A   3  -2.955 -11.265  -4.555
   34    H2     A   3           H2         A   3  -7.629  -9.849  -2.569
   35   1H5*    U   4          2H5*        U   4 -10.490  -5.498  -7.259
   36   2H5*    U   4          1H5*        U   4 -10.493  -3.732  -7.442
   37    H4*    U   4           H4*        U   4 -10.897  -4.377  -5.106
   38    H3*    U   4           H3*        U   4  -8.341  -2.920  -5.835
   39    H2*    U   4           H2*        U   4  -7.577  -3.018  -3.619
   40   2HO*    U   4          2HO*        U   4  -9.910  -2.348  -2.985
   41    H1*    U   4           H1*        U   4  -8.700  -5.466  -2.865
   42    H3     U   4           H3         U   4  -4.374  -6.346  -2.226
   43    H5     U   4           H5         U   4  -4.581  -5.560  -6.401
   44    H6     U   4           H6         U   4  -6.929  -4.998  -6.092
   45   1H5*    G   5          2H5*        G   5 -11.435  -0.714  -2.168
   46   2H5*    G   5          1H5*        G   5 -10.563   0.830  -2.263
   47    H4*    G   5           H4*        G   5 -10.996  -0.291   0.080
   48    H3*    G   5           H3*        G   5  -8.576   1.154  -0.972
   49    H2*    G   5           H2*        G   5  -7.229   0.545   0.864
   50   2HO*    G   5          2HO*        G   5  -8.804  -0.734   2.561
   51    H1*    G   5           H1*        G   5  -8.059  -2.020   1.230
   52    H8     G   5           H8         G   5  -7.878  -1.034  -2.446
   53    H1     G   5           H1         G   5  -2.269  -2.846  -0.026
   54   1H2     G   5          H21         G   5  -2.435  -3.117   2.167
   55   2H2     G   5          H22         G   5  -3.931  -2.853   3.035
   56   1H5*    C   6          2H5*        C   6  -8.086   1.249   3.398
   57   2H5*    C   6          1H5*        C   6  -8.079   2.993   3.691
   58    H4*    C   6           H4*        C   6  -6.046   1.635   4.488
   59    H3*    C   6           H3*        C   6  -6.021   4.213   2.881
   60    H2*    C   6           H2*        C   6  -3.702   4.070   2.691
   61   2HO*    C   6          2HO*        C   6  -2.706   2.644   4.576
   62    H1*    C   6           H1*        C   6  -3.561   1.241   3.419
   63   1H4     C   6          H41         C   6  -0.213   1.920  -1.973
   64   2H4     C   6          H42         C   6  -1.656   2.403  -2.836
   65    H5     C   6           H5         C   6  -3.801   2.678  -1.774
   66    H6     C   6           H6         C   6  -5.029   2.545   0.344
   67   1H5*    C   7          2H5*        C   7  -3.867   4.930   7.202
   68   2H5*    C   7          1H5*        C   7  -3.562   6.678   7.209
   69    H4*    C   7           H4*        C   7  -1.550   4.957   7.351
   70    H3*    C   7           H3*        C   7  -1.700   7.516   5.708
   71    H2*    C   7           H2*        C   7   0.500   7.106   4.954
   72   2HO*    C   7          2HO*        C   7   1.108   4.932   6.545
   73    H1*    C   7           H1*        C   7   0.316   4.313   4.822
   74   1H4     C   7          H41         C   7   0.125   6.529  -1.127
   75   2H4     C   7          H42         C   7  -1.586   6.858  -0.963
   76    H5     C   7           H5         C   7  -2.785   6.600   1.115
   77    H6     C   7           H6         C   7  -2.591   5.975   3.479
   78   1H5*    U   8          2H5*        U   8   1.440   8.435   9.390
   79   2H5*    U   8          1H5*        U   8   1.548  10.204   9.315
   80    H4*    U   8           H4*        U   8   3.717   8.719   9.034
   81    H3*    U   8           H3*        U   8   2.895  11.240   7.584
   82    H2*    U   8           H2*        U   8   4.721  11.084   6.097
   83   2HO*    U   8          2HO*        U   8   6.020   8.924   7.228
   84    H1*    U   8           H1*        U   8   4.750   8.373   5.707
   85    H3     U   8           H3         U   8   3.421  10.240   1.794
   86    H5     U   8           H5         U   8   0.020  10.511   4.268
   87    H6     U   8           H6         U   8   1.376   9.686   6.105
   88   1H5*    C   9          2H5*        C   9   7.375  12.070   7.813
   89   2H5*    C   9          1H5*        C   9   7.254  13.779   8.279
   90    H4*    C   9           H4*        C   9   8.315  13.112   5.957
   91    H3*    C   9           H3*        C   9   6.729  15.420   6.858
   92    H2*    C   9           H2*        C   9   5.490  15.756   4.956
   93   2HO*    C   9          2HO*        C   9   8.031  15.452   3.697
   94    H1*    C   9           H1*        C   9   6.539  13.580   3.285
   95   1H4     C   9          H41         C   9   0.262  13.638   2.273
   96   2H4     C   9          H42         C   9  -0.054  13.339   3.968
   97    H5     C   9           H5         C   9   1.687  13.211   5.634
   98    H6     C   9           H6         C   9   4.096  13.333   6.027
   99   1H5*    C  10          2H5*        C  10   7.317  18.877   5.655
  100   2H5*    C  10          1H5*        C  10   7.364  17.504   4.528
  101    H4*    C  10           H4*        C  10   8.070  20.343   4.094
  102    H3*    C  10           H3*        C  10   6.452  18.483   2.790
  103    H2*    C  10           H2*        C  10   8.157  17.077   1.945
  104   2HO*    C  10          2HO*        C  10   8.442  17.605  -0.194
  105    H1*    C  10           H1*        C  10  10.024  19.348   1.342
  106   1H4     C  10          H41         C  10  13.970  14.377   1.161
  107   2H4     C  10          H42         C  10  13.326  13.744   2.659
  108    H5     C  10           H5         C  10  11.506  14.772   3.853
  109    H6     C  10           H6         C  10   9.900  16.633   3.864
  110   1H5*    C  11          2H5*        C  11   7.245  19.604  -0.219
  111   2H5*    C  11          1H5*        C  11   6.797  20.956  -1.279
  112    H4*    C  11           H4*        C  11   6.829  18.840  -2.533
  113    H3*    C  11           H3*        C  11   4.800  20.705  -2.671
  114    H2*    C  11           H2*        C  11   3.275  19.627  -1.196
  115   2HO*    C  11          2HO*        C  11   2.180  19.702  -3.174
  116    H1*    C  11           H1*        C  11   3.972  16.901  -2.289
  117   1H4     C  11          H41         C  11   0.602  15.447   2.900
  118   2H4     C  11          H42         C  11   1.685  16.382   3.907
  119    H5     C  11           H5         C  11   3.508  17.685   3.030
  120    H6     C  11           H6         C  11   4.688  18.377   0.999
  121   1H5*    G  12          2H5*        G  12   6.084  16.916  -5.182
  122   2H5*    G  12          1H5*        G  12   6.753  16.896  -3.538
  123    H4*    G  12           H4*        G  12   8.351  16.501  -6.098
  124    H3*    G  12           H3*        G  12   6.985  14.621  -4.195
  125    H2*    G  12           H2*        G  12   8.858  13.286  -3.861
  126   2HO*    G  12          2HO*        G  12  10.604  13.939  -5.758
  127    H1*    G  12           H1*        G  12  10.919  15.176  -4.320
  128    H8     G  12           H8         G  12  12.045  15.101  -2.038
  129    H1     G  12           H1         G  12   6.594  14.259   1.152
  130   1H2     G  12          H21         G  12   4.877  14.323  -0.237
  131   2H2     G  12          H22         G  12   5.065  14.574  -1.959
  132   1H5*    A  13          2H5*        A  13   8.642  12.686  -6.575
  133   2H5*    A  13          1H5*        A  13   8.283  11.240  -7.540
  134    H4*    A  13           H4*        A  13   9.854  10.665  -5.758
  135    H3*    A  13           H3*        A  13   7.033   9.587  -5.626
  136    H2*    A  13           H2*        A  13   7.475   8.520  -3.557
  137   2HO*    A  13          2HO*        A  13   9.895   8.767  -2.862
  138    H1*    A  13           H1*        A  13   8.938  10.496  -2.375
  139    H8     A  13           H8         A  13   6.002  11.719  -4.504
  140   1H6     A  13          H61         A  13   2.539  11.168   0.560
  141   2H6     A  13          H62         A  13   2.573  11.723  -1.099
  142    H2     A  13           H2         A  13   6.604   9.479   1.457
  143   1H5*    G  14          2H5*        G  14  10.280   6.670  -5.029
  144   2H5*    G  14          1H5*        G  14   9.831   4.955  -5.110
  145    H4*    G  14           H4*        G  14  10.649   6.024  -2.830
  146    H3*    G  14           H3*        G  14   8.537   3.938  -3.388
  147    H2*    G  14           H2*        G  14   7.572   4.083  -1.277
  148   2HO*    G  14          2HO*        G  14   9.831   5.413  -0.184
  149    H1*    G  14           H1*        G  14   8.137   6.741  -0.586
  150    H8     G  14           H8         G  14   6.457   6.626  -3.955
  151    H1     G  14           H1         G  14   2.330   5.845   0.824
  152   1H2     G  14          H21         G  14   3.418   5.477   2.724
  153   2H2     G  14          H22         G  14   5.164   5.425   2.811
  154   1H5*    U  15          2H5*        U  15  12.397   3.168  -1.198
  155   2H5*    U  15          1H5*        U  15  13.536   1.819  -1.396
  156    H4*    U  15           H4*        U  15  12.129   0.330  -0.180
  157    H3*    U  15           H3*        U  15  10.003   2.319  -0.870
  158    H2*    U  15           H2*        U  15   9.241   2.531   1.290
  159   2HO*    U  15          2HO*        U  15   8.922   0.574   2.551
  160    H1*    U  15           H1*        U  15  11.296   0.865   2.591
  161    H3     U  15           H3         U  15   9.743   3.841   5.734
  162    H5     U  15           H5         U  15  12.172   6.073   3.106
  163    H6     U  15           H6         U  15  12.258   4.123   1.650
  164   1H5*    G  16          2H5*        G  16  10.008  -2.101  -1.027
  165   2H5*    G  16          1H5*        G  16   8.914  -3.290  -1.762
  166    H4*    G  16           H4*        G  16   8.692  -2.540   0.813
  167    H3*    G  16           H3*        G  16   6.581  -3.290  -1.304
  168    H2*    G  16           H2*        G  16   4.820  -2.675   0.107
  169   2HO*    G  16          2HO*        G  16   5.459  -2.307   2.491
  170    H1*    G  16           H1*        G  16   6.080  -0.599   1.559
  171    H8     G  16           H8         G  16   6.407  -0.050  -2.163
  172    H1     G  16           H1         G  16   0.605   1.430   0.068
  173   1H2     G  16          H21         G  16   0.391   0.725   2.155
  174   2H2     G  16          H22         G  16   1.676  -0.108   3.002
  175   1H5*    C  17          2H5*        C  17   5.862  -4.382   2.944
  176   2H5*    C  17          1H5*        C  17   5.889  -6.157   2.942
  177    H4*    C  17           H4*        C  17   4.276  -5.449   4.587
  178    H3*    C  17           H3*        C  17   3.159  -6.589   2.010
  179    H2*    C  17           H2*        C  17   0.953  -6.263   2.758
  180   2HO*    C  17          2HO*        C  17   1.046  -5.442   5.246
  181    H1*    C  17           H1*        C  17   1.335  -3.841   4.126
  182   1H4     C  17          H41         C  17  -1.357  -2.500  -1.493
  183   2H4     C  17          H42         C  17   0.184  -2.680  -2.298
  184    H5     C  17           H5         C  17   2.176  -3.399  -1.175
  185    H6     C  17           H6         C  17   3.144  -4.107   0.965
  186   1H5*    A  18          2H5*        A  18   1.409  -8.810   5.972
  187   2H5*    A  18          1H5*        A  18   0.995 -10.395   5.288
  188    H4*    A  18           H4*        A  18  -0.838  -9.066   6.579
  189    H3*    A  18           H3*        A  18  -1.057 -10.587   3.997
  190    H2*    A  18           H2*        A  18  -3.223  -9.779   3.525
  191   2HO*    A  18          2HO*        A  18  -3.326  -8.801   6.214
  192    H1*    A  18           H1*        A  18  -2.946  -7.196   4.295
  193    H8     A  18           H8         A  18   0.285  -8.428   2.753
  194   1H6     A  18          H61         A  18  -2.138  -7.007  -2.737
  195   2H6     A  18          H62         A  18  -0.684  -7.500  -1.899
  196    H2     A  18           H2         A  18  -5.371  -6.638   0.359
  197   1H5*    U  19          2H5*        U  19  -4.596 -12.456   6.421
  198   2H5*    U  19          1H5*        U  19  -4.713 -14.067   5.684
  199    H4*    U  19           H4*        U  19  -6.701 -12.383   5.400
  200    H3*    U  19           H3*        U  19  -5.429 -14.140   3.284
  201    H2*    U  19           H2*        U  19  -6.859 -13.267   1.632
  202   2HO*    U  19          2HO*        U  19  -8.474 -11.724   3.290
  203    H1*    U  19           H1*        U  19  -6.921 -10.613   2.524
  204    H3     U  19           H3         U  19  -4.899 -10.716  -1.569
  205    H5     U  19           H5         U  19  -1.910 -11.998   1.183
  206    H6     U  19           H6         U  19  -3.628 -12.043   2.893
  207   1H5*    C  20          2H5*        C  20  -9.967 -15.211   3.614
  208   2H5*    C  20          1H5*        C  20 -10.186 -16.790   2.832
  209    H4*    C  20           H4*        C  20 -11.382 -14.647   1.860
  210    H3*    C  20           H3*        C  20 -10.006 -16.906   0.382
  211    H2*    C  20           H2*        C  20 -10.385 -15.842  -1.692
  212   2HO*    C  20          2HO*        C  20 -12.585 -14.950  -0.422
  213    H1*    C  20           H1*        C  20  -9.916 -13.243  -0.920
  214   1H4     C  20          H41         C  20  -4.667 -15.601  -3.684
  215   2H4     C  20          H42         C  20  -4.071 -16.086  -2.112
  216    H5     C  20           H5         C  20  -5.378 -15.908  -0.092
  217    H6     C  20           H6         C  20  -7.538 -15.226   0.851
  218   1H5*    C  21          2H5*        C  21 -12.816 -15.671  -2.254
  219   2H5*    C  21          1H5*        C  21 -14.055 -16.940  -2.306
  220    H4*    C  21           H4*        C  21 -13.515 -16.350  -4.585
  221    H3*    C  21           H3*        C  21 -12.341 -18.965  -3.606
  222    H2*    C  21           H2*        C  21 -11.308 -19.320  -5.636
  223   2HO*    C  21          2HO*        C  21 -12.858 -17.432  -7.048
  224    H1*    C  21           H1*        C  21 -11.134 -16.543  -6.420
  225   1H4     C  21          H41         C  21  -5.124 -18.556  -5.960
  226   2H4     C  21          H42         C  21  -5.321 -18.892  -4.255
  227    H5     C  21           H5         C  21  -7.413 -18.631  -3.089
  228    H6     C  21           H6         C  21  -9.769 -17.987  -3.306
  229    H3T    C  21           H3T        C  21 -14.180 -18.978  -5.617
  Start of MODEL   11
    1   1H5*    G   1          2H5*        G   1   0.951 -16.765 -13.498
    2   2H5*    G   1          1H5*        G   1   0.790 -15.256 -14.419
    3    H4*    G   1           H4*        G   1  -1.194 -16.207 -15.048
    4    H3*    G   1           H3*        G   1  -1.664 -14.838 -12.397
    5    H2*    G   1           H2*        G   1  -3.818 -15.774 -12.204
    6   2HO*    G   1          2HO*        G   1  -3.787 -16.852 -14.812
    7    H1*    G   1           H1*        G   1  -3.314 -18.267 -13.198
    8    H8     G   1           H8         G   1  -0.416 -18.112 -11.103
    9    H1     G   1           H1         G   1  -5.635 -17.765  -7.455
   10   1H2     G   1          H21         G   1  -7.403 -17.279  -8.702
   11   2H2     G   1          H22         G   1  -7.296 -17.041 -10.432
   12    H5T    G   1           H5T        G   1   0.447 -15.735 -11.671
   13   1H5*    G   2          2H5*        G   2  -5.362 -14.983 -13.783
   14   2H5*    G   2          1H5*        G   2  -5.543 -13.461 -14.677
   15    H4*    G   2           H4*        G   2  -7.621 -13.614 -13.657
   16    H3*    G   2           H3*        G   2  -5.699 -12.000 -11.993
   17    H2*    G   2           H2*        G   2  -7.062 -11.986 -10.109
   18   2HO*    G   2          2HO*        G   2  -9.466 -12.747 -10.790
   19    H1*    G   2           H1*        G   2  -8.491 -14.376 -10.480
   20    H8     G   2           H8         G   2  -4.725 -14.826 -10.512
   21    H1     G   2           H1         G   2  -7.181 -14.514  -4.638
   22   1H2     G   2          H21         G   2  -9.308 -13.888  -4.737
   23   2H2     G   2          H22         G   2 -10.118 -13.546  -6.249
   24   1H5*    A   3          2H5*        A   3  -8.932 -10.463 -11.232
   25   2H5*    A   3          1H5*        A   3  -9.342  -8.813 -11.718
   26    H4*    A   3           H4*        A   3  -9.857  -8.921  -9.424
   27    H3*    A   3           H3*        A   3  -7.246  -7.559 -10.098
   28    H2*    A   3           H2*        A   3  -6.647  -7.484  -7.865
   29   2HO*    A   3          2HO*        A   3  -8.367  -5.997  -7.450
   30    H1*    A   3           H1*        A   3  -8.786  -9.319  -6.972
   31    H8     A   3           H8         A   3  -5.339 -10.076  -8.523
   32   1H6     A   3          H61         A   3  -3.430 -11.301  -2.805
   33   2H6     A   3          H62         A   3  -2.977 -11.274  -4.494
   34    H2     A   3           H2         A   3  -7.694  -9.913  -2.571
   35   1H5*    U   4          2H5*        U   4 -10.769  -4.795  -7.716
   36   2H5*    U   4          1H5*        U   4  -9.980  -3.205  -7.680
   37    H4*    U   4           H4*        U   4 -10.969  -4.238  -5.474
   38    H3*    U   4           H3*        U   4  -8.342  -2.778  -5.876
   39    H2*    U   4           H2*        U   4  -7.739  -3.133  -3.636
   40   2HO*    U   4          2HO*        U   4  -9.560  -2.387  -2.605
   41    H1*    U   4           H1*        U   4  -8.945  -5.622  -3.238
   42    H3     U   4           H3         U   4  -4.601  -6.353  -2.355
   43    H5     U   4           H5         U   4  -4.678  -5.670  -6.557
   44    H6     U   4           H6         U   4  -7.036  -5.116  -6.336
   45   1H5*    G   5          2H5*        G   5 -11.503  -1.085  -2.053
   46   2H5*    G   5          1H5*        G   5 -10.785   0.537  -2.130
   47    H4*    G   5           H4*        G   5 -11.047  -0.600   0.199
   48    H3*    G   5           H3*        G   5  -8.679   0.894  -0.912
   49    H2*    G   5           H2*        G   5  -7.298   0.323   0.916
   50   2HO*    G   5          2HO*        G   5  -9.277  -0.948   2.426
   51    H1*    G   5           H1*        G   5  -8.048  -2.266   1.260
   52    H8     G   5           H8         G   5  -7.973  -1.274  -2.412
   53    H1     G   5           H1         G   5  -2.248  -2.831  -0.090
   54   1H2     G   5          H21         G   5  -2.365  -3.093   2.109
   55   2H2     G   5          H22         G   5  -3.855  -2.884   3.001
   56   1H5*    C   6          2H5*        C   6  -8.155   0.923   3.394
   57   2H5*    C   6          1H5*        C   6  -8.183   2.653   3.758
   58    H4*    C   6           H4*        C   6  -6.132   1.309   4.519
   59    H3*    C   6           H3*        C   6  -6.177   3.950   3.028
   60    H2*    C   6           H2*        C   6  -3.869   3.863   2.746
   61   2HO*    C   6          2HO*        C   6  -2.564   3.445   4.427
   62    H1*    C   6           H1*        C   6  -3.632   1.028   3.468
   63   1H4     C   6          H41         C   6  -0.248   1.840  -1.883
   64   2H4     C   6          H42         C   6  -1.693   2.297  -2.757
   65    H5     C   6           H5         C   6  -3.855   2.509  -1.713
   66    H6     C   6           H6         C   6  -5.100   2.327   0.393
   67   1H5*    C   7          2H5*        C   7  -3.869   4.644   7.237
   68   2H5*    C   7          1H5*        C   7  -3.686   6.408   7.269
   69    H4*    C   7           H4*        C   7  -1.555   4.828   7.221
   70    H3*    C   7           H3*        C   7  -1.980   7.391   5.625
   71    H2*    C   7           H2*        C   7   0.207   7.133   4.777
   72   2HO*    C   7          2HO*        C   7   1.712   6.557   6.139
   73    H1*    C   7           H1*        C   7   0.204   4.311   4.714
   74   1H4     C   7          H41         C   7  -0.035   6.407  -1.277
   75   2H4     C   7          H42         C   7  -1.759   6.668  -1.132
   76    H5     C   7           H5         C   7  -2.966   6.394   0.942
   77    H6     C   7           H6         C   7  -2.765   5.814   3.317
   78   1H5*    U   8          2H5*        U   8   1.209   8.347   9.203
   79   2H5*    U   8          1H5*        U   8   1.359  10.114   9.173
   80    H4*    U   8           H4*        U   8   3.482   8.580   8.809
   81    H3*    U   8           H3*        U   8   2.696  11.156   7.430
   82    H2*    U   8           H2*        U   8   4.523  10.999   5.943
   83   2HO*    U   8          2HO*        U   8   5.567   8.980   7.686
   84    H1*    U   8           H1*        U   8   4.485   8.295   5.489
   85    H3     U   8           H3         U   8   3.251  10.330   1.618
   86    H5     U   8           H5         U   8  -0.194  10.518   4.039
   87    H6     U   8           H6         U   8   1.130   9.638   5.875
   88   1H5*    C   9          2H5*        C   9   7.231  11.929   7.928
   89   2H5*    C   9          1H5*        C   9   7.095  13.638   8.391
   90    H4*    C   9           H4*        C   9   8.328  12.974   6.160
   91    H3*    C   9           H3*        C   9   6.680  15.283   6.939
   92    H2*    C   9           H2*        C   9   5.615  15.640   4.937
   93   2HO*    C   9          2HO*        C   9   8.276  15.752   4.256
   94    H1*    C   9           H1*        C   9   6.770  13.455   3.354
   95   1H4     C   9          H41         C   9   0.587  13.636   1.871
   96   2H4     C   9          H42         C   9   0.142  13.290   3.527
   97    H5     C   9           H5         C   9   1.750  13.088   5.312
   98    H6     C   9           H6         C   9   4.125  13.168   5.892
   99   1H5*    C  10          2H5*        C  10   7.436  18.774   6.043
  100   2H5*    C  10          1H5*        C  10   7.542  17.330   5.016
  101    H4*    C  10           H4*        C  10   8.413  20.121   4.486
  102    H3*    C  10           H3*        C  10   6.725  18.285   3.214
  103    H2*    C  10           H2*        C  10   8.402  16.771   2.489
  104   2HO*    C  10          2HO*        C  10   9.137  18.331   0.382
  105    H1*    C  10           H1*        C  10  10.329  18.996   1.848
  106   1H4     C  10          H41         C  10  14.197  13.969   1.609
  107   2H4     C  10          H42         C  10  13.590  13.365   3.135
  108    H5     C  10           H5         C  10  11.813  14.430   4.365
  109    H6     C  10           H6         C  10  10.220  16.297   4.386
  110   1H5*    C  11          2H5*        C  11   7.710  19.715   0.075
  111   2H5*    C  11          1H5*        C  11   7.138  21.102  -0.872
  112    H4*    C  11           H4*        C  11   7.346  19.013  -2.223
  113    H3*    C  11           H3*        C  11   5.276  20.865  -2.344
  114    H2*    C  11           H2*        C  11   3.639  19.653  -1.150
  115   2HO*    C  11          2HO*        C  11   3.617  19.072  -3.851
  116    H1*    C  11           H1*        C  11   4.539  16.989  -2.212
  117   1H4     C  11          H41         C  11   0.825  15.417   2.698
  118   2H4     C  11          H42         C  11   1.805  16.368   3.791
  119    H5     C  11           H5         C  11   3.663  17.719   3.064
  120    H6     C  11           H6         C  11   4.980  18.447   1.131
  121   1H5*    G  12          2H5*        G  12   6.394  17.354  -5.030
  122   2H5*    G  12          1H5*        G  12   7.266  17.237  -3.489
  123    H4*    G  12           H4*        G  12   8.475  16.674  -6.223
  124    H3*    G  12           H3*        G  12   7.045  14.960  -4.221
  125    H2*    G  12           H2*        G  12   8.726  13.366  -4.062
  126   2HO*    G  12          2HO*        G  12  10.406  13.578  -5.992
  127    H1*    G  12           H1*        G  12  10.995  14.936  -4.685
  128    H8     G  12           H8         G  12  12.276  14.963  -2.448
  129    H1     G  12           H1         G  12   6.994  14.201   1.035
  130   1H2     G  12          H21         G  12   5.204  14.302  -0.263
  131   2H2     G  12          H22         G  12   5.307  14.556  -1.992
  132   1H5*    A  13          2H5*        A  13   8.335  12.760  -6.827
  133   2H5*    A  13          1H5*        A  13   7.576  11.309  -7.515
  134    H4*    A  13           H4*        A  13   9.561  10.885  -5.977
  135    H3*    A  13           H3*        A  13   6.830   9.650  -5.726
  136    H2*    A  13           H2*        A  13   7.331   8.624  -3.654
  137   2HO*    A  13          2HO*        A  13   9.359   8.118  -3.044
  138    H1*    A  13           H1*        A  13   8.702  10.636  -2.468
  139    H8     A  13           H8         A  13   5.837  11.837  -4.697
  140   1H6     A  13          H61         A  13   2.188  11.219   0.229
  141   2H6     A  13          H62         A  13   2.281  11.783  -1.425
  142    H2     A  13           H2         A  13   6.236   9.569   1.273
  143   1H5*    G  14          2H5*        G  14  10.180   6.903  -5.050
  144   2H5*    G  14          1H5*        G  14   9.792   5.172  -5.123
  145    H4*    G  14           H4*        G  14  10.518   6.290  -2.836
  146    H3*    G  14           H3*        G  14   8.475   4.140  -3.417
  147    H2*    G  14           H2*        G  14   7.488   4.265  -1.312
  148   2HO*    G  14          2HO*        G  14   8.744   5.301   0.468
  149    H1*    G  14           H1*        G  14   7.958   6.950  -0.648
  150    H8     G  14           H8         G  14   6.314   6.715  -4.031
  151    H1     G  14           H1         G  14   2.174   5.917   0.730
  152   1H2     G  14          H21         G  14   3.255   5.624   2.646
  153   2H2     G  14          H22         G  14   5.001   5.626   2.748
  154   1H5*    U  15          2H5*        U  15  12.311   3.502  -1.172
  155   2H5*    U  15          1H5*        U  15  13.502   2.194  -1.334
  156    H4*    U  15           H4*        U  15  12.129   0.666  -0.127
  157    H3*    U  15           H3*        U  15   9.947   2.567  -0.884
  158    H2*    U  15           H2*        U  15   9.132   2.779   1.254
  159   2HO*    U  15          2HO*        U  15   9.631   0.212   2.158
  160    H1*    U  15           H1*        U  15  11.213   1.203   2.622
  161    H3     U  15           H3         U  15   9.436   4.177   5.660
  162    H5     U  15           H5         U  15  11.914   6.438   3.103
  163    H6     U  15           H6         U  15  12.116   4.469   1.681
  164   1H5*    G  16          2H5*        G  16  10.037  -2.039  -1.154
  165   2H5*    G  16          1H5*        G  16   8.857  -3.082  -1.973
  166    H4*    G  16           H4*        G  16   8.703  -2.386   0.666
  167    H3*    G  16           H3*        G  16   6.595  -3.125  -1.462
  168    H2*    G  16           H2*        G  16   4.837  -2.547  -0.028
  169   2HO*    G  16          2HO*        G  16   5.793  -2.139   2.375
  170    H1*    G  16           H1*        G  16   6.085  -0.468   1.428
  171    H8     G  16           H8         G  16   6.400   0.117  -2.284
  172    H1     G  16           H1         G  16   0.568   1.485  -0.062
  173   1H2     G  16          H21         G  16   0.358   0.759   2.018
  174   2H2     G  16          H22         G  16   1.651  -0.059   2.865
  175   1H5*    C  17          2H5*        C  17   6.006  -4.319   2.921
  176   2H5*    C  17          1H5*        C  17   5.867  -6.084   2.820
  177    H4*    C  17           H4*        C  17   4.357  -5.183   4.540
  178    H3*    C  17           H3*        C  17   3.189  -6.451   2.047
  179    H2*    C  17           H2*        C  17   0.997  -6.041   2.797
  180   2HO*    C  17          2HO*        C  17   1.070  -6.799   4.872
  181    H1*    C  17           H1*        C  17   1.446  -3.557   4.034
  182   1H4     C  17          H41         C  17  -1.369  -2.507  -1.586
  183   2H4     C  17          H42         C  17   0.169  -2.667  -2.403
  184    H5     C  17           H5         C  17   2.193  -3.294  -1.279
  185    H6     C  17           H6         C  17   3.202  -3.909   0.871
  186   1H5*    A  18          2H5*        A  18   1.189  -8.297   6.109
  187   2H5*    A  18          1H5*        A  18   0.841  -9.922   5.485
  188    H4*    A  18           H4*        A  18  -1.095  -8.545   6.552
  189    H3*    A  18           H3*        A  18  -1.123 -10.180   4.023
  190    H2*    A  18           H2*        A  18  -3.291  -9.450   3.438
  191   2HO*    A  18          2HO*        A  18  -4.742  -8.725   4.904
  192    H1*    A  18           H1*        A  18  -3.084  -6.829   4.115
  193    H8     A  18           H8         A  18   0.193  -8.099   2.716
  194   1H6     A  18          H61         A  18  -2.096  -6.937  -2.895
  195   2H6     A  18          H62         A  18  -0.661  -7.386  -2.001
  196    H2     A  18           H2         A  18  -5.405  -6.443   0.099
  197   1H5*    U  19          2H5*        U  19  -4.450 -12.475   6.552
  198   2H5*    U  19          1H5*        U  19  -4.466 -14.036   5.706
  199    H4*    U  19           H4*        U  19  -6.562 -12.430   5.578
  200    H3*    U  19           H3*        U  19  -5.287 -14.085   3.383
  201    H2*    U  19           H2*        U  19  -6.814 -13.246   1.799
  202   2HO*    U  19          2HO*        U  19  -8.720 -12.098   2.486
  203    H1*    U  19           H1*        U  19  -6.926 -10.609   2.721
  204    H3     U  19           H3         U  19  -4.999 -10.685  -1.427
  205    H5     U  19           H5         U  19  -1.898 -11.797   1.274
  206    H6     U  19           H6         U  19  -3.574 -11.892   3.024
  207   1H5*    C  20          2H5*        C  20  -9.755 -15.392   3.785
  208   2H5*    C  20          1H5*        C  20  -9.883 -16.980   3.003
  209    H4*    C  20           H4*        C  20 -11.227 -14.914   2.054
  210    H3*    C  20           H3*        C  20  -9.737 -17.080   0.546
  211    H2*    C  20           H2*        C  20 -10.241 -16.040  -1.517
  212   2HO*    C  20          2HO*        C  20 -11.827 -14.350  -1.634
  213    H1*    C  20           H1*        C  20  -9.888 -13.424  -0.753
  214   1H4     C  20          H41         C  20  -4.556 -15.521  -3.579
  215   2H4     C  20          H42         C  20  -3.904 -15.919  -2.006
  216    H5     C  20           H5         C  20  -5.184 -15.776   0.029
  217    H6     C  20           H6         C  20  -7.369 -15.216   0.996
  218   1H5*    C  21          2H5*        C  21 -12.468 -15.905  -2.219
  219   2H5*    C  21          1H5*        C  21 -13.636 -17.238  -2.300
  220    H4*    C  21           H4*        C  21 -12.984 -16.726  -4.561
  221    H3*    C  21           H3*        C  21 -11.685 -19.202  -3.395
  222    H2*    C  21           H2*        C  21 -10.521 -19.565  -5.355
  223   2HO*    C  21          2HO*        C  21 -12.065 -19.668  -6.881
  224    H1*    C  21           H1*        C  21 -10.484 -16.815  -6.236
  225   1H4     C  21          H41         C  21  -4.398 -18.395  -5.325
  226   2H4     C  21          H42         C  21  -4.678 -18.672  -3.621
  227    H5     C  21           H5         C  21  -6.853 -18.504  -2.597
  228    H6     C  21           H6         C  21  -9.228 -18.032  -2.984
  229    H3T    C  21           H3T        C  21 -13.281 -19.843  -5.284
  Start of MODEL   12
    1   1H5*    G   1          2H5*        G   1   0.718 -17.565 -13.948
    2   2H5*    G   1          1H5*        G   1   0.706 -16.051 -14.876
    3    H4*    G   1           H4*        G   1  -1.446 -16.697 -15.321
    4    H3*    G   1           H3*        G   1  -1.483 -15.274 -12.653
    5    H2*    G   1           H2*        G   1  -3.735 -15.862 -12.290
    6   2HO*    G   1          2HO*        G   1  -3.762 -16.315 -15.096
    7    H1*    G   1           H1*        G   1  -3.696 -18.402 -13.311
    8    H8     G   1           H8         G   1  -0.614 -18.410 -11.331
    9    H1     G   1           H1         G   1  -5.713 -18.018  -7.524
   10   1H2     G   1          H21         G   1  -7.512 -17.499  -8.713
   11   2H2     G   1          H22         G   1  -7.454 -17.250 -10.444
   12    H5T    G   1           H5T        G   1   1.366 -16.190 -12.465
   13   1H5*    G   2          2H5*        G   2  -5.269 -14.937 -13.935
   14   2H5*    G   2          1H5*        G   2  -5.264 -13.401 -14.826
   15    H4*    G   2           H4*        G   2  -7.337 -13.277 -13.805
   16    H3*    G   2           H3*        G   2  -5.231 -11.982 -12.077
   17    H2*    G   2           H2*        G   2  -6.649 -11.781 -10.238
   18   2HO*    G   2          2HO*        G   2  -8.851 -11.531 -10.436
   19    H1*    G   2           H1*        G   2  -8.334 -13.981 -10.655
   20    H8     G   2           H8         G   2  -4.621 -14.811 -10.647
   21    H1     G   2           H1         G   2  -7.150 -14.426  -4.809
   22   1H2     G   2          H21         G   2  -9.208 -13.605  -4.927
   23   2H2     G   2          H22         G   2  -9.954 -13.154  -6.443
   24   1H5*    A   3          2H5*        A   3  -8.650 -10.104 -11.472
   25   2H5*    A   3          1H5*        A   3  -8.685  -8.367 -11.805
   26    H4*    A   3           H4*        A   3  -9.608  -8.814  -9.602
   27    H3*    A   3           H3*        A   3  -6.994  -7.322  -9.898
   28    H2*    A   3           H2*        A   3  -6.624  -7.390  -7.622
   29   2HO*    A   3          2HO*        A   3  -9.221  -6.567  -7.676
   30    H1*    A   3           H1*        A   3  -8.695  -9.399  -7.056
   31    H8     A   3           H8         A   3  -5.219 -10.044  -8.518
   32   1H6     A   3          H61         A   3  -3.383 -11.344  -2.795
   33   2H6     A   3          H62         A   3  -2.913 -11.303  -4.478
   34    H2     A   3           H2         A   3  -7.639  -9.923  -2.593
   35   1H5*    U   4          2H5*        U   4 -10.705  -5.007  -7.415
   36   2H5*    U   4          1H5*        U   4 -10.086  -3.345  -7.459
   37    H4*    U   4           H4*        U   4 -10.917  -4.293  -5.193
   38    H3*    U   4           H3*        U   4  -8.335  -2.799  -5.718
   39    H2*    U   4           H2*        U   4  -7.638  -3.077  -3.499
   40   2HO*    U   4          2HO*        U   4 -10.312  -3.784  -2.782
   41    H1*    U   4           H1*        U   4  -8.804  -5.562  -2.961
   42    H3     U   4           H3         U   4  -4.458  -6.362  -2.220
   43    H5     U   4           H5         U   4  -4.622  -5.596  -6.403
   44    H6     U   4           H6         U   4  -6.974  -5.036  -6.122
   45   1H5*    G   5          2H5*        G   5 -11.582  -0.797  -2.014
   46   2H5*    G   5          1H5*        G   5 -10.682   0.734  -2.010
   47    H4*    G   5           H4*        G   5 -11.227  -0.485   0.265
   48    H3*    G   5           H3*        G   5  -8.763   0.989  -0.627
   49    H2*    G   5           H2*        G   5  -7.469   0.273   1.210
   50   2HO*    G   5          2HO*        G   5  -8.933  -1.075   2.849
   51    H1*    G   5           H1*        G   5  -8.282  -2.307   1.382
   52    H8     G   5           H8         G   5  -8.134  -1.138  -2.231
   53    H1     G   5           H1         G   5  -2.452  -2.843   0.094
   54   1H2     G   5          H21         G   5  -2.604  -3.217   2.275
   55   2H2     G   5          H22         G   5  -4.106  -3.047   3.154
   56   1H5*    C   6          2H5*        C   6  -8.235   0.818   3.676
   57   2H5*    C   6          1H5*        C   6  -8.258   2.537   4.087
   58    H4*    C   6           H4*        C   6  -6.187   1.198   4.770
   59    H3*    C   6           H3*        C   6  -6.239   3.847   3.289
   60    H2*    C   6           H2*        C   6  -3.930   3.751   3.017
   61   2HO*    C   6          2HO*        C   6  -2.601   2.804   4.670
   62    H1*    C   6           H1*        C   6  -3.716   0.901   3.657
   63   1H4     C   6          H41         C   6  -0.450   1.813  -1.751
   64   2H4     C   6          H42         C   6  -1.914   2.285  -2.582
   65    H5     C   6           H5         C   6  -4.051   2.482  -1.487
   66    H6     C   6           H6         C   6  -5.250   2.266   0.646
   67   1H5*    C   7          2H5*        C   7  -3.836   4.562   7.401
   68   2H5*    C   7          1H5*        C   7  -3.717   6.332   7.437
   69    H4*    C   7           H4*        C   7  -1.532   4.833   7.303
   70    H3*    C   7           H3*        C   7  -2.100   7.376   5.717
   71    H2*    C   7           H2*        C   7   0.063   7.188   4.810
   72   2HO*    C   7          2HO*        C   7   0.851   6.734   7.122
   73    H1*    C   7           H1*        C   7   0.183   4.347   4.868
   74   1H4     C   7          H41         C   7   0.071   6.265  -1.194
   75   2H4     C   7          H42         C   7  -1.667   6.465  -1.113
   76    H5     C   7           H5         C   7  -2.929   6.201   0.929
   77    H6     C   7           H6         C   7  -2.786   5.691   3.324
   78   1H5*    U   8          2H5*        U   8   1.282   8.297   9.078
   79   2H5*    U   8          1H5*        U   8   1.453  10.062   9.064
   80    H4*    U   8           H4*        U   8   3.534   8.506   8.572
   81    H3*    U   8           H3*        U   8   2.720  11.106   7.248
   82    H2*    U   8           H2*        U   8   4.506  10.938   5.710
   83   2HO*    U   8          2HO*        U   8   6.333  10.309   6.577
   84    H1*    U   8           H1*        U   8   4.396   8.241   5.229
   85    H3     U   8           H3         U   8   3.114  10.402   1.446
   86    H5     U   8           H5         U   8  -0.285  10.539   3.927
   87    H6     U   8           H6         U   8   1.067   9.599   5.714
   88   1H5*    C   9          2H5*        C   9   7.234  11.885   7.756
   89   2H5*    C   9          1H5*        C   9   7.130  13.600   8.209
   90    H4*    C   9           H4*        C   9   8.348  12.909   5.981
   91    H3*    C   9           H3*        C   9   6.715  15.241   6.733
   92    H2*    C   9           H2*        C   9   5.675  15.596   4.718
   93   2HO*    C   9          2HO*        C   9   7.710  15.020   2.986
   94    H1*    C   9           H1*        C   9   6.795  13.371   3.170
   95   1H4     C   9          H41         C   9   0.613  13.608   1.693
   96   2H4     C   9          H42         C   9   0.169  13.254   3.348
   97    H5     C   9           H5         C   9   1.779  13.040   5.130
   98    H6     C   9           H6         C   9   4.154  13.112   5.708
   99   1H5*    C  10          2H5*        C  10   7.455  18.706   5.820
  100   2H5*    C  10          1H5*        C  10   7.560  17.281   4.767
  101    H4*    C  10           H4*        C  10   8.405  20.086   4.277
  102    H3*    C  10           H3*        C  10   6.734  18.254   2.978
  103    H2*    C  10           H2*        C  10   8.420  16.766   2.227
  104   2HO*    C  10          2HO*        C  10   7.433  17.769   0.353
  105    H1*    C  10           H1*        C  10  10.337  19.006   1.619
  106   1H4     C  10          H41         C  10  14.189  13.972   1.322
  107   2H4     C  10          H42         C  10  13.573  13.345   2.834
  108    H5     C  10           H5         C  10  11.797  14.398   4.075
  109    H6     C  10           H6         C  10  10.218  16.279   4.126
  110   1H5*    C  11          2H5*        C  11   7.624  19.877  -0.190
  111   2H5*    C  11          1H5*        C  11   6.912  21.251  -1.061
  112    H4*    C  11           H4*        C  11   7.154  19.167  -2.453
  113    H3*    C  11           H3*        C  11   5.048  20.973  -2.486
  114    H2*    C  11           H2*        C  11   3.506  19.735  -1.187
  115   2HO*    C  11          2HO*        C  11   2.116  19.424  -2.741
  116    H1*    C  11           H1*        C  11   4.376  17.094  -2.337
  117   1H4     C  11          H41         C  11   0.952  15.389   2.741
  118   2H4     C  11          H42         C  11   1.982  16.332   3.794
  119    H5     C  11           H5         C  11   3.778  17.717   2.990
  120    H6     C  11           H6         C  11   4.979  18.499   1.003
  121   1H5*    G  12          2H5*        G  12   6.211  17.458  -5.249
  122   2H5*    G  12          1H5*        G  12   7.049  17.360  -3.687
  123    H4*    G  12           H4*        G  12   8.329  16.895  -6.409
  124    H3*    G  12           H3*        G  12   7.033  15.080  -4.397
  125    H2*    G  12           H2*        G  12   8.827  13.606  -4.275
  126   2HO*    G  12          2HO*        G  12   9.489  14.589  -6.877
  127    H1*    G  12           H1*        G  12  10.965  15.352  -4.885
  128    H8     G  12           H8         G  12  12.261  15.382  -2.666
  129    H1     G  12           H1         G  12   7.054  14.340   0.859
  130   1H2     G  12          H21         G  12   5.246  14.384  -0.417
  131   2H2     G  12          H22         G  12   5.318  14.670  -2.141
  132   1H5*    A  13          2H5*        A  13   8.334  12.770  -6.963
  133   2H5*    A  13          1H5*        A  13   7.496  11.292  -7.480
  134    H4*    A  13           H4*        A  13   9.570  11.007  -5.973
  135    H3*    A  13           H3*        A  13   6.875   9.715  -5.668
  136    H2*    A  13           H2*        A  13   7.362   8.824  -3.539
  137   2HO*    A  13          2HO*        A  13   9.496   8.651  -2.766
  138    H1*    A  13           H1*        A  13   8.709  10.906  -2.446
  139    H8     A  13           H8         A  13   5.888  12.114  -4.688
  140   1H6     A  13          H61         A  13   2.133  11.380   0.144
  141   2H6     A  13          H62         A  13   2.259  11.993  -1.489
  142    H2     A  13           H2         A  13   6.147   9.674   1.217
  143   1H5*    G  14          2H5*        G  14  10.273   6.915  -4.861
  144   2H5*    G  14          1H5*        G  14   9.801   5.208  -4.984
  145    H4*    G  14           H4*        G  14  10.584   6.223  -2.667
  146    H3*    G  14           H3*        G  14   8.403   4.208  -3.285
  147    H2*    G  14           H2*        G  14   7.546   4.279  -1.110
  148   2HO*    G  14          2HO*        G  14   8.830   4.457   0.587
  149    H1*    G  14           H1*        G  14   8.054   6.945  -0.449
  150    H8     G  14           H8         G  14   6.409   6.825  -3.834
  151    H1     G  14           H1         G  14   2.241   5.877   0.880
  152   1H2     G  14          H21         G  14   3.312   5.532   2.793
  153   2H2     G  14          H22         G  14   5.057   5.535   2.907
  154   1H5*    U  15          2H5*        U  15  12.238   3.313  -1.221
  155   2H5*    U  15          1H5*        U  15  13.446   2.040  -1.506
  156    H4*    U  15           H4*        U  15  12.075   0.400  -0.392
  157    H3*    U  15           H3*        U  15   9.932   2.424  -0.815
  158    H2*    U  15           H2*        U  15   9.388   2.618   1.412
  159   2HO*    U  15          2HO*        U  15   9.579  -0.233   1.498
  160    H1*    U  15           H1*        U  15  11.394   0.688   2.439
  161    H3     U  15           H3         U  15  10.359   3.285   6.058
  162    H5     U  15           H5         U  15  12.374   5.847   3.381
  163    H6     U  15           H6         U  15  12.282   4.061   1.724
  164   1H5*    G  16          2H5*        G  16   9.854  -2.161  -1.176
  165   2H5*    G  16          1H5*        G  16   8.580  -3.162  -1.901
  166    H4*    G  16           H4*        G  16   8.618  -2.328   0.724
  167    H3*    G  16           H3*        G  16   6.410  -3.194  -1.242
  168    H2*    G  16           H2*        G  16   4.712  -2.476   0.198
  169   2HO*    G  16          2HO*        G  16   6.591  -2.468   2.358
  170    H1*    G  16           H1*        G  16   6.058  -0.351   1.508
  171    H8     G  16           H8         G  16   6.253   0.202  -2.186
  172    H1     G  16           H1         G  16   0.435   1.455   0.137
  173   1H2     G  16          H21         G  16   0.267   0.704   2.213
  174   2H2     G  16          H22         G  16   1.588  -0.099   3.032
  175   1H5*    C  17          2H5*        C  17   5.669  -4.023   2.980
  176   2H5*    C  17          1H5*        C  17   5.891  -5.780   3.099
  177    H4*    C  17           H4*        C  17   4.195  -5.252   4.677
  178    H3*    C  17           H3*        C  17   3.146  -6.399   2.076
  179    H2*    C  17           H2*        C  17   0.923  -6.186   2.806
  180   2HO*    C  17          2HO*        C  17   1.664  -7.069   4.992
  181    H1*    C  17           H1*        C  17   1.179  -3.779   4.231
  182   1H4     C  17          H41         C  17  -1.557  -2.477  -1.375
  183   2H4     C  17          H42         C  17  -0.001  -2.535  -2.169
  184    H5     C  17           H5         C  17   2.023  -3.147  -1.045
  185    H6     C  17           H6         C  17   3.019  -3.851   1.084
  186   1H5*    A  18          2H5*        A  18   1.482  -8.893   5.942
  187   2H5*    A  18          1H5*        A  18   0.988 -10.403   5.154
  188    H4*    A  18           H4*        A  18  -0.757  -8.997   6.544
  189    H3*    A  18           H3*        A  18  -1.079 -10.529   3.977
  190    H2*    A  18           H2*        A  18  -3.223  -9.643   3.539
  191   2HO*    A  18          2HO*        A  18  -4.438  -9.637   5.290
  192    H1*    A  18           H1*        A  18  -2.829  -7.067   4.266
  193    H8     A  18           H8         A  18   0.347  -8.379   2.707
  194   1H6     A  18          H61         A  18  -2.131  -7.073  -2.787
  195   2H6     A  18          H62         A  18  -0.671  -7.554  -1.954
  196    H2     A  18           H2         A  18  -5.328  -6.615   0.334
  197   1H5*    U  19          2H5*        U  19  -4.621 -12.521   6.471
  198   2H5*    U  19          1H5*        U  19  -4.684 -14.078   5.621
  199    H4*    U  19           H4*        U  19  -6.718 -12.395   5.473
  200    H3*    U  19           H3*        U  19  -5.484 -14.105   3.299
  201    H2*    U  19           H2*        U  19  -6.936 -13.201   1.682
  202   2HO*    U  19          2HO*        U  19  -8.769 -11.859   2.415
  203    H1*    U  19           H1*        U  19  -6.956 -10.561   2.592
  204    H3     U  19           H3         U  19  -4.925 -10.731  -1.503
  205    H5     U  19           H5         U  19  -1.944 -11.959   1.283
  206    H6     U  19           H6         U  19  -3.670 -11.981   2.986
  207   1H5*    C  20          2H5*        C  20 -10.073 -15.108   3.520
  208   2H5*    C  20          1H5*        C  20 -10.232 -16.695   2.741
  209    H4*    C  20           H4*        C  20 -11.459 -14.586   1.731
  210    H3*    C  20           H3*        C  20  -9.995 -16.816   0.292
  211    H2*    C  20           H2*        C  20 -10.385 -15.772  -1.795
  212   2HO*    C  20          2HO*        C  20 -11.944 -13.663  -0.917
  213    H1*    C  20           H1*        C  20  -9.948 -13.172  -1.034
  214   1H4     C  20          H41         C  20  -4.620 -15.558  -3.638
  215   2H4     C  20          H42         C  20  -4.065 -16.021  -2.045
  216    H5     C  20           H5         C  20  -5.421 -15.814  -0.062
  217    H6     C  20           H6         C  20  -7.603 -15.117   0.818
  218   1H5*    C  21          2H5*        C  21 -12.809 -15.752  -2.534
  219   2H5*    C  21          1H5*        C  21 -13.947 -17.113  -2.545
  220    H4*    C  21           H4*        C  21 -13.328 -16.606  -4.838
  221    H3*    C  21           H3*        C  21 -12.110 -19.107  -3.641
  222    H2*    C  21           H2*        C  21 -10.961 -19.542  -5.590
  223   2HO*    C  21          2HO*        C  21 -13.179 -18.268  -6.774
  224    H1*    C  21           H1*        C  21 -10.869 -16.814  -6.545
  225   1H4     C  21          H41         C  21  -4.804 -18.518  -5.726
  226   2H4     C  21          H42         C  21  -5.055 -18.751  -4.011
  227    H5     C  21           H5         C  21  -7.202 -18.512  -2.945
  228    H6     C  21           H6         C  21  -9.575 -17.994  -3.295
  229    H3T    C  21           H3T        C  21 -14.236 -18.492  -5.447
  Start of MODEL   13
    1   1H5*    G   1          2H5*        G   1   0.875 -16.221 -11.712
    2   2H5*    G   1          1H5*        G   1   0.956 -14.608 -12.450
    3    H4*    G   1           H4*        G   1  -0.417 -15.686 -13.970
    4    H3*    G   1           H3*        G   1  -1.713 -13.826 -12.414
    5    H2*    G   1           H2*        G   1  -2.786 -15.249 -10.876
    6   2HO*    G   1          2HO*        G   1  -4.743 -16.119 -12.451
    7    H1*    G   1           H1*        G   1  -3.310 -17.448 -12.827
    8    H8     G   1           H8         G   1  -0.786 -18.742 -10.739
    9    H1     G   1           H1         G   1  -6.059 -18.128  -7.209
   10   1H2     G   1          H21         G   1  -7.509 -16.800  -8.235
   11   2H2     G   1          H22         G   1  -7.178 -16.066  -9.788
   12    H5T    G   1           H5T        G   1  -0.420 -13.834 -10.961
   13   1H5*    G   2          2H5*        G   2  -5.926 -14.945 -13.888
   14   2H5*    G   2          1H5*        G   2  -6.081 -13.550 -14.974
   15    H4*    G   2           H4*        G   2  -7.952 -13.155 -13.727
   16    H3*    G   2           H3*        G   2  -5.614 -11.953 -12.241
   17    H2*    G   2           H2*        G   2  -6.859 -11.596 -10.298
   18   2HO*    G   2          2HO*        G   2  -9.232 -11.599 -10.425
   19    H1*    G   2           H1*        G   2  -8.672 -13.719 -10.475
   20    H8     G   2           H8         G   2  -4.942 -14.553 -10.790
   21    H1     G   2           H1         G   2  -7.090 -14.407  -4.789
   22   1H2     G   2          H21         G   2  -9.167 -13.633  -4.747
   23   2H2     G   2          H22         G   2 -10.022 -13.152  -6.196
   24   1H5*    A   3          2H5*        A   3  -9.057  -9.855 -11.496
   25   2H5*    A   3          1H5*        A   3  -8.939  -8.112 -11.757
   26    H4*    A   3           H4*        A   3  -9.878  -8.638  -9.552
   27    H3*    A   3           H3*        A   3  -7.232  -7.201  -9.855
   28    H2*    A   3           H2*        A   3  -6.844  -7.329  -7.581
   29   2HO*    A   3          2HO*        A   3  -8.301  -6.224  -6.529
   30    H1*    A   3           H1*        A   3  -8.924  -9.331  -7.047
   31    H8     A   3           H8         A   3  -5.519 -10.034  -8.625
   32   1H6     A   3          H61         A   3  -3.484 -11.347  -2.971
   33   2H6     A   3          H62         A   3  -3.076 -11.314  -4.671
   34    H2     A   3           H2         A   3  -7.710  -9.869  -2.615
   35   1H5*    U   4          2H5*        U   4 -10.458  -5.739  -7.005
   36   2H5*    U   4          1H5*        U   4 -10.635  -3.993  -7.273
   37    H4*    U   4           H4*        U   4 -10.870  -4.419  -4.910
   38    H3*    U   4           H3*        U   4  -8.302  -3.088  -5.810
   39    H2*    U   4           H2*        U   4  -7.452  -3.088  -3.623
   40   2HO*    U   4          2HO*        U   4 -10.087  -3.622  -2.651
   41    H1*    U   4           H1*        U   4  -8.603  -5.457  -2.692
   42    H3     U   4           H3         U   4  -4.287  -6.483  -2.229
   43    H5     U   4           H5         U   4  -4.643  -5.758  -6.405
   44    H6     U   4           H6         U   4  -6.963  -5.135  -6.012
   45   1H5*    G   5          2H5*        G   5 -11.276  -0.665  -2.318
   46   2H5*    G   5          1H5*        G   5 -10.375   0.864  -2.299
   47    H4*    G   5           H4*        G   5 -10.952  -0.361  -0.034
   48    H3*    G   5           H3*        G   5  -8.488   1.128  -0.889
   49    H2*    G   5           H2*        G   5  -7.201   0.400   0.948
   50   2HO*    G   5          2HO*        G   5  -8.511  -0.882   2.650
   51    H1*    G   5           H1*        G   5  -8.016  -2.180   1.113
   52    H8     G   5           H8         G   5  -7.832  -1.025  -2.502
   53    H1     G   5           H1         G   5  -2.175  -2.740  -0.117
   54   1H2     G   5          H21         G   5  -2.344  -3.093   2.066
   55   2H2     G   5          H22         G   5  -3.852  -2.906   2.933
   56   1H5*    C   6          2H5*        C   6  -8.096   0.990   3.517
   57   2H5*    C   6          1H5*        C   6  -8.096   2.722   3.874
   58    H4*    C   6           H4*        C   6  -6.069   1.317   4.633
   59    H3*    C   6           H3*        C   6  -6.062   3.992   3.199
   60    H2*    C   6           H2*        C   6  -3.752   3.875   2.948
   61   2HO*    C   6          2HO*        C   6  -3.145   4.009   5.042
   62    H1*    C   6           H1*        C   6  -3.572   1.019   3.589
   63   1H4     C   6          H41         C   6  -0.144   1.898  -1.720
   64   2H4     C   6          H42         C   6  -1.575   2.407  -2.589
   65    H5     C   6           H5         C   6  -3.736   2.640  -1.552
   66    H6     C   6           H6         C   6  -4.998   2.432   0.544
   67   1H5*    C   7          2H5*        C   7  -3.697   4.496   7.400
   68   2H5*    C   7          1H5*        C   7  -3.471   6.255   7.477
   69    H4*    C   7           H4*        C   7  -1.379   4.626   7.371
   70    H3*    C   7           H3*        C   7  -1.751   7.243   5.852
   71    H2*    C   7           H2*        C   7   0.414   6.953   4.972
   72   2HO*    C   7          2HO*        C   7   0.880   5.012   7.022
   73    H1*    C   7           H1*        C   7   0.360   4.123   4.890
   74   1H4     C   7          H41         C   7   0.281   6.278  -1.085
   75   2H4     C   7          H42         C   7  -1.446   6.540  -0.977
   76    H5     C   7           H5         C   7  -2.698   6.258   1.067
   77    H6     C   7           H6         C   7  -2.551   5.665   3.442
   78   1H5*    U   8          2H5*        U   8   1.566   8.212   9.345
   79   2H5*    U   8          1H5*        U   8   1.618   9.984   9.274
   80    H4*    U   8           H4*        U   8   3.800   8.561   8.828
   81    H3*    U   8           H3*        U   8   2.811  11.053   7.413
   82    H2*    U   8           H2*        U   8   4.599  10.947   5.872
   83   2HO*    U   8          2HO*        U   8   6.511  10.169   6.422
   84    H1*    U   8           H1*        U   8   4.677   8.230   5.495
   85    H3     U   8           H3         U   8   3.230  10.032   1.602
   86    H5     U   8           H5         U   8  -0.120  10.288   4.144
   87    H6     U   8           H6         U   8   1.286   9.499   5.961
   88   1H5*    C   9          2H5*        C   9   7.125  12.351   8.119
   89   2H5*    C   9          1H5*        C   9   6.871  14.082   8.424
   90    H4*    C   9           H4*        C   9   8.199  13.299   6.284
   91    H3*    C   9           H3*        C   9   6.364  15.561   6.795
   92    H2*    C   9           H2*        C   9   5.470  15.738   4.689
   93   2HO*    C   9          2HO*        C   9   8.174  15.772   4.173
   94    H1*    C   9           H1*        C   9   6.676  13.411   3.404
   95   1H4     C   9          H41         C   9   0.484  13.407   1.908
   96   2H4     C   9          H42         C   9   0.055  13.080   3.572
   97    H5     C   9           H5         C   9   1.676  12.975   5.358
   98    H6     C   9           H6         C   9   4.045  13.155   5.925
   99   1H5*    C  10          2H5*        C  10   6.893  18.972   5.660
  100   2H5*    C  10          1H5*        C  10   7.190  17.542   4.650
  101    H4*    C  10           H4*        C  10   7.878  20.406   4.167
  102    H3*    C  10           H3*        C  10   6.301  18.522   2.837
  103    H2*    C  10           H2*        C  10   8.050  17.066   2.165
  104   2HO*    C  10          2HO*        C  10   7.490  17.471   0.144
  105    H1*    C  10           H1*        C  10   9.918  19.349   1.562
  106   1H4     C  10          H41         C  10  13.899  14.404   1.470
  107   2H4     C  10          H42         C  10  13.271  13.806   2.989
  108    H5     C  10           H5         C  10  11.448  14.847   4.167
  109    H6     C  10           H6         C  10   9.824  16.691   4.139
  110   1H5*    C  11          2H5*        C  11   7.351  19.718  -0.208
  111   2H5*    C  11          1H5*        C  11   6.936  21.090  -1.254
  112    H4*    C  11           H4*        C  11   7.125  18.974  -2.536
  113    H3*    C  11           H3*        C  11   5.134  20.860  -2.845
  114    H2*    C  11           H2*        C  11   3.454  19.775  -1.560
  115   2HO*    C  11          2HO*        C  11   3.271  19.423  -4.204
  116    H1*    C  11           H1*        C  11   4.233  17.056  -2.602
  117   1H4     C  11          H41         C  11   0.367  15.597   2.230
  118   2H4     C  11          H42         C  11   1.340  16.536   3.340
  119    H5     C  11           H5         C  11   3.244  17.838   2.650
  120    H6     C  11           H6         C  11   4.624  18.526   0.748
  121   1H5*    G  12          2H5*        G  12   6.330  17.124  -5.148
  122   2H5*    G  12          1H5*        G  12   7.138  17.058  -3.570
  123    H4*    G  12           H4*        G  12   8.465  16.461  -6.241
  124    H3*    G  12           H3*        G  12   7.010  14.765  -4.242
  125    H2*    G  12           H2*        G  12   8.723  13.215  -3.994
  126   2HO*    G  12          2HO*        G  12  10.237  12.826  -5.672
  127    H1*    G  12           H1*        G  12  10.970  14.826  -4.602
  128    H8     G  12           H8         G  12  12.205  14.936  -2.350
  129    H1     G  12           H1         G  12   6.894  14.062   1.061
  130   1H2     G  12          H21         G  12   5.123  14.088  -0.265
  131   2H2     G  12          H22         G  12   5.245  14.320  -1.995
  132   1H5*    A  13          2H5*        A  13   8.374  12.584  -6.818
  133   2H5*    A  13          1H5*        A  13   7.729  11.070  -7.485
  134    H4*    A  13           H4*        A  13   9.644  10.789  -5.846
  135    H3*    A  13           H3*        A  13   6.949   9.467  -5.625
  136    H2*    A  13           H2*        A  13   7.420   8.561  -3.496
  137   2HO*    A  13          2HO*        A  13  10.149   9.171  -4.091
  138    H1*    A  13           H1*        A  13   8.735  10.661  -2.379
  139    H8     A  13           H8         A  13   5.831  11.699  -4.626
  140   1H6     A  13          H61         A  13   2.193  10.986   0.295
  141   2H6     A  13          H62         A  13   2.264  11.534  -1.365
  142    H2     A  13           H2         A  13   6.303   9.526   1.371
  143   1H5*    G  14          2H5*        G  14  10.414   6.807  -4.843
  144   2H5*    G  14          1H5*        G  14  10.057   5.070  -4.911
  145    H4*    G  14           H4*        G  14  10.778   6.198  -2.632
  146    H3*    G  14           H3*        G  14   8.773   4.016  -3.207
  147    H2*    G  14           H2*        G  14   7.760   4.139  -1.117
  148   2HO*    G  14          2HO*        G  14  10.280   5.159  -0.276
  149    H1*    G  14           H1*        G  14   8.222   6.819  -0.428
  150    H8     G  14           H8         G  14   6.565   6.570  -3.812
  151    H1     G  14           H1         G  14   2.444   5.765   0.965
  152   1H2     G  14          H21         G  14   3.531   5.498   2.882
  153   2H2     G  14          H22         G  14   5.277   5.521   2.982
  154   1H5*    U  15          2H5*        U  15  12.587   3.275  -0.894
  155   2H5*    U  15          1H5*        U  15  13.682   1.887  -1.063
  156    H4*    U  15           H4*        U  15  12.188   0.441   0.085
  157    H3*    U  15           H3*        U  15  10.142   2.488  -0.695
  158    H2*    U  15           H2*        U  15   9.230   2.630   1.413
  159   2HO*    U  15          2HO*        U  15   8.730   0.732   2.566
  160    H1*    U  15           H1*        U  15  11.227   1.005   2.825
  161    H3     U  15           H3         U  15   9.390   4.083   5.742
  162    H5     U  15           H5         U  15  12.162   6.186   3.357
  163    H6     U  15           H6         U  15  12.343   4.206   1.951
  164   1H5*    G  16          2H5*        G  16  10.076  -1.942  -1.049
  165   2H5*    G  16          1H5*        G  16   8.969  -3.063  -1.868
  166    H4*    G  16           H4*        G  16   8.736  -2.428   0.754
  167    H3*    G  16           H3*        G  16   6.653  -3.105  -1.418
  168    H2*    G  16           H2*        G  16   4.875  -2.579   0.017
  169   2HO*    G  16          2HO*        G  16   5.703  -2.225   2.430
  170    H1*    G  16           H1*        G  16   6.088  -0.526   1.526
  171    H8     G  16           H8         G  16   6.462   0.090  -2.185
  172    H1     G  16           H1         G  16   0.625   1.492  -0.002
  173   1H2     G  16          H21         G  16   0.394   0.755   2.073
  174   2H2     G  16          H22         G  16   1.675  -0.078   2.923
  175   1H5*    C  17          2H5*        C  17   5.990  -4.376   2.933
  176   2H5*    C  17          1H5*        C  17   5.923  -6.143   2.782
  177    H4*    C  17           H4*        C  17   4.363  -5.380   4.509
  178    H3*    C  17           H3*        C  17   3.249  -6.549   1.945
  179    H2*    C  17           H2*        C  17   1.041  -6.222   2.685
  180   2HO*    C  17          2HO*        C  17   0.542  -6.489   4.733
  181    H1*    C  17           H1*        C  17   1.411  -3.788   4.033
  182   1H4     C  17          H41         C  17  -1.261  -2.465  -1.598
  183   2H4     C  17          H42         C  17   0.281  -2.653  -2.397
  184    H5     C  17           H5         C  17   2.268  -3.373  -1.267
  185    H6     C  17           H6         C  17   3.229  -4.077   0.877
  186   1H5*    A  18          2H5*        A  18   1.570  -8.601   5.929
  187   2H5*    A  18          1H5*        A  18   1.189 -10.251   5.394
  188    H4*    A  18           H4*        A  18  -0.666  -8.941   6.613
  189    H3*    A  18           H3*        A  18  -0.895 -10.498   4.050
  190    H2*    A  18           H2*        A  18  -3.092  -9.748   3.626
  191   2HO*    A  18          2HO*        A  18  -3.540 -10.038   6.053
  192    H1*    A  18           H1*        A  18  -2.840  -7.147   4.341
  193    H8     A  18           H8         A  18   0.369  -8.377   2.744
  194   1H6     A  18          H61         A  18  -2.215  -7.120  -2.717
  195   2H6     A  18          H62         A  18  -0.735  -7.581  -1.906
  196    H2     A  18           H2         A  18  -5.365  -6.691   0.455
  197   1H5*    U  19          2H5*        U  19  -4.674 -12.141   6.429
  198   2H5*    U  19          1H5*        U  19  -4.707 -13.763   5.705
  199    H4*    U  19           H4*        U  19  -6.736 -12.112   5.347
  200    H3*    U  19           H3*        U  19  -5.400 -13.943   3.333
  201    H2*    U  19           H2*        U  19  -6.831 -13.175   1.631
  202   2HO*    U  19          2HO*        U  19  -8.710 -13.345   3.155
  203    H1*    U  19           H1*        U  19  -6.968 -10.485   2.418
  204    H3     U  19           H3         U  19  -4.957 -10.670  -1.671
  205    H5     U  19           H5         U  19  -1.939 -11.848   1.092
  206    H6     U  19           H6         U  19  -3.645 -11.858   2.817
  207   1H5*    C  20          2H5*        C  20  -9.915 -15.047   3.774
  208   2H5*    C  20          1H5*        C  20 -10.179 -16.625   3.006
  209    H4*    C  20           H4*        C  20 -11.372 -14.469   2.061
  210    H3*    C  20           H3*        C  20 -10.066 -16.746   0.541
  211    H2*    C  20           H2*        C  20 -10.534 -15.682  -1.517
  212   2HO*    C  20          2HO*        C  20 -12.444 -14.266   0.030
  213    H1*    C  20           H1*        C  20 -10.010 -13.087  -0.761
  214   1H4     C  20          H41         C  20  -4.903 -15.438  -3.781
  215   2H4     C  20          H42         C  20  -4.255 -15.978  -2.248
  216    H5     C  20           H5         C  20  -5.478 -15.837  -0.175
  217    H6     C  20           H6         C  20  -7.587 -15.149   0.872
  218   1H5*    C  21          2H5*        C  21 -12.951 -15.130  -1.908
  219   2H5*    C  21          1H5*        C  21 -14.150 -16.400  -2.224
  220    H4*    C  21           H4*        C  21 -13.288 -15.305  -4.308
  221    H3*    C  21           H3*        C  21 -12.798 -18.249  -3.789
  222    H2*    C  21           H2*        C  21 -11.682 -18.454  -5.800
  223   2HO*    C  21          2HO*        C  21 -12.701 -17.713  -7.487
  224    H1*    C  21           H1*        C  21 -10.852 -15.691  -5.997
  225   1H4     C  21          H41         C  21  -5.474 -19.061  -5.700
  226   2H4     C  21          H42         C  21  -5.874 -19.641  -4.099
  227    H5     C  21           H5         C  21  -7.947 -19.125  -2.987
  228    H6     C  21           H6         C  21 -10.086 -17.942  -3.168
  229    H3T    C  21           H3T        C  21 -14.615 -18.432  -5.015
  Start of MODEL   14
    1   1H5*    G   1          2H5*        G   1   1.228 -17.539 -13.884
    2   2H5*    G   1          1H5*        G   1   1.352 -15.953 -14.672
    3    H4*    G   1           H4*        G   1  -0.815 -16.413 -15.251
    4    H3*    G   1           H3*        G   1  -0.889 -15.238 -12.464
    5    H2*    G   1           H2*        G   1  -3.202 -15.685 -12.284
    6   2HO*    G   1          2HO*        G   1  -3.749 -16.684 -14.756
    7    H1*    G   1           H1*        G   1  -3.250 -18.138 -13.472
    8    H8     G   1           H8         G   1  -0.289 -18.620 -11.438
    9    H1     G   1           H1         G   1  -5.374 -17.803  -7.678
   10   1H2     G   1          H21         G   1  -7.064 -16.973  -8.854
   11   2H2     G   1          H22         G   1  -6.937 -16.623 -10.563
   12    H5T    G   1           H5T        G   1   0.923 -16.562 -11.945
   13   1H5*    G   2          2H5*        G   2  -4.645 -14.669 -13.985
   14   2H5*    G   2          1H5*        G   2  -4.600 -12.998 -14.580
   15    H4*    G   2           H4*        G   2  -6.734 -13.220 -13.584
   16    H3*    G   2           H3*        G   2  -4.689 -11.796 -11.886
   17    H2*    G   2           H2*        G   2  -6.059 -11.757  -9.999
   18   2HO*    G   2          2HO*        G   2  -8.408 -12.381 -11.438
   19    H1*    G   2           H1*        G   2  -7.597 -14.064 -10.442
   20    H8     G   2           H8         G   2  -3.858 -14.692 -10.517
   21    H1     G   2           H1         G   2  -6.260 -14.464  -4.618
   22   1H2     G   2          H21         G   2  -8.352 -13.728  -4.680
   23   2H2     G   2          H22         G   2  -9.152 -13.296  -6.173
   24   1H5*    A   3          2H5*        A   3  -7.926 -10.087 -11.187
   25   2H5*    A   3          1H5*        A   3  -8.235  -8.399 -11.616
   26    H4*    A   3           H4*        A   3  -8.882  -8.638  -9.348
   27    H3*    A   3           H3*        A   3  -6.262  -7.229  -9.876
   28    H2*    A   3           H2*        A   3  -5.740  -7.230  -7.623
   29   2HO*    A   3          2HO*        A   3  -8.473  -6.587  -7.444
   30    H1*    A   3           H1*        A   3  -7.864  -9.128  -6.860
   31    H8     A   3           H8         A   3  -4.404  -9.821  -8.393
   32   1H6     A   3          H61         A   3  -2.563 -11.311  -2.719
   33   2H6     A   3          H62         A   3  -2.100 -11.227  -4.403
   34    H2     A   3           H2         A   3  -6.800  -9.836  -2.457
   35   1H5*    U   4          2H5*        U   4  -9.994  -4.964  -7.623
   36   2H5*    U   4          1H5*        U   4  -9.537  -3.254  -7.499
   37    H4*    U   4           H4*        U   4 -10.490  -4.416  -5.392
   38    H3*    U   4           H3*        U   4  -8.019  -2.682  -5.578
   39    H2*    U   4           H2*        U   4  -7.455  -3.078  -3.344
   40   2HO*    U   4          2HO*        U   4  -9.014  -2.904  -1.938
   41    H1*    U   4           H1*        U   4  -8.447  -5.674  -3.057
   42    H3     U   4           H3         U   4  -4.088  -6.052  -2.020
   43    H5     U   4           H5         U   4  -4.073  -5.244  -6.200
   44    H6     U   4           H6         U   4  -6.476  -4.900  -6.056
   45   1H5*    G   5          2H5*        G   5 -11.408  -1.855  -1.882
   46   2H5*    G   5          1H5*        G   5 -11.248  -0.089  -1.961
   47    H4*    G   5           H4*        G   5 -11.328  -1.018   0.381
   48    H3*    G   5           H3*        G   5  -9.126   0.713  -0.708
   49    H2*    G   5           H2*        G   5  -7.738   0.422   1.176
   50   2HO*    G   5          2HO*        G   5 -10.156  -0.392   2.440
   51    H1*    G   5           H1*        G   5  -8.136  -2.214   1.659
   52    H8     G   5           H8         G   5  -8.146  -1.263  -2.047
   53    H1     G   5           H1         G   5  -2.339  -2.437   0.299
   54   1H2     G   5          H21         G   5  -2.451  -2.721   2.497
   55   2H2     G   5          H22         G   5  -3.957  -2.620   3.381
   56   1H5*    C   6          2H5*        C   6  -8.761   1.046   3.552
   57   2H5*    C   6          1H5*        C   6  -8.904   2.782   3.854
   58    H4*    C   6           H4*        C   6  -6.756   1.564   4.622
   59    H3*    C   6           H3*        C   6  -7.024   4.213   3.177
   60    H2*    C   6           H2*        C   6  -4.751   4.281   2.763
   61   2HO*    C   6          2HO*        C   6  -4.027   4.592   4.793
   62    H1*    C   6           H1*        C   6  -4.252   1.489   3.547
   63   1H4     C   6          H41         C   6  -1.045   2.344  -1.898
   64   2H4     C   6          H42         C   6  -2.526   2.741  -2.740
   65    H5     C   6           H5         C   6  -4.668   2.895  -1.644
   66    H6     C   6           H6         C   6  -5.853   2.698   0.495
   67   1H5*    C   7          2H5*        C   7  -4.960   5.198   7.487
   68   2H5*    C   7          1H5*        C   7  -4.874   6.971   7.462
   69    H4*    C   7           H4*        C   7  -2.658   5.516   7.483
   70    H3*    C   7           H3*        C   7  -3.242   8.008   5.838
   71    H2*    C   7           H2*        C   7  -1.076   7.867   4.931
   72   2HO*    C   7          2HO*        C   7  -0.276   5.855   6.755
   73    H1*    C   7           H1*        C   7  -0.897   5.079   4.825
   74   1H4     C   7          H41         C   7  -1.796   7.136  -1.116
   75   2H4     C   7          H42         C   7  -3.453   7.573  -0.761
   76    H5     C   7           H5         C   7  -4.425   7.381   1.442
   77    H6     C   7           H6         C   7  -4.010   6.734   3.771
   78   1H5*    U   8          2H5*        U   8   0.637   7.629   8.434
   79   2H5*    U   8          1H5*        U   8   1.303   9.254   8.687
   80    H4*    U   8           H4*        U   8   2.807   7.339   7.669
   81    H3*    U   8           H3*        U   8   2.642  10.257   6.832
   82    H2*    U   8           H2*        U   8   4.245   9.855   5.130
   83   2HO*    U   8          2HO*        U   8   4.706   7.200   6.005
   84    H1*    U   8           H1*        U   8   3.304   7.432   4.269
   85    H3     U   8           H3         U   8   2.608  10.635   1.089
   86    H5     U   8           H5         U   8  -0.598  11.083   3.786
   87    H6     U   8           H6         U   8   0.494   9.474   5.245
   88   1H5*    C   9          2H5*        C   9   7.195   9.844   6.929
   89   2H5*    C   9          1H5*        C   9   7.570  11.442   7.607
   90    H4*    C   9           H4*        C   9   8.339  10.821   5.156
   91    H3*    C   9           H3*        C   9   7.394  13.370   6.372
   92    H2*    C   9           H2*        C   9   6.622  14.336   4.429
   93   2HO*    C   9          2HO*        C   9   7.896  14.381   2.621
   94    H1*    C   9           H1*        C   9   6.697  12.054   2.637
   95   1H4     C   9          H41         C   9   0.867  14.598   2.259
   96   2H4     C   9          H42         C   9   0.464  13.937   3.828
   97    H5     C   9           H5         C   9   2.058  12.784   5.227
   98    H6     C   9           H6         C   9   4.371  12.021   5.416
   99   1H5*    C  10          2H5*        C  10   8.877  16.353   5.892
  100   2H5*    C  10          1H5*        C  10   9.062  15.064   4.684
  101    H4*    C  10           H4*        C  10  10.630  17.637   4.987
  102    H3*    C  10           H3*        C  10   8.544  16.882   3.260
  103    H2*    C  10           H2*        C  10   9.698  15.210   2.056
  104   2HO*    C  10          2HO*        C  10   9.301  16.802   0.498
  105    H1*    C  10           H1*        C  10  12.309  16.704   2.138
  106   1H4     C  10          H41         C  10  14.238  10.943   0.311
  107   2H4     C  10          H42         C  10  13.268  10.166   1.542
  108    H5     C  10           H5         C  10  11.821  11.373   3.041
  109    H6     C  10           H6         C  10  10.989  13.597   3.684
  110   1H5*    C  11          2H5*        C  11   9.886  18.841   0.645
  111   2H5*    C  11          1H5*        C  11   9.683  20.540   0.173
  112    H4*    C  11           H4*        C  11   9.124  18.833  -1.626
  113    H3*    C  11           H3*        C  11   7.915  21.282  -1.152
  114    H2*    C  11           H2*        C  11   6.028  20.492   0.050
  115   2HO*    C  11          2HO*        C  11   5.522  20.388  -2.730
  116    H1*    C  11           H1*        C  11   5.756  18.045  -1.689
  117   1H4     C  11          H41         C  11   1.901  16.749   3.192
  118   2H4     C  11          H42         C  11   3.233  16.883   4.318
  119    H5     C  11           H5         C  11   5.451  17.557   3.665
  120    H6     C  11           H6         C  11   6.873  18.242   1.789
  121   1H5*    G  12          2H5*        G  12   7.605  18.176  -4.536
  122   2H5*    G  12          1H5*        G  12   8.341  17.431  -3.104
  123    H4*    G  12           H4*        G  12   9.358  17.139  -5.956
  124    H3*    G  12           H3*        G  12   7.442  15.555  -4.273
  125    H2*    G  12           H2*        G  12   8.523  13.524  -4.590
  126   2HO*    G  12          2HO*        G  12  10.197  14.098  -6.679
  127    H1*    G  12           H1*        G  12  11.176  14.419  -5.027
  128    H8     G  12           H8         G  12  12.423  13.542  -2.958
  129    H1     G  12           H1         G  12   7.196  13.508   0.687
  130   1H2     G  12          H21         G  12   5.506  14.435  -0.388
  131   2H2     G  12          H22         G  12   5.654  15.071  -2.012
  132   1H5*    A  13          2H5*        A  13   6.463  11.829  -8.437
  133   2H5*    A  13          1H5*        A  13   5.423  12.244  -7.058
  134    H4*    A  13           H4*        A  13   8.020  10.693  -7.079
  135    H3*    A  13           H3*        A  13   5.152  10.220  -6.268
  136    H2*    A  13           H2*        A  13   5.791   9.004  -4.347
  137   2HO*    A  13          2HO*        A  13   8.242   8.769  -5.737
  138    H1*    A  13           H1*        A  13   7.838  10.569  -3.497
  139    H8     A  13           H8         A  13   5.494  13.111  -4.745
  140   1H6     A  13          H61         A  13   1.928  12.188   0.191
  141   2H6     A  13          H62         A  13   2.242  13.232  -1.178
  142    H2     A  13           H2         A  13   4.926   8.846   0.001
  143   1H5*    G  14          2H5*        G  14   7.630   7.201  -6.347
  144   2H5*    G  14          1H5*        G  14   7.425   5.443  -6.478
  145    H4*    G  14           H4*        G  14   8.091   6.551  -4.176
  146    H3*    G  14           H3*        G  14   6.923   4.082  -4.850
  147    H2*    G  14           H2*        G  14   4.715   4.519  -4.195
  148   2HO*    G  14          2HO*        G  14   5.604   4.497  -1.528
  149    H1*    G  14           H1*        G  14   5.466   6.433  -2.014
  150    H8     G  14           H8         G  14   3.745   7.185  -5.362
  151    H1     G  14           H1         G  14  -0.211   6.852  -0.377
  152   1H2     G  14          H21         G  14   0.891   6.165   1.410
  153   2H2     G  14          H22         G  14   2.597   5.785   1.381
  154   1H5*    U  15          2H5*        U  15   9.466   5.022  -0.977
  155   2H5*    U  15          1H5*        U  15  10.897   4.135  -1.543
  156    H4*    U  15           H4*        U  15  11.406   4.029   0.669
  157    H3*    U  15           H3*        U  15   9.256   1.924   0.366
  158    H2*    U  15           H2*        U  15   9.561   1.445   2.690
  159   2HO*    U  15          2HO*        U  15  11.990   2.670   2.223
  160    H1*    U  15           H1*        U  15   9.511   4.049   3.472
  161    H3     U  15           H3         U  15   5.430   2.709   4.759
  162    H5     U  15           H5         U  15   5.130   2.853   0.558
  163    H6     U  15           H6         U  15   7.507   3.307   0.466
  164   1H5*    G  16          2H5*        G  16   9.318  -1.650  -0.963
  165   2H5*    G  16          1H5*        G  16   8.101  -0.727  -1.864
  166    H4*    G  16           H4*        G  16   8.333  -1.029   1.173
  167    H3*    G  16           H3*        G  16   6.437  -2.088  -1.027
  168    H2*    G  16           H2*        G  16   4.573  -1.799   0.363
  169   2HO*    G  16          2HO*        G  16   4.922  -1.455   2.711
  170    H1*    G  16           H1*        G  16   5.423   0.475   1.811
  171    H8     G  16           H8         G  16   5.699   0.774  -1.988
  172    H1     G  16           H1         G  16  -0.146   1.983   0.275
  173   1H2     G  16          H21         G  16  -0.251   1.455   2.424
  174   2H2     G  16          H22         G  16   1.118   0.810   3.302
  175   1H5*    C  17          2H5*        C  17   5.932  -3.336   3.319
  176   2H5*    C  17          1H5*        C  17   6.062  -5.105   3.254
  177    H4*    C  17           H4*        C  17   4.403  -4.471   4.923
  178    H3*    C  17           H3*        C  17   3.420  -5.784   2.371
  179    H2*    C  17           H2*        C  17   1.191  -5.671   3.120
  180   2HO*    C  17          2HO*        C  17   0.650  -5.450   5.281
  181    H1*    C  17           H1*        C  17   1.325  -3.179   4.404
  182   1H4     C  17          H41         C  17  -1.485  -2.265  -1.233
  183   2H4     C  17          H42         C  17   0.050  -2.407  -2.057
  184    H5     C  17           H5         C  17   2.097  -2.952  -0.933
  185    H6     C  17           H6         C  17   3.138  -3.476   1.225
  186   1H5*    A  18          2H5*        A  18   1.772  -8.164   6.360
  187   2H5*    A  18          1H5*        A  18   1.712  -9.782   5.635
  188    H4*    A  18           H4*        A  18  -0.413  -8.925   6.819
  189    H3*    A  18           H3*        A  18  -0.219 -10.213   4.105
  190    H2*    A  18           H2*        A  18  -2.498  -9.813   3.621
  191   2HO*    A  18          2HO*        A  18  -3.650 -10.361   5.361
  192    H1*    A  18           H1*        A  18  -2.742  -7.302   4.620
  193    H8     A  18           H8         A  18   0.674  -7.827   3.061
  194   1H6     A  18          H61         A  18  -1.886  -6.323  -2.340
  195   2H6     A  18          H62         A  18  -0.382  -6.653  -1.507
  196    H2     A  18           H2         A  18  -5.175  -6.762   0.699
  197   1H5*    U  19          2H5*        U  19  -3.372 -12.524   6.530
  198   2H5*    U  19          1H5*        U  19  -3.551 -14.138   5.811
  199    H4*    U  19           H4*        U  19  -5.598 -12.544   5.748
  200    H3*    U  19           H3*        U  19  -4.465 -14.158   3.452
  201    H2*    U  19           H2*        U  19  -6.043 -13.261   1.951
  202   2HO*    U  19          2HO*        U  19  -7.999 -12.627   2.582
  203    H1*    U  19           H1*        U  19  -6.050 -10.639   2.888
  204    H3     U  19           H3         U  19  -4.154 -10.684  -1.270
  205    H5     U  19           H5         U  19  -1.093 -12.065   1.351
  206    H6     U  19           H6         U  19  -2.746 -12.094   3.125
  207   1H5*    C  20          2H5*        C  20  -8.981 -15.180   3.802
  208   2H5*    C  20          1H5*        C  20  -9.153 -16.782   3.056
  209    H4*    C  20           H4*        C  20 -10.419 -14.700   2.041
  210    H3*    C  20           H3*        C  20  -8.982 -16.951   0.612
  211    H2*    C  20           H2*        C  20  -9.400 -15.951  -1.487
  212   2HO*    C  20          2HO*        C  20 -10.882 -13.925  -1.330
  213    H1*    C  20           H1*        C  20  -9.020 -13.317  -0.780
  214   1H4     C  20          H41         C  20  -3.684 -15.523  -3.510
  215   2H4     C  20          H42         C  20  -3.072 -15.956  -1.930
  216    H5     C  20           H5         C  20  -4.386 -15.793   0.085
  217    H6     C  20           H6         C  20  -6.569 -15.180   1.017
  218   1H5*    C  21          2H5*        C  21 -11.814 -15.666  -1.970
  219   2H5*    C  21          1H5*        C  21 -13.016 -16.960  -2.151
  220    H4*    C  21           H4*        C  21 -12.354 -16.166  -4.362
  221    H3*    C  21           H3*        C  21 -11.306 -18.886  -3.528
  222    H2*    C  21           H2*        C  21 -10.233 -19.129  -5.558
  223   2HO*    C  21          2HO*        C  21 -12.124 -17.239  -6.575
  224    H1*    C  21           H1*        C  21  -9.897 -16.313  -6.092
  225   1H4     C  21          H41         C  21  -4.038 -18.730  -5.569
  226   2H4     C  21          H42         C  21  -4.292 -19.077  -3.874
  227    H5     C  21           H5         C  21  -6.389 -18.707  -2.750
  228    H6     C  21           H6         C  21  -8.699 -17.925  -3.008
  229    H3T    C  21           H3T        C  21 -13.137 -19.530  -4.464
  Start of MODEL   15
    1   1H5*    G   1          2H5*        G   1   1.028 -17.222 -13.760
    2   2H5*    G   1          1H5*        G   1   0.882 -15.764 -14.764
    3    H4*    G   1           H4*        G   1  -1.246 -16.558 -15.063
    4    H3*    G   1           H3*        G   1  -1.235 -14.980 -12.484
    5    H2*    G   1           H2*        G   1  -3.418 -15.679 -11.958
    6   2HO*    G   1          2HO*        G   1  -3.739 -16.742 -14.579
    7    H1*    G   1           H1*        G   1  -3.299 -18.261 -12.878
    8    H8     G   1           H8         G   1  -0.144 -17.948 -11.003
    9    H1     G   1           H1         G   1  -5.164 -17.902  -7.071
   10   1H2     G   1          H21         G   1  -7.030 -17.584  -8.230
   11   2H2     G   1          H22         G   1  -7.035 -17.384  -9.967
   12    H5T    G   1           H5T        G   1   1.665 -15.041 -12.881
   13   1H5*    G   2          2H5*        G   2  -5.132 -15.019 -13.615
   14   2H5*    G   2          1H5*        G   2  -5.307 -13.507 -14.528
   15    H4*    G   2           H4*        G   2  -7.315 -13.564 -13.364
   16    H3*    G   2           H3*        G   2  -5.229 -11.967 -11.891
   17    H2*    G   2           H2*        G   2  -6.474 -11.832  -9.931
   18   2HO*    G   2          2HO*        G   2  -8.675 -12.065 -11.700
   19    H1*    G   2           H1*        G   2  -8.017 -14.174 -10.131
   20    H8     G   2           H8         G   2  -4.223 -14.578 -10.328
   21    H1     G   2           H1         G   2  -6.490 -14.477  -4.373
   22   1H2     G   2          H21         G   2  -8.640 -13.920  -4.388
   23   2H2     G   2          H22         G   2  -9.511 -13.576  -5.865
   24   1H5*    A   3          2H5*        A   3  -8.602 -10.425 -11.001
   25   2H5*    A   3          1H5*        A   3  -8.946  -8.751 -11.449
   26    H4*    A   3           H4*        A   3  -9.503  -9.010  -9.139
   27    H3*    A   3           H3*        A   3  -7.025  -7.436  -9.848
   28    H2*    A   3           H2*        A   3  -6.344  -7.373  -7.639
   29   2HO*    A   3          2HO*        A   3  -8.890  -7.529  -6.498
   30    H1*    A   3           H1*        A   3  -8.296  -9.371  -6.692
   31    H8     A   3           H8         A   3  -4.904  -9.854  -8.448
   32   1H6     A   3          H61         A   3  -2.631 -11.250  -2.910
   33   2H6     A   3          H62         A   3  -2.278 -11.131  -4.617
   34    H2     A   3           H2         A   3  -6.930 -10.051  -2.380
   35   1H5*    U   4          2H5*        U   4 -10.101  -6.256  -7.160
   36   2H5*    U   4          1H5*        U   4 -10.782  -4.627  -7.344
   37    H4*    U   4           H4*        U   4 -10.867  -5.029  -5.025
   38    H3*    U   4           H3*        U   4  -8.456  -3.380  -5.840
   39    H2*    U   4           H2*        U   4  -7.695  -3.314  -3.619
   40   2HO*    U   4          2HO*        U   4  -9.114  -3.794  -1.854
   41    H1*    U   4           H1*        U   4  -8.544  -5.846  -2.798
   42    H3     U   4           H3         U   4  -4.148  -6.327  -2.221
   43    H5     U   4           H5         U   4  -4.468  -5.463  -6.377
   44    H6     U   4           H6         U   4  -6.860  -5.167  -6.044
   45   1H5*    G   5          2H5*        G   5 -11.640  -1.535  -2.363
   46   2H5*    G   5          1H5*        G   5 -11.104   0.157  -2.363
   47    H4*    G   5           H4*        G   5 -11.333  -1.063  -0.079
   48    H3*    G   5           H3*        G   5  -9.080   0.685  -1.051
   49    H2*    G   5           H2*        G   5  -7.733   0.208   0.828
   50   2HO*    G   5          2HO*        G   5  -9.780  -1.220   2.157
   51    H1*    G   5           H1*        G   5  -8.241  -2.452   1.084
   52    H8     G   5           H8         G   5  -8.086  -1.350  -2.556
   53    H1     G   5           H1         G   5  -2.351  -2.425   0.006
   54   1H2     G   5          H21         G   5  -2.547  -2.780   2.184
   55   2H2     G   5          H22         G   5  -4.090  -2.749   3.007
   56   1H5*    C   6          2H5*        C   6  -8.732   0.732   3.305
   57   2H5*    C   6          1H5*        C   6  -8.922   2.456   3.651
   58    H4*    C   6           H4*        C   6  -6.775   1.277   4.461
   59    H3*    C   6           H3*        C   6  -7.051   3.940   3.043
   60    H2*    C   6           H2*        C   6  -4.771   4.061   2.704
   61   2HO*    C   6          2HO*        C   6  -4.821   3.809   5.279
   62    H1*    C   6           H1*        C   6  -4.237   1.271   3.470
   63   1H4     C   6          H41         C   6  -0.863   2.269  -1.846
   64   2H4     C   6          H42         C   6  -2.326   2.621  -2.740
   65    H5     C   6           H5         C   6  -4.509   2.703  -1.719
   66    H6     C   6           H6         C   6  -5.761   2.460   0.376
   67   1H5*    C   7          2H5*        C   7  -4.929   4.784   7.273
   68   2H5*    C   7          1H5*        C   7  -4.915   6.556   7.372
   69    H4*    C   7           H4*        C   7  -2.642   5.207   7.237
   70    H3*    C   7           H3*        C   7  -3.377   7.764   5.760
   71    H2*    C   7           H2*        C   7  -1.245   7.766   4.780
   72   2HO*    C   7          2HO*        C   7   0.412   6.266   5.725
   73    H1*    C   7           H1*        C   7  -0.900   4.969   4.643
   74   1H4     C   7          H41         C   7  -1.666   7.069  -1.303
   75   2H4     C   7          H42         C   7  -3.354   7.421  -1.006
   76    H5     C   7           H5         C   7  -4.396   7.155   1.156
   77    H6     C   7           H6         C   7  -4.039   6.500   3.493
   78   1H5*    U   8          2H5*        U   8   0.531   7.505   8.341
   79   2H5*    U   8          1H5*        U   8   1.146   9.147   8.609
   80    H4*    U   8           H4*        U   8   2.691   7.302   7.524
   81    H3*    U   8           H3*        U   8   2.413  10.226   6.724
   82    H2*    U   8           H2*        U   8   4.046   9.886   5.031
   83   2HO*    U   8          2HO*        U   8   5.575   8.396   5.203
   84    H1*    U   8           H1*        U   8   3.157   7.447   4.146
   85    H3     U   8           H3         U   8   2.468  10.714   1.025
   86    H5     U   8           H5         U   8  -0.828  10.989   3.629
   87    H6     U   8           H6         U   8   0.274   9.382   5.082
   88   1H5*    C   9          2H5*        C   9   6.938  10.230   7.581
   89   2H5*    C   9          1H5*        C   9   7.144  11.911   8.110
   90    H4*    C   9           H4*        C   9   8.232  11.085   5.849
   91    H3*    C   9           H3*        C   9   7.021  13.681   6.654
   92    H2*    C   9           H2*        C   9   6.420  14.379   4.545
   93   2HO*    C   9          2HO*        C   9   7.916  13.838   2.741
   94    H1*    C   9           H1*        C   9   6.839  11.931   3.038
   95   1H4     C   9          H41         C   9   0.970  14.037   1.715
   96   2H4     C   9          H42         C   9   0.420  13.533   3.297
   97    H5     C   9           H5         C   9   1.892  12.647   4.988
   98    H6     C   9           H6         C   9   4.201  12.050   5.524
   99   1H5*    C  10          2H5*        C  10   8.248  16.481   5.603
  100   2H5*    C  10          1H5*        C  10   9.018  15.083   4.828
  101    H4*    C  10           H4*        C  10  10.283  17.829   5.229
  102    H3*    C  10           H3*        C  10   8.422  17.108   3.255
  103    H2*    C  10           H2*        C  10   9.689  15.400   2.219
  104   2HO*    C  10          2HO*        C  10   9.699  16.589   0.445
  105    H1*    C  10           H1*        C  10  12.288  16.870   2.604
  106   1H4     C  10          H41         C  10  14.317  11.070   1.010
  107   2H4     C  10          H42         C  10  13.264  10.323   2.190
  108    H5     C  10           H5         C  10  11.717  11.563   3.553
  109    H6     C  10           H6         C  10  10.839  13.797   4.079
  110   1H5*    C  11          2H5*        C  11  10.008  18.637   0.820
  111   2H5*    C  11          1H5*        C  11  10.092  20.280   0.153
  112    H4*    C  11           H4*        C  11   9.561  18.592  -1.587
  113    H3*    C  11           H3*        C  11   8.347  21.055  -1.325
  114    H2*    C  11           H2*        C  11   6.395  20.322  -0.178
  115   2HO*    C  11          2HO*        C  11   6.113  20.634  -2.850
  116    H1*    C  11           H1*        C  11   6.190  17.846  -1.888
  117   1H4     C  11          H41         C  11   1.964  16.686   2.716
  118   2H4     C  11          H42         C  11   3.196  16.879   3.943
  119    H5     C  11           H5         C  11   5.460  17.538   3.450
  120    H6     C  11           H6         C  11   7.031  18.155   1.672
  121   1H5*    G  12          2H5*        G  12   8.036  17.858  -4.664
  122   2H5*    G  12          1H5*        G  12   8.785  17.274  -3.165
  123    H4*    G  12           H4*        G  12   9.754  16.623  -5.976
  124    H3*    G  12           H3*        G  12   7.804  15.299  -4.121
  125    H2*    G  12           H2*        G  12   8.839  13.221  -4.163
  126   2HO*    G  12          2HO*        G  12   9.770  14.064  -6.722
  127    H1*    G  12           H1*        G  12  11.510  13.979  -4.726
  128    H8     G  12           H8         G  12  12.812  13.639  -2.484
  129    H1     G  12           H1         G  12   7.427  13.364   0.908
  130   1H2     G  12          H21         G  12   5.705  13.966  -0.348
  131   2H2     G  12          H22         G  12   5.880  14.437  -2.023
  132   1H5*    A  13          2H5*        A  13   7.347  13.128  -7.692
  133   2H5*    A  13          1H5*        A  13   5.881  12.128  -7.724
  134    H4*    A  13           H4*        A  13   8.247  11.189  -6.849
  135    H3*    A  13           H3*        A  13   5.397  10.548  -6.136
  136    H2*    A  13           H2*        A  13   5.988   9.323  -4.216
  137   2HO*    A  13          2HO*        A  13   8.703   9.364  -4.324
  138    H1*    A  13           H1*        A  13   7.943  10.907  -3.224
  139    H8     A  13           H8         A  13   5.584  13.397  -4.583
  140   1H6     A  13          H61         A  13   1.794  12.293   0.145
  141   2H6     A  13          H62         A  13   2.136  13.360  -1.197
  142    H2     A  13           H2         A  13   4.935   9.083   0.100
  143   1H5*    G  14          2H5*        G  14   7.974   7.589  -6.200
  144   2H5*    G  14          1H5*        G  14   7.793   5.835  -6.387
  145    H4*    G  14           H4*        G  14   8.326   6.894  -4.025
  146    H3*    G  14           H3*        G  14   7.196   4.425  -4.832
  147    H2*    G  14           H2*        G  14   4.988   4.784  -4.170
  148   2HO*    G  14          2HO*        G  14   4.699   4.182  -2.017
  149    H1*    G  14           H1*        G  14   5.644   6.712  -1.975
  150    H8     G  14           H8         G  14   3.997   7.453  -5.361
  151    H1     G  14           H1         G  14  -0.097   6.843  -0.513
  152   1H2     G  14          H21         G  14   0.980   6.173   1.299
  153   2H2     G  14          H22         G  14   2.702   5.875   1.317
  154   1H5*    U  15          2H5*        U  15   9.955   5.186  -0.999
  155   2H5*    U  15          1H5*        U  15  11.201   4.069  -1.593
  156    H4*    U  15           H4*        U  15  11.769   4.058   0.630
  157    H3*    U  15           H3*        U  15   9.528   2.049   0.349
  158    H2*    U  15           H2*        U  15   9.796   1.562   2.671
  159   2HO*    U  15          2HO*        U  15  11.792   1.640   3.376
  160    H1*    U  15           H1*        U  15   9.917   4.162   3.465
  161    H3     U  15           H3         U  15   5.799   2.953   4.809
  162    H5     U  15           H5         U  15   5.407   3.370   0.634
  163    H6     U  15           H6         U  15   7.808   3.671   0.502
  164   1H5*    G  16          2H5*        G  16   9.399  -1.576  -0.826
  165   2H5*    G  16          1H5*        G  16   8.238  -0.624  -1.771
  166    H4*    G  16           H4*        G  16   8.484  -0.701   1.281
  167    H3*    G  16           H3*        G  16   6.566  -1.954  -0.792
  168    H2*    G  16           H2*        G  16   4.710  -1.500   0.563
  169   2HO*    G  16          2HO*        G  16   5.689  -0.664   2.903
  170    H1*    G  16           H1*        G  16   5.591   0.896   1.775
  171    H8     G  16           H8         G  16   5.926   1.033  -1.999
  172    H1     G  16           H1         G  16  -0.046   2.011   0.041
  173   1H2     G  16          H21         G  16  -0.203   1.512   2.196
  174   2H2     G  16          H22         G  16   1.161   0.943   3.131
  175   1H5*    C  17          2H5*        C  17   5.549  -2.741   3.238
  176   2H5*    C  17          1H5*        C  17   6.146  -4.387   3.522
  177    H4*    C  17           H4*        C  17   4.260  -4.316   4.892
  178    H3*    C  17           H3*        C  17   3.549  -5.451   2.171
  179    H2*    C  17           H2*        C  17   1.287  -5.643   2.793
  180   2HO*    C  17          2HO*        C  17   1.034  -4.998   5.299
  181    H1*    C  17           H1*        C  17   1.081  -3.283   4.288
  182   1H4     C  17          H41         C  17  -1.421  -2.133  -1.458
  183   2H4     C  17          H42         C  17   0.173  -2.063  -2.172
  184    H5     C  17           H5         C  17   2.186  -2.506  -0.943
  185    H6     C  17           H6         C  17   3.126  -3.117   1.239
  186   1H5*    A  18          2H5*        A  18   2.041  -7.711   5.871
  187   2H5*    A  18          1H5*        A  18   2.127  -9.445   5.506
  188    H4*    A  18           H4*        A  18  -0.049  -8.735   6.529
  189    H3*    A  18           H3*        A  18   0.159 -10.082   3.842
  190    H2*    A  18           H2*        A  18  -2.160  -9.866   3.440
  191   2HO*    A  18          2HO*        A  18  -3.343 -10.309   5.148
  192    H1*    A  18           H1*        A  18  -2.536  -7.344   4.364
  193    H8     A  18           H8         A  18   0.844  -7.797   2.674
  194   1H6     A  18          H61         A  18  -1.995  -6.441  -2.627
  195   2H6     A  18          H62         A  18  -0.447  -6.726  -1.863
  196    H2     A  18           H2         A  18  -5.128  -6.885   0.569
  197   1H5*    U  19          2H5*        U  19  -2.903 -12.233   6.465
  198   2H5*    U  19          1H5*        U  19  -3.193 -13.862   5.820
  199    H4*    U  19           H4*        U  19  -5.167 -12.157   5.840
  200    H3*    U  19           H3*        U  19  -4.304 -13.963   3.567
  201    H2*    U  19           H2*        U  19  -5.972 -13.081   2.153
  202   2HO*    U  19          2HO*        U  19  -7.784 -13.028   3.375
  203    H1*    U  19           H1*        U  19  -5.747 -10.411   2.896
  204    H3     U  19           H3         U  19  -4.183 -10.847  -1.378
  205    H5     U  19           H5         U  19  -0.996 -12.186   1.112
  206    H6     U  19           H6         U  19  -2.516 -12.025   2.997
  207   1H5*    C  20          2H5*        C  20  -8.899 -14.994   4.175
  208   2H5*    C  20          1H5*        C  20  -8.925 -16.649   3.537
  209    H4*    C  20           H4*        C  20 -10.378 -14.761   2.402
  210    H3*    C  20           H3*        C  20  -8.731 -16.940   1.077
  211    H2*    C  20           H2*        C  20  -9.341 -16.118  -1.059
  212   2HO*    C  20          2HO*        C  20 -11.030 -14.485  -1.231
  213    H1*    C  20           H1*        C  20  -9.176 -13.428  -0.506
  214   1H4     C  20          H41         C  20  -3.779 -15.308  -3.335
  215   2H4     C  20          H42         C  20  -3.082 -15.655  -1.767
  216    H5     C  20           H5         C  20  -4.332 -15.526   0.289
  217    H6     C  20           H6         C  20  -6.521 -15.036   1.284
  218   1H5*    C  21          2H5*        C  21 -11.644 -16.475  -1.474
  219   2H5*    C  21          1H5*        C  21 -12.697 -17.904  -1.458
  220    H4*    C  21           H4*        C  21 -12.188 -17.433  -3.762
  221    H3*    C  21           H3*        C  21 -10.612 -19.727  -2.566
  222    H2*    C  21           H2*        C  21  -9.511 -20.065  -4.568
  223   2HO*    C  21          2HO*        C  21 -11.363 -18.548  -6.079
  224    H1*    C  21           H1*        C  21  -9.750 -17.359  -5.541
  225   1H4     C  21          H41         C  21  -3.520 -18.379  -4.817
  226   2H4     C  21          H42         C  21  -3.711 -18.586  -3.091
  227    H5     C  21           H5         C  21  -5.850 -18.544  -1.983
  228    H6     C  21           H6         C  21  -8.271 -18.296  -2.292
  229    H3T    C  21           H3T        C  21 -13.019 -19.632  -3.012
  Start of MODEL   16
    1   1H5*    G   1          2H5*        G   1   0.919 -16.517 -13.886
    2   2H5*    G   1          1H5*        G   1   0.919 -14.892 -14.599
    3    H4*    G   1           H4*        G   1  -1.148 -15.549 -15.336
    4    H3*    G   1           H3*        G   1  -1.511 -14.516 -12.518
    5    H2*    G   1           H2*        G   1  -3.768 -15.215 -12.492
    6   2HO*    G   1          2HO*        G   1  -3.883 -16.077 -15.138
    7    H1*    G   1           H1*        G   1  -3.478 -17.610 -13.757
    8    H8     G   1           H8         G   1  -0.602 -17.958 -11.641
    9    H1     G   1           H1         G   1  -5.822 -17.519  -8.006
   10   1H2     G   1          H21         G   1  -7.519 -16.743  -9.204
   11   2H2     G   1          H22         G   1  -7.364 -16.334 -10.898
   12    H5T    G   1           H5T        G   1   0.733 -14.034 -12.685
   13   1H5*    G   2          2H5*        G   2  -5.194 -14.185 -14.138
   14   2H5*    G   2          1H5*        G   2  -5.236 -12.514 -14.737
   15    H4*    G   2           H4*        G   2  -7.397 -12.834 -13.864
   16    H3*    G   2           H3*        G   2  -5.532 -11.404 -11.970
   17    H2*    G   2           H2*        G   2  -7.039 -11.495 -10.190
   18   2HO*    G   2          2HO*        G   2  -9.376 -12.224 -11.073
   19    H1*    G   2           H1*        G   2  -8.394 -13.867 -10.802
   20    H8     G   2           H8         G   2  -4.656 -14.387 -10.729
   21    H1     G   2           H1         G   2  -7.242 -14.180  -4.907
   22   1H2     G   2          H21         G   2  -9.348 -13.488  -5.038
   23   2H2     G   2          H22         G   2 -10.110 -13.078  -6.557
   24   1H5*    A   3          2H5*        A   3  -8.790  -9.691 -11.357
   25   2H5*    A   3          1H5*        A   3  -9.021  -7.978 -11.730
   26    H4*    A   3           H4*        A   3  -9.712  -8.279  -9.478
   27    H3*    A   3           H3*        A   3  -7.037  -6.941  -9.921
   28    H2*    A   3           H2*        A   3  -6.565  -7.015  -7.660
   29   2HO*    A   3          2HO*        A   3  -9.370  -6.584  -7.343
   30    H1*    A   3           H1*        A   3  -8.743  -8.884  -6.995
   31    H8     A   3           H8         A   3  -5.304  -9.676  -8.516
   32   1H6     A   3          H61         A   3  -3.484 -11.134  -2.828
   33   2H6     A   3          H62         A   3  -3.020 -11.078  -4.511
   34    H2     A   3           H2         A   3  -7.692  -9.583  -2.579
   35   1H5*    U   4          2H5*        U   4 -10.403  -5.038  -7.279
   36   2H5*    U   4          1H5*        U   4 -10.267  -3.276  -7.429
   37    H4*    U   4           H4*        U   4 -10.748  -3.972  -5.106
   38    H3*    U   4           H3*        U   4  -8.133  -2.598  -5.787
   39    H2*    U   4           H2*        U   4  -7.403  -2.758  -3.561
   40   2HO*    U   4          2HO*        U   4  -9.066  -3.365  -1.894
   41    H1*    U   4           H1*        U   4  -8.606  -5.183  -2.874
   42    H3     U   4           H3         U   4  -4.299  -6.161  -2.218
   43    H5     U   4           H5         U   4  -4.476  -5.354  -6.391
   44    H6     U   4           H6         U   4  -6.811  -4.736  -6.086
   45   1H5*    G   5          2H5*        G   5 -11.070  -0.689  -2.095
   46   2H5*    G   5          1H5*        G   5 -10.351   0.934  -2.047
   47    H4*    G   5           H4*        G   5 -10.647  -0.377   0.190
   48    H3*    G   5           H3*        G   5  -8.282   1.222  -0.769
   49    H2*    G   5           H2*        G   5  -6.919   0.531   1.030
   50   2HO*    G   5          2HO*        G   5  -8.482  -0.926   2.607
   51    H1*    G   5           H1*        G   5  -7.673  -2.083   1.202
   52    H8     G   5           H8         G   5  -7.486  -0.833  -2.391
   53    H1     G   5           H1         G   5  -1.853  -2.663  -0.042
   54   1H2     G   5          H21         G   5  -2.028  -3.074   2.128
   55   2H2     G   5          H22         G   5  -3.536  -2.897   2.998
   56   1H5*    C   6          2H5*        C   6  -7.818   0.975   3.550
   57   2H5*    C   6          1H5*        C   6  -7.873   2.679   4.016
   58    H4*    C   6           H4*        C   6  -5.815   1.343   4.734
   59    H3*    C   6           H3*        C   6  -5.869   4.035   3.342
   60    H2*    C   6           H2*        C   6  -3.569   3.968   3.043
   61   2HO*    C   6          2HO*        C   6  -3.597   3.776   5.555
   62    H1*    C   6           H1*        C   6  -3.302   1.116   3.698
   63   1H4     C   6          H41         C   6   0.099   2.048  -1.619
   64   2H4     C   6          H42         C   6  -1.322   2.617  -2.464
   65    H5     C   6           H5         C   6  -3.475   2.861  -1.413
   66    H6     C   6           H6         C   6  -4.737   2.605   0.679
   67   1H5*    C   7          2H5*        C   7  -3.510   4.688   7.540
   68   2H5*    C   7          1H5*        C   7  -3.388   6.458   7.568
   69    H4*    C   7           H4*        C   7  -1.204   4.953   7.464
   70    H3*    C   7           H3*        C   7  -1.754   7.499   5.876
   71    H2*    C   7           H2*        C   7   0.428   7.318   4.997
   72   2HO*    C   7          2HO*        C   7   0.876   5.813   7.347
   73    H1*    C   7           H1*        C   7   0.517   4.497   4.933
   74   1H4     C   7          H41         C   7   0.125   6.554  -1.059
   75   2H4     C   7          H42         C   7  -1.590   6.850  -0.873
   76    H5     C   7           H5         C   7  -2.751   6.601   1.231
   77    H6     C   7           H6         C   7  -2.504   6.016   3.600
   78   1H5*    U   8          2H5*        U   8   1.756   8.250   9.150
   79   2H5*    U   8          1H5*        U   8   1.932  10.014   9.182
   80    H4*    U   8           H4*        U   8   4.008   8.473   8.639
   81    H3*    U   8           H3*        U   8   3.187  11.103   7.375
   82    H2*    U   8           H2*        U   8   4.969  10.969   5.828
   83   2HO*    U   8          2HO*        U   8   6.392  10.180   7.694
   84    H1*    U   8           H1*        U   8   4.885   8.266   5.318
   85    H3     U   8           H3         U   8   3.660  10.383   1.501
   86    H5     U   8           H5         U   8   0.253  10.642   3.964
   87    H6     U   8           H6         U   8   1.568   9.692   5.770
   88   1H5*    C   9          2H5*        C   9   7.799  11.673   7.170
   89   2H5*    C   9          1H5*        C   9   7.745  13.314   7.848
   90    H4*    C   9           H4*        C   9   8.567  12.925   5.366
   91    H3*    C   9           H3*        C   9   7.102  15.119   6.684
   92    H2*    C   9           H2*        C   9   5.733  15.702   4.934
   93   2HO*    C   9          2HO*        C   9   6.699  16.191   2.922
   94    H1*    C   9           H1*        C   9   6.595  13.709   2.956
   95   1H4     C   9          H41         C   9   0.271  14.007   2.425
   96   2H4     C   9          H42         C   9   0.067  13.537   4.097
   97    H5     C   9           H5         C   9   1.915  13.192   5.608
   98    H6     C   9           H6         C   9   4.349  13.215   5.835
   99   1H5*    C  10          2H5*        C  10   8.241  19.347   5.486
  100   2H5*    C  10          1H5*        C  10   6.781  18.622   4.785
  101    H4*    C  10           H4*        C  10   7.873  20.736   3.649
  102    H3*    C  10           H3*        C  10   6.133  18.758   2.693
  103    H2*    C  10           H2*        C  10   7.756  17.342   1.716
  104   2HO*    C  10          2HO*        C  10   8.044  18.939  -0.482
  105    H1*    C  10           H1*        C  10   9.430  19.653   0.754
  106   1H4     C  10          H41         C  10  13.580  14.902   0.091
  107   2H4     C  10          H42         C  10  13.133  14.217   1.639
  108    H5     C  10           H5         C  10  11.412  15.140   3.043
  109    H6     C  10           H6         C  10   9.730  16.921   3.266
  110   1H5*    C  11          2H5*        C  11   6.494  19.990  -0.558
  111   2H5*    C  11          1H5*        C  11   5.743  21.304  -1.486
  112    H4*    C  11           H4*        C  11   5.811  19.155  -2.750
  113    H3*    C  11           H3*        C  11   3.694  20.923  -2.675
  114    H2*    C  11           H2*        C  11   2.398  19.797  -1.026
  115   2HO*    C  11          2HO*        C  11   0.750  19.362  -2.271
  116    H1*    C  11           H1*        C  11   3.083  17.092  -2.171
  117   1H4     C  11          H41         C  11   0.367  15.626   3.387
  118   2H4     C  11          H42         C  11   1.596  16.521   4.248
  119    H5     C  11           H5         C  11   3.303  17.814   3.156
  120    H6     C  11           H6         C  11   4.207  18.526   0.995
  121   1H5*    G  12          2H5*        G  12   5.085  17.195  -5.270
  122   2H5*    G  12          1H5*        G  12   5.926  17.199  -3.708
  123    H4*    G  12           H4*        G  12   7.279  17.164  -6.433
  124    H3*    G  12           H3*        G  12   6.428  15.005  -4.511
  125    H2*    G  12           H2*        G  12   8.499  13.932  -4.555
  126   2HO*    G  12          2HO*        G  12   9.798  15.105  -6.615
  127    H1*    G  12           H1*        G  12  10.185  16.153  -5.034
  128    H8     G  12           H8         G  12  11.602  15.708  -2.972
  129    H1     G  12           H1         G  12   6.605  14.738   0.864
  130   1H2     G  12          H21         G  12   4.718  14.953  -0.265
  131   2H2     G  12          H22         G  12   4.677  15.341  -1.969
  132   1H5*    A  13          2H5*        A  13   9.059  11.963  -7.431
  133   2H5*    A  13          1H5*        A  13   7.628  10.924  -7.280
  134    H4*    A  13           H4*        A  13  10.073  10.561  -5.980
  135    H3*    A  13           H3*        A  13   7.291   9.435  -5.725
  136    H2*    A  13           H2*        A  13   7.710   8.546  -3.578
  137   2HO*    A  13          2HO*        A  13  10.248   8.993  -3.040
  138    H1*    A  13           H1*        A  13   9.159  10.579  -2.511
  139    H8     A  13           H8         A  13   6.342  11.818  -4.766
  140   1H6     A  13          H61         A  13   2.641  11.344   0.140
  141   2H6     A  13          H62         A  13   2.759  11.895  -1.516
  142    H2     A  13           H2         A  13   6.628   9.579   1.221
  143   1H5*    G  14          2H5*        G  14  10.529   6.550  -4.776
  144   2H5*    G  14          1H5*        G  14  10.020   4.851  -4.840
  145    H4*    G  14           H4*        G  14  10.774   5.939  -2.549
  146    H3*    G  14           H3*        G  14   8.613   3.932  -3.169
  147    H2*    G  14           H2*        G  14   7.530   4.164  -1.137
  148   2HO*    G  14          2HO*        G  14  10.022   5.102  -0.093
  149    H1*    G  14           H1*        G  14   8.247   6.789  -0.413
  150    H8     G  14           H8         G  14   6.608   6.676  -3.808
  151    H1     G  14           H1         G  14   2.387   6.165   0.927
  152   1H2     G  14          H21         G  14   3.443   5.831   2.856
  153   2H2     G  14          H22         G  14   5.185   5.735   2.968
  154   1H5*    U  15          2H5*        U  15  10.504   3.019   0.829
  155   2H5*    U  15          1H5*        U  15  11.952   2.723  -0.155
  156    H4*    U  15           H4*        U  15  12.707   1.387   1.486
  157    H3*    U  15           H3*        U  15  10.307  -0.195   0.592
  158    H2*    U  15           H2*        U  15  10.598  -1.674   2.412
  159   2HO*    U  15          2HO*        U  15  13.193  -0.500   2.575
  160    H1*    U  15           H1*        U  15  11.258   0.231   4.284
  161    H3     U  15           H3         U  15   7.187  -1.907   4.966
  162    H5     U  15           H5         U  15   6.420   1.779   3.074
  163    H6     U  15           H6         U  15   8.805   1.969   2.630
  164   1H5*    G  16          2H5*        G  16   9.833  -3.202  -1.315
  165   2H5*    G  16          1H5*        G  16   8.697  -2.094  -2.108
  166    H4*    G  16           H4*        G  16   8.948  -2.707   0.879
  167    H3*    G  16           H3*        G  16   6.894  -3.236  -1.365
  168    H2*    G  16           H2*        G  16   5.097  -2.813   0.077
  169   2HO*    G  16          2HO*        G  16   6.911  -3.178   2.266
  170    H1*    G  16           H1*        G  16   6.274  -0.866   1.751
  171    H8     G  16           H8         G  16   6.677  -0.079  -1.946
  172    H1     G  16           H1         G  16   0.896   1.418   0.324
  173   1H2     G  16          H21         G  16   0.648   0.607   2.368
  174   2H2     G  16          H22         G  16   1.904  -0.299   3.181
  175   1H5*    C  17          2H5*        C  17   6.315  -4.907   2.940
  176   2H5*    C  17          1H5*        C  17   5.989  -6.627   2.648
  177    H4*    C  17           H4*        C  17   4.585  -5.671   4.472
  178    H3*    C  17           H3*        C  17   3.330  -6.769   1.939
  179    H2*    C  17           H2*        C  17   1.174  -6.272   2.741
  180   2HO*    C  17          2HO*        C  17   1.940  -5.490   5.316
  181    H1*    C  17           H1*        C  17   1.771  -3.855   4.037
  182   1H4     C  17          H41         C  17  -0.970  -2.481  -1.550
  183   2H4     C  17          H42         C  17   0.545  -2.751  -2.379
  184    H5     C  17           H5         C  17   2.515  -3.553  -1.282
  185    H6     C  17           H6         C  17   3.487  -4.278   0.851
  186   1H5*    A  18          2H5*        A  18   1.320  -8.686   6.140
  187   2H5*    A  18          1H5*        A  18   0.913 -10.242   5.391
  188    H4*    A  18           H4*        A  18  -0.948  -8.919   6.657
  189    H3*    A  18           H3*        A  18  -1.108 -10.358   4.015
  190    H2*    A  18           H2*        A  18  -3.292  -9.555   3.584
  191   2HO*    A  18          2HO*        A  18  -4.465  -9.729   5.379
  192    H1*    A  18           H1*        A  18  -2.986  -6.991   4.392
  193    H8     A  18           H8         A  18   0.231  -8.246   2.839
  194   1H6     A  18          H61         A  18  -2.171  -6.755  -2.642
  195   2H6     A  18          H62         A  18  -0.725  -7.278  -1.808
  196    H2     A  18           H2         A  18  -5.395  -6.346   0.457
  197   1H5*    U  19          2H5*        U  19  -4.581 -12.561   6.407
  198   2H5*    U  19          1H5*        U  19  -4.670 -14.070   5.477
  199    H4*    U  19           H4*        U  19  -6.700 -12.379   5.460
  200    H3*    U  19           H3*        U  19  -5.510 -13.954   3.162
  201    H2*    U  19           H2*        U  19  -7.025 -12.970   1.646
  202   2HO*    U  19          2HO*        U  19  -8.941 -12.072   2.273
  203    H1*    U  19           H1*        U  19  -6.980 -10.383   2.680
  204    H3     U  19           H3         U  19  -5.020 -10.435  -1.463
  205    H5     U  19           H5         U  19  -2.004 -11.771   1.231
  206    H6     U  19           H6         U  19  -3.701 -11.835   2.963
  207   1H5*    C  20          2H5*        C  20 -10.056 -15.131   3.384
  208   2H5*    C  20          1H5*        C  20 -10.129 -16.703   2.566
  209    H4*    C  20           H4*        C  20 -11.468 -14.640   1.607
  210    H3*    C  20           H3*        C  20  -9.880 -16.745   0.109
  211    H2*    C  20           H2*        C  20 -10.341 -15.670  -1.949
  212   2HO*    C  20          2HO*        C  20 -12.574 -14.870  -0.593
  213    H1*    C  20           H1*        C  20 -10.048 -13.071  -1.116
  214   1H4     C  20          H41         C  20  -4.604 -15.097  -3.794
  215   2H4     C  20          H42         C  20  -4.004 -15.522  -2.205
  216    H5     C  20           H5         C  20  -5.355 -15.411  -0.212
  217    H6     C  20           H6         C  20  -7.572 -14.870   0.687
  218   1H5*    C  21          2H5*        C  21 -12.675 -15.509  -2.604
  219   2H5*    C  21          1H5*        C  21 -13.800 -16.871  -2.787
  220    H4*    C  21           H4*        C  21 -13.110 -16.053  -4.992
  221    H3*    C  21           H3*        C  21 -12.027 -18.740  -4.104
  222    H2*    C  21           H2*        C  21 -10.890 -18.980  -6.098
  223   2HO*    C  21          2HO*        C  21 -12.692 -18.723  -7.457
  224    H1*    C  21           H1*        C  21 -10.627 -16.158  -6.667
  225   1H4     C  21          H41         C  21  -4.702 -18.367  -6.022
  226   2H4     C  21          H42         C  21  -4.985 -18.753  -4.339
  227    H5     C  21           H5         C  21  -7.121 -18.473  -3.261
  228    H6     C  21           H6         C  21  -9.448 -17.762  -3.564
  229    H3T    C  21           H3T        C  21 -14.073 -19.081  -4.574
  Start of MODEL   17
    1   1H5*    G   1          2H5*        G   1   1.803 -16.045 -11.143
    2   2H5*    G   1          1H5*        G   1   1.938 -14.428 -11.863
    3    H4*    G   1           H4*        G   1   0.702 -15.428 -13.520
    4    H3*    G   1           H3*        G   1  -0.828 -13.746 -12.006
    5    H2*    G   1           H2*        G   1  -1.813 -15.308 -10.533
    6   2HO*    G   1          2HO*        G   1  -3.634 -16.221 -12.313
    7    H1*    G   1           H1*        G   1  -2.152 -17.462 -12.570
    8    H8     G   1           H8         G   1   0.385 -18.774 -10.575
    9    H1     G   1           H1         G   1  -4.799 -18.342  -6.888
   10   1H2     G   1          H21         G   1  -6.288 -16.993  -7.826
   11   2H2     G   1          H22         G   1  -6.004 -16.200  -9.359
   12    H5T    G   1           H5T        G   1   1.158 -14.745  -9.557
   13   1H5*    G   2          2H5*        G   2  -4.876 -15.063 -13.543
   14   2H5*    G   2          1H5*        G   2  -5.096 -13.710 -14.669
   15    H4*    G   2           H4*        G   2  -7.000 -13.387 -13.449
   16    H3*    G   2           H3*        G   2  -4.741 -11.989 -12.030
   17    H2*    G   2           H2*        G   2  -5.923 -11.710 -10.046
   18   2HO*    G   2          2HO*        G   2  -8.312 -11.822 -10.107
   19    H1*    G   2           H1*        G   2  -7.685 -13.889 -10.171
   20    H8     G   2           H8         G   2  -3.897 -14.495 -10.474
   21    H1     G   2           H1         G   2  -6.128 -14.613  -4.502
   22   1H2     G   2          H21         G   2  -8.256 -13.984  -4.478
   23   2H2     G   2          H22         G   2  -9.120 -13.535  -5.931
   24   1H5*    A   3          2H5*        A   3  -8.270 -10.085 -11.344
   25   2H5*    A   3          1H5*        A   3  -8.320  -8.348 -11.667
   26    H4*    A   3           H4*        A   3  -9.175  -8.863  -9.432
   27    H3*    A   3           H3*        A   3  -6.668  -7.221  -9.837
   28    H2*    A   3           H2*        A   3  -6.182  -7.277  -7.577
   29   2HO*    A   3          2HO*        A   3  -7.779  -6.938  -6.043
   30    H1*    A   3           H1*        A   3  -8.118  -9.390  -6.917
   31    H8     A   3           H8         A   3  -4.687  -9.816  -8.552
   32   1H6     A   3          H61         A   3  -2.542 -11.239  -2.968
   33   2H6     A   3          H62         A   3  -2.149 -11.118  -4.667
   34    H2     A   3           H2         A   3  -6.842 -10.015  -2.530
   35   1H5*    U   4          2H5*        U   4 -10.022  -6.146  -7.175
   36   2H5*    U   4          1H5*        U   4 -10.521  -4.452  -7.365
   37    H4*    U   4           H4*        U   4 -10.794  -5.037  -5.048
   38    H3*    U   4           H3*        U   4  -8.456  -3.237  -5.727
   39    H2*    U   4           H2*        U   4  -7.713  -3.229  -3.502
   40   2HO*    U   4          2HO*        U   4  -9.149  -3.871  -1.772
   41    H1*    U   4           H1*        U   4  -8.471  -5.808  -2.758
   42    H3     U   4           H3         U   4  -4.061  -6.102  -2.151
   43    H5     U   4           H5         U   4  -4.399  -5.263  -6.308
   44    H6     U   4           H6         U   4  -6.800  -5.048  -5.983
   45   1H5*    G   5          2H5*        G   5 -11.788  -1.483  -2.045
   46   2H5*    G   5          1H5*        G   5 -11.151   0.169  -2.166
   47    H4*    G   5           H4*        G   5 -11.355  -0.997   0.189
   48    H3*    G   5           H3*        G   5  -9.198   0.784  -0.924
   49    H2*    G   5           H2*        G   5  -7.746   0.396   0.888
   50   2HO*    G   5          2HO*        G   5  -9.127  -1.081   2.616
   51    H1*    G   5           H1*        G   5  -8.212  -2.262   1.308
   52    H8     G   5           H8         G   5  -8.143  -1.307  -2.381
   53    H1     G   5           H1         G   5  -2.358  -2.339   0.090
   54   1H2     G   5          H21         G   5  -2.506  -2.590   2.289
   55   2H2     G   5          H22         G   5  -4.030  -2.502   3.145
   56   1H5*    C   6          2H5*        C   6  -8.751   0.954   3.439
   57   2H5*    C   6          1H5*        C   6  -8.938   2.684   3.757
   58    H4*    C   6           H4*        C   6  -6.769   1.511   4.533
   59    H3*    C   6           H3*        C   6  -7.089   4.166   3.110
   60    H2*    C   6           H2*        C   6  -4.822   4.286   2.690
   61   2HO*    C   6          2HO*        C   6  -3.709   2.871   4.696
   62    H1*    C   6           H1*        C   6  -4.253   1.506   3.472
   63   1H4     C   6          H41         C   6  -1.042   2.450  -1.954
   64   2H4     C   6          H42         C   6  -2.523   2.841  -2.798
   65    H5     C   6           H5         C   6  -4.671   2.959  -1.710
   66    H6     C   6           H6         C   6  -5.863   2.720   0.421
   67   1H5*    C   7          2H5*        C   7  -5.069   5.131   7.486
   68   2H5*    C   7          1H5*        C   7  -4.979   6.904   7.466
   69    H4*    C   7           H4*        C   7  -2.766   5.442   7.547
   70    H3*    C   7           H3*        C   7  -3.310   7.954   5.922
   71    H2*    C   7           H2*        C   7  -1.154   7.817   5.004
   72   2HO*    C   7          2HO*        C   7   0.355   6.179   6.044
   73    H1*    C   7           H1*        C   7  -0.954   5.035   4.877
   74   1H4     C   7          H41         C   7  -1.874   7.140  -1.044
   75   2H4     C   7          H42         C   7  -3.534   7.559  -0.682
   76    H5     C   7           H5         C   7  -4.504   7.336   1.517
   77    H6     C   7           H6         C   7  -4.084   6.668   3.840
   78   1H5*    U   8          2H5*        U   8   0.614   7.578   8.504
   79   2H5*    U   8          1H5*        U   8   1.257   9.213   8.738
   80    H4*    U   8           H4*        U   8   2.769   7.311   7.696
   81    H3*    U   8           H3*        U   8   2.567  10.231   6.870
   82    H2*    U   8           H2*        U   8   4.164   9.843   5.156
   83   2HO*    U   8          2HO*        U   8   4.629   7.265   6.310
   84    H1*    U   8           H1*        U   8   3.217   7.428   4.287
   85    H3     U   8           H3         U   8   2.476  10.685   1.167
   86    H5     U   8           H5         U   8  -0.719  11.050   3.882
   87    H6     U   8           H6         U   8   0.397   9.426   5.308
   88   1H5*    C   9          2H5*        C   9   7.131   9.943   7.298
   89   2H5*    C   9          1H5*        C   9   7.456  11.577   7.911
   90    H4*    C   9           H4*        C   9   8.370  10.841   5.545
   91    H3*    C   9           H3*        C   9   7.331  13.435   6.567
   92    H2*    C   9           H2*        C   9   6.635  14.281   4.545
   93   2HO*    C   9          2HO*        C   9   8.081  14.484   2.985
   94    H1*    C   9           H1*        C   9   6.859  11.916   2.875
   95   1H4     C   9          H41         C   9   1.016  14.316   2.025
   96   2H4     C   9          H42         C   9   0.535  13.741   3.605
   97    H5     C   9           H5         C   9   2.064  12.700   5.155
   98    H6     C   9           H6         C   9   4.375  11.990   5.519
   99   1H5*    C  10          2H5*        C  10   8.463  16.128   5.096
  100   2H5*    C  10          1H5*        C  10   9.366  14.729   4.483
  101    H4*    C  10           H4*        C  10  10.599  17.481   4.916
  102    H3*    C  10           H3*        C  10   8.708  16.916   2.922
  103    H2*    C  10           H2*        C  10   9.896  15.198   1.816
  104   2HO*    C  10          2HO*        C  10   9.953  16.459   0.091
  105    H1*    C  10           H1*        C  10  12.562  16.524   2.239
  106   1H4     C  10          H41         C  10  14.314  10.679   0.491
  107   2H4     C  10          H42         C  10  13.233   9.952   1.659
  108    H5     C  10           H5         C  10  11.750  11.231   3.061
  109    H6     C  10           H6         C  10  10.970  13.487   3.637
  110   1H5*    C  11          2H5*        C  11  10.227  18.621   0.508
  111   2H5*    C  11          1H5*        C  11  10.147  20.292  -0.087
  112    H4*    C  11           H4*        C  11   9.494  18.585  -1.804
  113    H3*    C  11           H3*        C  11   8.308  21.046  -1.390
  114    H2*    C  11           H2*        C  11   6.469  20.291  -0.080
  115   2HO*    C  11          2HO*        C  11   5.519  21.216  -1.914
  116    H1*    C  11           H1*        C  11   6.120  17.832  -1.793
  117   1H4     C  11          H41         C  11   2.328  16.580   3.149
  118   2H4     C  11          H42         C  11   3.653  16.798   4.269
  119    H5     C  11           H5         C  11   5.853  17.503   3.589
  120    H6     C  11           H6         C  11   7.260  18.150   1.688
  121   1H5*    G  12          2H5*        G  12   7.826  17.816  -4.668
  122   2H5*    G  12          1H5*        G  12   8.592  17.166  -3.205
  123    H4*    G  12           H4*        G  12   9.501  16.635  -6.061
  124    H3*    G  12           H3*        G  12   7.657  15.205  -4.169
  125    H2*    G  12           H2*        G  12   8.710  13.143  -4.399
  126   2HO*    G  12          2HO*        G  12  10.338  13.304  -6.471
  127    H1*    G  12           H1*        G  12  11.348  13.983  -4.969
  128    H8     G  12           H8         G  12  12.673  13.394  -2.815
  129    H1     G  12           H1         G  12   7.427  13.359   0.804
  130   1H2     G  12          H21         G  12   5.699  14.122  -0.344
  131   2H2     G  12          H22         G  12   5.830  14.643  -2.010
  132   1H5*    A  13          2H5*        A  13   6.932  13.067  -7.718
  133   2H5*    A  13          1H5*        A  13   5.439  12.115  -7.581
  134    H4*    A  13           H4*        A  13   7.891  11.135  -6.955
  135    H3*    A  13           H3*        A  13   5.094  10.490  -6.070
  136    H2*    A  13           H2*        A  13   5.793   9.225  -4.207
  137   2HO*    A  13          2HO*        A  13   8.293   9.180  -5.565
  138    H1*    A  13           H1*        A  13   7.775  10.799  -3.287
  139    H8     A  13           H8         A  13   5.396  13.317  -4.572
  140   1H6     A  13          H61         A  13   1.777  12.278   0.299
  141   2H6     A  13          H62         A  13   2.084  13.337  -1.058
  142    H2     A  13           H2         A  13   4.866   9.020   0.142
  143   1H5*    G  14          2H5*        G  14   7.628   7.570  -6.174
  144   2H5*    G  14          1H5*        G  14   7.447   5.815  -6.360
  145    H4*    G  14           H4*        G  14   8.055   6.864  -4.013
  146    H3*    G  14           H3*        G  14   6.916   4.399  -4.786
  147    H2*    G  14           H2*        G  14   4.713   4.761  -4.099
  148   2HO*    G  14          2HO*        G  14   5.014   3.369  -2.501
  149    H1*    G  14           H1*        G  14   5.413   6.660  -1.894
  150    H8     G  14           H8         G  14   3.701   7.424  -5.245
  151    H1     G  14           H1         G  14  -0.286   6.892  -0.303
  152   1H2     G  14          H21         G  14   0.819   6.211   1.484
  153   2H2     G  14          H22         G  14   2.536   5.884   1.465
  154   1H5*    U  15          2H5*        U  15   9.380   5.222  -0.864
  155   2H5*    U  15          1H5*        U  15  10.818   4.378  -1.477
  156    H4*    U  15           H4*        U  15  11.366   4.222   0.725
  157    H3*    U  15           H3*        U  15   9.254   2.083   0.384
  158    H2*    U  15           H2*        U  15   9.581   1.540   2.686
  159   2HO*    U  15          2HO*        U  15  11.893   1.798   2.670
  160    H1*    U  15           H1*        U  15   9.528   4.121   3.553
  161    H3     U  15           H3         U  15   5.520   2.588   4.896
  162    H5     U  15           H5         U  15   5.067   3.057   0.733
  163    H6     U  15           H6         U  15   7.437   3.542   0.593
  164   1H5*    G  16          2H5*        G  16   9.352  -1.478  -0.982
  165   2H5*    G  16          1H5*        G  16   8.131  -0.560  -1.884
  166    H4*    G  16           H4*        G  16   8.346  -0.882   1.152
  167    H3*    G  16           H3*        G  16   6.471  -1.940  -1.066
  168    H2*    G  16           H2*        G  16   4.597  -1.669   0.310
  169   2HO*    G  16          2HO*        G  16   5.615  -1.082   2.737
  170    H1*    G  16           H1*        G  16   5.428   0.592   1.790
  171    H8     G  16           H8         G  16   5.712   0.959  -2.007
  172    H1     G  16           H1         G  16  -0.152   2.062   0.263
  173   1H2     G  16          H21         G  16  -0.260   1.493   2.401
  174   2H2     G  16          H22         G  16   1.114   0.848   3.272
  175   1H5*    C  17          2H5*        C  17   5.933  -3.253   3.385
  176   2H5*    C  17          1H5*        C  17   5.956  -5.020   3.224
  177    H4*    C  17           H4*        C  17   4.293  -4.265   4.895
  178    H3*    C  17           H3*        C  17   3.398  -5.679   2.367
  179    H2*    C  17           H2*        C  17   1.144  -5.504   2.997
  180   2HO*    C  17          2HO*        C  17   0.681  -4.808   5.279
  181    H1*    C  17           H1*        C  17   1.250  -2.993   4.265
  182   1H4     C  17          H41         C  17  -1.469  -2.179  -1.432
  183   2H4     C  17          H42         C  17   0.085  -2.297  -2.222
  184    H5     C  17           H5         C  17   2.121  -2.797  -1.051
  185    H6     C  17           H6         C  17   3.122  -3.295   1.132
  186   1H5*    A  18          2H5*        A  18   1.275  -6.790   5.788
  187   2H5*    A  18          1H5*        A  18   1.772  -8.429   6.253
  188    H4*    A  18           H4*        A  18  -0.519  -8.382   6.777
  189    H3*    A  18           H3*        A  18   0.094  -9.710   4.149
  190    H2*    A  18           H2*        A  18  -2.179  -9.871   3.534
  191   2HO*    A  18          2HO*        A  18  -3.688  -9.056   5.443
  192    H1*    A  18           H1*        A  18  -3.065  -7.453   4.371
  193    H8     A  18           H8         A  18   0.512  -7.599   2.963
  194   1H6     A  18          H61         A  18  -2.007  -6.244  -2.498
  195   2H6     A  18          H62         A  18  -0.505  -6.482  -1.634
  196    H2     A  18           H2         A  18  -5.331  -6.885   0.458
  197   1H5*    U  19          2H5*        U  19  -3.270 -12.057   6.507
  198   2H5*    U  19          1H5*        U  19  -3.198 -13.687   5.805
  199    H4*    U  19           H4*        U  19  -5.405 -12.244   5.597
  200    H3*    U  19           H3*        U  19  -4.067 -14.007   3.527
  201    H2*    U  19           H2*        U  19  -5.667 -13.414   1.908
  202   2HO*    U  19          2HO*        U  19  -7.686 -13.147   2.485
  203    H1*    U  19           H1*        U  19  -5.958 -10.721   2.599
  204    H3     U  19           H3         U  19  -4.078 -10.740  -1.529
  205    H5     U  19           H5         U  19  -0.937 -11.993   1.062
  206    H6     U  19           H6         U  19  -2.560 -12.029   2.868
  207   1H5*    C  20          2H5*        C  20  -8.549 -15.264   4.060
  208   2H5*    C  20          1H5*        C  20  -8.686 -16.892   3.368
  209    H4*    C  20           H4*        C  20 -10.070 -14.888   2.347
  210    H3*    C  20           H3*        C  20  -8.607 -17.125   0.916
  211    H2*    C  20           H2*        C  20  -9.167 -16.201  -1.183
  212   2HO*    C  20          2HO*        C  20 -10.714 -14.236  -1.025
  213    H1*    C  20           H1*        C  20  -8.849 -13.538  -0.563
  214   1H4     C  20          H41         C  20  -3.553 -15.529  -3.495
  215   2H4     C  20          H42         C  20  -2.888 -16.033  -1.956
  216    H5     C  20           H5         C  20  -4.139 -15.980   0.104
  217    H6     C  20           H6         C  20  -6.299 -15.431   1.131
  218   1H5*    C  21          2H5*        C  21 -11.905 -15.737  -1.600
  219   2H5*    C  21          1H5*        C  21 -12.831 -17.220  -1.907
  220    H4*    C  21           H4*        C  21 -12.043 -15.899  -3.968
  221    H3*    C  21           H3*        C  21 -11.456 -18.834  -3.497
  222    H2*    C  21           H2*        C  21 -10.309 -18.963  -5.496
  223   2HO*    C  21          2HO*        C  21 -10.814 -16.884  -6.960
  224    H1*    C  21           H1*        C  21  -9.573 -16.169  -5.634
  225   1H4     C  21          H41         C  21  -4.114 -19.416  -5.349
  226   2H4     C  21          H42         C  21  -4.502 -20.011  -3.752
  227    H5     C  21           H5         C  21  -6.586 -19.547  -2.640
  228    H6     C  21           H6         C  21  -8.751 -18.411  -2.818
  229    H3T    C  21           H3T        C  21 -13.332 -17.270  -4.962