*HEADER    RNA                                     18-JUN-12   2LUN              
*TITLE     RNA APTAMER FOR B. ANTHRACIS RIBOSOMAL PROTEIN S8                     
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: RNA (28-MER);                                              
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 ENGINEERED: YES                                                      
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES                                                       
*KEYWDS    APTAMER, PROTEIN S8, RIBOSOME, SELEX, NON-CANONICAL BASE PAIRS, RNA   
*EXPDTA    SOLUTION NMR                                                          
*NUMMDL    8                                                                     
*AUTHOR    E.P.NIKONOWICZ, J.WANG                                                
*REVDAT   1   18-DEC-13 2LUN    0                                                


!Modified by jwang 
! 
!----------------------------------------------------------------------!
!updated 02-06-2009 with tortional angles and dihedral from GA motif   !
!----------------------------------------------------------------------!
!
!--------------------33mer RNA sequence:---------------------------
!----------------------------------------------------------------------!
!               GGGAGUAAAGAUUGACUUCGGUCAUGAACUCCC                      !
!----------------------------------------------------------------------!
!
! backbone beta constraints SLX26
! updated Feb/06/2009
!Selex28_A5_dih_v63_test4.tbl & Selex28_A5_dih_v63_test3.tbl are similar for noe6.tbl
!
! beta
!
!
!
!G2
assign (resid 2  and name P  )
       (resid 2  and name O5')
       (resid 2  and name C5')
       (resid 2  and name C4')  1.0  170.0  40.0  2
!
!G3 
assign (resid 3  and name P  )
       (resid 3  and name O5')
       (resid 3  and name C5')
       (resid 3  and name C4')  1.0  170.0  40.0  2
!
!C4   beta 4 =161.7 |  gamma 4 =52.2
assign (resid 4  and name P  )
       (resid 4  and name O5')
       (resid 4  and name C5')
       (resid 4  and name C4')  1.0  170.0  40.0  2
!
!A5 -102.987 in crystal structure
assign (resid 5  and name P  )
       (resid 5  and name O5')
       (resid 5  and name C5')
       (resid 5  and name C4')  1.0  -170.0  40.0  2
! A5 Gamma
! 156 in crystal structure
assign (resid 5  and name O5')
      (resid 5  and name C5')
       (resid 5  and name C4')
      (resid 5  and name C3')  1.0   110.0  40.0  2 !
!
!G6 -175.637 in crystal structure
!  160.0 55mer A46 
assign (resid 6  and name P  )
      (resid 6  and name O5')
      (resid 6  and name C5')
      (resid 6  and name C4')  1.0  160.0  40.0  2 ! 
! G6 Gamma
!
assign (resid 6  and name O5')
       (resid 6  and name C5')
       (resid 6  and name C4')
       (resid 6  and name C3')  1.0   105.0  40.0  2 !


!
!U7   
!                        
assign (resid 7  and name P  )
       (resid 7  and name O5')
       (resid 7  and name C5')
       (resid 7  and name C4')  1.0  175.0  60.0  2  ! 

!
!G8 
!  
assign (resid 8  and name P  )
       (resid 8  and name O5')
       (resid 8  and name C5')
       (resid 8  and name C4')  1.0   160.0  40.0  2 ! 


!
!A9 
!
assign (resid 9  and name P  )
       (resid 9  and name O5')
       (resid 9  and name C5')
       (resid 9  and name C4')  1.0   170.0  40.0  2  ! 

!
!U10 
!
assign (resid 10  and name P  )
       (resid 10  and name O5')
       (resid 10  and name C5')
       (resid 10  and name C4')  1.0  170.0  40.0  2 ! 
!
!G11 
!
assign (resid 11  and name P  )
       (resid 11  and name O5')
       (resid 11  and name C5')
       (resid 11  and name C4')  1.0   -175.0  40.0  2 ! 
!
!C12 
!
assign ( resid 12 and name P )
       ( resid 12 and name O5' )
       ( resid 12 and name C5' )
       ( resid 12 and name C4' )  1.0   170.0  40.0 2  ! 

!-----------------tetra-loop-------------------------|
!U13-from 
!
assign ( resid 13 and name P )
       ( resid 13 and name O5' )
       ( resid 13 and name C5' )
       ( resid 13 and name C4' )  1.0  -170.0  40.0 2 ! 
!
!U14-from 
assign ( resid 14 and name P )
       ( resid 14 and name O5' )
       ( resid 14 and name C5' )
       ( resid 14 and name C4' )  1.0  155.0  40.0 2 !
!
!C15-from
assign ( resid 15 and name P )
       ( resid 15 and name O5' )
       ( resid 15 and name C5' )
       ( resid 15 and name C4' )  1.0  -170.0  40.0 2 !
!G16-from 
assign ( resid 16 and name P )
       ( resid 16 and name O5' )
       ( resid 16 and name C5' )
       ( resid 16 and name C4' )  1.0  -170.0  40.0  2 !
!
!--------------------end of tetra loop----------------------------|

!
!G17
assign (resid 17  and name P  )
       (resid 17  and name O5')
       (resid 17  and name C5')
       (resid 17  and name C4')  1.0  170.0  40.0  2 !
!
!C18  
assign (resid 18  and name P  )
       (resid 18  and name O5')
       (resid 18  and name C5')
       (resid 18  and name C4')  1.0  175.0  40.0  2 !
!
!A19  
assign (resid 19  and name P  )
       (resid 19  and name O5')
       (resid 19  and name C5')
       (resid 19  and name C4')  1.0  155.0  40.0  2 !
!
!U20  
! 
assign (resid 20  and name P  )
       (resid 20  and name O5')
       (resid 20  and name C5')
       (resid 20  and name C4')  1.0  110.0  40.0  2 !


!
!A21 
! 
assign (resid 21  and name P  )
       (resid 21  and name O5')
       (resid 21  and name C5')
       (resid 21  and name C4')  1.0  150.0  40.0  2 !

!
!U22  
!  
assign (resid 22  and name P  )
       (resid 22  and name O5')
       (resid 22  and name C5')
       (resid 22  and name C4')  1.0  155.0  40.0  2 !
!
!C23 
!
assign (resid 23  and name P  )
       (resid 23  and name O5')
       (resid 23  and name C5')
       (resid 23  and name C4')  1.0  130.0  40.0  2 !
! C23 
!
assign (resid 23  and name O5')
       (resid 23  and name C5')
       (resid 23  and name C4')
       (resid 23  and name C3')  1.0   80.0  40.0  2 !
!
!A24 
!
assign (resid 24  and name P  )
       (resid 24  and name O5')
       (resid 24  and name C5')
       (resid 24  and name C4')  1.0   -155.0  40.0  2 ! 

!
!G25  
!
assign (resid 25  and name P  )
       (resid 25  and name O5')
       (resid 25  and name C5')
       (resid 25  and name C4')  1.0  170.0  40.0  2 ! 
!
!C26 
!
assign (resid 26  and name P  )
       (resid 26  and name O5')
       (resid 26  and name C5')
       (resid 26  and name C4')  1.0  170.0  40.0  2 ! 
!
!C27  
!   
assign (resid 27  and name P  )
       (resid 27  and name O5')
       (resid 27  and name C5')
       (resid 27  and name C4')  1.0  170.0  40.0  2 ! 
!
!C28  176.894 in crystal structure
! 
assign (resid 28  and name P  )
       (resid 28  and name O5')
       (resid 28  and name C5')
       (resid 28  and name C4')  1.0  170.0  60.0  2  ! 




! backbone epsilon constraints GA_33mer
! updated 4/4/07
!
!
! epsilon
! 160.00 for both side chians
! around -160.0 in residues close to 1S72-loopE 
!
! G1 
! 
assign (resid  1  and name C4')
       (resid  1  and name C3')
       (resid  1  and name O3')
       (resid  2  and name P  )  1.0 -160.0 40.0  2 !
!
! G2 
! 
assign (resid  2  and name C4')
       (resid  2  and name C3')
       (resid  2  and name O3')
       (resid  3  and name P  )  1.0 -160.0 40.0  2
!
! G3 
! 
assign (resid  3  and name C4')
       (resid  3  and name C3')
       (resid  3  and name O3')
       (resid  4  and name P  )  1.0 -160.0 40.0  2
!
! C4 
! 
assign (resid  4  and name C4')
       (resid  4  and name C3')
       (resid  4  and name O3')
       (resid  5  and name P  )  1.0  -155.0 40.0  2
!
! A5 
!
assign (resid  5  and name C4')
       (resid  5  and name C3')
       (resid  5  and name O3')
       (resid  6  and name P  )  1.0 -165.0 40.0  2 !
!
! G6  
!  
assign (resid  6  and name C4')
       (resid  6  and name C3')
       (resid  6  and name O3')
       (resid  7  and name P  )  1.0 -150.0 40.0  2 !
!
! U7  
!  
assign (resid  7  and name C4')
       (resid  7  and name C3')
       (resid  7  and name O3')
       (resid  8  and name P  )  1.0 -160.0 40.0  2 !
!
! G8  
!  
assign (resid  8  and name C4')
       (resid  8  and name C3')
       (resid  8  and name O3')
       (resid  9  and name P  )  1.0 -145.0 40.0  2 !
!
! A9  
!  
assign (resid  9  and name C4')
       (resid  9  and name C3')
       (resid  9  and name O3')
       (resid  10  and name P )  1.0 -150.0 40.0  2 !
!
! U10 
! 
assign (resid  10  and name C4')
       (resid  10  and name C3')
       (resid  10  and name O3')
       (resid  11  and name P  )  1.0 -150.0 40.0  2 !
!
! G11  
assign (resid  11  and name C4')
       (resid  11  and name C3')
       (resid  11  and name O3')
       (resid  12  and name P  )  1.0  -150.0 40.0  2 ! 
! C12  
!
assign (resid  12  and name C4')
       (resid  12  and name C3')
       (resid  12  and name O3')
       (resid  13  and name P  )  1.0 -145.0 40.0  2 ! 
!-----------------tetra-loop-------------------------|
!
! U13 
!
assign (resid  13  and name C4')
       (resid  13  and name C3')
       (resid  13  and name O3')
       (resid  14  and name P  )  1.0  -160.0 40.0  2 !

!
! U14 
!
assign (resid  14  and name C4')
       (resid  14  and name C3')
       (resid  14  and name O3')
       (resid  15  and name P  )  1.0 -110.0 40.0  2 !
!
! C15 
!
assign (resid 15  and name C4')
       (resid 15  and name C3')
       (resid 15  and name O3')
       (resid 16  and name P  )  1.0 -90.0 40.0 2 !  
!
! G16  
! 
assign (resid 16  and name C4')
       (resid 16  and name C3')
       (resid 16  and name O3')
       (resid 17  and name P  )  1.0 -142.0 40.0 2 ! 
!-----------------end of tetra-loop-------------------------|
!
!G17 
!
assign ( resid 17 and name C4' )
       ( resid 17 and name C3' )
       ( resid 17 and name O3' )
       ( resid 18 and name P )    1.0  -145.0  40.0 2 ! 
!
!C18   
!
assign ( resid 18 and name C4' )
       ( resid 18 and name C3' )
       ( resid 18 and name O3' )
       ( resid 19 and name P )    1.0  -155.0  40.0 2 !
!
!A19  
!
assign ( resid 19 and name C4' )
       ( resid 19 and name C3' )
       ( resid 19 and name O3' )
       ( resid 20 and name P )    1.0  -150.0  40.0 2 !
!
!U20  
!  
assign ( resid 20 and name C4' )
       ( resid 20 and name C3' )
       ( resid 20 and name O3' )
       ( resid 21 and name P )    1.0  -150.0  40.0 2 
!
! A21  
!  
assign (resid  21  and name C4')
       (resid  21  and name C3')
       (resid  21  and name O3')
       (resid  22  and name P  )  1.0 -140.0 40.0  2  !  
!
! U22   
!
assign (resid  22  and name C4')
       (resid  22  and name C3')
       (resid  22  and name O3')
       (resid  23  and name P  )  1.0 -150.0 40.0  2   ! 
!
! C23  
! 
assign (resid 23  and name C4')
       (resid 23  and name C3')
       (resid 23  and name O3')
       (resid 24  and name P  )  1.0 -150.0 40.0  2 !
!
! A24 
! 
assign (resid 24  and name C4')
       (resid 24  and name C3')
       (resid 24  and name O3')
       (resid 25  and name P  )  1.0   -155.0 40.0 2 !
!
!G25   
! 
assign (resid  25  and name C4')
       (resid  25  and name C3')
       (resid  25  and name O3')
       (resid  26  and name P  )  1.0  -155.0 30.0  2 !
!
! C26  
! 
assign (resid  26  and name C4')
       (resid  26  and name C3')
       (resid  26  and name O3')
       (resid  27  and name P  )  1.0 -140.0 40.0 2 !
!
! C27   
! 
assign (resid  27  and name C4')
       (resid  27  and name C3')
       (resid  27  and name O3')
       (resid  28  and name P  )  1.0 -140.0 40.0 2 !



! backbone alpha and zeta constraints SLX26
! updated 02/06/2009
!
!alpha - average -70.0 
!
!G1 
assign ( resid 1 and name O3' )
       ( resid 2 and name P   )
       ( resid 2 and name O5' )
       ( resid 2 and name C5' )  1.0  -70.0  60.0 2 !
!
!G2  
assign ( resid 2 and name O3' )
       ( resid 3 and name P   )
       ( resid 3 and name O5' )
       ( resid 3 and name C5' )  1.0  -70.0  60.0 2 ! 
!
!G3  
assign ( resid 3 and name O3' )
       ( resid 4 and name P   )
       ( resid 4 and name O5' )
       ( resid 4 and name C5' )  1.0  -80.0  40.0 2 ! 
!
!C4   
assign ( resid 4 and name O3' )
       ( resid 5 and name P   )
       ( resid 5 and name O5' )
       ( resid 5 and name C5' )  1.0  -80.0  40.0 2 !
!
!G5 
! 
assign ( resid 5 and name O3' )
       ( resid 6 and name P   )
       ( resid 6 and name O5' )
       ( resid 6 and name C5' )  1.0  -80.0  60.0 2 !

!
!C6 
! 
assign ( resid 6 and name O3' )
       ( resid 7 and name P   )
       ( resid 7 and name O5' )
       ( resid 7 and name C5' )  1.0  -90.0  40.0 2 !
!----------------------------------------------
!A7 
! 
assign ( resid 7 and name O3' )
       ( resid 8 and name P   )
       ( resid 8 and name O5' )
       ( resid 8 and name C5' )  1.0  -40.0  40.0 2 !
!
!A8 
! 
assign ( resid 8 and name O3' )
       ( resid 9 and name P   )
       ( resid 9 and name O5' )
       ( resid 9 and name C5' )  1.0   -40.0  40.0 2 !
!
!A9  
!
assign ( resid 9 and name O3' )
       ( resid 10 and name P   )
       ( resid 10 and name O5' )
       ( resid 10 and name C5' )  1.0  -70.0  40.0 2 !
!
!G10  
!
assign ( resid 10 and name O3' )
       ( resid 11 and name P   )
       ( resid 11 and name O5' )
       ( resid 11 and name C5' )  1.0   -80.0  40.0 2 !
!
!A11 
!
assign ( resid 11 and name O3' )
       ( resid 12 and name P   )
       ( resid 12 and name O5' )
       ( resid 12 and name C5' )  1.0  150.0  60.0 2 !
!
!U12  
!
assign ( resid 12 and name O3' )
       ( resid 13 and name P   )
       ( resid 13 and name O5' )
       ( resid 13 and name C5' )  1.0  -80.0 40.0 2 !

!-------------------Tetra-loop----------------------------|
!
!U13  
!
assign ( resid 13 and name O3' )
       ( resid 14 and name P   )
       ( resid 14 and name O5' )
       ( resid 14 and name C5' )  1.0  -150.0  40.0 2 

!
!U14   
!
assign ( resid 14 and name O3' )
       ( resid 15 and name P   )
       ( resid 15 and name O5' )
       ( resid 15 and name C5' )  1.0  -100.0  40.0 2 
!
!C15   
!
assign ( resid 15 and name O3' )
       ( resid 16 and name P   )
       ( resid 16 and name O5' )
       ( resid 16 and name C5' )  1.0  60.0  40.0 2 ! 
!
!G16  
!
assign ( resid 16 and name O3' )
       ( resid 17 and name P   )
       ( resid 17 and name O5' )
       ( resid 17 and name C5' )  1.0  120.0  40.0 2 !
!
!G17  
!
assign ( resid 17 and name O3' )
       ( resid 18 and name P   )
       ( resid 18 and name O5' )
       ( resid 18 and name C5' )  1.0  -70.0  40.0 2 
!
!C18 
assign ( resid 18 and name O3' )
       ( resid 19 and name P   )
       ( resid 19 and name O5' )
       ( resid 19 and name C5' )  1.0  -80.0  40.0 2 !
!
!A19  
assign ( resid 19 and name O3' )
       ( resid 20 and name P   )
       ( resid 20 and name O5' )
       ( resid 20 and name C5' )  1.0   -80.0  40.0 2 ! 
!
!U20  
!
assign ( resid 20 and name O3' )
      ( resid 21 and name P   )
       ( resid 21 and name O5' )
       ( resid 21 and name C5' )  1.0   -120.0  40.0 2 !60 flipped A

!
!A21   
! 
assign ( resid 21 and name O3' )
       ( resid 22 and name P   )
       ( resid 22 and name O5' )
       ( resid 22 and name C5' )  1.0  170.0  40.0 2 ! 
!
!U22  
! 
assign ( resid 22 and name O3' )
       ( resid 23 and name P   )
       ( resid 23 and name O5' )
       ( resid 23 and name C5' )  1.0  -60.0  40.0 2 !
!
!C23   
assign ( resid 23 and name O3' )
       ( resid 24 and name P   )
       ( resid 24 and name O5' )
       ( resid 24 and name C5' )  1.0  -105.0  40.0 2 !
!
!A24   
!
assign ( resid 24 and name O3' )
       ( resid 25 and name P   )
       ( resid 25 and name O5' )
       ( resid 25 and name C5' )  1.0  -90.0  40.0 2 !

!
!G25 
!
assign ( resid 25 and name O3' )
       ( resid 26 and name P   )
       ( resid 26 and name O5' )
       ( resid 26 and name C5' )  1.0 -60.0  60.0 2 !
!
!C26  
!
assign ( resid 26 and name O3' )
       ( resid 27 and name P   )
       ( resid 27 and name O5' )
       ( resid 27 and name C5' )  5.0 -70.0  60.0 2 !
!
!C27  
!
assign ( resid 27 and name O3' )
       ( resid 28 and name P   )
       ( resid 28 and name O5' )
       ( resid 28 and name C5' )  1.0  -70.0  60.0 2 !
!---------------------------------------------------------




!
! zeta
!
! Average -70.0 in residues close to loopE in 1S72
!
! G1 -
! 
assign (resid  1  and name C3') 
       (resid  1  and name O3') 
       (resid  2  and name P  )
       (resid  2  and name O5')  1.0  -70.0 60.0 2 !
! 
! G2 
! 
assign (resid  2  and name C3') 
       (resid  2  and name O3') 
       (resid  3  and name P  )
       (resid  3  and name O5')  1.0  -70.0 60.0 2 ! 
! 
! G3 
! 
assign (resid  3  and name C3') 
       (resid  3  and name O3') 
       (resid  4  and name P  )
       (resid  4  and name O5')  1.0  -70.0 60.0 2 ! 
! 
! C4 
! 
assign (resid  4  and name C3') 
       (resid  4  and name O3') 
       (resid  5  and name P  )
       (resid  5  and name O5')  1.0  -60.0 40.0 2 ! 
! 
! A5 
!
assign (resid  5  and name C3') 
       (resid  5  and name O3') 
       (resid  6  and name P  )
       (resid  6  and name O5')  1.0  -30.0 40.0 2 !
! 
! G6 
! 
assign (resid  6  and name C3') 
       (resid  6  and name O3') 
       (resid  7  and name P  )
       (resid  7  and name O5')  1.0  -70.0 30.0 2 !
! 
! U7 
! 
assign (resid  7  and name C3') 
       (resid  7  and name O3') 
       (resid  8  and name P  )
       (resid  8  and name O5')  1.0  -90.0 40.0 2 !
! 
! G8 
! 
 assign (resid  8  and name C3') 
         (resid  8  and name O3') 
        (resid  9  and name P  )
        (resid  9  and name O5')  1.0  -70.0 40.0 2 !
! 
! A9   
! 
assign (resid  9  and name C3') 
       (resid  9  and name O3') 
       (resid 10  and name P  )
       (resid 10  and name O5')  1.0  -70.0 40.0 2 !
! 
! U10 
! 
assign (resid 10  and name C3') 
       (resid 10  and name O3') 
       (resid 11  and name P  )
       (resid 11  and name O5')  1.0 -70.0 40.0 2 !
! 
! G11
! 
assign (resid 11  and name C3') 
       (resid 11  and name O3') 
       (resid 12  and name P  )
       (resid 12  and name O5')  1.0 -70.0 60.0 2 !
! 
! C12 
! 
assign (resid 12  and name C3') 
       (resid 12  and name O3') 
       (resid 13  and name P  )
       (resid 13  and name O5')  1.0  -65.0 60.0 2 ! 

!-------------------Tetra-loop----------------------------|
!
! U13   
! 
assign (resid 13  and name C3') 
       (resid 13  and name O3') 
       (resid 14  and name P  )
       (resid 14  and name O5')  1.0  -100.0 40.0 2 !
!
! U14 
! 
assign (resid 14  and name C3') 
       (resid 14  and name O3') 
       (resid 15  and name P  )
       (resid 15  and name O5')  1.0  -60.0 40.0 2 ! 
! 
! C15 
! 
assign (resid 15  and name C3') 
       (resid 15  and name O3') 
       (resid 16  and name P  )
       (resid 16  and name O5')  1.0  82.0 40.0 2 !
!
! G16  
! 
assign (resid 16  and name C3') 
       (resid 16  and name O3') 
       (resid 17  and name P  )
       (resid 17  and name O5')  1.0  -105.00 40.0 2 !
!
! G17   
!
assign (resid 17  and name C3') 
       (resid 17  and name O3') 
       (resid 18  and name P  )
       (resid 18  and name O5')  1.0  -65.0 60.0 2 ! 
!
! C18   
! 
assign (resid 18  and name C3') 
       (resid 18  and name O3') 
       (resid 19  and name P  )
       (resid 19  and name O5')  1.0  -70.0 40.0 2 ! 
! 
! A19  
! 
assign (resid 19  and name C3') 
       (resid 19  and name O3') 
       (resid 20  and name P  )
       (resid 20  and name O5')  1.0  -40.0 40.0 2 !
! 
! U20  
!
assign (resid 20  and name C3') 
       (resid 20  and name O3') 
       (resid 21  and name P  )
       (resid 21  and name O5')  1.0  -80.0 40.0 2 ! 
! 
! A21   
!
assign (resid 21  and name C3') 
       (resid 21  and name O3') 
       (resid 22  and name P  )
       (resid 22  and name O5')  1.0  -40.0 40.0 2 !
! 
! U22 
! 
assign (resid 22  and name C3') 
       (resid 22  and name O3') 
       (resid 23  and name P  )
       (resid 23  and name O5')  1.0  -80.0 40.0 2 !
! 
! C23   
! 
assign (resid 23  and name C3') 
       (resid 23  and name O3') 
       (resid 24  and name P  )
       (resid 24  and name O5')  1.0  -75.0 40.0 2 !
! 
! A24  
! 
!
assign (resid 24  and name C3') 
       (resid 24  and name O3') 
       (resid 25  and name P  )
       (resid 25  and name O5')  1.0   -75.0 40 2 ! 
!
! G25  
!
assign (resid 25  and name C3') 
       (resid 25  and name O3') 
       (resid 26  and name P  )
       (resid 26  and name O5')  1.0  -95.0 40.0 2 !
! 
!C26  
!
assign (resid 26  and name C3') 
       (resid 26  and name O3') 
       (resid 27  and name P  )
       (resid 27  and name O5')  1.0  -100.0 60.0 2 !
! 
! C27 
!
assign (resid 27  and name C3') 
       (resid 27  and name O3') 
       (resid 28  and name P  )
       (resid 28  and name O5')  1.0  -70.0 60.0 2 !


!
! backbone Delta from 1IKD
! updated 4/4/07
!
! Delta
!
!
!U13 
assign ( resid 13 and name C5' )
       ( resid 13 and name C4' )
       ( resid 13 and name C3' )
       ( resid 13 and name O3' )  1.0  85.0  30.0 2 !85.0 in 1IKD/82.45 in 1K2G
!
!U14 
assign ( resid 14 and name C5' )
       ( resid 14 and name C4' )
       ( resid 14 and name C3' )
       ( resid 14 and name O3' )  1.0  155.0  30.0 2 !162.0 in 1IKD/151.38 in 1K2G
!
!C15
assign ( resid 15 and name C5' )
       ( resid 15 and name C4' )
       ( resid 15 and name C3' )
       ( resid 15 and name O3' )  1.0  160.0  30.0 2 !162.0 in 1IKD/-93.10 in 1K2G
!
!G16 
assign ( resid 16 and name C5' )
       ( resid 16 and name C4' )
       ( resid 16 and name C3' )
       ( resid 16 and name O3' )  1.0  85.0  30.0 2 !85.0 in 1IKD/85.41 in 1K2G


!Sugar pucker constraints for SLX26
!modified from Sean Moran's y32sugardih.tbl for SLX1
!Dan Harmon 4/3/07
!
!
! G1 - C3' endo 
! 
assign (resid 1  and name O4') 
       (resid 1  and name C4') 
       (resid 1  and name C3') 
       (resid 1  and name C2')  1.0 -36.1  3.0 2 
assign (resid 1  and name C4') 
       (resid 1  and name C3') 
       (resid 1  and name C2') 
       (resid 1  and name C1')  1.0  37.3  3.0 2 
assign (resid 1  and name C3') 
       (resid 1  and name C2') 
       (resid 1  and name C1') 
       (resid 1  and name O4')  1.0 -25.8  3.0 2 
! 
! G2 - C3' endo
! 
assign (resid 2  and name O4') 
       (resid 2  and name C4') 
       (resid 2  and name C3') 
       (resid 2  and name C2')  1.0 -36.1  3.0 2 
assign (resid 2  and name C4') 
       (resid 2  and name C3') 
       (resid 2  and name C2') 
       (resid 2  and name C1')  1.0  37.3  3.0 2 
assign (resid 2  and name C3') 
       (resid 2  and name C2') 
       (resid 2  and name C1') 
       (resid 2  and name O4')  1.0  -25.8  3.0 2 
! 
! G3 - C3' endo 
! 
assign (resid 3  and name O4') 
       (resid 3  and name C4') 
       (resid 3  and name C3') 
       (resid 3  and name C2')  1.0 -36.1  3.0 2 
assign (resid 3  and name C4') 
       (resid 3  and name C3') 
       (resid 3  and name C2') 
       (resid 3  and name C1')  1.0  37.3  3.0 2 
assign (resid 3  and name C3') 
       (resid 3  and name C2') 
       (resid 3  and name C1') 
       (resid 3  and name O4')  1.0 -25.8  3.0 2 
! 
! C4 - C3' endo
! 
assign (resid 4 and name O4') 
       (resid 4 and name C4') 
       (resid 4 and name C3') 
       (resid 4 and name C2')  1.0 -36.1 3.0 2 
assign (resid 4 and name C4') 
       (resid 4 and name C3') 
       (resid 4 and name C2') 
       (resid 4 and name C1')  1.0  37.3 3.0 2 
assign (resid 4 and name C3') 
       (resid 4 and name C2') 
       (resid 4 and name C1') 
       (resid 4 and name O4')  1.0 -25.1 3.0 2 
! 
! A5 - C3' endo 
! 
assign (resid 5 and name O4') 
       (resid 5 and name C4') 
       (resid 5 and name C3') 
       (resid 5 and name C2')  1.0 -36.1 3.0 2 
assign (resid 5 and name C4') 
       (resid 5 and name C3') 
       (resid 5 and name C2') 
       (resid 5 and name C1')  1.0  37.3 3.0 2 
assign (resid 5 and name C3') 
       (resid 5 and name C2') 
       (resid 5 and name C1') 
       (resid 5 and name O4')  1.0 -25.8 3.0 2 
! 
! G6 - C3' endo 
! 
assign (resid 6  and name O4') 
       (resid 6  and name C4') 
       (resid 6  and name C3') 
       (resid 6  and name C2')  1.0 -36.1  3.0 2
assign (resid 6  and name C4') 
       (resid 6  and name C3') 
       (resid 6  and name C2') 
       (resid 6  and name C1')  1.0  37.3 3.0 2
assign (resid 6  and name C3') 
       (resid 6  and name C2') 
       (resid 6  and name C1') 
       (resid 6  and name O4')  1.0 -25.8  3.0 2

! 
! U7 - C3' endo 
! 
assign (resid 7  and name O4') 
       (resid 7  and name C4') 
       (resid 7  and name C3') 
       (resid 7  and name C2')  1.0 -36.1  3.0 2 
assign (resid 7  and name C4') 
       (resid 7  and name C3') 
       (resid 7  and name C2') 
       (resid 7  and name C1')  1.0  37.3  3.0 2 
assign (resid 7  and name C3') 
       (resid 7  and name C2') 
       (resid 7  and name C1') 
       (resid 7  and name O4')  1.0 -25.1  3.0 2 
! 
! G8 - C2' endo, more likely, changed 05-26-2011
! 
assign (resid 8  and name O4') 
       (resid 8  and name C4') 
       (resid 8  and name C3') 
       (resid 8  and name C2')  1.0 33.3  3.0 2 !
assign (resid 8  and name C4') 
       (resid 8  and name C3') 
       (resid 8  and name C2') 
       (resid 8  and name C1')  1.0 -34.9 3.0 2 !
assign (resid 8  and name C3') 
       (resid 8  and name C2') 
       (resid 8  and name C1') 
       (resid 8  and name O4')  1.0 24.9  3.0 2!

! 
! A9 - C3' endo - changed 05-26-2011
! 
assign (resid 9  and name O4') 
       (resid 9  and name C4') 
       (resid 9  and name C3') 
       (resid 9  and name C2')  1.0 -36.1  3.0 2 !
assign (resid 9  and name C4') 
       (resid 9  and name C3') 
       (resid 9  and name C2') 
       (resid 9  and name C1')  1.0  37.3  3.0 2 !
assign (resid 9  and name C3') 
       (resid 9  and name C2') 
       (resid 9  and name C1') 
       (resid 9  and name O4')  1.0 -25.1  3.0 2 !
! 
! U10 - C3' endo 
! 
assign (resid 10  and name O4') 
       (resid 10  and name C4') 
       (resid 10  and name C3') 
       (resid 10  and name C2')  1.0  -36.1  3.0 2 !
assign (resid 10  and name C4') 
       (resid 10  and name C3') 
       (resid 10  and name C2') 
       (resid 10  and name C1')  1.0  37.3  3.0 2 !
assign (resid 10  and name C3') 
       (resid 10  and name C2') 
       (resid 10  and name C1') 
       (resid 10  and name O4')  1.0  -25.1  3.0 2 !
! 
! G11 -  - 
! 
assign (resid 11  and name O4') 
       (resid 11  and name C4') 
       (resid 11  and name C3') 
       (resid 11  and name C2')  1.0 -36.1  3.0 2 
assign (resid 11  and name C4') 
       (resid 11  and name C3') 
       (resid 11  and name C2') 
       (resid 11  and name C1')  1.0  37.3  3.0 2 
assign (resid 11  and name C3') 
       (resid 11  and name C2') 
       (resid 11  and name C1') 
       (resid 11  and name O4')  1.0 -25.8  3.0 2 
! 
! C12 - C3' endo from real 38mer
!
assign (resid 12  and name O4') 
       (resid 12  and name C4') 
       (resid 12  and name C3') 
       (resid 12  and name C2')  1.0 -36.1  3.0 2 !
assign (resid 12  and name C4') 
       (resid 12  and name C3') 
       (resid 12  and name C2') 
       (resid 12  and name C1')  1.0  37.3  3.0 2 !
assign (resid 12  and name C3') 
       (resid 12  and name C2') 
       (resid 12  and name C1') 
       (resid 12  and name O4')  1.0 -25.8  3.0 2 !
! 
! U13  - C3' endo 
! 
assign (resid 13  and name O4') 
       (resid 13  and name C4') 
       (resid 13  and name C3') 
       (resid 13  and name C2')  1.0 -36.1 3.0 2 !
assign (resid 13  and name C4') 
       (resid 13  and name C3') 
       (resid 13  and name C2') 
       (resid 13  and name C1')  1.0  37.3 3.0 2 !
assign (resid 13  and name C3') 
       (resid 13  and name C2') 
       (resid 13  and name C1') 
       (resid 13  and name O4')  1.0 -25.8 3.0 2 !
! 
! U14 - 
! 
assign (resid 14  and name O4') 
       (resid 14  and name C4') 
       (resid 14  and name C3') 
       (resid 14  and name C2')  1.0  33.3  3.0 2 !
assign (resid 14  and name C4') 
       (resid 14  and name C3') 
       (resid 14  and name C2') 
       (resid 14  and name C1')  1.0 -34.9  3.0 2 !
assign (resid 14  and name C3') 
       (resid 14  and name C2') 
       (resid 14  and name C1') 
       (resid 14  and name O4')  1.0  24.9  3.0 2 !
! 
! C15 - C2' endo
! 
assign (resid 15  and name O4') 
       (resid 15  and name C4') 
       (resid 15  and name C3') 
       (resid 15  and name C2')  1.0  33.3  3.0 2 !
assign (resid 15  and name C4') 
       (resid 15  and name C3') 
       (resid 15  and name C2') 
       (resid 15  and name C1')  1.0 -34.9  3.0 2 !
assign (resid 15  and name C3') 
       (resid 15  and name C2') 
       (resid 15  and name C1') 
       (resid 15  and name O4')  1.0  24.9  3.0 2 !
! 
! G16 - C3' endo
! 
assign (resid 16  and name O4') 
       (resid 16  and name C4') 
       (resid 16  and name C3') 
       (resid 16  and name C2')  1.0  -36.1  3.0 2 !
assign (resid 16  and name C4') 
       (resid 16  and name C3') 
       (resid 16  and name C2') 
       (resid 16  and name C1')  1.0  37.3  3.0 2 !
assign (resid 16  and name C3') 
       (resid 16  and name C2') 
       (resid 16  and name C1') 
       (resid 16  and name O4')  1.0  -25.8  3.0 2 !

!
!chi G16-syn
!
assign (resid 16  and name O4') 
       (resid 16  and name C1') 
       (resid 16  and name N9) 
       (resid 16  and name C4) 1.0 55.0 15.0 2 !
assign (resid 16  and name C2') 
       (resid 16  and name C1') 
       (resid 16  and name N9) 
       (resid 16  and name C8) 1.0 115.0 15.0 2 !

! 
! G17 - C3' endo
! 
assign (resid 17 and name O4') 
       (resid 17 and name C4') 
       (resid 17 and name C3') 
       (resid 17 and name C2')  1.0 -36.1 3.0 2 !
assign (resid 17 and name C4') 
       (resid 17 and name C3') 
       (resid 17 and name C2') 
       (resid 17 and name C1')  1.0  37.3 3.0 2 !
assign (resid 17 and name C3') 
       (resid 17 and name C2') 
       (resid 17 and name C1') 
       (resid 17 and name O4')  1.0 -25.8 3.0 2 !
! 
!C18 - 
!
assign (resid 18 and name O4')
       (resid 18 and name C4')
       (resid 18 and name C3')
       (resid 18 and name C2')  1.0 -36.1  3.0 2 !
assign (resid 18 and name C4')
       (resid 18 and name C3')
       (resid 18 and name C2')
       (resid 18 and name C1')  1.0  37.3  3.0 2 !
assign (resid 18 and name C3')
       (resid 18 and name C2')
       (resid 18 and name C1')
       (resid 18 and name O4')  1.0  -25.8  3.0 2 !
!
!A19 - 
!
assign (resid 19 and name O4')
       (resid 19 and name C4')
       (resid 19 and name C3')
       (resid 19 and name C2')  1.0  -36.1  3.0 2 !
assign (resid 19 and name C4')
       (resid 19 and name C3')
       (resid 19 and name C2')
       (resid 19 and name C1')  1.0  37.3  3.0 2 !
assign (resid 19 and name C3')
       (resid 19 and name C2')
       (resid 19 and name C1')
       (resid 19 and name O4')  1.0  -25.8  3.0 2 !
! 
! U20 - C3' endo
! 
assign (resid 20  and name O4') 
       (resid 20  and name C4') 
       (resid 20  and name C3') 
       (resid 20  and name C2')  1.0  -36.1  3.0 2 !
assign (resid 20  and name C4') 
       (resid 20  and name C3') 
       (resid 20  and name C2') 
       (resid 20  and name C1')  1.0  37.3  3.0 2 !
assign (resid 20  and name C3') 
       (resid 20  and name C2') 
       (resid 20  and name C1') 
       (resid 20  and name O4')  1.0  -25.8  3.0 2 !



! 
! A21 - C3' endo
!
assign (resid 21  and name O4') 
       (resid 21  and name C4') 
       (resid 21  and name C3') 
       (resid 21  and name C2')  1.0  -36.1  3.0 2 !
assign (resid 21  and name C4') 
       (resid 21  and name C3') 
       (resid 21  and name C2') 
       (resid 21  and name C1')  1.0  37.3  3.0 2 !
assign (resid 21  and name C3') 
       (resid 21  and name C2') 
       (resid 21  and name C1') 
       (resid 21  and name O4')  1.0  -25.8  3.0 2 !
! 
! U22 
! 
assign (resid 22 and name O4') 
       (resid 22 and name C4') 
       (resid 22 and name C3') 
       (resid 22 and name C2')  1.0 -36.1 3.0 2 
assign (resid 22 and name C4') 
       (resid 22 and name C3') 
       (resid 22 and name C2') 
       (resid 22 and name C1')  1.0  37.3 3.0 2 
assign (resid 22 and name C3') 
       (resid 22 and name C2') 
       (resid 22 and name C1') 
       (resid 22 and name O4')  1.0 -25.8 3.0 2 
! 
! C23 - C3' endo
! 
assign (resid 23 and name O4') 
       (resid 23 and name C4') 
       (resid 23 and name C3') 
       (resid 23 and name C2')  1.0 -36.1 3.0 2 
assign (resid 23 and name C4') 
       (resid 23 and name C3') 
       (resid 23 and name C2') 
       (resid 23 and name C1')  1.0  37.3 3.0 2 
assign (resid 23 and name C3') 
       (resid 23 and name C2') 
       (resid 23 and name C1') 
       (resid 23 and name O4')  1.0 -25.8 3.0 2 
! 
! A24 - C3' endo
! 
assign (resid 24 and name O4') 
       (resid 24 and name C4') 
       (resid 24 and name C3') 
       (resid 24 and name C2')  1.0 -36.1 3.0 2 
assign (resid 24 and name C4') 
       (resid 24 and name C3') 
       (resid 24 and name C2') 
       (resid 24 and name C1')  1.0  37.3 3.0 2 
assign (resid 24 and name C3') 
       (resid 24 and name C2') 
       (resid 24 and name C1') 
       (resid 24 and name O4')  1.0 -25.8 3.0 2 
! 
! G25 - C3' endo
! 
assign (resid 25 and name O4') 
       (resid 25 and name C4') 
       (resid 25 and name C3') 
       (resid 25 and name C2')  1.0 -36.1 3.0 2 
assign (resid 25 and name C4') 
       (resid 25 and name C3') 
       (resid 25 and name C2') 
       (resid 25 and name C1')  1.0  37.3 3.0 2 
assign (resid 25 and name C3') 
       (resid 25 and name C2') 
       (resid 25 and name C1') 
       (resid 25 and name O4')  1.0 -25.8 3.0 2 
! 
! C26 - 
! 
assign (resid 26  and name O4') 
       (resid 26  and name C4') 
       (resid 26  and name C3') 
       (resid 26  and name C2')  1.0 -36.1 3.0 2 
assign (resid 26  and name C4') 
       (resid 26  and name C3') 
       (resid 26  and name C2') 
       (resid 26  and name C1')  1.0  37.3 3.0 2 
assign (resid 26  and name C3') 
       (resid 26  and name C2') 
       (resid 26  and name C1') 
       (resid 26  and name O4')  1.0 -25.8 3.0 2 
! 
! C27 - C3' endo from slx26 A5
! 
assign (resid 27  and name O4') 
       (resid 27  and name C4') 
       (resid 27  and name C3') 
       (resid 27  and name C2')  1.0 -36.1  3.0 2 !
assign (resid 27  and name C4') 
       (resid 27  and name C3') 
       (resid 27  and name C2') 
       (resid 27  and name C1')  1.0  37.3  3.0 2 !
assign (resid 27  and name C3') 
       (resid 27  and name C2') 
       (resid 27  and name C1') 
       (resid 27  and name O4')  1.0 -25.8  3.0 2 !
! 
! C28 - no data from real 38mer - 
! 
assign (resid 28  and name O4') 
       (resid 28  and name C4') 
       (resid 28  and name C3') 
       (resid 28  and name C2')  1.0 -36.1  3.0 2 !
assign (resid 28  and name C4') 
       (resid 28  and name C3') 
       (resid 28  and name C2') 
       (resid 28  and name C1')  1.0  37.3  3.0 2 !
assign (resid 28  and name C3') 
       (resid 28  and name C2') 
       (resid 28  and name C1') 
       (resid 28  and name O4')  1.0 -25.8  3.0 2 !



! base pair tortional restraints SLX26
! updated 09/24/07 by jwang
!
!

!
!G1-C28
assign (resid 1  and name C5 )
       (resid 1  and name C6 )
       (resid 1  and name N1 )
       (resid 28 and name N3 )  10.0 180.0 5.0 2
assign (resid 1  and name C5 ) 
       (resid 1  and name C6 ) 
       (resid 1  and name O6 )
       (resid 28 and name N4 )  10.0 180.0 5.0 2

!
!G2-C27
assign (resid 2  and name C5 )
       (resid 2  and name C6 )
       (resid 2  and name N1 )
       (resid 27 and name N3 )  10.0 180.0 5.0 2
assign (resid 2  and name C5 ) 
       (resid 2  and name C6 ) 
       (resid 2  and name O6 )
       (resid 27 and name N4 )  10.0 180.0 5.0 2
!
!G3-C26
assign (resid 3  and name C5 )
       (resid 3  and name C6 )
       (resid 3  and name N1 )
       (resid 26 and name N3 )  10.0 180.0 5.0  2
assign (resid 3  and name C5 ) 
       (resid 3  and name C6 ) 
       (resid 3  and name O6 )
       (resid 26 and name N4 )  10.0 180.0 5.0 2
!
!C4-G25
assign (resid 25 and name C5 ) 
       (resid 25 and name C6 ) 
       (resid 25 and name N1 )
       (resid 4  and name N3 )  10.0 180 5.0 2
assign (resid 25 and name C5 ) 
       (resid 25 and name C6 ) 
       (resid 25 and name O6 )
       (resid 4  and name N4 )  10.0 180 5.0 2
!
!G6-C23 - loose base pair - added 05-26-2011
assign (resid 6  and name C5 )
       (resid 6  and name C6 )
       (resid 6  and name N1 )
       (resid 23 and name N3 )  10.0 180.0 5.0  2
assign (resid 6  and name C5 ) 
       (resid 6  and name C6 ) 
       (resid 6  and name O6 )
       (resid 23 and name N4 )  10.0 180.0 5.0 2
!
!U7-U22 *** Weak Base Pair, 
!UU imino-4-carbonyl U22 O4 acceptor (U7O2-U22H3/U7H3-U22O4) 
assign (resid 7  and name N1 ) 
       (resid 7  and name C2 ) 
       (resid 7  and name O2 )
       (resid 22  and name N3 )  10.0 180 5.0 2
assign (resid 22  and name C5 ) 
       (resid 22  and name C4 ) 
       (resid 22  and name O4 )
       (resid 7  and name N3 )  10.0 180 5.0 2
!
!G8-A21 very weak sheared G8-A21
assign (resid  8 and name N1 ) 
       (resid  8 and name C2 ) 
       (resid  8 and name N3 )
       (resid 21 and name N6 )  10.0 180 10.0 2
assign (resid 21 and name C4 ) 
       (resid 21 and name C5 ) 
       (resid 21 and name N7 )
       (resid  8 and name N2 )  10.0 180 10.0 2
assign (resid 21 and name N1 ) 
       (resid 21 and name C6 ) 
       (resid 21 and name N6 )
       (resid  8 and name N3 )  10.0 180 10.0 2
!
!A9-U20 - Very weak bp - 
assign (resid 9   and name C5 ) 
       (resid 9   and name C6 ) 
       (resid 9   and name N1 )
       (resid 20  and name N3 )  30.0 180 5.0 2
assign (resid 9   and name C5 ) 
       (resid 9   and name C6 ) 
       (resid 9   and name N6 )
       (resid 20  and name O4 )  30.0 180 5.0 2

!A19-U10 regular A-U bp
assign (resid 19  and name C5 ) 
       (resid 19  and name C6 ) 
       (resid 19  and name N1 )
       (resid 10  and name N3 )  10.0 180 5.0 2
assign (resid 19  and name C5 ) 
       (resid 19  and name C6 ) 
       (resid 19  and name N6 )
       (resid 10 and name O4 )  10.0 180 5.0 2
!
!G11-C18
assign (resid 11 and name C5 )
       (resid 11 and name C6 )
       (resid 11 and name N1 )
       (resid 18 and name N3 )  5.0 180.0 5.0 2
assign (resid 11 and name C5 ) 
       (resid 11 and name C6 ) 
       (resid 11 and name O6 )
       (resid 18 and name N4 )  5.0 180.0 5.0 2


!G17-C12
assign (resid 17 and name C5 )
       (resid 17 and name C6 )
       (resid 17 and name N1 )
       (resid 12 and name N3 )  5.0 180.0 5.0 2
assign (resid 17 and name C5 ) 
       (resid 17 and name C6 ) 
       (resid 17 and name O6 )
       (resid 12 and name N4 )  5.0 180.0 5.0 2

!
! Modified by jwang 
! a summarize noed table combined by hhnoeDH.tbl and hbnoe.tbl
! Same as Selex28_A5_hbonds_v6.tbl
!


!
! G1-C28
!
assign ( resid  1 and name O6   ) ( resid 28 and name H41  ) 2.00 0.2 0.4
assign ( resid  1 and name O6   ) ( resid 28 and name N4   ) 2.90 0.3 0.6
assign ( resid  1 and name H1   ) ( resid 28 and name N3   ) 2.00 0.2 0.4
assign ( resid  1 and name N1   ) ( resid 28 and name N3   ) 2.90 0.3 0.6
assign ( resid  1 and name H21  ) ( resid 28 and name O2   ) 2.00 0.2 0.4
assign ( resid  1 and name N2   ) ( resid 28 and name O2   ) 2.90 0.3 0.6
!
! G2-C27
!
assign ( resid  2 and name O6   ) ( resid 27 and name H41  ) 2.00 0.2 0.4
assign ( resid  2 and name O6   ) ( resid 27 and name N4   ) 2.90 0.3 0.6
assign ( resid  2 and name H1   ) ( resid 27 and name N3   ) 2.00 0.2 0.4
assign ( resid  2 and name N1   ) ( resid 27 and name N3   ) 2.90 0.3 0.6
assign ( resid  2 and name H21  ) ( resid 27 and name O2   ) 2.00 0.2 0.4
assign ( resid  2 and name N2   ) ( resid 27 and name O2   ) 2.90 0.3 0.6
!
! G3-C26
!
assign ( resid  3 and name O6   ) ( resid 26 and name H41  ) 2.00 0.2 0.4
assign ( resid  3 and name O6   ) ( resid 26 and name N4   ) 2.90 0.3 0.6
assign ( resid  3 and name H1   ) ( resid 26 and name N3   ) 2.00 0.2 0.4
assign ( resid  3 and name N1   ) ( resid 26 and name N3   ) 2.90 0.3 0.6
assign ( resid  3 and name H21  ) ( resid 26 and name O2   ) 2.00 0.2 0.4
assign ( resid  3 and name N2   ) ( resid 26 and name O2   ) 2.90 0.3 0.6
!
! C4-G25
!
assign ( resid 25 and name O6   ) ( resid  4 and name H41  ) 2.00 0.2 0.4
assign ( resid 25 and name O6   ) ( resid  4 and name N4   ) 2.90 0.3 0.6
assign ( resid 25 and name H1   ) ( resid  4 and name N3   ) 2.00 0.2 0.4
assign ( resid 25 and name N1   ) ( resid  4 and name N3   ) 2.90 0.3 0.6
assign ( resid 25 and name H21  ) ( resid  4 and name O2   ) 2.00 0.2 0.4
assign ( resid 25 and name N2   ) ( resid  4 and name O2   ) 2.90 0.3 0.6

!
!A5-A24 ***NO evidence for H-bonding***
!

!
! G6-C23 very loose base pair
! 
assign ( resid  6 and name O6   ) ( resid 23 and name H41  ) 2.50 1.5 0.2
assign ( resid  6 and name O6   ) ( resid 23 and name N4   ) 3.30 1.5 0.4
assign ( resid  6 and name H1   ) ( resid 23 and name N3   ) 2.50 1.5 0.2
assign ( resid  6 and name N1   ) ( resid 23 and name N3   ) 3.30 1.5 0.4
assign ( resid  6 and name H21  ) ( resid 23 and name O2   ) 2.40 1.5 0.2
assign ( resid  6 and name N2   ) ( resid 23 and name O2   ) 3.30 1.5 0.4

!
!U7-U22 - WEAK base pair -added on July-24-2009
!UU imino-4-carbonyl U22O4 h acceptor (U7O2-U22H3/U7H3-U22O4)
!
assign ( resid 22 and name H3  ) ( resid 7 and name O2   ) 2.40 1.5 0.2 
assign ( resid 22 and name N3  ) ( resid 7 and name O2   ) 3.40 1.5 0.4  
assign ( resid 22 and name O4  ) ( resid 7 and name H3   ) 2.40 1.5 0.2  
assign ( resid 22 and name O4  ) ( resid 7 and name N3   ) 3.40 1.5 0.4  

assign ( resid 22 and name C4 ) ( resid 7 and name N3 ) 3.7 1.5 0.4 
assign ( resid 22 and name N3 ) ( resid 7 and name N3 ) 3.8 1.5 0.4 
assign ( resid 22 and name N3 ) ( resid 7 and name C2 ) 3.9 1.5 0.4 
assign ( resid 22 and name C4 ) ( resid 7 and name O2 ) 3.9 1.5 0.4
assign ( resid 22 and name C2 ) ( resid 7 and name O2 ) 3.9 1.5 0.4 

!
!A21-G8 Weak sheared A-G 
!
assign ( resid 21 and name H61  ) ( resid 8 and name N3   ) 3.10 0.2 0.5 !
assign ( resid 21 and name N6  ) ( resid 8 and name N3   ) 3.50 0.3 0.5 !
assign ( resid 21 and name N7  ) ( resid 8 and name H21   ) 3.10 0.2 0.5 !
assign ( resid 21 and name N7  ) ( resid 8 and name N2   ) 3.50 0.3 0.5 !

!
! U20-A9 - weak AU bp
!
assign ( resid 9 and name H61  ) ( resid 20 and name O4   ) 3.00 0.4 0.2
assign ( resid 9 and name N6   ) ( resid 20 and name O4   ) 3.50 0.6 0.2
assign ( resid 9 and name N1   ) ( resid 20 and name H3   ) 3.00 0.4 0.2
assign ( resid 9 and name N1   ) ( resid 20 and name N3   ) 3.50 0.6 0.2

!
! U10-A19 regular AU bp
!
assign ( resid 19 and name H61  ) ( resid 10 and name O4   ) 2.00 0.2 0.4
assign ( resid 19 and name N6   ) ( resid 10 and name O4   ) 2.90 0.3 0.6
assign ( resid 19 and name N1   ) ( resid 10 and name H3   ) 2.00 0.2 0.4
assign ( resid 19 and name N1   ) ( resid 10 and name N3   ) 2.90 0.3 0.6

!
! G11-C18
!
assign ( resid  11 and name O6   ) ( resid 18 and name H41  ) 2.00 0.2 0.4
assign ( resid  11 and name O6   ) ( resid 18 and name N4   ) 2.90 0.3 0.6
assign ( resid  11 and name H1   ) ( resid 18 and name N3   ) 2.00 0.2 0.4
assign ( resid  11 and name N1   ) ( resid 18 and name N3   ) 2.90 0.3 0.6
assign ( resid  11 and name H21  ) ( resid 18 and name O2   ) 2.00 0.2 0.4
assign ( resid  11 and name N2   ) ( resid 18 and name O2   ) 2.90 0.3 0.6

!
! C12-G17
!
assign ( resid 12 and name H41  ) ( resid 17 and name O6   ) 2.00 0.2 0.4
assign ( resid 12 and name N4   ) ( resid 17 and name O6   ) 2.90 0.3 0.6
assign ( resid 12 and name N3   ) ( resid 17 and name H1   ) 2.00 0.2 0.4
assign ( resid 12 and name N3   ) ( resid 17 and name N1   ) 2.90 0.3 0.6
assign ( resid 12 and name O2   ) ( resid 17 and name H21  ) 2.00 0.2 0.4
assign ( resid 12 and name O2   ) ( resid 17 and name N2   ) 2.90 0.3 0.6



















!
! Modified by jwang 
! a summarize noed table combined by hhnoeDH.tbl and hbnoe.tbl
! Same as Selex28_A5_noe_v5.tbl
!



! H2O NOESY AMINOS (List)            
!--------------------------------------------------------------------------------                 
!distance H20 Noesy 2D DATA             
!semiquantitative interproton distances s=4 m=5 w=6 vw=7         
!in xplor                  in xplor-nih also could be
!s=4 2.2 0                   2.9 1.1 1.1
!m=5 3.2 0                   3.4 1.6 1.6
!w=6 4.2 0                   3.9 2.1 2.1
!vw=7 5.2 0                  4.4 2.6 2.6 
!--------------------------------------------------------------------------------   

!
!Base to 1' region                                                        
!
assign ( resid 1 and name H8 ) ( resid 1 and name H1' ) 5.0 3.2 0 !M      
assign ( resid 1 and name H1' ) ( resid 2 and name H8 ) 5.0 3.2 0 !M
assign ( resid 2 and name H8 ) ( resid 2 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 2 and name H1' ) ( resid 3 and name H8 ) 6.0 4.2 0 !W 
assign ( resid 3 and name H8 ) ( resid 3 and name H1' ) 6.0 4.2 0 !W
assign ( resid 3 and name H1' ) ( resid 4 and name H6 ) 6.0 4.2 0 !W 
assign ( resid 4 and name H6 ) ( resid 4 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 4 and name H1' ) ( resid 5 and name H8 ) 5.0 3.2 0 !M
assign ( resid 5 and name H8 ) ( resid 5 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 5 and name H1' ) ( resid 6 and name H8 ) 6.0 4.2 0 !W 
assign ( resid 6 and name H8 ) ( resid 6 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 6 and name H1' ) ( resid 7 and name H6 ) 7.0 5.2 0 !VW 
assign ( resid 7 and name H6 ) ( resid 7 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 7 and name H1' ) ( resid 8 and name H8 ) 7.0 5.2 0 !VW
assign ( resid 8 and name H8 ) ( resid 8 and name H1' ) 4.0 2.2 0 !S 
assign ( resid 8 and name H1' ) ( resid 9 and name H8 ) 5.0 3.2 0 !M 
assign ( resid 9 and name H8 ) ( resid 9 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 9 and name H1' ) ( resid 10 and name H6 ) 6.0 4.2 0 !W 
assign ( resid 10 and name H6 ) ( resid 10 and name H1' ) 7.0 5.2 0 !VW
assign ( resid 10 and name H1' ) ( resid 11 and name H8 ) 6.0 4.2 0 !W 
assign ( resid 11 and name H8 ) ( resid 11 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 11 and name H1' ) ( resid 12 and name H6 ) 5.0 3.2 0 !M 
assign ( resid 12 and name H6 ) ( resid 12 and name H1' ) 5.0 3.2 0 !M
assign ( resid 12 and name H1' ) ( resid 13 and name H6 ) 6.0 4.2 0 !W
assign ( resid 13 and name H6 ) ( resid 13 and name H1' ) 5.0 3.2 0 !M
assign ( resid 13 and name H1' ) ( resid 14 and name H6 ) 6.0 4.2 0 !W
assign ( resid 13 and name H1' ) ( resid 15 and name H6 ) 6.0 4.2 0 !W
assign ( resid 13 and name H1' ) ( resid 16 and name H8 ) 6.0 4.2 0 !W
assign ( resid 14 and name H6 ) ( resid 14 and name H1' ) 4.0 2.2 0 !S
assign ( resid 14 and name H1' ) ( resid 15 and name H6 ) 5.0 3.2 0 !M
assign ( resid 14 and name H1' ) ( resid 16 and name H8 ) 5.0 3.2 0 !M
assign ( resid 15 and name H6 ) ( resid 15 and name H1' ) 5.0 3.2 0 !M 
assign ( resid 15 and name H1' ) ( resid 16 and name H8 ) 6.0 4.2 0 !W
assign ( resid 16 and name H8 ) ( resid 16 and name H1' ) 4.0 2.2 0 !S
assign ( resid 16 and name H1' ) ( resid 17 and name H8 ) 6.0 4.2 0 !W
assign ( resid 17 and name H8 ) ( resid 17 and name H1' ) 5.0 3.2 0 !M 
assign ( resid 17 and name H8 ) ( resid 18 and name H1' ) 5.0 3.2 0 !M 
assign ( resid 18 and name H6 ) ( resid 18 and name H1' ) 5.0 3.2 0 !M 
assign ( resid 18 and name H6 ) ( resid 18 and name H1' ) 5.0 3.2 0 !M 
assign ( resid 18 and name H1' ) ( resid 19 and name H8 ) 5.0 3.2 0 !M 
assign ( resid 19 and name H8 ) ( resid 19 and name H1' ) 6.0 4.2 0 !W
assign ( resid 19 and name H1' ) ( resid 20 and name H6 ) 6.0 4.2 0 !W 
assign ( resid 20 and name H6 ) ( resid 20 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 20 and name H1' ) ( resid 21 and name H8 ) 6.0 4.2 0 !W 
assign ( resid 21 and name H8 ) ( resid 21 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 21 and name H1' ) ( resid 22 and name H6 ) 6.0 4.2 0 !W 
assign ( resid 22 and name H6 ) ( resid 22 and name H1' ) 6.0 4.2 0 !W 
assign ( resid 22 and name H1' ) ( resid 23 and name H6 ) 6.0 4.2 0 !W 
assign ( resid 23 and name H6 ) ( resid 23 and name H1' ) 6.0 4.2 0 !W
assign ( resid 23 and name H1' ) ( resid 24 and name H8 ) 5.0 3.2 0 !M 
assign ( resid 24 and name H8 ) ( resid 24 and name H1' ) 5.0 3.2 0 !M 
assign ( resid 24 and name H1' ) ( resid 25 and name H8 ) 7.0 5.2 0 !VW
assign ( resid 25 and name H8 ) ( resid 25 and name H1' ) 6.0 4.2 0 !W
assign ( resid 25 and name H1' ) ( resid 26 and name H6 ) 7.0 5.2 0 !VW
assign ( resid 26 and name H6 ) ( resid 26 and name H1' ) 5.0 3.2 0 !M 
assign ( resid 27 and name H6 ) ( resid 27 and name H1' ) 5.0 3.2 0 !M
assign ( resid 28 and name H6 ) ( resid 28 and name H1' ) 6.0 4.2 0 !W 


!
!
!H5-H6 intra-residue for U & C                                          
!
!                                                          
assign ( resid 4 and name H5 ) ( resid 4 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 7 and name H5 ) ( resid 7 and name H6 ) 4.0 2.2 0 !VS 
assign ( resid 10 and name H5 ) ( resid 10 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 12 and name H5 ) ( resid 12 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 13 and name H5 ) ( resid 13 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 14 and name H5 ) ( resid 14 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 15 and name H5 ) ( resid 15 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 18 and name H5 ) ( resid 18 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 20 and name H5 ) ( resid 20 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 22 and name H5 ) ( resid 22 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 23 and name H5 ) ( resid 23 and name H6 ) 3.0 1.2 0 !VS  
assign ( resid 26 and name H5 ) ( resid 26 and name H6 ) 3.0 1.2 0 !VS  
assign ( resid 27 and name H5 ) ( resid 27 and name H6 ) 3.0 1.2 0 !VS 
assign ( resid 28 and name H5 ) ( resid 28 and name H6 ) 3.0 1.2 0 !VS 

!
!
!C & U H5-H6/8 (inter)
!                                               
assign ( resid 4 and name H5 ) ( resid 3 and name H8 )  7.0 5.2 0 !VW  
assign ( resid 7 and name H5 ) ( resid 6 and name H8 )  7.0 5.2 0 !VW 
assign ( resid 10 and name H5 ) ( resid 9 and name H8 )  6.0 4.2 0 !W 
assign ( resid 18 and name H5 ) ( resid 17 and name H8 )  7.0 5.2 0 !VW 
assign ( resid 20 and name H5 ) ( resid 19 and name H8 )  7.0 5.2 0 !VW 
assign ( resid 22 and name H5 ) ( resid 21 and name H8 )  6.0 4.2 0 !W  
assign ( resid 26 and name H5 ) ( resid 25 and name H8 )  7.0 5.2 0 !VW  

!    
!Adenosine H2                                                              
!
assign ( resid 5 and name H2 ) ( resid 24 and name H2 )  6.0 5.2 0 !W 
assign ( resid 9 and name H2 ) ( resid 21 and name H2 )  7.0 5.2 0 !VW 
assign ( resid 9 and name H2 ) ( resid 21 and name H1' )  6.0 5.2 0 !W 
assign ( resid 9 and name H2 ) ( resid 10 and name H1' )  6.0 5.2 0 !W 
assign ( resid 19 and name H2 ) ( resid 9 and name H1' ) 7.0 5.2 0 !VW 
assign ( resid 19 and name H2 ) ( resid 20 and name H1' )  6.0 5.2 0 !W 
assign ( resid 21 and name H2 ) ( resid 9 and name H8 )  7.0 5.2 0 !VW 
assign ( resid 21 and name H2 ) ( resid 9 and name H1' )  7.0 5.2 0 !VW
assign ( resid 21 and name H2 ) ( resid 22 and name H1' )  5.0 4.2 0 !M 
assign ( resid 24 and name H2 ) ( resid 6 and name H1' ) 6.0 5.2 0 !W 
assign ( resid 24 and name H2 ) ( resid 25 and name H1' ) 5.0 4.2 0 !M 

!
!H6/8-H6/8 (sequential) 
!                                                                
assign ( resid 4 and name H6 ) ( resid 5 and name H8 ) 7.0 5.2 0 !VW 
assign ( resid 10 and name H6 ) ( resid 9 and name H8 ) 6.0 4.2 0 !W 
assign ( resid 10 and name H6 ) ( resid 11 and name H8 ) 6.0 4.2 0 !W  
assign ( resid 11 and name H8 ) ( resid 12 and name H6 ) 6.0 4.2 0 !W  
assign ( resid 12 and name H6 ) ( resid 13 and name H6 ) 7.0 5.2 0 !VW 
assign ( resid 17 and name H8 ) ( resid 18 and name H6 ) 7.0 5.2 0 !VW 
assign ( resid 18 and name H6 ) ( resid 19 and name H8 ) 6.0 4.2 0 !W  
assign ( resid 19 and name H8 ) ( resid 20 and name H6 ) 7.0 5.2 0 !VW 
assign ( resid 21 and name H8 ) ( resid 22 and name H6 ) 7.0 5.2 0 !VW 
assign ( resid 22 and name H6 ) ( resid 23 and name H6 ) 6.0 4.2 0 !W  
assign ( resid 23 and name H6 ) ( resid 24 and name H8 ) 6.0 4.2 0 !W 
assign ( resid 24 and name H8 ) ( resid 25 and name H8 ) 7.0 5.2 0 !VW 
assign ( resid 27 and name H6 ) ( resid 28 and name H6 ) 6.0 4.2 0 !W 

!
!H1'-H1'                                                
!
assign ( resid 15 and name H1' ) ( resid 14 and name H1' ) 7.0 5.2 0 !VW 

!
!H1'-H5 
!
assign ( resid 9 and name H1' ) (resid 10 and name H5 ) 6.0 4.2 0 !W  
assign ( resid 15 and name H1' ) ( resid 15 and name H5 ) 7.0 5.2 0 !VW 
assign ( resid 26 and name H1' ) ( resid 26 and name H5 ) 7.0 5.2 0 !VW 



!
!base H6/H8 to ribose (inter+intra)             
!
!G1-H8 
!
assign ( resid 1 and name H8 ) ( resid 1 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 1 and name H8 ) ( resid 1 and name H3' ) 4.0 2.2 0 !S
assign ( resid 1 and name H8 ) ( resid 1 and name H4' ) 5.0 3.2 0 !M
assign ( resid 1 and name H8 ) ( resid 1 and name H5' ) 4.0 2.2 0 !S
assign ( resid 1 and name H8 ) ( resid 1 and name H5'' ) 5.0 3.2 0 !M
!
!G2-H8 
!
assign ( resid 2 and name H8 ) ( resid 1 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 2 and name H8 ) ( resid 1 and name H3' ) 4.0 2.2 0 !S
assign ( resid 2 and name H8 ) ( resid 1 and name H4' ) 6.0 4.2 0 !W
!
assign ( resid 2 and name H8 ) ( resid 2 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 2 and name H8 ) ( resid 2 and name H3' ) 4.0 2.2 0 !S
assign ( resid 2 and name H8 ) ( resid 2 and name H4' ) 5.0 3.2 0 !M
assign ( resid 2 and name H8 ) ( resid 2 and name H5' ) 4.0 2.2 0 !S
assign ( resid 2 and name H8 ) ( resid 2 and name H5'' ) 5.0 3.2 0 !M

!
!G3-H8 
!
assign ( resid 3 and name H8 ) ( resid 2 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 3 and name H8 ) ( resid 2 and name H3' ) 4.0 2.2 0 !S
assign ( resid 3 and name H8 ) ( resid 2 and name H4' ) 6.0 4.2 0 !W
!
assign ( resid 3 and name H8 ) ( resid 3 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 3 and name H8 ) ( resid 3 and name H3' ) 6.0 4.2 0 !W
assign ( resid 3 and name H8 ) ( resid 3 and name H4' ) 5.0 3.2 0 !M
assign ( resid 3 and name H8 ) ( resid 3 and name H5' ) 4.0 2.2 0 !S
assign ( resid 3 and name H8 ) ( resid 3 and name H5'' ) 5.0 3.2 0 !M

!
!C4-H6 
!
assign ( resid 4 and name H6 ) ( resid 3 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 4 and name H6 ) ( resid 3 and name H3' ) 4.0 2.2 0 !S
assign ( resid 4 and name H6 ) ( resid 3 and name H4' ) 6.0 4.2 0 !W
!
assign ( resid 4 and name H6 ) ( resid 4 and name H2'' ) 6.0 4.2 0 !W 
assign ( resid 4 and name H6 ) ( resid 4 and name H3' ) 6.0 4.2 0 !W 
assign ( resid 4 and name H6 ) ( resid 4 and name H4' ) 5.0 3.2 0 !M 
assign ( resid 4 and name H6 ) ( resid 4 and name H5' ) 4.0 2.2 0 !S
assign ( resid 4 and name H6 ) ( resid 4 and name H5'' ) 5.0 3.2 0 !M

!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~end of stem 4 bps~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
!
!A5-H8
!
assign ( resid 5 and name H8 ) ( resid 4 and name H2'' ) 4.0 2.2 0 !S 
!assign ( resid 5 and name H8 ) ( resid 4 and name H3' ) 6.0 4.2 0 !W 
assign ( resid 5 and name H8 ) ( resid 4 and name H4' ) 5.0 3.2 0 !M 
!
assign ( resid 5 and name H8 ) ( resid 5 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 5 and name H8 ) ( resid 5 and name H3' ) 5.0 3.2 0 !M 
assign ( resid 5 and name H8 ) ( resid 5 and name H4' ) 5.0 3.2 0 !M
assign ( resid 5 and name H8 ) ( resid 5 and name H5' ) 4.0 2.2 0 !S
assign ( resid 5 and name H8 ) ( resid 5 and name H5'' ) 5.0 3.2 0 !M 


!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~<(oLo)>~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
!G6-H8                                                      |   
!
assign ( resid 6 and name H8 ) ( resid 5 and name H2'' )  5.0 3.2 0 !M 
assign ( resid 6 and name H8 ) ( resid 5 and name H3' )  6.0 4.2 0 !VW 
!
assign ( resid 6 and name H8 ) ( resid 6 and name H2'' )  5.0 3.2 0 !M 
assign ( resid 6 and name H8 ) ( resid 6 and name H3' ) 6.0 4.2 0 !W 
assign ( resid 6 and name H8 ) ( resid 6 and name H5' ) 6.0 4.2 0 !W 
assign ( resid 6 and name H8 ) ( resid 6 and name H5'' ) 6.0 4.2 0 !W 

!
!U7-H6  
!
assign ( resid 7 and name H6 ) ( resid 6 and name H2'' )   5.0 3.2 0 !M
assign ( resid 7 and name H6 ) ( resid 6 and name H3' )    6.0 4.2 0 !W

!
assign ( resid 7 and name H6 ) ( resid 7 and name H2'' )  6.0 4.2 0 !W 
assign ( resid 7 and name H6 ) ( resid 7 and name H4' )  6.0 4.2 0 !W 


!
!G8-H8  
!
assign ( resid 8 and name H8 ) ( resid 7 and name H2'' )  6.0 4.2 0 !W 

!
assign ( resid 8 and name H8 ) ( resid 8 and name H2'' ) 6.0 4.2 0 !W 
assign ( resid 8 and name H8 ) ( resid 8 and name H3' ) 6.0 4.2 0 !W 
assign ( resid 8 and name H8 ) ( resid 8 and name H4' )  7.0 5.2 0 !VW 
!
!A9-H8    Weak A9-U20 bp
!
assign ( resid 9 and name H8 ) ( resid 8 and name H2'' )  7.0 5.2 0 !VW 
assign ( resid 9 and name H8 ) ( resid 8 and name H4' )  6.0 4.2 0 !W 
!
assign ( resid 9 and name H8 ) ( resid 9 and name H3' )  6.0 4.2 0 !W 
assign ( resid 9 and name H8 ) ( resid 9 and name H4' )  5.0 3.2 0 !M 

!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^



!
!U10-H6  base paired with A19
!
assign ( resid 10 and name H6 ) ( resid 10 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 10 and name H6 ) ( resid 10 and name H3' ) 4.0 2.2 0 !S
assign ( resid 10 and name H6 ) ( resid 10 and name H4' ) 5.0 3.2 0 !M
assign ( resid 10 and name H6 ) ( resid 10 and name H5' ) 5.0 3.2 0 !M
assign ( resid 10 and name H6 ) ( resid 10 and name H5'' ) 5.0 3.2 0 !M

!
!G11-H8
!
assign ( resid 11 and name H8 ) ( resid 10 and name H2'' ) 4.0 2.2 0  !S
assign ( resid 11 and name H8 ) ( resid 10 and name H3' ) 5.0 3.2 0 !M
assign ( resid 11 and name H8 ) ( resid 10 and name H5' ) 7.0 5.2 0 !VW
assign ( resid 11 and name H8 ) ( resid 10 and name H5'' ) 6.0 4.2 0 !W
!
assign ( resid 11 and name H8 ) ( resid 11 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 11 and name H8 ) ( resid 11 and name H3' ) 4.0 2.2 0 !S
assign ( resid 11 and name H8 ) ( resid 11 and name H5' )  5.0 3.2 0 !M
assign ( resid 11 and name H8 ) ( resid 11 and name H5'' )  4.0 2.2 0 !S


!
!C12-H6
!
assign ( resid 12 and name H5 ) ( resid 11 and name H3' ) 6.0 4.2 0 !W
assign ( resid 12 and name H6 ) ( resid 11 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 12 and name H6 ) ( resid 11 and name H3' ) 5.0 3.2 0 !M
assign ( resid 12 and name H6 ) ( resid 11 and name H4' ) 5.0 3.2 0 !M
assign ( resid 12 and name H6 ) ( resid 11 and name H5'' ) 6.0 4.2 0 !W
!
assign ( resid 13 and name H6 ) ( resid 12 and name H2'' ) 6.0 4.2 0 !W
assign ( resid 12 and name H6 ) ( resid 12 and name H3' ) 6.0 4.2 0 !W 
assign ( resid 12 and name H6 ) ( resid 12 and name H4' )  5.0 3.2 0 !M
assign ( resid 12 and name H6 ) ( resid 12 and name H5' )  5.0 3.2 0 !M
assign ( resid 12 and name H6 ) ( resid 12 and name H5'' )  5.0 3.2 0 !M

!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~UUCG tetra-loop~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
!U13-H6
!
assign ( resid 13 and name H6 ) ( resid 12 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 13 and name H6 ) ( resid 12 and name H3' ) 5.0 3.2 0 !M 
assign ( resid 13 and name H6 ) ( resid 12 and name H4' ) 6.0 4.2 0 !W
!
assign ( resid 13 and name H6 ) ( resid 13 and name H2'' ) 6.0 4.2 0 !W
assign ( resid 13 and name H6 ) ( resid 13 and name H3' ) 4.0 2.2 0 !S
assign ( resid 13 and name H6 ) ( resid 13 and name H5' ) 4.0 2.2 0 !S
assign ( resid 13 and name H6 ) ( resid 13 and name H5'' ) 4.0 2.2 0 !S

!
!U14-H6
!
assign ( resid 14 and name H6 ) ( resid 13 and name H2'' ) 6.0 4.2 0 !W
assign ( resid 14 and name H6 ) ( resid 13 and name H3' ) 7.0 5.2 0 !VW
assign ( resid 14 and name H6 ) ( resid 13 and name H4' ) 6.0 4.2 0 !W
!
assign ( resid 14 and name H6 ) ( resid 14 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 14 and name H6 ) ( resid 14 and name H3' ) 6.0 4.2 0 !W 
assign ( resid 14 and name H6 ) ( resid 14 and name H4' ) 5.0 3.2 0 !M 
assign ( resid 14 and name H6 ) ( resid 14 and name H5' ) 6.0 4.2 0 !W
assign ( resid 14 and name H6 ) ( resid 14 and name H5'' ) 7.0 5.2 0 !VW

!
!C15-H6
!
assign ( resid 15 and name H6 )  ( resid 14 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 15 and name H6 ) ( resid 14 and name H3' ) 4.0 2.2 0  !S
assign ( resid 15 and name H6 )  ( resid 14 and name H4' )  5.0 3.2 0 !M
assign ( resid 15 and name H6 )  ( resid 14 and name H5' ) 5.0 3.2 0 !M
assign ( resid 15 and name H6 )  ( resid 14 and name H5'' ) 5.0 3.2 0 !M
assign ( resid 15 and name H6 ) ( resid 15 and name H3' ) 4.0 2.2 0 !S
assign ( resid 15 and name H6 ) ( resid 15 and name H4' ) 5.0 3.2 0 !M
assign ( resid 15 and name H6 ) ( resid 15 and name H2'' ) 3.0 1.2 0 !VS
assign ( resid 15 and name H6 ) ( resid 15 and name H5' ) 4.0 2.2 0 !S
assign ( resid 15 and name H6 ) ( resid 15 and name H5'' ) 4.0 2.2 0 !S 
!
!G16-H8
!
assign ( resid 16 and name H8 ) ( resid 15 and name H3' ) 6.0 5.2 0 !W
assign ( resid 16 and name H8 ) ( resid 15 and name H4' ) 5.0 3.2 0 !M
assign ( resid 16 and name H8 ) ( resid 15 and name H5' ) 4.0 2.2 0 !S
assign ( resid 16 and name H8 ) ( resid 15 and name H5'' ) 5.0 3.2 0 !M

assign ( resid 16 and name H8 ) ( resid 16 and name H3' ) 5.0 3.2 0 !M
assign ( resid 16 and name H8 ) ( resid 16 and name H2'' ) 4.0 2.2 0 !S

!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~end of tetra-loop~~~~~~~~~~~~~~~~~~~~~~~~~~~

!
!G17-H8
!
assign ( resid 17 and name H8 ) ( resid 16 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 17 and name H8 ) ( resid 16 and name H3' ) 4.0 2.2 0.0 !S
!
assign ( resid 17 and name H8 ) ( resid 17 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 17 and name H8 ) ( resid 17 and name H3' ) 4.0 2.2 0 !S
assign ( resid 17 and name H8 ) ( resid 17 and name H4' ) 5.0 3.2 0 !M
assign ( resid 17 and name H8 ) ( resid 17 and name H5' ) 5.0 3.2 0 !M 
assign ( resid 17 and name H8 ) ( resid 17 and name H5'' ) 4.0 2.2 0 !S
!
!C18-H6
!
assign ( resid 18 and name H6 ) ( resid 17 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 18 and name H6 ) ( resid 17 and name H3' ) 4.0 2.2 0 !S
assign ( resid 18 and name H6 ) ( resid 17 and name H4' ) 5.0 3.2 0 !M
!
assign ( resid 18 and name H6 ) ( resid 18 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 18 and name H6 ) ( resid 18 and name H3' ) 4.0 2.2 0 !S
assign ( resid 18 and name H6 ) ( resid 18 and name H4' ) 7.0 5.2 0 !VW
assign ( resid 18 and name H6 ) ( resid 18 and name H5' ) 4.0 2.2 0 !S
assign ( resid 18 and name H6 ) ( resid 18 and name H5'' ) 5.0 3.2 0 !M

!
!A19-H8  base paired with U10
!
assign ( resid 19 and name H8 ) ( resid 18 and name H2'' ) 4.0 2.2 0  !S
assign ( resid 19 and name H8 ) ( resid 18 and name H3' ) 5.0 3.2 0 !M
assign ( resid 19 and name H8 ) ( resid 18 and name H5' ) 7.0 5.2 0 !VW
assign ( resid 19 and name H8 ) ( resid 18 and name H5'' ) 6.0 4.2 0 !W
!
assign ( resid 19 and name H8 ) ( resid 19 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 19 and name H8 ) ( resid 19 and name H3' ) 4.0 2.2 0 !S 
assign ( resid 19 and name H8 ) ( resid 19 and name H5' )  5.0 3.2 0 !M
assign ( resid 19 and name H8 ) ( resid 19 and name H5'' )  4.0 2.2 0 !S
!
!U20-H6     Weak A9-U20 bp
!
assign ( resid 20 and name H6 ) ( resid 20 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 20 and name H6 ) ( resid 20 and name H5'' ) 6.0 4.2 0 !W 
assign ( resid 20 and name H6 ) ( resid 20 and name H5'' ) 6.0 4.2 0 !W 
!
!A21-H8
!
assign ( resid 21 and name H8 ) ( resid 20 and name H2'' ) 5.0 3.2 0 !M 
!
assign ( resid 21 and name H8 ) ( resid 21 and name H2'' ) 6.0 4.2 0 !W 
assign ( resid 21 and name H8 ) ( resid 21 and name H3' ) 5.0 3.2 0 !M
assign ( resid 21 and name H8 ) ( resid 21 and name H5' ) 5.0 3.2 0 !M 
assign ( resid 21 and name H8 ) ( resid 21 and name H5'' ) 5.0 3.2 0 !M 

!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
!U22-H6   U22~~U7~~A9 ????                                                          |
!                                                                                   V
assign ( resid 22 and name H6 ) ( resid 21 and name H3' ) 6.0 4.2 0 !W 
assign ( resid 22 and name H6 ) ( resid 21 and name H4' ) 6.0 4.2 0 !W
!
assign ( resid 22 and name H6 ) ( resid 22 and name H2'' ) 6.0 4.2 0 !W
assign ( resid 22 and name H6 ) ( resid 22 and name H4' )  5.0 3.2 0 !M
!
!C23-H6    C23~~G6~~G8 ????
!
assign ( resid 23 and name H6 ) ( resid 22 and name H2'') 4.0 2.2 0 !S 
assign ( resid 23 and name H6 ) ( resid 22 and name H4' ) 4.0 2.2 0 !S
!
assign ( resid 23 and name H6 ) ( resid 23 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 23 and name H6 ) ( resid 23 and name H3' ) 5.0 3.2 0 !M
assign ( resid 23 and name H6 ) ( resid 23 and name H5' ) 6.0 4.2 0 !W
!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^


!
!A24-H8
!
assign ( resid 24 and name H8 ) ( resid 23 and name H2'' ) 5.0 3.2 0!M
assign ( resid 24 and name H8 ) ( resid 23 and name H3' )  6.0 4.2 0 !W
!
assign ( resid 24 and name H8 ) ( resid 24 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 24 and name H8 ) ( resid 24 and name H3' ) 5.0 3.2 0 !M 
assign ( resid 24 and name H8 ) ( resid 24 and name H4' ) 6.0 4.2 0 !W 
assign ( resid 24 and name H8 ) ( resid 24 and name H5'' )  6.0 4.2 0 !W
assign ( resid 24 and name H8 ) ( resid 24 and name H5' )  6.0 4.2 0 !W


!~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Stem 4 bps~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
!
!G25-H8 
!
assign ( resid 25 and name H8 ) ( resid 24 and name H2'' )  5.0 3.2 0!M
assign ( resid 25 and name H8 ) ( resid 24 and name H3' )  5.0 3.2 0!M
assign ( resid 25 and name H8 ) ( resid 24 and name H5' )  7.0 5.2 0 !VW

assign ( resid 25 and name H8 ) ( resid 25 and name H2'' )  5.0 3.2 0 !M
assign ( resid 25 and name H8 ) ( resid 25 and name H3' )  4.0 2.2 0 !S
assign ( resid 25 and name H8 ) ( resid 25 and name H5' ) 4.0 2.2 0 !S
assign ( resid 25 and name H8 ) ( resid 25 and name H5'' ) 5.0 3.2 0 !M 
!
!C26-H6 
!
assign ( resid 26 and name H6 ) ( resid 25 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 26 and name H6 ) ( resid 25 and name H3' ) 4.0 2.2 0 !S
assign ( resid 26 and name H6 ) ( resid 25 and name H4' ) 5.0 3.2 0 !M
assign ( resid 26 and name H6 ) ( resid 25 and name H5' ) 7.0 5.2 0 !VW
assign ( resid 26 and name H6 ) ( resid 25 and name H5'' ) 6.0 4.2 0 !W
!
assign ( resid 26 and name H6 ) ( resid 26 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 26 and name H6 ) ( resid 26 and name H3' ) 4.0 2.2 0 !S 
assign ( resid 26 and name H6 ) ( resid 26 and name H4' ) 7.0 5.2 0 !VW
assign ( resid 26 and name H6 ) ( resid 26 and name H5' ) 4.0 2.2 0 !S
assign ( resid 26 and name H6 ) ( resid 26 and name H5'' ) 5.0 3.2 0 !M
!
!U27-H6
!
assign ( resid 27 and name H6 ) ( resid 26 and name H2'' ) 4.0 2.2 0 !S
assign ( resid 27 and name H6 ) ( resid 26 and name H3' ) 4.0 2.2 0 !S
assign ( resid 27 and name H6 ) ( resid 26 and name H4' ) 5.0 3.2 0 !M
assign ( resid 27 and name H6 ) ( resid 26 and name H5' ) 7.0 5.2 0 !VW
assign ( resid 27 and name H6 ) ( resid 26 and name H5'' ) 6.0 4.2 0 !W
!
assign ( resid 27 and name H6 ) ( resid 27 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 27 and name H6 ) ( resid 27 and name H3' )  5.0 3.2 0 !M
assign ( resid 27 and name H6 ) ( resid 27 and name H4' ) 7.0 5.2 0 !VW
assign ( resid 27 and name H6 ) ( resid 27 and name H5' ) 4.0 2.2 0 !S
assign ( resid 27 and name H6 ) ( resid 27 and name H5'' ) 5.0 3.2 0 !M
!
!C28-H6 
!
assign ( resid 28 and name H6 ) ( resid 27 and name H2'' ) 5.0 3.2 0 !M
assign ( resid 28 and name H6 ) ( resid 27 and name H3' ) 4.0 2.2 0 !S
assign ( resid 28 and name H6 ) ( resid 27 and name H4' ) 5.0 3.2 0 !M
assign ( resid 28 and name H6 ) ( resid 27 and name H5' ) 7.0 5.2 0 !VW
assign ( resid 28 and name H6 ) ( resid 27 and name H5'' ) 6.0 4.2 0 !W
!
assign ( resid 28 and name H6 ) ( resid 28 and name H2'' )  6.0 4.2 0 !W
assign ( resid 28 and name H6 ) ( resid 28 and name H3' ) 5.0 3.2 0 !M
assign ( resid 28 and name H6 ) ( resid 28 and name H4' ) 7.0 5.2 0 !VW
assign ( resid 28 and name H6 ) ( resid 28 and name H5' ) 4.0 2.2 0 !S
assign ( resid 28 and name H6 ) ( resid 28 and name H5'' ) 5.0 3.2 0 !M


  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1    H5'    G   1           H5'        G   1  13.425   3.765  10.675
    2   H5''    G   1          H5''        G   1  14.155   3.244   9.146
    3    H4'    G   1           H4'        G   1  14.134   6.142  10.026
    4    H3'    G   1           H3'        G   1  12.040   4.596   8.481
    5    H2'    G   1          H2''        G   1  11.798   6.392   6.986
    6   HO2'    G   1          H2'         G   1  13.412   8.110   8.556
    7    H1'    G   1           H1'        G   1  14.449   7.160   6.870
    8    H8     G   1           H8         G   1  13.610   3.374   6.779
    9    H1     G   1           H1         G   1  14.220   6.200   1.052
   10    H21    G   1           H21        G   1  14.476   8.391   1.307
   11    H22    G   1           H22        G   1  14.496   9.156   2.880
   12   HO5'    G   1          H5T         G   1  15.328   3.923  11.499
   13    H5'    G   2           H5'        G   2   9.865   8.931   9.895
   14   H5''    G   2          H5''        G   2   8.283   8.141  10.061
   15    H4'    G   2           H4'        G   2   8.466  10.269   8.575
   16    H3'    G   2           H3'        G   2   7.079   7.702   7.771
   17    H2'    G   2          H2''        G   2   6.589   8.606   5.657
   18   HO2'    G   2          H2'         G   2   7.256  11.143   6.801
   19    H1'    G   2           H1'        G   2   8.950   9.977   5.264
   20    H8     G   2           H8         G   2   9.468   6.519   6.842
   21    H1     G   2           H1         G   2   9.206   6.515   0.432
   22    H21    G   2           H21        G   2   8.591   8.516  -0.306
   23    H22    G   2           H22        G   2   8.245   9.850   0.773
   24    H5'    G   3           H5'        G   3   3.957  10.771   7.518
   25   H5''    G   3          H5''        G   3   2.352  10.109   7.890
   26    H4'    G   3           H4'        G   3   2.650  10.993   5.530
   27    H3'    G   3           H3'        G   3   1.775   8.145   6.065
   28    H2'    G   3          H2''        G   3   1.705   7.714   3.756
   29   HO2'    G   3          H2'         G   3   1.068   9.217   2.407
   30    H1'    G   3           H1'        G   3   3.932   9.170   3.024
   31    H8     G   3           H8         G   3   4.551   7.254   6.267
   32    H1     G   3           H1         G   3   5.487   3.792   0.947
   33    H21    G   3           H21        G   3   4.756   4.909  -0.826
   34    H22    G   3           H22        G   3   4.041   6.501  -0.704
   35    H5'    C   4           H5'        C   4  -1.777   9.816   2.952
   36   H5''    C   4          H5''        C   4  -3.011   9.192   4.066
   37    H4'    C   4           H4'        C   4  -3.108   8.489   1.558
   38    H3'    C   4           H3'        C   4  -3.367   6.601   3.909
   39    H2'    C   4          H2''        C   4  -3.547   4.774   2.442
   40   HO2'    C   4          H2'         C   4  -3.832   5.204   0.113
   41    H1'    C   4           H1'        C   4  -1.720   5.620   0.551
   42    H41    C   4           H41        C   4   1.381   1.541   4.382
   43    H42    C   4           H42        C   4   1.862   2.884   5.395
   44    H5     C   4           H5         C   4   1.063   5.133   5.072
   45    H6     C   4           H6         C   4  -0.370   6.582   3.709
   46    H5'    A   5           H5'        A   5  -7.986   6.952   0.664
   47   H5''    A   5          H5''        A   5  -8.651   6.148   2.101
   48    H4'    A   5           H4'        A   5  -9.296   5.220  -0.230
   49    H3'    A   5           H3'        A   5  -8.294   3.533   2.074
   50    H2'    A   5          H2''        A   5  -8.386   1.605   0.732
   51   HO2'    A   5          H2'         A   5  -9.405   2.094  -1.546
   52    H1'    A   5           H1'        A   5  -7.501   2.727  -1.623
   53    H8     A   5           H8         A   5  -5.471   4.144   1.256
   54    H61    A   5           H61        A   5  -1.876  -0.867   0.717
   55    H62    A   5           H62        A   5  -2.059   0.700   1.471
   56    H2     A   5           H2         A   5  -5.494  -1.465  -1.865
   57    H5'    G   6           H5'        G   6 -11.260   0.384   0.807
   58   H5''    G   6          H5''        G   6 -12.043   0.304   2.398
   59    H4'    G   6           H4'        G   6 -10.864  -1.823   1.502
   60    H3'    G   6           H3'        G   6 -10.464  -0.677   4.275
   61    H2'    G   6          H2''        G   6  -8.907  -2.367   4.766
   62   HO2'    G   6          H2'         G   6  -9.174  -3.862   2.451
   63    H1'    G   6           H1'        G   6  -7.681  -2.491   2.295
   64    H8     G   6           H8         G   6  -8.202   1.159   3.038
   65    H1     G   6           H1         G   6  -3.240  -1.372   6.221
   66    H21    G   6           H21        G   6  -3.278  -3.586   6.052
   67    H22    G   6           H22        G   6  -4.518  -4.438   5.161
   68    H5'    U   7           H5'        U   7 -11.796  -4.519   5.056
   69   H5''    U   7          H5''        U   7 -12.899  -4.724   6.432
   70    H4'    U   7           H4'        U   7 -10.620  -5.808   6.688
   71    H3'    U   7           H3'        U   7 -11.648  -3.785   8.692
   72    H2'    U   7          H2''        U   7  -9.655  -3.970   9.923
   73   HO2'    U   7          H2'         U   7  -9.463  -6.203  10.029
   74    H1'    U   7           H1'        U   7  -7.910  -4.220   7.791
   75    H3     U   7           H3         U   7  -7.136  -0.237   9.972
   76    H5     U   7           H5         U   7 -10.126   0.564   7.109
   77    H6     U   7           H6         U   7 -10.301  -1.825   6.720
   78    H5'    G   8           H5'        G   8 -10.989  -7.497  10.770
   79   H5''    G   8          H5''        G   8 -12.233  -7.978  11.939
   80    H4'    G   8           H4'        G   8  -9.777  -7.735  12.758
   81    H3'    G   8           H3'        G   8 -12.076  -7.571  14.220
   82    H2'    G   8          H2''        G   8 -12.457  -5.257  14.051
   83   HO2'    G   8          H2'         G   8 -12.274  -4.940  16.130
   84    H1'    G   8           H1'        G   8  -9.563  -4.530  14.324
   85    H8     G   8           H8         G   8 -12.694  -4.172  12.013
   86    H1     G   8           H1         G   8  -9.009   1.051  12.568
   87    H21    G   8           H21        G   8  -7.240   0.603  13.831
   88    H22    G   8           H22        G   8  -6.964  -0.973  14.536
   89    H5'    A   9           H5'        A   9  -7.994  -6.507  16.993
   90   H5''    A   9          H5''        A   9  -8.374  -7.726  18.227
   91    H4'    A   9           H4'        A   9  -7.492  -6.140  19.634
   92    H3'    A   9           H3'        A   9 -10.340  -5.202  19.197
   93    H2'    A   9          H2''        A   9  -9.880  -3.233  20.389
   94   HO2'    A   9          H2'         A   9  -7.618  -3.223  21.469
   95    H1'    A   9           H1'        A   9  -7.284  -2.844  19.506
   96    H8     A   9           H8         A   9 -10.252  -3.826  17.159
   97    H61    A   9           H61        A   9 -10.231   2.159  15.577
   98    H62    A   9           H62        A   9 -10.955   0.594  15.286
   99    H2     A   9           H2         A   9  -7.140   1.551  18.771
  100    H5'    U  10           H5'        U  10  -8.688  -5.746  23.993
  101   H5''    U  10          H5''        U  10 -10.144  -5.254  24.882
  102    H4'    U  10           H4'        U  10  -7.804  -4.052  25.302
  103    H3'    U  10           H3'        U  10 -10.536  -2.754  25.179
  104    H2'    U  10          H2''        U  10  -9.555  -0.633  25.433
  105   HO2'    U  10          H2'         U  10  -7.091  -0.723  25.883
  106    H1'    U  10           H1'        U  10  -7.302  -1.064  23.889
  107    H3     U  10           H3         U  10  -9.539   1.780  21.154
  108    H5     U  10           H5         U  10 -11.959  -1.673  21.180
  109    H6     U  10           H6         U  10 -10.470  -2.624  22.844
  110    H5'    G  11           H5'        G  11  -8.233  -1.866  28.628
  111   H5''    G  11          H5''        G  11  -9.016  -1.456  30.168
  112    H4'    G  11           H4'        G  11  -7.432   0.299  29.245
  113    H3'    G  11           H3'        G  11 -10.303   0.940  29.899
  114    H2'    G  11          H2''        G  11  -9.977   3.156  29.160
  115   HO2'    G  11          H2'         G  11  -7.927   3.346  30.335
  116    H1'    G  11           H1'        G  11  -8.314   2.622  27.028
  117    H8     G  11           H8         G  11 -11.109   0.057  27.089
  118    H1     G  11           H1         G  11 -12.743   5.614  24.330
  119    H21    G  11           H21        G  11 -11.180   7.143  24.714
  120    H22    G  11           H22        G  11  -9.739   6.799  25.646
  121    H5'    C  12           H5'        C  12  -8.522   3.873  34.276
  122   H5''    C  12          H5''        C  12 -10.081   3.072  34.569
  123    H4'    C  12           H4'        C  12  -9.660   5.843  34.384
  124    H3'    C  12           H3'        C  12 -12.155   4.142  34.175
  125    H2'    C  12          H2''        C  12 -13.388   5.998  33.425
  126   HO2'    C  12          H2'         C  12 -11.756   7.333  35.041
  127    H1'    C  12           H1'        C  12 -11.460   7.112  31.814
  128    H41    C  12           H41        C  12 -15.301   3.531  28.142
  129    H42    C  12           H42        C  12 -14.099   2.262  28.195
  130    H5     C  12           H5         C  12 -12.134   2.360  29.585
  131    H6     C  12           H6         C  12 -10.897   3.698  31.226
  132    H5'    U  13           H5'        U  13 -14.294   7.128  35.967
  133   H5''    U  13          H5''        U  13 -15.549   6.216  36.830
  134    H4'    U  13           H4'        U  13 -16.165   7.467  34.614
  135    H3'    U  13           H3'        U  13 -16.977   4.639  35.326
  136    H2'    U  13          H2''        U  13 -18.044   4.413  33.244
  137   HO2'    U  13          H2'         U  13 -17.772   7.230  32.845
  138    H1'    U  13           H1'        U  13 -16.224   5.836  31.721
  139    H3     U  13           H3         U  13 -15.899   1.485  30.335
  140    H5     U  13           H5         U  13 -13.639   1.671  33.890
  141    H6     U  13           H6         U  13 -14.481   3.921  34.229
  142    H5'    U  14           H5'        U  14 -21.104   7.536  36.739
  143   H5''    U  14          H5''        U  14 -22.268   6.215  36.913
  144    H4'    U  14           H4'        U  14 -23.425   7.582  35.437
  145    H3'    U  14           H3'        U  14 -22.518   5.355  34.208
  146    H2'    U  14          H2''        U  14 -20.434   6.241  33.466
  147   HO2'    U  14          H2'         U  14 -20.642   6.630  31.254
  148    H1'    U  14           H1'        U  14 -21.721   8.793  32.552
  149    H3     U  14           H3         U  14 -17.309   9.385  31.357
  150    H5     U  14           H5         U  14 -17.436   9.739  35.557
  151    H6     U  14           H6         U  14 -19.732   8.956  35.488
  152    H5'    C  15           H5'        C  15 -22.850   6.317  30.683
  153   H5''    C  15          H5''        C  15 -24.357   5.856  29.869
  154    H4'    C  15           H4'        C  15 -22.557   5.125  28.486
  155    H3'    C  15           H3'        C  15 -24.404   3.281  29.318
  156    H2'    C  15          H2''        C  15 -23.137   2.307  31.040
  157   HO2'    C  15          H2'         C  15 -21.686   0.793  29.274
  158    H1'    C  15           H1'        C  15 -20.612   2.483  29.400
  159    H41    C  15           H41        C  15 -18.193   1.314  35.195
  160    H42    C  15           H42        C  15 -19.120   2.627  35.885
  161    H5     C  15           H5         C  15 -20.692   3.943  34.618
  162    H6     C  15           H6         C  15 -21.713   4.284  32.415
  163    H5'    G  16           H5'        G  16 -25.035   5.435  24.885
  164   H5''    G  16          H5''        G  16 -23.357   4.934  25.180
  165    H4'    G  16           H4'        G  16 -24.884   7.230  26.433
  166    H3'    G  16           H3'        G  16 -22.381   7.001  24.743
  167    H2'    G  16          H2''        G  16 -21.391   8.778  25.911
  168   HO2'    G  16          H2'         G  16 -23.629   9.379  27.482
  169    H1'    G  16           H1'        G  16 -22.211   8.082  28.421
  170    H8     G  16           H8         G  16 -19.885   7.361  29.263
  171    H1     G  16           H1         G  16 -18.960   3.480  24.239
  172    H21    G  16           H21        G  16 -20.692   3.600  22.855
  173    H22    G  16           H22        G  16 -22.072   4.630  23.166
  174    H5'    G  17           H5'        G  17 -21.068  10.118  21.699
  175   H5''    G  17          H5''        G  17 -20.699   8.781  22.808
  176    H4'    G  17           H4'        G  17 -20.391  11.714  23.530
  177    H3'    G  17           H3'        G  17 -18.408   9.768  22.355
  178    H2'    G  17          H2''        G  17 -16.734  10.586  23.792
  179   HO2'    G  17          H2'         G  17 -18.292  12.682  24.827
  180    H1'    G  17           H1'        G  17 -18.297  10.926  26.036
  181    H8     G  17           H8         G  17 -18.555   7.838  23.661
  182    H1     G  17           H1         G  17 -15.256   6.918  29.086
  183    H21    G  17           H21        G  17 -15.134   8.813  30.234
  184    H22    G  17           H22        G  17 -15.862  10.302  29.670
  185    H5'    C  18           H5'        C  18 -16.195  13.173  20.874
  186   H5''    C  18          H5''        C  18 -15.159  12.440  19.632
  187    H4'    C  18           H4'        C  18 -14.292  12.847  22.136
  188    H3'    C  18           H3'        C  18 -13.671  10.501  20.323
  189    H2'    C  18          H2''        C  18 -12.447   9.491  22.057
  190   HO2'    C  18          H2'         C  18 -12.393  12.114  23.165
  191    H1'    C  18           H1'        C  18 -14.069  10.263  24.163
  192    H41    C  18           H41        C  18 -15.676   4.229  22.862
  193    H42    C  18           H42        C  18 -16.918   4.815  21.776
  194    H5     C  18           H5         C  18 -17.173   7.139  21.195
  195    H6     C  18           H6         C  18 -16.294   9.404  21.529
  196    H5'    A  19           H5'        A  19  -9.880  12.152  22.037
  197   H5''    A  19          H5''        A  19  -8.754  12.377  20.682
  198    H4'    A  19           H4'        A  19  -7.719  11.235  22.647
  199    H3'    A  19           H3'        A  19  -7.899   9.788  19.996
  200    H2'    A  19          H2''        A  19  -6.897   7.881  20.937
  201   HO2'    A  19          H2'         A  19  -5.408   8.057  22.440
  202    H1'    A  19           H1'        A  19  -8.138   7.961  23.393
  203    H8     A  19           H8         A  19 -10.651   8.891  20.698
  204    H61    A  19           H61        A  19 -11.597   2.813  19.998
  205    H62    A  19           H62        A  19 -12.154   4.416  19.574
  206    H2     A  19           H2         A  19  -8.045   3.370  22.679
  207    H5'    U  20           H5'        U  20  -4.853  10.179  17.222
  208   H5''    U  20          H5''        U  20  -6.325   9.463  16.535
  209    H4'    U  20           H4'        U  20  -4.805   8.509  18.987
  210    H3'    U  20           H3'        U  20  -5.116   7.432  16.176
  211    H2'    U  20          H2''        U  20  -5.196   5.237  17.005
  212   HO2'    U  20          H2'         U  20  -4.521   6.097  19.626
  213    H1'    U  20           H1'        U  20  -6.708   5.743  19.265
  214    H3     U  20           H3         U  20  -8.791   3.352  15.738
  215    H5     U  20           H5         U  20 -10.342   7.270  15.877
  216    H6     U  20           H6         U  20  -8.539   7.860  17.391
  217    H5'    A  21           H5'        A  21  -0.770   4.500  16.208
  218   H5''    A  21          H5''        A  21  -2.107   3.499  15.606
  219    H4'    A  21           H4'        A  21  -0.996   3.620  18.425
  220    H3'    A  21           H3'        A  21  -1.105   1.486  16.280
  221    H2'    A  21          H2''        A  21  -1.402  -0.165  17.925
  222   HO2'    A  21          H2'         A  21  -0.170   1.758  19.562
  223    H1'    A  21           H1'        A  21  -3.029   1.285  19.630
  224    H8     A  21           H8         A  21  -4.736   2.182  16.577
  225    H61    A  21           H61        A  21  -6.873  -3.606  16.077
  226    H62    A  21           H62        A  21  -7.033  -1.958  15.518
  227    H2     A  21           H2         A  21  -3.561  -3.601  19.102
  228    H5'    U  22           H5'        U  22   1.901  -0.505  14.317
  229   H5''    U  22          H5''        U  22   0.417   0.357  13.862
  230    H4'    U  22           H4'        U  22   0.639  -2.517  14.808
  231    H3'    U  22           H3'        U  22   0.071  -1.277  12.134
  232    H2'    U  22          H2''        U  22  -1.532  -2.961  11.711
  233   HO2'    U  22          H2'         U  22  -0.882  -4.489  13.978
  234    H1'    U  22           H1'        U  22  -2.541  -3.212  14.270
  235    H3     U  22           H3         U  22  -5.556  -1.561  11.093
  236    H5     U  22           H5         U  22  -4.024   1.710  13.269
  237    H6     U  22           H6         U  22  -2.353   0.219  14.206
  238    H5'    C  23           H5'        C  23   2.720  -4.984  11.798
  239   H5''    C  23          H5''        C  23   3.926  -5.021  10.496
  240    H4'    C  23           H4'        C  23   2.115  -6.723  10.229
  241    H3'    C  23           H3'        C  23   2.508  -4.585   8.126
  242    H2'    C  23          H2''        C  23   0.689  -5.428   6.889
  243   HO2'    C  23          H2'         C  23   0.225  -7.500   6.886
  244    H1'    C  23           H1'        C  23  -0.995  -5.933   8.983
  245    H41    C  23           H41        C  23  -2.106   0.028   6.798
  246    H42    C  23           H42        C  23  -1.373   0.618   8.272
  247    H5     C  23           H5         C  23  -0.270  -0.815   9.864
  248    H6     C  23           H6         C  23   0.369  -3.124  10.386
  249    H5'    A  24           H5'        A  24   4.037  -8.504   5.097
  250   H5''    A  24          H5''        A  24   5.207  -7.307   4.505
  251    H4'    A  24           H4'        A  24   3.639  -8.458   2.787
  252    H3'    A  24           H3'        A  24   4.116  -5.474   2.951
  253    H2'    A  24          H2''        A  24   2.602  -5.122   1.189
  254   HO2'    A  24          H2'         A  24   3.294  -7.759   0.559
  255    H1'    A  24           H1'        A  24   0.757  -7.066   1.872
  256    H8     A  24           H8         A  24   1.958  -5.156   4.953
  257    H61    A  24           H61        A  24  -2.558  -1.111   3.700
  258    H62    A  24           H62        A  24  -1.344  -1.601   4.860
  259    H2     A  24           H2         A  24  -2.244  -3.961   0.251
  260    H5'    G  25           H5'        G  25   4.910  -6.616  -0.836
  261   H5''    G  25          H5''        G  25   6.332  -6.017  -1.715
  262    H4'    G  25           H4'        G  25   4.272  -5.417  -2.898
  263    H3'    G  25           H3'        G  25   5.835  -3.144  -1.653
  264    H2'    G  25          H2''        G  25   4.229  -1.606  -2.419
  265   HO2'    G  25          H2'         G  25   4.175  -2.983  -4.543
  266    H1'    G  25           H1'        G  25   1.982  -3.155  -2.003
  267    H8     G  25           H8         G  25   4.516  -3.413   0.863
  268    H1     G  25           H1         G  25   0.437   1.516   1.347
  269    H21    G  25           H21        G  25  -0.739   1.718  -0.525
  270    H22    G  25           H22        G  25  -0.522   0.645  -1.890
  271    H5'    C  26           H5'        C  26   6.161  -1.952  -5.765
  272   H5''    C  26          H5''        C  26   7.738  -1.192  -6.062
  273    H4'    C  26           H4'        C  26   5.715   0.356  -6.143
  274    H3'    C  26           H3'        C  26   8.084   0.882  -4.336
  275    H2'    C  26          H2''        C  26   7.038   2.812  -3.497
  276   HO2'    C  26          H2'         C  26   5.039   2.631  -5.524
  277    H1'    C  26           H1'        C  26   4.452   1.848  -3.425
  278    H41    C  26           H41        C  26   6.800   1.204   2.490
  279    H42    C  26           H42        C  26   7.295  -0.426   2.092
  280    H5     C  26           H5         C  26   7.134  -1.351  -0.128
  281    H6     C  26           H6         C  26   6.465  -0.911  -2.445
  282    H5'    C  27           H5'        C  27   8.630   3.901  -7.886
  283   H5''    C  27          H5''        C  27  10.366   4.190  -8.117
  284    H4'    C  27           H4'        C  27   9.015   6.190  -7.333
  285    H3'    C  27           H3'        C  27  11.407   5.179  -5.780
  286    H2'    C  27          H2''        C  27  11.080   6.855  -4.161
  287   HO2'    C  27          H2'         C  27  10.140   8.750  -4.600
  288    H1'    C  27           H1'        C  27   8.326   6.790  -4.097
  289    H41    C  27           H41        C  27  10.383   3.106   0.718
  290    H42    C  27           H42        C  27  10.349   1.720  -0.349
  291    H5     C  27           H5         C  27   9.889   1.881  -2.709
  292    H6     C  27           H6         C  27   9.360   3.405  -4.555
  293    H5'    C  28           H5'        C  28  12.705   9.031  -7.180
  294   H5''    C  28          H5''        C  28  14.355   9.111  -7.830
  295    H4'    C  28           H4'        C  28  14.109  10.497  -5.806
  296    H3'    C  28           H3'        C  28  15.891   8.062  -5.606
  297   HO3'    C  28          H3T         C  28  17.230   9.473  -6.429
  298    H2'    C  28          H2''        C  28  16.389   8.597  -3.380
  299   HO2'    C  28          H2'         C  28  16.823  10.804  -3.618
  300    H1'    C  28           H1'        C  28  13.868   9.472  -2.660
  301    H41    C  28           H41        C  28  14.313   3.397  -0.708
  302    H42    C  28           H42        C  28  13.651   2.874  -2.241
  303    H5     C  28           H5         C  28  13.228   4.374  -4.078
  304    H6     C  28           H6         C  28  13.348   6.701  -4.842
  Start of MODEL    2
    1    H5'    G   1           H5'        G   1  17.785   6.887  -2.286
    2   H5''    G   1          H5''        G   1  17.249   6.257  -3.855
    3    H4'    G   1           H4'        G   1  17.435   9.230  -3.345
    4    H3'    G   1           H3'        G   1  15.178   7.350  -2.612
    5    H2'    G   1          H2''        G   1  13.607   8.893  -3.438
    6   HO2'    G   1          H2'         G   1  14.033  10.882  -2.809
    7    H1'    G   1           H1'        G   1  15.038   9.770  -5.623
    8    H8     G   1           H8         G   1  15.523   6.042  -5.468
    9    H1     G   1           H1         G   1   9.809   7.740  -7.838
   10    H21    G   1           H21        G   1   9.457   9.906  -7.499
   11    H22    G   1           H22        G   1  10.623  10.931  -6.693
   12   HO5'    G   1          H5T         G   1  19.322   6.443  -4.229
   13    H5'    G   2           H5'        G   2  14.869  10.813  -0.101
   14   H5''    G   2          H5''        G   2  14.601  10.617   1.643
   15    H4'    G   2           H4'        G   2  12.798  11.943   0.672
   16    H3'    G   2           H3'        G   2  12.055   9.154   1.585
   17    H2'    G   2          H2''        G   2   9.843   9.487   0.866
   18   HO2'    G   2          H2'         G   2   8.945  11.495   0.599
   19    H1'    G   2           H1'        G   2  10.392  10.931  -1.423
   20    H8     G   2           H8         G   2  12.917   8.154  -1.332
   21    H1     G   2           H1         G   2   7.104   6.189  -3.204
   22    H21    G   2           H21        G   2   5.602   7.777  -2.813
   23    H22    G   2           H22        G   2   6.027   9.314  -2.095
   24    H5'    G   3           H5'        G   3   9.495  12.016   3.544
   25   H5''    G   3          H5''        G   3   9.032  11.602   5.208
   26    H4'    G   3           H4'        G   3   7.106  11.927   3.589
   27    H3'    G   3           H3'        G   3   7.464   9.354   5.142
   28    H2'    G   3          H2''        G   3   5.568   8.436   4.103
   29   HO2'    G   3          H2'         G   3   4.946  11.139   3.425
   30    H1'    G   3           H1'        G   3   5.953   9.494   1.583
   31    H8     G   3           H8         G   3   9.306   8.342   2.906
   32    H1     G   3           H1         G   3   5.711   3.584   0.540
   33    H21    G   3           H21        G   3   3.643   4.302   0.174
   34    H22    G   3           H22        G   3   3.147   5.946   0.509
   35    H5'    C   4           H5'        C   4   3.343  10.942   5.174
   36   H5''    C   4          H5''        C   4   2.609  10.715   6.774
   37    H4'    C   4           H4'        C   4   1.320   9.866   4.682
   38    H3'    C   4           H3'        C   4   1.779   8.259   7.205
   39    H2'    C   4          H2''        C   4   0.679   6.413   6.254
   40   HO2'    C   4          H2'         C   4  -0.520   8.402   4.685
   41    H1'    C   4           H1'        C   4   1.631   6.681   3.677
   42    H41    C   4           H41        C   4   5.397   2.354   6.506
   43    H42    C   4           H42        C   4   6.442   3.642   7.063
   44    H5     C   4           H5         C   4   5.929   5.978   6.774
   45    H6     C   4           H6         C   4   4.301   7.584   5.889
   46    H5'    A   5           H5'        A   5  -3.545   9.426   5.698
   47   H5''    A   5          H5''        A   5  -3.839   8.846   7.350
   48    H4'    A   5           H4'        A   5  -5.379   8.001   5.421
   49    H3'    A   5           H3'        A   5  -4.108   6.253   7.539
   50    H2'    A   5          H2''        A   5  -5.035   4.337   6.541
   51   HO2'    A   5          H2'         A   5  -6.689   4.548   4.901
   52    H1'    A   5           H1'        A   5  -4.710   5.080   3.905
   53    H8     A   5           H8         A   5  -1.607   6.074   5.848
   54    H61    A   5           H61        A   5   0.392   0.287   4.924
   55    H62    A   5           H62        A   5   0.821   1.887   5.487
   56    H2     A   5           H2         A   5  -3.899   0.503   3.635
   57    H5'    G   6           H5'        G   6  -8.026   4.575   6.518
   58   H5''    G   6          H5''        G   6  -8.767   4.218   8.092
   59    H4'    G   6           H4'        G   6  -8.429   2.283   6.356
   60    H3'    G   6           H3'        G   6  -7.799   2.146   9.313
   61    H2'    G   6          H2''        G   6  -6.976  -0.043   9.055
   62   HO2'    G   6          H2'         G   6  -7.324  -1.131   6.941
   63    H1'    G   6           H1'        G   6  -5.717   0.303   6.630
   64    H8     G   6           H8         G   6  -5.101   3.380   8.758
   65    H1     G   6           H1         G   6  -1.248  -1.548  10.180
   66    H21    G   6           H21        G   6  -1.953  -3.386   9.153
   67    H22    G   6           H22        G   6  -3.366  -3.402   8.121
   68    H5'    U   7           H5'        U   7  -9.984  -1.429   9.095
   69   H5''    U   7          H5''        U   7 -10.941  -1.557  10.585
   70    H4'    U   7           H4'        U   7  -8.991  -3.245  10.184
   71    H3'    U   7           H3'        U   7  -9.509  -1.747  12.762
   72    H2'    U   7          H2''        U   7  -7.599  -2.719  13.730
   73   HO2'    U   7          H2'         U   7  -7.466  -4.523  11.514
   74    H1'    U   7           H1'        U   7  -5.967  -2.655  11.504
   75    H3     U   7           H3         U   7  -4.362   0.277  14.675
   76    H5     U   7           H5         U   7  -7.157   2.453  12.388
   77    H6     U   7           H6         U   7  -7.824   0.368  11.340
   78    H5'    G   8           H5'        G   8  -9.846  -5.826  13.810
   79   H5''    G   8          H5''        G   8 -11.137  -6.285  14.936
   80    H4'    G   8           H4'        G   8  -8.649  -6.570  15.672
   81    H3'    G   8           H3'        G   8 -10.873  -6.342  17.237
   82    H2'    G   8          H2''        G   8 -10.907  -3.999  17.475
   83   HO2'    G   8          H2'         G   8  -9.667  -3.491  19.455
   84    H1'    G   8           H1'        G   8  -7.931  -3.777  17.766
   85    H8     G   8           H8         G   8 -10.991  -2.517  15.684
   86    H1     G   8           H1         G   8  -6.527   1.880  17.061
   87    H21    G   8           H21        G   8  -4.836   0.934  18.144
   88    H22    G   8           H22        G   8  -4.804  -0.772  18.529
   89    H5'    A   9           H5'        A   9  -7.367  -5.568  19.919
   90   H5''    A   9          H5''        A   9  -6.974  -7.211  20.464
   91    H4'    A   9           H4'        A   9  -6.826  -6.581  22.678
   92    H3'    A   9           H3'        A   9  -9.013  -4.581  22.065
   93    H2'    A   9          H2''        A   9  -8.255  -3.190  23.800
   94   HO2'    A   9          H2'         A   9  -6.361  -5.041  24.758
   95    H1'    A   9           H1'        A   9  -5.555  -3.534  23.431
   96    H8     A   9           H8         A   9  -7.889  -3.196  20.335
   97    H61    A   9           H61        A   9  -6.222   2.764  20.396
   98    H62    A   9           H62        A   9  -7.120   1.528  19.546
   99    H2     A   9           H2         A   9  -4.400   0.773  23.978
  100    H5'    U  10           H5'        U  10  -9.766  -6.226  26.543
  101   H5''    U  10          H5''        U  10 -11.288  -5.445  27.023
  102    H4'    U  10           H4'        U  10  -8.974  -4.868  28.240
  103    H3'    U  10           H3'        U  10 -11.230  -2.968  27.552
  104    H2'    U  10          H2''        U  10  -9.957  -1.151  28.322
  105   HO2'    U  10          H2'         U  10  -8.357  -1.347  29.811
  106    H1'    U  10           H1'        U  10  -7.467  -2.022  27.463
  107    H3     U  10           H3         U  10  -7.927   1.414  24.559
  108    H5     U  10           H5         U  10 -11.080  -1.177  23.499
  109    H6     U  10           H6         U  10 -10.473  -2.579  25.384
  110    H5'    G  11           H5'        G  11 -10.656  -2.473  31.976
  111   H5''    G  11          H5''        G  11 -12.190  -1.923  32.682
  112    H4'    G  11           H4'        G  11 -10.167  -0.319  32.792
  113    H3'    G  11           H3'        G  11 -12.906   0.473  31.822
  114    H2'    G  11          H2''        G  11 -12.115   2.637  31.330
  115   HO2'    G  11          H2'         G  11 -10.428   2.078  33.408
  116    H1'    G  11           H1'        G  11  -9.600   1.953  30.428
  117    H8     G  11           H8         G  11 -12.267  -0.421  29.071
  118    H1     G  11           H1         G  11 -11.472   4.928  25.619
  119    H21    G  11           H21        G  11 -10.176   6.357  26.717
  120    H22    G  11           H22        G  11  -9.508   5.998  28.294
  121    H5'    C  12           H5'        C  12 -13.459   3.571  36.411
  122   H5''    C  12          H5''        C  12 -14.996   2.854  35.880
  123    H4'    C  12           H4'        C  12 -14.358   5.591  35.863
  124    H3'    C  12           H3'        C  12 -16.506   3.983  34.464
  125    H2'    C  12          H2''        C  12 -17.060   5.832  33.121
  126   HO2'    C  12          H2'         C  12 -15.437   7.464  34.821
  127    H1'    C  12           H1'        C  12 -14.515   6.782  32.697
  128    H41    C  12           H41        C  12 -16.091   3.149  27.663
  129    H42    C  12           H42        C  12 -15.175   1.839  28.374
  130    H5     C  12           H5         C  12 -14.223   1.940  30.585
  131    H6     C  12           H6         C  12 -13.945   3.320  32.593
  132    H5'    U  13           H5'        U  13 -18.690   7.111  34.880
  133   H5''    U  13          H5''        U  13 -20.366   6.687  35.283
  134    H4'    U  13           H4'        U  13 -20.033   7.581  32.946
  135    H3'    U  13           H3'        U  13 -21.231   4.844  33.418
  136    H2'    U  13          H2''        U  13 -21.392   4.483  31.104
  137   HO2'    U  13          H2'         U  13 -21.030   6.311  29.628
  138    H1'    U  13           H1'        U  13 -19.034   5.713  30.348
  139    H3     U  13           H3         U  13 -18.365   1.265  29.532
  140    H5     U  13           H5         U  13 -17.860   1.682  33.697
  141    H6     U  13           H6         U  13 -18.630   3.975  33.495
  142    H5'    U  14           H5'        U  14 -26.059   6.607  30.874
  143   H5''    U  14          H5''        U  14 -25.091   5.312  30.183
  144    H4'    U  14           H4'        U  14 -26.173   7.431  28.748
  145    H3'    U  14           H3'        U  14 -24.784   5.258  27.973
  146    H2'    U  14          H2''        U  14 -22.630   6.020  28.672
  147   HO2'    U  14          H2'         U  14 -21.524   6.388  26.815
  148    H1'    U  14           H1'        U  14 -23.115   8.733  27.477
  149    H3     U  14           H3         U  14 -18.732   8.510  29.197
  150    H5     U  14           H5         U  14 -21.341   9.725  32.278
  151    H6     U  14           H6         U  14 -23.206   9.111  30.851
  152    H5'    C  15           H5'        C  15 -22.935   6.487  24.996
  153   H5''    C  15          H5''        C  15 -23.747   6.173  23.451
  154    H4'    C  15           H4'        C  15 -21.553   5.327  23.204
  155    H3'    C  15           H3'        C  15 -23.609   3.547  22.885
  156    H2'    C  15          H2''        C  15 -23.486   2.540  25.012
  157   HO2'    C  15          H2'         C  15 -21.409   0.928  24.331
  158    H1'    C  15           H1'        C  15 -20.471   2.610  24.952
  159    H41    C  15           H41        C  15 -21.376   1.462  31.165
  160    H42    C  15           H42        C  15 -22.687   2.618  31.238
  161    H5     C  15           H5         C  15 -23.476   3.842  29.318
  162    H6     C  15           H6         C  15 -23.177   4.223  26.914
  163    H5'    G  16           H5'        G  16 -21.300   6.002  19.131
  164   H5''    G  16          H5''        G  16 -20.185   5.285  20.312
  165    H4'    G  16           H4'        G  16 -21.959   7.721  20.642
  166    H3'    G  16           H3'        G  16 -18.969   7.241  20.691
  167    H2'    G  16          H2''        G  16 -18.703   8.852  22.373
  168   HO2'    G  16          H2'         G  16 -21.034   9.849  21.269
  169    H1'    G  16           H1'        G  16 -20.898   8.202  23.868
  170    H8     G  16           H8         G  16 -19.661   7.128  25.847
  171    H1     G  16           H1         G  16 -16.064   3.469  21.997
  172    H21    G  16           H21        G  16 -16.569   3.872  19.873
  173    H22    G  16           H22        G  16 -17.787   5.038  19.403
  174    H5'    G  17           H5'        G  17 -15.817   9.917  19.092
  175   H5''    G  17          H5''        G  17 -16.501   8.709  20.198
  176    H4'    G  17           H4'        G  17 -16.319  11.635  20.946
  177    H3'    G  17           H3'        G  17 -14.181   9.518  21.141
  178    H2'    G  17          H2''        G  17 -13.621  10.249  23.305
  179   HO2'    G  17          H2'         G  17 -15.137  12.599  22.690
  180    H1'    G  17           H1'        G  17 -16.177  10.795  24.194
  181    H8     G  17           H8         G  17 -15.167   7.649  22.108
  182    H1     G  17           H1         G  17 -16.041   6.678  28.389
  183    H21    G  17           H21        G  17 -16.510   8.598  29.399
  184    H22    G  17           H22        G  17 -16.608  10.116  28.532
  185    H5'    C  18           H5'        C  18 -11.200  12.666  21.070
  186   H5''    C  18          H5''        C  18  -9.750  11.785  20.544
  187    H4'    C  18           H4'        C  18 -10.226  12.218  23.122
  188    H3'    C  18           H3'        C  18  -9.134   9.682  21.877
  189    H2'    C  18          H2''        C  18  -9.130   8.647  23.987
  190   HO2'    C  18          H2'         C  18  -9.755  11.037  25.361
  191    H1'    C  18           H1'        C  18 -11.465   9.773  24.964
  192    H41    C  18           H41        C  18 -13.126   3.959  22.932
  193    H42    C  18           H42        C  18 -13.405   4.606  21.329
  194    H5     C  18           H5         C  18 -12.880   6.875  20.712
  195    H6     C  18           H6         C  18 -11.973   9.014  21.496
  196    H5'    A  19           H5'        A  19  -5.579  11.538  24.299
  197   H5''    A  19          H5''        A  19  -4.153  11.452  23.245
  198    H4'    A  19           H4'        A  19  -3.671  10.441  25.425
  199    H3'    A  19           H3'        A  19  -3.781   8.585  23.038
  200    H2'    A  19          H2''        A  19  -3.376   6.728  24.421
  201   HO2'    A  19          H2'         A  19  -1.684   8.059  25.613
  202    H1'    A  19           H1'        A  19  -4.903   7.497  26.578
  203    H8     A  19           H8         A  19  -6.838   8.439  23.478
  204    H61    A  19           H61        A  19  -8.874   2.593  23.367
  205    H62    A  19           H62        A  19  -9.063   4.197  22.695
  206    H2     A  19           H2         A  19  -5.572   2.861  26.389
  207    H5'    U  20           H5'        U  20   0.475   7.962  24.150
  208   H5''    U  20          H5''        U  20   1.241   7.219  22.730
  209    H4'    U  20           H4'        U  20   0.605   5.707  24.758
  210    H3'    U  20           H3'        U  20   0.026   5.085  21.853
  211    H2'    U  20          H2''        U  20  -1.101   3.116  22.471
  212   HO2'    U  20          H2'         U  20  -0.566   3.193  25.192
  213    H1'    U  20           H1'        U  20  -2.356   4.078  24.730
  214    H3     U  20           H3         U  20  -5.934   3.776  21.957
  215    H5     U  20           H5         U  20  -3.628   6.877  20.270
  216    H6     U  20           H6         U  20  -1.910   6.407  21.918
  217    H5'    A  21           H5'        A  21   2.898   0.896  21.285
  218   H5''    A  21          H5''        A  21   1.418   0.563  20.363
  219    H4'    A  21           H4'        A  21   2.014  -0.095  23.259
  220    H3'    A  21           H3'        A  21   1.371  -1.729  20.791
  221    H2'    A  21          H2''        A  21   0.173  -3.263  22.105
  222   HO2'    A  21          H2'         A  21   0.998  -3.795  23.973
  223    H1'    A  21           H1'        A  21  -0.952  -1.463  23.880
  224    H8     A  21           H8         A  21  -1.921   0.540  21.176
  225    H61    A  21           H61        A  21  -5.673  -3.875  18.995
  226    H62    A  21           H62        A  21  -5.260  -2.176  18.935
  227    H2     A  21           H2         A  21  -2.854  -5.766  21.925
  228    H5'    U  22           H5'        U  22   3.982  -3.893  18.544
  229   H5''    U  22          H5''        U  22   2.900  -2.529  18.196
  230    H4'    U  22           H4'        U  22   2.234  -5.481  18.192
  231    H3'    U  22           H3'        U  22   2.305  -3.354  16.085
  232    H2'    U  22          H2''        U  22   0.404  -4.303  15.061
  233   HO2'    U  22          H2'         U  22   1.151  -6.618  16.532
  234    H1'    U  22           H1'        U  22  -0.947  -5.068  17.347
  235    H3     U  22           H3         U  22  -3.268  -1.765  15.103
  236    H5     U  22           H5         U  22  -0.737   0.195  17.847
  237    H6     U  22           H6         U  22   0.371  -1.928  18.241
  238    H5'    C  23           H5'        C  23   3.318  -7.070  14.498
  239   H5''    C  23          H5''        C  23   4.669  -7.451  13.411
  240    H4'    C  23           H4'        C  23   2.611  -7.723  12.180
  241    H3'    C  23           H3'        C  23   4.200  -5.252  11.453
  242    H2'    C  23          H2''        C  23   2.547  -4.604   9.923
  243   HO2'    C  23          H2'         C  23   1.802  -7.343  10.031
  244    H1'    C  23           H1'        C  23   0.331  -5.406  11.352
  245    H41    C  23           H41        C  23   1.178   0.888  12.237
  246    H42    C  23           H42        C  23   1.981   0.525  13.748
  247    H5     C  23           H5         C  23   2.517  -1.716  14.453
  248    H6     C  23           H6         C  23   2.396  -4.092  13.864
  249    H5'    A  24           H5'        A  24   4.317  -8.861   7.530
  250   H5''    A  24          H5''        A  24   5.419  -7.853   6.569
  251    H4'    A  24           H4'        A  24   3.394  -8.909   5.362
  252    H3'    A  24           H3'        A  24   4.144  -5.982   5.198
  253    H2'    A  24          H2''        A  24   2.259  -5.538   3.864
  254   HO2'    A  24          H2'         A  24   1.780  -6.965   2.383
  255    H1'    A  24           H1'        A  24   0.469  -7.186   5.146
  256    H8     A  24           H8         A  24   2.552  -5.607   7.854
  257    H61    A  24           H61        A  24  -1.143  -0.660   7.405
  258    H62    A  24           H62        A  24   0.115  -1.438   8.338
  259    H2     A  24           H2         A  24  -2.026  -3.377   3.948
  260    H5'    G  25           H5'        G  25   3.598  -7.145   1.493
  261   H5''    G  25          H5''        G  25   4.539  -6.463   0.151
  262    H4'    G  25           H4'        G  25   2.060  -5.815   0.280
  263    H3'    G  25           H3'        G  25   4.297  -3.790   0.064
  264    H2'    G  25          H2''        G  25   2.741  -2.030   0.165
  265   HO2'    G  25          H2'         G  25   0.378  -3.386   0.150
  266    H1'    G  25           H1'        G  25   1.013  -3.137   2.010
  267    H8     G  25           H8         G  25   4.354  -3.966   3.406
  268    H1     G  25           H1         G  25   2.895   2.240   4.122
  269    H21    G  25           H21        G  25   1.146   2.762   2.859
  270    H22    G  25           H22        G  25   0.339   1.589   1.842
  271    H5'    C  26           H5'        C  26   1.721  -3.427  -3.189
  272   H5''    C  26          H5''        C  26   2.219  -2.746  -4.751
  273    H4'    C  26           H4'        C  26   0.718  -1.264  -3.345
  274    H3'    C  26           H3'        C  26   3.433  -0.327  -4.299
  275    H2'    C  26          H2''        C  26   3.130   1.729  -3.201
  276   HO2'    C  26          H2'         C  26   1.203   2.622  -2.977
  277    H1'    C  26           H1'        C  26   1.845   0.779  -0.949
  278    H41    C  26           H41        C  26   8.015   1.522   0.577
  279    H42    C  26           H42        C  26   8.270  -0.175   0.235
  280    H5     C  26           H5         C  26   6.580  -1.596  -0.728
  281    H6     C  26           H6         C  26   4.279  -1.697  -1.571
  282    H5'    C  27           H5'        C  27   0.256   1.873  -6.646
  283   H5''    C  27          H5''        C  27   0.740   2.448  -8.254
  284    H4'    C  27           H4'        C  27   0.334   4.254  -6.516
  285    H3'    C  27           H3'        C  27   2.962   4.022  -7.998
  286    H2'    C  27          H2''        C  27   3.822   5.854  -6.801
  287   HO2'    C  27          H2'         C  27   1.185   6.399  -5.839
  288    H1'    C  27           H1'        C  27   2.684   5.284  -4.353
  289    H41    C  27           H41        C  27   8.652   2.992  -4.152
  290    H42    C  27           H42        C  27   8.051   1.439  -4.688
  291    H5     C  27           H5         C  27   5.770   1.072  -5.372
  292    H6     C  27           H6         C  27   3.573   2.114  -5.690
  293    H5'    C  28           H5'        C  28   1.027   7.675  -8.959
  294   H5''    C  28          H5''        C  28   0.991   8.342 -10.604
  295    H4'    C  28           H4'        C  28   2.088   9.888  -9.032
  296    H3'    C  28           H3'        C  28   3.816   8.620 -11.165
  297   HO3'    C  28          H3T         C  28   2.447  10.141 -11.969
  298    H2'    C  28          H2''        C  28   5.690   9.782 -10.369
  299   HO2'    C  28          H2'         C  28   3.831  11.616  -9.667
  300    H1'    C  28           H1'        C  28   5.152   9.523  -7.683
  301    H41    C  28           H41        C  28   9.164   4.784  -9.240
  302    H42    C  28           H42        C  28   7.788   3.732  -9.481
  303    H5     C  28           H5         C  28   5.506   4.502  -9.396
  304    H6     C  28           H6         C  28   4.052   6.448  -9.063
  Start of MODEL    3
    1    H5'    G   1           H5'        G   1  16.737  11.930   5.581
    2   H5''    G   1          H5''        G   1  16.623  11.546   3.854
    3    H4'    G   1           H4'        G   1  14.784  13.509   5.255
    4    H3'    G   1           H3'        G   1  14.470  10.540   4.758
    5    H2'    G   1          H2''        G   1  12.224  10.864   4.151
    6   HO2'    G   1          H2'         G   1  11.276  13.056   4.536
    7    H1'    G   1           H1'        G   1  12.530  13.257   2.804
    8    H8     G   1           H8         G   1  15.099  10.372   2.333
    9    H1     G   1           H1         G   1  10.495  10.750  -2.118
   10    H21    G   1           H21        G   1   9.034  12.330  -1.570
   11    H22    G   1           H22        G   1   9.192  13.290  -0.116
   12   HO5'    G   1          H5T         G   1  16.651  14.227   4.327
   13    H5'    G   2           H5'        G   2  11.213  12.263   7.719
   14   H5''    G   2          H5''        G   2  10.795  10.871   8.738
   15    H4'    G   2           H4'        G   2   8.878  12.129   7.526
   16    H3'    G   2           H3'        G   2   9.240   9.124   7.510
   17    H2'    G   2          H2''        G   2   7.362   8.889   6.118
   18   HO2'    G   2          H2'         G   2   5.786  10.453   5.930
   19    H1'    G   2           H1'        G   2   7.777  11.113   4.535
   20    H8     G   2           H8         G   2  11.009   9.192   5.284
   21    H1     G   2           H1         G   2   7.722   7.012   0.224
   22    H21    G   2           H21        G   2   5.741   8.007   0.118
   23    H22    G   2           H22        G   2   5.228   9.204   1.287
   24    H5'    G   3           H5'        G   3   5.602  10.407   8.502
   25   H5''    G   3          H5''        G   3   4.545   9.755   9.771
   26    H4'    G   3           H4'        G   3   3.391   9.803   7.602
   27    H3'    G   3           H3'        G   3   4.028   7.083   8.768
   28    H2'    G   3          H2''        G   3   3.061   6.037   6.898
   29   HO2'    G   3          H2'         G   3   2.062   8.103   5.479
   30    H1'    G   3           H1'        G   3   3.934   7.811   4.970
   31    H8     G   3           H8         G   3   6.662   7.061   7.541
   32    H1     G   3           H1         G   3   6.258   2.767   2.792
   33    H21    G   3           H21        G   3   4.433   3.138   1.584
   34    H22    G   3           H22        G   3   3.318   4.437   1.942
   35    H5'    C   4           H5'        C   4  -0.040   7.842   7.400
   36   H5''    C   4          H5''        C   4  -1.317   7.027   8.326
   37    H4'    C   4           H4'        C   4  -1.295   6.775   5.735
   38    H3'    C   4           H3'        C   4  -1.620   4.494   7.698
   39    H2'    C   4          H2''        C   4  -1.708   2.959   5.921
   40   HO2'    C   4          H2'         C   4  -1.708   4.788   3.832
   41    H1'    C   4           H1'        C   4   0.175   4.156   4.288
   42    H41    C   4           H41        C   4   3.206  -0.533   7.408
   43    H42    C   4           H42        C   4   3.635   0.605   8.666
   44    H5     C   4           H5         C   4   2.813   2.868   8.735
   45    H6     C   4           H6         C   4   1.402   4.530   7.613
   46    H5'    A   5           H5'        A   5  -5.751   5.592   4.136
   47   H5''    A   5          H5''        A   5  -6.682   4.514   5.197
   48    H4'    A   5           H4'        A   5  -6.913   4.244   2.615
   49    H3'    A   5           H3'        A   5  -6.480   1.979   4.575
   50    H2'    A   5          H2''        A   5  -6.415   0.434   2.804
   51   HO2'    A   5          H2'         A   5  -6.941   1.558   0.575
   52    H1'    A   5           H1'        A   5  -5.033   1.985   0.990
   53    H8     A   5           H8         A   5  -3.434   2.505   4.373
   54    H61    A   5           H61        A   5  -0.263  -2.706   3.316
   55    H62    A   5           H62        A   5  -0.431  -1.306   4.352
   56    H2     A   5           H2         A   5  -3.427  -2.335   0.159
   57    H5'    G   6           H5'        G   6 -10.102  -0.571   2.967
   58   H5''    G   6          H5''        G   6 -10.752  -0.550   4.620
   59    H4'    G   6           H4'        G   6 -10.054  -2.832   3.574
   60    H3'    G   6           H3'        G   6  -9.298  -1.880   6.346
   61    H2'    G   6          H2''        G   6  -8.040  -3.835   6.696
   62   HO2'    G   6          H2'         G   6  -9.504  -4.871   4.474
   63    H1'    G   6           H1'        G   6  -6.980  -4.072   4.163
   64    H8     G   6           H8         G   6  -6.960  -0.416   5.195
   65    H1     G   6           H1         G   6  -2.042  -3.799   7.544
   66    H21    G   6           H21        G   6  -2.371  -5.966   7.189
   67    H22    G   6           H22        G   6  -3.795  -6.579   6.378
   68    H5'    U   7           H5'        U   7 -10.976  -5.441   7.143
   69   H5''    U   7          H5''        U   7 -12.009  -5.575   8.581
   70    H4'    U   7           H4'        U   7  -9.873  -6.882   8.734
   71    H3'    U   7           H3'        U   7 -10.462  -4.688  10.734
   72    H2'    U   7          H2''        U   7  -8.407  -5.086  11.803
   73   HO2'    U   7          H2'         U   7  -7.637  -7.319  10.344
   74    H1'    U   7           H1'        U   7  -6.894  -5.594   9.548
   75    H3     U   7           H3         U   7  -5.483  -1.644  11.443
   76    H5     U   7           H5         U   7  -8.682  -0.619   8.895
   77    H6     U   7           H6         U   7  -9.136  -2.987   8.621
   78    H5'    G   8           H5'        G   8  -9.897  -8.156  12.867
   79   H5''    G   8          H5''        G   8 -11.028  -8.621  14.152
   80    H4'    G   8           H4'        G   8  -8.527  -8.325  14.761
   81    H3'    G   8           H3'        G   8 -10.702  -8.108  16.399
   82    H2'    G   8          H2''        G   8 -11.101  -5.799  16.156
   83   HO2'    G   8          H2'         G   8 -10.345  -6.335  18.401
   84    H1'    G   8           H1'        G   8  -8.187  -5.088  16.190
   85    H8     G   8           H8         G   8 -11.478  -4.757  14.105
   86    H1     G   8           H1         G   8  -7.762   0.468  14.337
   87    H21    G   8           H21        G   8  -5.907   0.033  15.477
   88    H22    G   8           H22        G   8  -5.583  -1.537  16.179
   89    H5'    A   9           H5'        A   9  -7.442  -5.958  18.341
   90   H5''    A   9          H5''        A   9  -6.548  -7.375  18.928
   91    H4'    A   9           H4'        A   9  -6.080  -6.396  20.980
   92    H3'    A   9           H3'        A   9  -8.646  -4.833  20.618
   93    H2'    A   9          H2''        A   9  -7.776  -3.071  21.901
   94   HO2'    A   9          H2'         A   9  -6.671  -3.595  23.622
   95    H1'    A   9           H1'        A   9  -5.182  -3.154  20.983
   96    H8     A   9           H8         A   9  -7.993  -3.623  18.359
   97    H61    A   9           H61        A   9  -7.485   2.482  17.474
   98    H62    A   9           H62        A   9  -8.241   1.004  16.924
   99    H2     A   9           H2         A   9  -4.852   1.351  20.925
  100    H5'    U  10           H5'        U  10  -7.591  -5.612  25.295
  101   H5''    U  10          H5''        U  10  -9.023  -5.008  26.156
  102    H4'    U  10           H4'        U  10  -6.612  -3.927  26.545
  103    H3'    U  10           H3'        U  10  -9.272  -2.490  26.388
  104    H2'    U  10          H2''        U  10  -8.179  -0.417  26.572
  105   HO2'    U  10          H2'         U  10  -5.887  -0.368  27.168
  106    H1'    U  10           H1'        U  10  -5.957  -1.014  25.041
  107    H3     U  10           H3         U  10  -8.032   1.850  22.205
  108    H5     U  10           H5         U  10 -10.639  -1.461  22.344
  109    H6     U  10           H6         U  10  -9.209  -2.432  24.048
  110    H5'    G  11           H5'        G  11  -7.293  -1.340  30.270
  111   H5''    G  11          H5''        G  11  -8.513  -0.744  31.415
  112    H4'    G  11           H4'        G  11  -6.661   0.892  30.569
  113    H3'    G  11           H3'        G  11  -9.602   1.528  30.754
  114    H2'    G  11          H2''        G  11  -9.202   3.652  29.817
  115   HO2'    G  11          H2'         G  11  -7.517   4.641  30.633
  116    H1'    G  11           H1'        G  11  -7.241   2.934  28.014
  117    H8     G  11           H8         G  11  -9.966   0.312  27.903
  118    H1     G  11           H1         G  11 -11.301   5.568  24.476
  119    H21    G  11           H21        G  11  -9.849   7.178  24.955
  120    H22    G  11           H22        G  11  -8.555   6.962  26.112
  121    H5'    C  12           H5'        C  12  -8.310   5.006  34.950
  122   H5''    C  12          H5''        C  12  -9.929   4.292  35.119
  123    H4'    C  12           H4'        C  12  -9.342   7.012  34.640
  124    H3'    C  12           H3'        C  12 -11.881   5.381  34.404
  125    H2'    C  12          H2''        C  12 -12.945   7.143  33.267
  126   HO2'    C  12          H2'         C  12 -10.781   8.917  33.728
  127    H1'    C  12           H1'        C  12 -10.828   7.938  31.715
  128    H41    C  12           H41        C  12 -14.400   3.870  28.279
  129    H42    C  12           H42        C  12 -13.230   2.619  28.631
  130    H5     C  12           H5         C  12 -11.399   2.918  30.168
  131    H6     C  12           H6         C  12 -10.295   4.481  31.700
  132    H5'    U  13           H5'        U  13 -13.822   8.657  35.683
  133   H5''    U  13          H5''        U  13 -15.216   8.096  36.629
  134    H4'    U  13           H4'        U  13 -15.678   9.037  34.277
  135    H3'    U  13           H3'        U  13 -16.713   6.367  35.255
  136    H2'    U  13          H2''        U  13 -17.703   5.962  33.163
  137   HO2'    U  13          H2'         U  13 -17.543   8.774  32.920
  138    H1'    U  13           H1'        U  13 -15.732   7.066  31.574
  139    H3     U  13           H3         U  13 -15.607   2.562  30.766
  140    H5     U  13           H5         U  13 -13.497   3.083  34.379
  141    H6     U  13           H6         U  13 -14.220   5.400  34.390
  142    H5'    U  14           H5'        U  14 -20.741   9.673  35.883
  143   H5''    U  14          H5''        U  14 -22.010   8.456  36.075
  144    H4'    U  14           H4'        U  14 -22.925   9.722  34.358
  145    H3'    U  14           H3'        U  14 -22.085   7.326  33.461
  146    H2'    U  14          H2''        U  14 -19.863   7.984  32.889
  147   HO2'    U  14          H2'         U  14 -19.855   7.646  30.789
  148    H1'    U  14           H1'        U  14 -20.846  10.488  31.554
  149    H3     U  14           H3         U  14 -16.295  10.633  30.820
  150    H5     U  14           H5         U  14 -16.862  11.573  34.891
  151    H6     U  14           H6         U  14 -19.186  10.915  34.651
  152    H5'    C  15           H5'        C  15 -21.957   7.946  29.832
  153   H5''    C  15          H5''        C  15 -23.388   7.483  28.892
  154    H4'    C  15           H4'        C  15 -21.470   6.524  27.827
  155    H3'    C  15           H3'        C  15 -23.556   4.896  28.547
  156    H2'    C  15          H2''        C  15 -22.609   4.012  30.509
  157   HO2'    C  15          H2'         C  15 -22.627   2.031  29.768
  158    H1'    C  15           H1'        C  15 -19.889   3.845  29.216
  159    H41    C  15           H41        C  15 -18.321   3.060  35.356
  160    H42    C  15           H42        C  15 -19.214   4.496  35.804
  161    H5     C  15           H5         C  15 -20.499   5.796  34.235
  162    H6     C  15           H6         C  15 -21.206   6.000  31.896
  163    H5'    G  16           H5'        G  16 -23.568   5.665  23.493
  164   H5''    G  16          H5''        G  16 -22.008   5.206  24.206
  165    H4'    G  16           H4'        G  16 -23.536   7.800  24.536
  166    H3'    G  16           H3'        G  16 -20.828   7.052  23.401
  167    H2'    G  16          H2''        G  16 -19.901   9.045  24.225
  168   HO2'    G  16          H2'         G  16 -21.050  10.833  24.422
  169    H1'    G  16           H1'        G  16 -21.159   9.081  26.653
  170    H8     G  16           H8         G  16 -18.884   8.712  27.850
  171    H1     G  16           H1         G  16 -17.909   3.168  24.771
  172    H21    G  16           H21        G  16 -19.516   2.836  23.275
  173    H22    G  16           H22        G  16 -20.824   3.973  23.034
  174    H5'    G  17           H5'        G  17 -18.705   9.349  20.189
  175   H5''    G  17          H5''        G  17 -18.816   8.343  21.647
  176    H4'    G  17           H4'        G  17 -18.612  11.347  21.856
  177    H3'    G  17           H3'        G  17 -16.371   9.401  21.327
  178    H2'    G  17          H2''        G  17 -15.025  10.479  22.931
  179   HO2'    G  17          H2'         G  17 -16.941  12.591  23.095
  180    H1'    G  17           H1'        G  17 -16.978  10.952  24.807
  181    H8     G  17           H8         G  17 -16.819   7.626  22.781
  182    H1     G  17           H1         G  17 -14.336   7.398  28.692
  183    H21    G  17           H21        G  17 -14.395   9.412  29.621
  184    H22    G  17           H22        G  17 -15.044  10.811  28.791
  185    H5'    C  18           H5'        C  18 -14.068  12.683  19.793
  186   H5''    C  18          H5''        C  18 -12.837  11.872  18.801
  187    H4'    C  18           H4'        C  18 -12.348  12.552  21.335
  188    H3'    C  18           H3'        C  18 -11.473  10.026  19.912
  189    H2'    C  18          H2''        C  18 -10.538   9.218  21.911
  190   HO2'    C  18          H2'         C  18 -10.564  10.902  23.771
  191    H1'    C  18           H1'        C  18 -12.454  10.193  23.652
  192    H41    C  18           H41        C  18 -13.962   4.063  22.749
  193    H42    C  18           H42        C  18 -14.950   4.519  21.378
  194    H5     C  18           H5         C  18 -15.032   6.761  20.497
  195    H6     C  18           H6         C  18 -14.183   9.048  20.739
  196    H5'    A  19           H5'        A  19  -7.499  12.132  21.195
  197   H5''    A  19          H5''        A  19  -6.514  12.069  19.719
  198    H4'    A  19           H4'        A  19  -5.288  11.241  21.714
  199    H3'    A  19           H3'        A  19  -5.859   9.324  19.443
  200    H2'    A  19          H2''        A  19  -4.833   7.569  20.624
  201   HO2'    A  19          H2'         A  19  -3.111   9.273  21.342
  202    H1'    A  19           H1'        A  19  -5.758   8.193  23.138
  203    H8     A  19           H8         A  19  -8.583   8.812  20.700
  204    H61    A  19           H61        A  19  -9.846   2.767  21.147
  205    H62    A  19           H62        A  19 -10.403   4.316  20.552
  206    H2     A  19           H2         A  19  -5.907   3.520  23.154
  207    H5'    U  20           H5'        U  20  -1.425   9.286  19.618
  208   H5''    U  20          H5''        U  20  -0.817   8.502  18.145
  209    H4'    U  20           H4'        U  20  -0.844   7.179  20.420
  210    H3'    U  20           H3'        U  20  -1.685   6.112  17.716
  211    H2'    U  20          H2''        U  20  -2.301   4.064  18.695
  212   HO2'    U  20          H2'         U  20  -0.263   4.579  20.307
  213    H1'    U  20           H1'        U  20  -3.407   5.066  21.013
  214    H3     U  20           H3         U  20  -7.160   3.734  18.829
  215    H5     U  20           H5         U  20  -5.781   6.997  16.544
  216    H6     U  20           H6         U  20  -3.815   7.078  17.966
  217    H5'    A  21           H5'        A  21   1.933   2.334  17.454
  218   H5''    A  21          H5''        A  21   0.420   1.588  16.900
  219    H4'    A  21           H4'        A  21   1.623   1.537  19.682
  220    H3'    A  21           H3'        A  21   0.992  -0.570  17.600
  221    H2'    A  21          H2''        A  21   0.404  -2.086  19.294
  222   HO2'    A  21          H2'         A  21   2.253  -1.703  20.616
  223    H1'    A  21           H1'        A  21  -0.820  -0.297  21.010
  224    H8     A  21           H8         A  21  -2.524   0.968  18.162
  225    H61    A  21           H61        A  21  -5.600  -4.364  17.495
  226    H62    A  21           H62        A  21  -5.530  -2.674  17.047
  227    H2     A  21           H2         A  21  -2.131  -5.092  20.243
  228    H5'    U  22           H5'        U  22   3.742  -2.771  15.376
  229   H5''    U  22          H5''        U  22   2.362  -1.796  14.830
  230    H4'    U  22           H4'        U  22   2.357  -4.675  15.771
  231    H3'    U  22           H3'        U  22   1.733  -3.322  13.162
  232    H2'    U  22          H2''        U  22   0.005  -4.889  12.784
  233   HO2'    U  22          H2'         U  22  -0.052  -6.883  13.762
  234    H1'    U  22           H1'        U  22  -0.886  -5.142  15.383
  235    H3     U  22           H3         U  22  -3.982  -3.239  12.467
  236    H5     U  22           H5         U  22  -1.991  -0.085  14.433
  237    H6     U  22           H6         U  22  -0.396  -1.707  15.278
  238    H5'    C  23           H5'        C  23   4.550  -7.126  12.549
  239   H5''    C  23          H5''        C  23   5.519  -7.014  11.065
  240    H4'    C  23           H4'        C  23   3.785  -8.880  11.132
  241    H3'    C  23           H3'        C  23   3.904  -6.827   8.914
  242    H2'    C  23          H2''        C  23   2.008  -7.776   7.886
  243   HO2'    C  23          H2'         C  23   1.574  -9.881   9.605
  244    H1'    C  23           H1'        C  23   0.526  -8.197  10.142
  245    H41    C  23           H41        C  23  -0.792  -2.291   7.893
  246    H42    C  23           H42        C  23  -0.048  -1.679   9.353
  247    H5     C  23           H5         C  23   1.130  -3.079  10.922
  248    H6     C  23           H6         C  23   1.847  -5.368  11.429
  249    H5'    A  24           H5'        A  24   4.272 -10.908   5.891
  250   H5''    A  24          H5''        A  24   5.677 -10.065   5.207
  251    H4'    A  24           H4'        A  24   3.905 -10.739   3.532
  252    H3'    A  24           H3'        A  24   4.750  -7.848   3.842
  253    H2'    A  24          H2''        A  24   3.219  -7.212   2.178
  254   HO2'    A  24          H2'         A  24   3.671  -9.794   1.308
  255    H1'    A  24           H1'        A  24   1.182  -8.960   2.844
  256    H8     A  24           H8         A  24   2.933  -7.233   5.818
  257    H61    A  24           H61        A  24  -1.485  -2.928   5.298
  258    H62    A  24           H62        A  24  -0.133  -3.498   6.251
  259    H2     A  24           H2         A  24  -1.880  -5.754   1.838
  260    H5'    G  25           H5'        G  25   5.616  -8.165  -0.131
  261   H5''    G  25          H5''        G  25   6.982  -7.127  -0.590
  262    H4'    G  25           H4'        G  25   4.642  -6.340  -1.283
  263    H3'    G  25           H3'        G  25   6.583  -4.599   0.250
  264    H2'    G  25          H2''        G  25   4.997  -2.865   0.315
  265   HO2'    G  25          H2'         G  25   4.432  -3.585  -2.078
  266    H1'    G  25           H1'        G  25   2.741  -4.415   0.675
  267    H8     G  25           H8         G  25   5.475  -5.807   2.883
  268    H1     G  25           H1         G  25   2.618  -0.608   5.326
  269    H21    G  25           H21        G  25   1.330   0.344   3.790
  270    H22    G  25           H22        G  25   1.173  -0.294   2.168
  271    H5'    C  26           H5'        C  26   5.797  -3.337  -3.920
  272   H5''    C  26          H5''        C  26   6.848  -2.203  -4.792
  273    H4'    C  26           H4'        C  26   4.491  -1.385  -4.222
  274    H3'    C  26           H3'        C  26   6.988   0.154  -3.483
  275    H2'    C  26          H2''        C  26   5.679   1.811  -2.450
  276   HO2'    C  26          H2'         C  26   3.626   0.741  -4.082
  277    H1'    C  26           H1'        C  26   3.771   0.157  -1.339
  278    H41    C  26           H41        C  26   8.105   1.474   3.194
  279    H42    C  26           H42        C  26   8.857  -0.070   2.863
  280    H5     C  26           H5         C  26   8.200  -1.494   1.033
  281    H6     C  26           H6         C  26   6.679  -1.744  -0.873
  282    H5'    C  27           H5'        C  27   4.551   2.228  -6.381
  283   H5''    C  27          H5''        C  27   5.206   3.419  -7.524
  284    H4'    C  27           H4'        C  27   3.660   4.360  -5.757
  285    H3'    C  27           H3'        C  27   6.492   5.376  -6.072
  286    H2'    C  27          H2''        C  27   6.174   6.867  -4.283
  287   HO2'    C  27          H2'         C  27   4.312   7.873  -4.289
  288    H1'    C  27           H1'        C  27   4.650   5.220  -2.677
  289    H41    C  27           H41        C  27  10.705   4.870  -0.620
  290    H42    C  27           H42        C  27  10.893   3.396  -1.544
  291    H5     C  27           H5         C  27   9.215   2.565  -3.059
  292    H6     C  27           H6         C  27   6.992   2.965  -4.014
  293    H5'    C  28           H5'        C  28   3.605   8.300  -6.942
  294   H5''    C  28          H5''        C  28   3.600   9.355  -8.370
  295    H4'    C  28           H4'        C  28   3.492  10.733  -6.384
  296    H3'    C  28           H3'        C  28   6.168  10.765  -7.791
  297   HO3'    C  28          H3T         C  28   5.337  12.643  -8.593
  298    H2'    C  28          H2''        C  28   7.006  12.265  -6.198
  299   HO2'    C  28          H2'         C  28   4.963  13.549  -6.263
  300    H1'    C  28           H1'        C  28   5.789  11.149  -3.989
  301    H41    C  28           H41        C  28  11.726   8.771  -4.226
  302    H42    C  28           H42        C  28  11.115   7.400  -5.125
  303    H5     C  28           H5         C  28   8.844   7.243  -5.915
  304    H6     C  28           H6         C  28   6.668   8.368  -6.015
  Start of MODEL    4
    1    H5'    G   1           H5'        G   1  13.029   1.927   9.614
    2   H5''    G   1          H5''        G   1  13.650   2.002   7.955
    3    H4'    G   1           H4'        G   1  13.935   4.343   9.847
    4    H3'    G   1           H3'        G   1  11.548   3.597   8.141
    5    H2'    G   1          H2''        G   1  11.320   5.837   7.460
    6   HO2'    G   1          H2'         G   1  12.795   6.349   9.817
    7    H1'    G   1           H1'        G   1  13.998   6.452   7.254
    8    H8     G   1           H8         G   1  13.428   2.988   5.824
    9    H1     G   1           H1         G   1  11.942   7.730   1.766
   10    H21    G   1           H21        G   1  11.944   9.675   2.835
   11    H22    G   1           H22        G   1  12.310   9.809   4.540
   12   HO5'    G   1          H5T         G   1  15.600   1.801   8.682
   13    H5'    G   2           H5'        G   2   9.812   5.923  11.697
   14   H5''    G   2          H5''        G   2   8.239   5.245  12.168
   15    H4'    G   2           H4'        G   2   8.150   7.653  11.454
   16    H3'    G   2           H3'        G   2   6.558   5.555   9.962
   17    H2'    G   2          H2''        G   2   5.747   7.195   8.489
   18   HO2'    G   2          H2'         G   2   6.790   9.453   9.655
   19    H1'    G   2           H1'        G   2   8.049   8.712   8.292
   20    H8     G   2           H8         G   2   9.189   5.147   8.113
   21    H1     G   2           H1         G   2   6.518   7.182   2.647
   22    H21    G   2           H21        G   2   5.483   9.117   2.979
   23    H22    G   2           H22        G   2   5.449   9.908   4.539
   24    H5'    G   3           H5'        G   3   3.385   8.014  11.896
   25   H5''    G   3          H5''        G   3   1.973   7.026  12.324
   26    H4'    G   3           H4'        G   3   1.601   8.776  10.514
   27    H3'    G   3           H3'        G   3   0.988   5.845  10.071
   28    H2'    G   3          H2''        G   3   0.314   6.301   7.866
   29   HO2'    G   3          H2'         G   3  -0.918   8.024   7.716
   30    H1'    G   3           H1'        G   3   2.215   8.210   7.267
   31    H8     G   3           H8         G   3   3.834   5.384   9.222
   32    H1     G   3           H1         G   3   3.159   4.151   2.962
   33    H21    G   3           H21        G   3   1.875   5.695   2.017
   34    H22    G   3           H22        G   3   1.185   7.025   2.920
   35    H5'    C   4           H5'        C   4  -3.367   7.953   8.952
   36   H5''    C   4          H5''        C   4  -4.229   6.716   9.892
   37    H4'    C   4           H4'        C   4  -4.884   7.108   7.389
   38    H3'    C   4           H3'        C   4  -4.456   4.414   8.700
   39    H2'    C   4          H2''        C   4  -4.849   3.334   6.652
   40   HO2'    C   4          H2'         C   4  -5.966   5.824   5.800
   41    H1'    C   4           H1'        C   4  -3.588   5.159   5.004
   42    H41    C   4           H41        C   4   0.629   0.460   6.024
   43    H42    C   4           H42        C   4   1.233   1.325   7.420
   44    H5     C   4           H5         C   4   0.214   3.335   8.270
   45    H6     C   4           H6         C   4  -1.605   4.951   7.967
   46    H5'    A   5           H5'        A   5  -9.636   5.476   6.608
   47   H5''    A   5          H5''        A   5  -9.977   4.088   7.663
   48    H4'    A   5           H4'        A   5 -10.986   4.123   5.258
   49    H3'    A   5           H3'        A   5  -9.581   1.766   6.533
   50    H2'    A   5          H2''        A   5  -9.836   0.519   4.558
   51   HO2'    A   5          H2'         A   5 -12.031   2.161   4.254
   52    H1'    A   5           H1'        A   5  -9.392   2.555   2.751
   53    H8     A   5           H8         A   5  -6.854   3.052   5.469
   54    H61    A   5           H61        A   5  -3.454  -1.328   2.717
   55    H62    A   5           H62        A   5  -3.475  -0.074   3.937
   56    H2     A   5           H2         A   5  -7.530  -1.348   0.846
   57    H5'    G   6           H5'        G   6 -12.858  -1.270   5.159
   58   H5''    G   6          H5''        G   6 -13.001  -1.781   6.854
   59    H4'    G   6           H4'        G   6 -12.098  -3.483   5.097
   60    H3'    G   6           H3'        G   6 -10.857  -2.935   7.803
   61    H2'    G   6          H2''        G   6  -9.119  -4.448   7.336
   62   HO2'    G   6          H2'         G   6 -10.956  -5.453   5.431
   63    H1'    G   6           H1'        G   6  -8.764  -3.822   4.678
   64    H8     G   6           H8         G   6  -9.360  -0.596   6.565
   65    H1     G   6           H1         G   6  -3.352  -2.789   7.077
   66    H21    G   6           H21        G   6  -3.225  -4.855   6.278
   67    H22    G   6           H22        G   6  -4.612  -5.695   5.620
   68    H5'    U   7           H5'        U   7 -11.667  -6.924   8.283
   69   H5''    U   7          H5''        U   7 -12.309  -7.406   9.866
   70    H4'    U   7           H4'        U   7  -9.969  -8.194   9.440
   71    H3'    U   7           H3'        U   7 -10.537  -6.339  11.763
   72    H2'    U   7          H2''        U   7  -8.260  -6.349  12.345
   73   HO2'    U   7          H2'         U   7  -7.179  -8.155  12.178
   74    H1'    U   7           H1'        U   7  -7.214  -6.350   9.786
   75    H3     U   7           H3         U   7  -6.213  -2.349  11.833
   76    H5     U   7           H5         U   7 -10.015  -1.835  10.085
   77    H6     U   7           H6         U   7 -10.056  -4.218   9.630
   78    H5'    G   8           H5'        G   8  -9.310 -10.004  13.663
   79   H5''    G   8          H5''        G   8 -10.145 -10.405  15.176
   80    H4'    G   8           H4'        G   8  -7.615  -9.755  15.247
   81    H3'    G   8           H3'        G   8  -9.462  -9.656  17.256
   82    H2'    G   8          H2''        G   8 -10.238  -7.459  16.924
   83   HO2'    G   8          H2'         G   8  -9.112  -7.599  19.014
   84    H1'    G   8           H1'        G   8  -7.513  -6.362  16.323
   85    H8     G   8           H8         G   8 -11.146  -6.704  14.920
   86    H1     G   8           H1         G   8  -8.288  -1.040  13.965
   87    H21    G   8           H21        G   8  -6.207  -1.099  14.733
   88    H22    G   8           H22        G   8  -5.521  -2.524  15.478
   89    H5'    A   9           H5'        A   9  -6.086  -7.185  18.545
   90   H5''    A   9          H5''        A   9  -4.989  -8.298  19.387
   91    H4'    A   9           H4'        A   9  -4.727  -6.882  21.189
   92    H3'    A   9           H3'        A   9  -7.592  -6.034  20.707
   93    H2'    A   9          H2''        A   9  -7.155  -3.943  21.676
   94   HO2'    A   9          H2'         A   9  -5.436  -3.575  23.055
   95    H1'    A   9           H1'        A   9  -4.596  -3.581  20.700
   96    H8     A   9           H8         A   9  -7.674  -4.894  18.668
   97    H61    A   9           H61        A   9  -7.703   0.764  16.155
   98    H62    A   9           H62        A   9  -8.460  -0.812  16.164
   99    H2     A   9           H2         A   9  -4.410   0.607  19.197
  100    H5'    U  10           H5'        U  10  -5.895  -5.857  25.530
  101   H5''    U  10          H5''        U  10  -7.390  -5.303  26.310
  102    H4'    U  10           H4'        U  10  -5.105  -3.936  26.546
  103    H3'    U  10           H3'        U  10  -7.897  -2.807  26.234
  104    H2'    U  10          H2''        U  10  -7.015  -0.630  26.175
  105   HO2'    U  10          H2'         U  10  -4.505  -0.637  26.647
  106    H1'    U  10           H1'        U  10  -4.698  -1.194  24.755
  107    H3     U  10           H3         U  10  -6.862   1.177  21.561
  108    H5     U  10           H5         U  10  -9.315  -2.211  22.089
  109    H6     U  10           H6         U  10  -7.859  -2.901  23.904
  110    H5'    G  11           H5'        G  11  -6.527  -1.553  30.484
  111   H5''    G  11          H5''        G  11  -7.960  -1.093  31.428
  112    H4'    G  11           H4'        G  11  -6.212   0.742  30.798
  113    H3'    G  11           H3'        G  11  -9.202   1.024  30.542
  114    H2'    G  11          H2''        G  11  -8.916   3.169  29.610
  115   HO2'    G  11          H2'         G  11  -7.465   4.397  30.526
  116    H1'    G  11           H1'        G  11  -6.645   2.662  28.129
  117    H8     G  11           H8         G  11  -8.985  -0.269  27.683
  118    H1     G  11           H1         G  11 -10.465   4.782  24.014
  119    H21    G  11           H21        G  11  -9.306   6.560  24.665
  120    H22    G  11           H22        G  11  -8.172   6.506  25.997
  121    H5'    C  12           H5'        C  12  -8.970   4.693  34.757
  122   H5''    C  12          H5''        C  12 -10.493   3.776  34.725
  123    H4'    C  12           H4'        C  12 -10.197   6.539  34.240
  124    H3'    C  12           H3'        C  12 -12.442   4.583  33.695
  125    H2'    C  12          H2''        C  12 -13.546   6.173  32.359
  126   HO2'    C  12          H2'         C  12 -11.912   8.341  32.676
  127    H1'    C  12           H1'        C  12 -11.341   7.231  31.112
  128    H41    C  12           H41        C  12 -13.792   2.725  27.270
  129    H42    C  12           H42        C  12 -12.547   1.632  27.832
  130    H5     C  12           H5         C  12 -11.034   2.168  29.629
  131    H6     C  12           H6         C  12 -10.387   3.866  31.274
  132    H5'    U  13           H5'        U  13 -14.863   7.593  34.445
  133   H5''    U  13          H5''        U  13 -16.322   6.975  35.247
  134    H4'    U  13           H4'        U  13 -16.582   7.690  32.808
  135    H3'    U  13           H3'        U  13 -17.389   4.950  33.809
  136    H2'    U  13          H2''        U  13 -18.019   4.317  31.636
  137   HO2'    U  13          H2'         U  13 -18.534   5.779  30.047
  138    H1'    U  13           H1'        U  13 -16.016   5.619  30.246
  139    H3     U  13           H3         U  13 -15.143   1.162  29.708
  140    H5     U  13           H5         U  13 -13.709   2.089  33.563
  141    H6     U  13           H6         U  13 -14.731   4.279  33.345
  142    H5'    U  14           H5'        U  14 -21.860   7.691  33.799
  143   H5''    U  14          H5''        U  14 -22.970   6.320  33.937
  144    H4'    U  14           H4'        U  14 -23.826   7.331  32.032
  145    H3'    U  14           H3'        U  14 -22.547   5.038  31.422
  146    H2'    U  14          H2''        U  14 -20.391   5.986  31.047
  147   HO2'    U  14          H2'         U  14 -20.248   5.248  29.079
  148    H1'    U  14           H1'        U  14 -21.557   8.238  29.436
  149    H3     U  14           H3         U  14 -17.019   9.025  29.187
  150    H5     U  14           H5         U  14 -18.171  10.052  33.110
  151    H6     U  14           H6         U  14 -20.340   9.057  32.662
  152    H5'    C  15           H5'        C  15 -22.063   5.454  27.741
  153   H5''    C  15          H5''        C  15 -23.269   4.646  26.721
  154    H4'    C  15           H4'        C  15 -21.070   3.995  25.988
  155    H3'    C  15           H3'        C  15 -22.949   2.083  26.571
  156    H2'    C  15          H2''        C  15 -22.151   1.491  28.701
  157   HO2'    C  15          H2'         C  15 -21.736  -0.504  28.139
  158    H1'    C  15           H1'        C  15 -19.288   1.717  27.777
  159    H41    C  15           H41        C  15 -18.489   1.542  34.112
  160    H42    C  15           H42        C  15 -19.657   2.827  34.330
  161    H5     C  15           H5         C  15 -20.900   3.805  32.513
  162    H6     C  15           H6         C  15 -21.293   3.761  30.093
  163    H5'    G  16           H5'        G  16 -22.147   2.574  21.498
  164   H5''    G  16          H5''        G  16 -20.730   2.449  22.560
  165    H4'    G  16           H4'        G  16 -22.699   4.742  22.329
  166    H3'    G  16           H3'        G  16 -19.738   4.419  21.775
  167    H2'    G  16          H2''        G  16 -19.328   6.599  22.542
  168   HO2'    G  16          H2'         G  16 -22.151   7.056  22.616
  169    H1'    G  16           H1'        G  16 -21.008   6.566  24.699
  170    H8     G  16           H8         G  16 -18.993   6.659  26.332
  171    H1     G  16           H1         G  16 -16.507   1.251  23.939
  172    H21    G  16           H21        G  16 -17.709   0.564  22.203
  173    H22    G  16           H22        G  16 -19.116   1.433  21.634
  174    H5'    G  17           H5'        G  17 -18.146   7.847  18.483
  175   H5''    G  17          H5''        G  17 -17.484   6.627  19.588
  176    H4'    G  17           H4'        G  17 -18.057   9.545  20.177
  177    H3'    G  17           H3'        G  17 -15.551   7.879  20.004
  178    H2'    G  17          H2''        G  17 -14.588   9.123  21.756
  179   HO2'    G  17          H2'         G  17 -15.161  11.163  22.213
  180    H1'    G  17           H1'        G  17 -16.840   9.358  23.320
  181    H8     G  17           H8         G  17 -15.996   6.054  21.437
  182    H1     G  17           H1         G  17 -14.253   6.243  27.608
  183    H21    G  17           H21        G  17 -14.683   8.245  28.462
  184    H22    G  17           H22        G  17 -15.397   9.535  27.518
  185    H5'    C  18           H5'        C  18 -13.414  11.381  18.730
  186   H5''    C  18          H5''        C  18 -11.973  10.679  17.965
  187    H4'    C  18           H4'        C  18 -11.964  11.459  20.525
  188    H3'    C  18           H3'        C  18 -10.595   9.032  19.337
  189    H2'    C  18          H2''        C  18  -9.882   8.390  21.484
  190   HO2'    C  18          H2'         C  18 -10.346  10.053  23.266
  191    H1'    C  18           H1'        C  18 -12.150   9.146  22.874
  192    H41    C  18           H41        C  18 -12.695   2.856  21.962
  193    H42    C  18           H42        C  18 -13.531   3.161  20.454
  194    H5     C  18           H5         C  18 -13.778   5.362  19.503
  195    H6     C  18           H6         C  18 -13.278   7.744  19.793
  196    H5'    A  19           H5'        A  19  -7.250  11.417  20.911
  197   H5''    A  19          H5''        A  19  -6.037  11.730  19.654
  198    H4'    A  19           H4'        A  19  -4.920  10.755  21.561
  199    H3'    A  19           H3'        A  19  -5.222   8.909  19.183
  200    H2'    A  19          H2''        A  19  -4.195   7.160  20.371
  201   HO2'    A  19          H2'         A  19  -3.122   7.610  22.416
  202    H1'    A  19           H1'        A  19  -5.347   7.623  22.821
  203    H8     A  19           H8         A  19  -7.976   8.224  20.158
  204    H61    A  19           H61        A  19  -8.992   2.117  20.279
  205    H62    A  19           H62        A  19  -9.563   3.661  19.687
  206    H2     A  19           H2         A  19  -5.297   2.963  22.676
  207    H5'    U  20           H5'        U  20  -2.079   8.926  16.344
  208   H5''    U  20          H5''        U  20  -3.501   8.091  15.688
  209    H4'    U  20           H4'        U  20  -1.926   7.417  18.189
  210    H3'    U  20           H3'        U  20  -2.461   6.003  15.567
  211    H2'    U  20          H2''        U  20  -2.517   3.933  16.674
  212   HO2'    U  20          H2'         U  20  -0.935   3.737  18.082
  213    H1'    U  20           H1'        U  20  -3.826   4.763  18.963
  214    H3     U  20           H3         U  20  -6.249   1.946  16.053
  215    H5     U  20           H5         U  20  -7.665   5.894  15.626
  216    H6     U  20           H6         U  20  -5.739   6.652  16.893
  217    H5'    A  21           H5'        A  21   1.524   2.809  15.461
  218   H5''    A  21          H5''        A  21   0.043   1.860  15.228
  219    H4'    A  21           H4'        A  21   1.486   2.391  17.847
  220    H3'    A  21           H3'        A  21   1.134  -0.064  16.111
  221    H2'    A  21          H2''        A  21   0.955  -1.407  18.030
  222   HO2'    A  21          H2'         A  21   2.451  -0.922  19.466
  223    H1'    A  21           H1'        A  21  -0.474   0.366  19.605
  224    H8     A  21           H8         A  21  -2.704   0.930  16.992
  225    H61    A  21           H61        A  21  -4.548  -4.979  16.963
  226    H62    A  21           H62        A  21  -4.923  -3.351  16.450
  227    H2     A  21           H2         A  21  -0.672  -4.740  19.207
  228    H5'    U  22           H5'        U  22   3.777  -1.532  13.530
  229   H5''    U  22          H5''        U  22   2.132  -0.866  13.470
  230    H4'    U  22           H4'        U  22   2.958  -3.737  13.972
  231    H3'    U  22           H3'        U  22   1.454  -2.348  11.776
  232    H2'    U  22          H2''        U  22   0.050  -4.237  11.567
  233   HO2'    U  22          H2'         U  22   0.648  -6.257  12.592
  234    H1'    U  22           H1'        U  22  -0.110  -4.913  14.239
  235    H3     U  22           H3         U  22  -4.138  -3.536  12.322
  236    H5     U  22           H5         U  22  -2.461  -0.213  14.303
  237    H6     U  22           H6         U  22  -0.404  -1.480  14.545
  238    H5'    C  23           H5'        C  23   4.496  -5.424  10.104
  239   H5''    C  23          H5''        C  23   5.171  -5.049   8.505
  240    H4'    C  23           H4'        C  23   3.706  -7.098   8.570
  241    H3'    C  23           H3'        C  23   3.061  -4.767   6.754
  242    H2'    C  23          H2''        C  23   1.124  -5.868   5.985
  243   HO2'    C  23          H2'         C  23   0.791  -8.145   6.808
  244    H1'    C  23           H1'        C  23   0.259  -6.830   8.390
  245    H41    C  23           H41        C  23  -2.327  -0.996   7.437
  246    H42    C  23           H42        C  23  -1.319  -0.434   8.751
  247    H5     C  23           H5         C  23   0.387  -1.790   9.780
  248    H6     C  23           H6         C  23   1.495  -3.978   9.769
  249    H5'    A  24           H5'        A  24   3.720  -8.123   2.974
  250   H5''    A  24          H5''        A  24   4.736  -6.860   2.251
  251    H4'    A  24           H4'        A  24   2.873  -7.702   0.770
  252    H3'    A  24           H3'        A  24   3.062  -4.773   1.512
  253    H2'    A  24          H2''        A  24   1.126  -4.323   0.259
  254   HO2'    A  24          H2'         A  24   0.730  -5.369  -1.543
  255    H1'    A  24           H1'        A  24  -0.270  -6.633   0.867
  256    H8     A  24           H8         A  24   1.546  -5.023   3.857
  257    H61    A  24           H61        A  24  -3.724  -1.911   4.788
  258    H62    A  24           H62        A  24  -2.137  -2.281   5.425
  259    H2     A  24           H2         A  24  -4.087  -4.137   0.911
  260    H5'    G  25           H5'        G  25   3.136  -4.716  -2.567
  261   H5''    G  25          H5''        G  25   4.143  -3.491  -3.366
  262    H4'    G  25           H4'        G  25   1.705  -3.121  -3.713
  263    H3'    G  25           H3'        G  25   3.311  -1.034  -2.222
  264    H2'    G  25          H2''        G  25   1.374   0.268  -1.931
  265   HO2'    G  25          H2'         G  25   0.381   0.350  -3.857
  266    H1'    G  25           H1'        G  25  -0.409  -1.789  -1.484
  267    H8     G  25           H8         G  25   2.935  -2.356   0.292
  268    H1     G  25           H1         G  25  -1.233   1.251   3.575
  269    H21    G  25           H21        G  25  -2.971   1.764   2.292
  270    H22    G  25           H22        G  25  -3.107   1.221   0.635
  271    H5'    C  26           H5'        C  26   2.212   1.571  -5.462
  272   H5''    C  26          H5''        C  26   3.604   2.626  -5.782
  273    H4'    C  26           H4'        C  26   1.545   3.726  -4.730
  274    H3'    C  26           H3'        C  26   4.318   3.948  -3.539
  275    H2'    C  26          H2''        C  26   3.469   5.227  -1.758
  276   HO2'    C  26          H2'         C  26   1.833   6.158  -3.613
  277    H1'    C  26           H1'        C  26   1.085   3.877  -1.418
  278    H41    C  26           H41        C  26   5.156   1.530   2.922
  279    H42    C  26           H42        C  26   5.590   0.263   1.796
  280    H5     C  26           H5         C  26   4.809   0.198  -0.483
  281    H6     C  26           H6         C  26   3.443   1.333  -2.174
  282    H5'    C  27           H5'        C  27   3.775   8.138  -5.639
  283   H5''    C  27          H5''        C  27   5.404   8.692  -6.076
  284    H4'    C  27           H4'        C  27   4.207   9.985  -4.220
  285    H3'    C  27           H3'        C  27   6.977   8.813  -3.886
  286    H2'    C  27          H2''        C  27   7.061   9.597  -1.671
  287   HO2'    C  27          H2'         C  27   6.366  11.619  -1.572
  288    H1'    C  27           H1'        C  27   4.434   9.099  -0.989
  289    H41    C  27           H41        C  27   7.816   4.101   1.134
  290    H42    C  27           H42        C  27   7.576   3.300  -0.403
  291    H5     C  27           H5         C  27   6.519   4.358  -2.292
  292    H6     C  27           H6         C  27   5.464   6.412  -3.115
  293    H5'    C  28           H5'        C  28   7.322  13.063  -3.736
  294   H5''    C  28          H5''        C  28   8.631  13.901  -4.595
  295    H4'    C  28           H4'        C  28   8.782  14.295  -2.180
  296    H3'    C  28           H3'        C  28  10.953  12.583  -3.406
  297   HO3'    C  28          H3T         C  28  12.089  14.591  -2.943
  298    H2'    C  28          H2''        C  28  11.989  12.380  -1.314
  299   HO2'    C  28          H2'         C  28  11.865  13.896   0.191
  300    H1'    C  28           H1'        C  28   9.686  12.154   0.196
  301    H41    C  28           H41        C  28  11.823   6.211  -0.834
  302    H42    C  28           H42        C  28  10.793   6.110  -2.245
  303    H5     C  28           H5         C  28   9.534   7.978  -3.098
  304    H6     C  28           H6         C  28   8.990  10.348  -2.782
  Start of MODEL    5
    1    H5'    G   1           H5'        G   1  16.667   4.875   5.459
    2   H5''    G   1          H5''        G   1  16.586   4.122   3.856
    3    H4'    G   1           H4'        G   1  16.856   7.114   4.277
    4    H3'    G   1           H3'        G   1  14.379   5.398   3.987
    5    H2'    G   1          H2''        G   1  13.424   6.993   2.551
    6   HO2'    G   1          H2'         G   1  15.482   8.871   3.110
    7    H1'    G   1           H1'        G   1  15.723   7.722   1.201
    8    H8     G   1           H8         G   1  14.766   4.033   2.058
    9    H1     G   1           H1         G   1  13.650   5.889  -3.981
   10    H21    G   1           H21        G   1  14.152   8.038  -4.222
   11    H22    G   1           H22        G   1  14.760   9.013  -2.903
   12   HO5'    G   1          H5T         G   1  18.702   5.691   4.914
   13    H5'    G   2           H5'        G   2  12.970  10.293   5.401
   14   H5''    G   2          H5''        G   2  11.742   9.483   6.395
   15    H4'    G   2           H4'        G   2  10.981  11.353   4.757
   16    H3'    G   2           H3'        G   2   9.669   8.638   5.016
   17    H2'    G   2          H2''        G   2   8.159   9.183   3.300
   18   HO2'    G   2          H2'         G   2   8.202  11.499   2.519
   19    H1'    G   2           H1'        G   2   9.904  10.572   1.676
   20    H8     G   2           H8         G   2  11.225   7.338   3.344
   21    H1     G   2           H1         G   2   8.663   6.563  -2.486
   22    H21    G   2           H21        G   2   7.749   8.465  -3.175
   23    H22    G   2           H22        G   2   7.769   9.921  -2.206
   24    H5'    G   3           H5'        G   3   6.325  11.588   5.562
   25   H5''    G   3          H5''        G   3   5.171  10.847   6.689
   26    H4'    G   3           H4'        G   3   4.317  11.442   4.333
   27    H3'    G   3           H3'        G   3   3.965   8.722   5.612
   28    H2'    G   3          H2''        G   3   2.893   7.929   3.676
   29   HO2'    G   3          H2'         G   3   2.613  10.687   2.978
   30    H1'    G   3           H1'        G   3   4.453   9.229   1.810
   31    H8     G   3           H8         G   3   6.359   7.746   4.817
   32    H1     G   3           H1         G   3   5.671   3.780  -0.179
   33    H21    G   3           H21        G   3   4.323   4.689  -1.692
   34    H22    G   3           H22        G   3   3.596   6.265  -1.475
   35    H5'    C   4           H5'        C   4  -0.255  10.341   3.792
   36   H5''    C   4          H5''        C   4  -1.262   9.836   5.165
   37    H4'    C   4           H4'        C   4  -1.977   9.174   2.732
   38    H3'    C   4           H3'        C   4  -1.971   7.340   5.140
   39    H2'    C   4          H2''        C   4  -2.670   5.544   3.798
   40   HO2'    C   4          H2'         C   4  -3.081   6.565   1.381
   41    H1'    C   4           H1'        C   4  -1.184   6.142   1.548
   42    H41    C   4           H41        C   4   2.147   1.746   4.787
   43    H42    C   4           H42        C   4   2.962   3.025   5.658
   44    H5     C   4           H5         C   4   2.370   5.351   5.450
   45    H6     C   4           H6         C   4   0.867   6.954   4.361
   46    H5'    A   5           H5'        A   5  -7.030   8.249   2.779
   47   H5''    A   5          H5''        A   5  -7.522   7.535   4.329
   48    H4'    A   5           H4'        A   5  -8.687   6.695   2.176
   49    H3'    A   5           H3'        A   5  -7.489   4.886   4.285
   50    H2'    A   5          H2''        A   5  -8.078   2.994   3.020
   51   HO2'    A   5          H2'         A   5  -9.443   3.974   0.938
   52    H1'    A   5           H1'        A   5  -7.531   4.018   0.518
   53    H8     A   5           H8         A   5  -4.758   5.149   2.815
   54    H61    A   5           H61        A   5  -2.155  -0.391   1.887
   55    H62    A   5           H62        A   5  -1.932   1.213   2.549
   56    H2     A   5           H2         A   5  -6.300  -0.496   0.178
   57    H5'    G   6           H5'        G   6 -10.868   2.451   3.547
   58   H5''    G   6          H5''        G   6 -11.566   2.285   5.171
   59    H4'    G   6           H4'        G   6 -10.841   0.129   3.968
   60    H3'    G   6           H3'        G   6  -9.973   0.849   6.777
   61    H2'    G   6          H2''        G   6  -8.698  -1.121   6.902
   62   HO2'    G   6          H2'         G   6 -10.508  -1.979   4.944
   63    H1'    G   6           H1'        G   6  -7.767  -1.141   4.303
   64    H8     G   6           H8         G   6  -7.543   2.427   5.455
   65    H1     G   6           H1         G   6  -2.855  -1.265   7.812
   66    H21    G   6           H21        G   6  -3.310  -3.405   7.437
   67    H22    G   6           H22        G   6  -4.761  -3.925   6.609
   68    H5'    U   7           H5'        U   7 -11.794  -2.889   7.480
   69   H5''    U   7          H5''        U   7 -12.787  -2.887   8.951
   70    H4'    U   7           H4'        U   7 -10.783  -4.456   8.962
   71    H3'    U   7           H3'        U   7 -11.191  -2.358  11.105
   72    H2'    U   7          H2''        U   7  -9.197  -3.022  12.155
   73   HO2'    U   7          H2'         U   7  -8.823  -5.098  12.260
   74    H1'    U   7           H1'        U   7  -7.715  -3.523   9.876
   75    H3     U   7           H3         U   7  -5.938   0.114  12.068
   76    H5     U   7           H5         U   7  -8.971   1.643   9.570
   77    H6     U   7           H6         U   7  -9.663  -0.641   9.123
   78    H5'    G   8           H5'        G   8 -11.013  -6.059  12.874
   79   H5''    G   8          H5''        G   8 -12.128  -6.558  14.161
   80    H4'    G   8           H4'        G   8  -9.581  -6.544  14.664
   81    H3'    G   8           H3'        G   8 -11.656  -6.333  16.427
   82    H2'    G   8          H2''        G   8 -11.864  -3.985  16.444
   83   HO2'    G   8          H2'         G   8 -11.226  -3.477  18.416
   84    H1'    G   8           H1'        G   8  -8.897  -3.534  16.415
   85    H8     G   8           H8         G   8 -12.225  -2.670  14.551
   86    H1     G   8           H1         G   8  -8.020   2.135  15.173
   87    H21    G   8           H21        G   8  -6.170   1.404  16.159
   88    H22    G   8           H22        G   8  -5.969  -0.259  16.663
   89    H5'    A   9           H5'        A   9  -8.152  -4.683  18.482
   90   H5''    A   9          H5''        A   9  -7.371  -6.236  18.837
   91    H4'    A   9           H4'        A   9  -6.802  -5.606  21.006
   92    H3'    A   9           H3'        A   9  -9.160  -3.713  20.881
   93    H2'    A   9          H2''        A   9  -8.077  -2.237  22.354
   94   HO2'    A   9          H2'         A   9  -6.798  -4.571  23.157
   95    H1'    A   9           H1'        A   9  -5.521  -2.510  21.374
   96    H8     A   9           H8         A   9  -8.337  -2.355  18.729
   97    H61    A   9           H61        A   9  -7.260   3.742  18.657
   98    H62    A   9           H62        A   9  -8.142   2.426  17.917
   99    H2     A   9           H2         A   9  -4.786   1.928  21.930
  100    H5'    U  10           H5'        U  10  -8.468  -5.048  25.414
  101   H5''    U  10          H5''        U  10  -9.910  -4.450  26.261
  102    H4'    U  10           H4'        U  10  -7.497  -3.522  26.867
  103    H3'    U  10           H3'        U  10 -10.056  -1.920  26.633
  104    H2'    U  10          H2''        U  10  -8.866   0.063  27.047
  105   HO2'    U  10          H2'         U  10  -7.677  -0.703  28.850
  106    H1'    U  10           H1'        U  10  -6.566  -0.569  25.642
  107    H3     U  10           H3         U  10  -8.230   2.635  22.899
  108    H5     U  10           H5         U  10 -11.054  -0.482  22.600
  109    H6     U  10           H6         U  10  -9.819  -1.676  24.314
  110    H5'    G  11           H5'        G  11  -8.817  -1.587  31.061
  111   H5''    G  11          H5''        G  11 -10.246  -1.145  32.019
  112    H4'    G  11           H4'        G  11  -8.298   0.555  31.878
  113    H3'    G  11           H3'        G  11 -11.195   1.243  31.416
  114    H2'    G  11          H2''        G  11 -10.589   3.468  30.925
  115   HO2'    G  11          H2'         G  11  -8.303   2.803  32.431
  116    H1'    G  11           H1'        G  11  -8.240   2.954  29.575
  117    H8     G  11           H8         G  11 -10.933   0.481  28.516
  118    H1     G  11           H1         G  11 -11.157   6.092  25.414
  119    H21    G  11           H21        G  11  -9.802   7.556  26.389
  120    H22    G  11           H22        G  11  -8.845   7.155  27.798
  121    H5'    C  12           H5'        C  12 -11.115   4.059  36.225
  122   H5''    C  12          H5''        C  12 -12.693   3.314  35.889
  123    H4'    C  12           H4'        C  12 -12.143   6.073  35.952
  124    H3'    C  12           H3'        C  12 -14.442   4.471  34.808
  125    H2'    C  12          H2''        C  12 -15.257   6.380  33.702
  126   HO2'    C  12          H2'         C  12 -15.145   8.236  34.703
  127    H1'    C  12           H1'        C  12 -12.844   7.432  32.922
  128    H41    C  12           H41        C  12 -15.167   3.985  28.044
  129    H42    C  12           H42        C  12 -14.093   2.685  28.508
  130    H5     C  12           H5         C  12 -12.768   2.721  30.521
  131    H6     C  12           H6         C  12 -12.187   4.012  32.522
  132    H5'    U  13           H5'        U  13 -16.931   7.536  35.768
  133   H5''    U  13          H5''        U  13 -18.461   6.714  36.136
  134    H4'    U  13           H4'        U  13 -18.235   7.975  33.872
  135    H3'    U  13           H3'        U  13 -19.318   5.168  34.196
  136    H2'    U  13          H2''        U  13 -19.589   4.985  31.868
  137   HO2'    U  13          H2'         U  13 -19.199   7.060  30.596
  138    H1'    U  13           H1'        U  13 -17.311   6.351  31.102
  139    H3     U  13           H3         U  13 -16.583   1.999  29.895
  140    H5     U  13           H5         U  13 -15.802   2.120  34.036
  141    H6     U  13           H6         U  13 -16.656   4.391  34.064
  142    H5'    U  14           H5'        U  14 -23.582   8.207  33.979
  143   H5''    U  14          H5''        U  14 -24.764   6.925  33.677
  144    H4'    U  14           H4'        U  14 -25.248   8.345  31.906
  145    H3'    U  14           H3'        U  14 -24.015   6.103  31.055
  146    H2'    U  14          H2''        U  14 -21.778   6.916  31.179
  147   HO2'    U  14          H2'         U  14 -21.191   7.581  28.995
  148    H1'    U  14           H1'        U  14 -22.539   9.522  29.900
  149    H3     U  14           H3         U  14 -17.983   9.930  30.492
  150    H5     U  14           H5         U  14 -19.705  10.326  34.320
  151    H6     U  14           H6         U  14 -21.824   9.625  33.367
  152    H5'    C  15           H5'        C  15 -22.957   7.119  27.687
  153   H5''    C  15          H5''        C  15 -24.049   6.711  26.349
  154    H4'    C  15           H4'        C  15 -21.867   5.942  25.753
  155    H3'    C  15           H3'        C  15 -23.945   4.155  25.751
  156    H2'    C  15          H2''        C  15 -23.475   3.110  27.802
  157   HO2'    C  15          H2'         C  15 -21.492   1.679  26.409
  158    H1'    C  15           H1'        C  15 -20.509   3.214  27.272
  159    H41    C  15           H41        C  15 -20.560   1.854  33.511
  160    H42    C  15           H42        C  15 -21.641   3.191  33.830
  161    H5     C  15           H5         C  15 -22.558   4.591  32.096
  162    H6     C  15           H6         C  15 -22.634   5.010  29.681
  163    H5'    G  16           H5'        G  16 -22.691   6.398  21.464
  164   H5''    G  16          H5''        G  16 -21.282   5.762  22.336
  165    H4'    G  16           H4'        G  16 -23.006   8.152  23.042
  166    H3'    G  16           H3'        G  16 -20.085   7.765  22.341
  167    H2'    G  16          H2''        G  16 -19.469   9.455  23.846
  168   HO2'    G  16          H2'         G  16 -20.887  11.089  23.475
  169    H1'    G  16           H1'        G  16 -21.179   8.790  25.872
  170    H8     G  16           H8         G  16 -19.428   7.842  27.496
  171    H1     G  16           H1         G  16 -16.774   4.167  22.956
  172    H21    G  16           H21        G  16 -17.829   4.464  21.024
  173    H22    G  16           H22        G  16 -19.180   5.560  20.851
  174    H5'    G  17           H5'        G  17 -17.602  10.819  19.960
  175   H5''    G  17          H5''        G  17 -17.794   9.483  21.113
  176    H4'    G  17           H4'        G  17 -17.691  12.398  21.947
  177    H3'    G  17           H3'        G  17 -15.448  10.415  21.578
  178    H2'    G  17          H2''        G  17 -14.444  11.152  23.574
  179   HO2'    G  17          H2'         G  17 -16.059  13.212  24.297
  180    H1'    G  17           H1'        G  17 -16.750  11.516  25.046
  181    H8     G  17           H8         G  17 -16.094   8.470  22.689
  182    H1     G  17           H1         G  17 -15.294   7.374  28.960
  183    H21    G  17           H21        G  17 -15.616   9.246  30.108
  184    H22    G  17           H22        G  17 -16.027  10.762  29.336
  185    H5'    C  18           H5'        C  18 -12.747  13.775  21.043
  186   H5''    C  18          H5''        C  18 -11.361  13.000  20.248
  187    H4'    C  18           H4'        C  18 -11.427  13.383  22.896
  188    H3'    C  18           H3'        C  18 -10.310  10.992  21.408
  189    H2'    C  18          H2''        C  18  -9.831   9.946  23.459
  190   HO2'    C  18          H2'         C  18  -9.007  11.188  24.956
  191    H1'    C  18           H1'        C  18 -12.070  10.791  24.842
  192    H41    C  18           H41        C  18 -13.350   4.844  22.910
  193    H42    C  18           H42        C  18 -14.054   5.490  21.443
  194    H5     C  18           H5         C  18 -13.965   7.825  20.852
  195    H6     C  18           H6         C  18 -13.183  10.044  21.540
  196    H5'    A  19           H5'        A  19  -6.417  12.837  23.168
  197   H5''    A  19          H5''        A  19  -5.296  12.858  21.792
  198    H4'    A  19           H4'        A  19  -4.355  11.630  23.717
  199    H3'    A  19           H3'        A  19  -4.969  10.077  21.194
  200    H2'    A  19          H2''        A  19  -4.259   8.083  22.216
  201   HO2'    A  19          H2'         A  19  -2.448   8.323  23.305
  202    H1'    A  19           H1'        A  19  -5.284   8.543  24.731
  203    H8     A  19           H8         A  19  -7.850   9.751  22.235
  204    H61    A  19           H61        A  19  -9.807   3.886  21.908
  205    H62    A  19           H62        A  19 -10.149   5.546  21.473
  206    H2     A  19           H2         A  19  -5.939   3.940  24.178
  207    H5'    U  20           H5'        U  20  -0.500   9.491  21.511
  208   H5''    U  20          H5''        U  20   0.019   8.851  19.938
  209    H4'    U  20           H4'        U  20  -0.122   7.246  22.013
  210    H3'    U  20           H3'        U  20  -1.105   6.643  19.215
  211    H2'    U  20          H2''        U  20  -1.935   4.562  19.930
  212   HO2'    U  20          H2'         U  20  -0.438   4.941  22.342
  213    H1'    U  20           H1'        U  20  -2.897   5.353  22.390
  214    H3     U  20           H3         U  20  -6.813   4.765  20.169
  215    H5     U  20           H5         U  20  -5.092   8.119  18.281
  216    H6     U  20           H6         U  20  -3.109   7.784  19.640
  217    H5'    A  21           H5'        A  21   2.076   2.696  18.146
  218   H5''    A  21          H5''        A  21   0.486   2.179  17.547
  219    H4'    A  21           H4'        A  21   1.748   1.602  20.242
  220    H3'    A  21           H3'        A  21   0.869  -0.102  17.898
  221    H2'    A  21          H2''        A  21   0.188  -1.799  19.373
  222   HO2'    A  21          H2'         A  21   2.025  -1.881  20.687
  223    H1'    A  21           H1'        A  21  -0.819  -0.187  21.380
  224    H8     A  21           H8         A  21  -2.375   1.595  18.664
  225    H61    A  21           H61        A  21  -6.142  -3.214  17.655
  226    H62    A  21           H62        A  21  -5.849  -1.520  17.331
  227    H2     A  21           H2         A  21  -2.786  -4.602  20.287
  228    H5'    U  22           H5'        U  22   3.275  -2.397  15.331
  229   H5''    U  22          H5''        U  22   1.980  -1.216  15.048
  230    H4'    U  22           H4'        U  22   1.704  -4.179  15.613
  231    H3'    U  22           H3'        U  22   1.085  -2.434  13.250
  232    H2'    U  22          H2''        U  22  -0.838  -3.735  12.812
  233   HO2'    U  22          H2'         U  22  -0.011  -5.792  12.921
  234    H1'    U  22           H1'        U  22  -1.593  -4.228  15.425
  235    H3     U  22           H3         U  22  -4.536  -1.561  12.921
  236    H5     U  22           H5         U  22  -2.237   0.962  15.395
  237    H6     U  22           H6         U  22  -0.792  -0.930  15.869
  238    H5'    C  23           H5'        C  23   3.124  -6.428  11.997
  239   H5''    C  23          H5''        C  23   4.102  -6.352  10.517
  240    H4'    C  23           H4'        C  23   2.051  -7.807  10.347
  241    H3'    C  23           H3'        C  23   2.477  -5.463   8.482
  242    H2'    C  23          H2''        C  23   0.413  -5.885   7.430
  243   HO2'    C  23          H2'         C  23  -0.754  -7.917   8.228
  244    H1'    C  23           H1'        C  23  -1.050  -6.442   9.669
  245    H41    C  23           H41        C  23  -1.483  -0.127   8.443
  246    H42    C  23           H42        C  23  -0.534   0.128   9.890
  247    H5     C  23           H5         C  23   0.498  -1.664  11.126
  248    H6     C  23           H6         C  23   0.843  -4.089  11.242
  249    H5'    A  24           H5'        A  24   2.831  -9.031   4.906
  250   H5''    A  24          H5''        A  24   4.178  -8.090   4.235
  251    H4'    A  24           H4'        A  24   2.238  -8.608   2.650
  252    H3'    A  24           H3'        A  24   3.261  -5.800   3.126
  253    H2'    A  24          H2''        A  24   1.637  -4.946   1.658
  254   HO2'    A  24          H2'         A  24   1.454  -7.636   0.727
  255    H1'    A  24           H1'        A  24  -0.435  -6.640   2.350
  256    H8     A  24           H8         A  24   1.495  -5.428   5.421
  257    H61    A  24           H61        A  24  -2.352  -0.577   5.411
  258    H62    A  24           H62        A  24  -1.095  -1.418   6.291
  259    H2     A  24           H2         A  24  -3.039  -2.909   1.642
  260    H5'    G  25           H5'        G  25   3.593  -6.832  -0.941
  261   H5''    G  25          H5''        G  25   4.927  -6.222  -1.942
  262    H4'    G  25           H4'        G  25   2.675  -5.502  -2.747
  263    H3'    G  25           H3'        G  25   4.679  -3.415  -1.861
  264    H2'    G  25          H2''        G  25   3.129  -1.708  -2.326
  265   HO2'    G  25          H2'         G  25   2.317  -3.448  -4.224
  266    H1'    G  25           H1'        G  25   0.863  -2.995  -1.430
  267    H8     G  25           H8         G  25   3.859  -3.619   0.867
  268    H1     G  25           H1         G  25   0.687   1.825   2.077
  269    H21    G  25           H21        G  25  -0.800   2.211   0.474
  270    H22    G  25           H22        G  25  -1.013   1.135  -0.888
  271    H5'    C  26           H5'        C  26   3.894  -2.654  -5.885
  272   H5''    C  26          H5''        C  26   5.158  -1.978  -6.932
  273    H4'    C  26           H4'        C  26   3.263  -0.399  -6.421
  274    H3'    C  26           H3'        C  26   6.112   0.311  -5.691
  275    H2'    C  26          H2''        C  26   5.385   2.352  -4.777
  276   HO2'    C  26          H2'         C  26   2.711   2.154  -5.518
  277    H1'    C  26           H1'        C  26   3.059   1.444  -3.616
  278    H41    C  26           H41        C  26   7.570   1.502   0.929
  279    H42    C  26           H42        C  26   7.858  -0.196   0.620
  280    H5     C  26           H5         C  26   6.825  -1.402  -1.192
  281    H6     C  26           H6         C  26   5.294  -1.241  -3.100
  282    H5'    C  27           H5'        C  27   5.111   2.835  -9.498
  283   H5''    C  27          H5''        C  27   6.576   3.036 -10.481
  284    H4'    C  27           H4'        C  27   5.617   5.185  -9.594
  285    H3'    C  27           H3'        C  27   8.437   4.353  -8.880
  286    H2'    C  27          H2''        C  27   8.695   6.297  -7.580
  287   HO2'    C  27          H2'         C  27   6.241   7.438  -8.339
  288    H1'    C  27           H1'        C  27   6.157   6.371  -6.503
  289    H41    C  27           H41        C  27   9.897   3.518  -2.165
  290    H42    C  27           H42        C  27   9.503   1.966  -2.871
  291    H5     C  27           H5         C  27   8.215   1.724  -4.893
  292    H6     C  27           H6         C  27   7.026   2.916  -6.675
  293    H5'    C  28           H5'        C  28   8.942   7.858 -11.041
  294   H5''    C  28          H5''        C  28  10.196   7.961 -12.293
  295    H4'    C  28           H4'        C  28  10.672   9.517 -10.461
  296    H3'    C  28           H3'        C  28  12.536   7.151 -10.729
  297   HO3'    C  28          H3T         C  28  12.488   9.909 -11.424
  298    H2'    C  28          H2''        C  28  13.798   7.928  -8.914
  299   HO2'    C  28          H2'         C  28  12.360  10.397  -9.070
  300    H1'    C  28           H1'        C  28  11.681   8.822  -7.377
  301    H41    C  28           H41        C  28  13.192   2.995  -5.213
  302    H42    C  28           H42        C  28  12.035   2.300  -6.326
  303    H5     C  28           H5         C  28  10.863   3.590  -7.989
  304    H6     C  28           H6         C  28  10.546   5.827  -8.942
  Start of MODEL    6
    1    H5'    G   1           H5'        G   1  14.486   3.327   7.476
    2   H5''    G   1          H5''        G   1  15.173   3.002   5.874
    3    H4'    G   1           H4'        G   1  15.610   5.698   7.131
    4    H3'    G   1           H3'        G   1  13.034   4.728   5.872
    5    H2'    G   1          H2''        G   1  12.843   6.747   4.679
    6   HO2'    G   1          H2'         G   1  14.422   8.507   5.258
    7    H1'    G   1           H1'        G   1  15.511   7.107   4.099
    8    H8     G   1           H8         G   1  14.773   3.450   3.581
    9    H1     G   1           H1         G   1  12.734   7.149  -1.248
   10    H21    G   1           H21        G   1  12.837   9.289  -0.663
   11    H22    G   1           H22        G   1  13.405   9.806   0.909
   12   HO5'    G   1          H5T         G   1  16.383   3.057   8.266
   13    H5'    G   2           H5'        G   2  11.559   7.994   8.760
   14   H5''    G   2          H5''        G   2  10.067   7.394   9.513
   15    H4'    G   2           H4'        G   2   9.772   9.532   8.238
   16    H3'    G   2           H3'        G   2   8.237   7.056   7.417
   17    H2'    G   2          H2''        G   2   7.233   8.245   5.657
   18   HO2'    G   2          H2'         G   2   7.940  10.735   5.794
   19    H1'    G   2           H1'        G   2   9.418   9.769   4.927
   20    H8     G   2           H8         G   2  10.736   6.310   5.566
   21    H1     G   2           H1         G   2   7.718   6.843  -0.071
   22    H21    G   2           H21        G   2   6.613   8.767  -0.164
   23    H22    G   2           H22        G   2   6.617   9.916   1.156
   24    H5'    G   3           H5'        G   3   5.196   9.905   8.665
   25   H5''    G   3          H5''        G   3   3.745   9.176   9.384
   26    H4'    G   3           H4'        G   3   3.379  10.352   7.172
   27    H3'    G   3           H3'        G   3   2.662   7.437   7.552
   28    H2'    G   3          H2''        G   3   1.954   7.297   5.315
   29   HO2'    G   3          H2'         G   3   0.838   8.941   4.598
   30    H1'    G   3           H1'        G   3   3.907   8.884   4.189
   31    H8     G   3           H8         G   3   5.344   6.602   6.898
   32    H1     G   3           H1         G   3   4.827   3.843   1.130
   33    H21    G   3           H21        G   3   3.678   5.156  -0.242
   34    H22    G   3           H22        G   3   3.039   6.707   0.258
   35    H5'    C   4           H5'        C   4  -1.351   9.433   5.583
   36   H5''    C   4          H5''        C   4  -2.398   8.747   6.842
   37    H4'    C   4           H4'        C   4  -3.026   8.358   4.348
   38    H3'    C   4           H3'        C   4  -2.953   6.202   6.472
   39    H2'    C   4          H2''        C   4  -3.543   4.586   4.871
   40   HO2'    C   4          H2'         C   4  -4.303   6.797   3.223
   41    H1'    C   4           H1'        C   4  -2.076   5.590   2.753
   42    H41    C   4           H41        C   4   1.420   0.892   5.329
   43    H42    C   4           H42        C   4   2.214   2.070   6.349
   44    H5     C   4           H5         C   4   1.549   4.383   6.461
   45    H6     C   4           H6         C   4  -0.024   6.065   5.620
   46    H5'    A   5           H5'        A   5  -8.005   7.238   4.143
   47   H5''    A   5          H5''        A   5  -8.497   6.284   5.557
   48    H4'    A   5           H4'        A   5  -9.578   5.736   3.265
   49    H3'    A   5           H3'        A   5  -8.380   3.680   5.136
   50    H2'    A   5          H2''        A   5  -8.866   1.972   3.598
   51   HO2'    A   5          H2'         A   5 -11.008   3.416   3.115
   52    H1'    A   5           H1'        A   5  -8.296   3.364   1.283
   53    H8     A   5           H8         A   5  -5.574   4.263   3.708
   54    H61    A   5           H61        A   5  -2.849  -1.086   2.197
   55    H62    A   5           H62        A   5  -2.661   0.443   3.026
   56    H2     A   5           H2         A   5  -6.995  -1.104   0.487
   57    H5'    G   6           H5'        G   6 -11.746   1.017   3.833
   58   H5''    G   6          H5''        G   6 -12.328   0.689   5.478
   59    H4'    G   6           H4'        G   6 -11.486  -1.312   4.091
   60    H3'    G   6           H3'        G   6 -10.539  -0.696   6.899
   61    H2'    G   6          H2''        G   6  -9.086  -2.543   6.830
   62   HO2'    G   6          H2'         G   6  -9.630  -3.703   4.468
   63    H1'    G   6           H1'        G   6  -8.284  -2.302   4.201
   64    H8     G   6           H8         G   6  -8.436   1.152   5.764
   65    H1     G   6           H1         G   6  -3.076  -2.083   7.167
   66    H21    G   6           H21        G   6  -3.275  -4.199   6.525
   67    H22    G   6           H22        G   6  -4.719  -4.815   5.755
   68    H5'    U   7           H5'        U   7 -11.826  -4.595   7.566
   69   H5''    U   7          H5''        U   7 -12.653  -4.741   9.131
   70    H4'    U   7           H4'        U   7 -10.443  -5.982   8.926
   71    H3'    U   7           H3'        U   7 -10.945  -3.952  11.114
   72    H2'    U   7          H2''        U   7  -8.774  -4.290  11.947
   73   HO2'    U   7          H2'         U   7  -8.593  -6.603  10.271
   74    H1'    U   7           H1'        U   7  -7.474  -4.573   9.525
   75    H3     U   7           H3         U   7  -6.094  -0.679  11.566
   76    H5     U   7           H5         U   7  -9.555   0.326   9.378
   77    H6     U   7           H6         U   7  -9.912  -2.042   8.982
   78    H5'    G   8           H5'        G   8 -10.351  -7.701  13.005
   79   H5''    G   8          H5''        G   8 -11.347  -8.144  14.405
   80    H4'    G   8           H4'        G   8  -8.770  -7.853  14.714
   81    H3'    G   8           H3'        G   8 -10.742  -7.714  16.597
   82    H2'    G   8          H2''        G   8 -11.207  -5.412  16.469
   83   HO2'    G   8          H2'         G   8 -10.475  -4.660  18.329
   84    H1'    G   8           H1'        G   8  -8.332  -4.622  16.166
   85    H8     G   8           H8         G   8 -11.865  -4.350  14.516
   86    H1     G   8           H1         G   8  -8.260   0.953  14.322
   87    H21    G   8           H21        G   8  -6.263   0.549  15.203
   88    H22    G   8           H22        G   8  -5.816  -1.019  15.835
   89    H5'    A   9           H5'        A   9  -7.014  -5.968  18.335
   90   H5''    A   9          H5''        A   9  -6.275  -7.301  19.244
   91    H4'    A   9           H4'        A   9  -5.859  -5.974  21.059
   92    H3'    A   9           H3'        A   9  -8.607  -4.801  20.575
   93    H2'    A   9          H2''        A   9  -7.989  -2.845  21.714
   94   HO2'    A   9          H2'         A   9  -5.848  -4.421  22.756
   95    H1'    A   9           H1'        A   9  -5.377  -2.682  20.829
   96    H8     A   9           H8         A   9  -8.508  -3.505  18.627
   97    H61    A   9           H61        A   9  -7.854   2.291  16.552
   98    H62    A   9           H62        A   9  -8.773   0.809  16.421
   99    H2     A   9           H2         A   9  -4.703   1.560  19.660
  100    H5'    U  10           H5'        U  10  -7.124  -5.281  25.521
  101   H5''    U  10          H5''        U  10  -8.542  -4.510  26.262
  102    H4'    U  10           H4'        U  10  -6.047  -3.605  26.688
  103    H3'    U  10           H3'        U  10  -8.590  -1.985  26.401
  104    H2'    U  10          H2''        U  10  -7.348   0.003  26.538
  105   HO2'    U  10          H2'         U  10  -6.012  -0.215  28.231
  106    H1'    U  10           H1'        U  10  -5.109  -0.840  25.133
  107    H3     U  10           H3         U  10  -6.737   2.094  22.089
  108    H5     U  10           H5         U  10  -9.726  -0.873  22.282
  109    H6     U  10           H6         U  10  -8.471  -1.928  24.071
  110    H5'    G  11           H5'        G  11  -7.111  -1.023  30.506
  111   H5''    G  11          H5''        G  11  -8.435  -0.424  31.527
  112    H4'    G  11           H4'        G  11  -6.553   1.229  30.767
  113    H3'    G  11           H3'        G  11  -9.522   1.788  30.729
  114    H2'    G  11          H2''        G  11  -9.134   3.884  29.735
  115   HO2'    G  11          H2'         G  11  -7.349   4.311  31.294
  116    H1'    G  11           H1'        G  11  -7.018   3.176  28.109
  117    H8     G  11           H8         G  11  -9.515   0.406  27.751
  118    H1     G  11           H1         G  11 -11.045   5.635  24.364
  119    H21    G  11           H21        G  11  -9.791   7.351  25.006
  120    H22    G  11           H22        G  11  -8.583   7.213  26.263
  121    H5'    C  12           H5'        C  12 -10.900   3.467  35.498
  122   H5''    C  12          H5''        C  12 -11.521   3.025  33.894
  123    H4'    C  12           H4'        C  12 -10.896   5.764  35.011
  124    H3'    C  12           H3'        C  12 -13.307   4.455  33.730
  125    H2'    C  12          H2''        C  12 -13.910   6.480  32.703
  126   HO2'    C  12          H2'         C  12 -13.022   8.475  33.353
  127    H1'    C  12           H1'        C  12 -11.400   7.330  31.999
  128    H41    C  12           H41        C  12 -13.909   4.100  27.031
  129    H42    C  12           H42        C  12 -12.766   2.825  27.386
  130    H5     C  12           H5         C  12 -11.371   2.811  29.350
  131    H6     C  12           H6         C  12 -10.770   4.017  31.399
  132    H5'    U  13           H5'        U  13 -15.272   7.598  35.158
  133   H5''    U  13          H5''        U  13 -16.928   7.145  35.614
  134    H4'    U  13           H4'        U  13 -16.643   8.529  33.470
  135    H3'    U  13           H3'        U  13 -18.194   5.933  33.586
  136    H2'    U  13          H2''        U  13 -18.626   6.062  31.278
  137   HO2'    U  13          H2'         U  13 -17.528   8.620  30.937
  138    H1'    U  13           H1'        U  13 -16.184   7.055  30.475
  139    H3     U  13           H3         U  13 -16.493   2.750  28.909
  140    H5     U  13           H5         U  13 -15.115   2.408  32.879
  141    H6     U  13           H6         U  13 -15.551   4.779  33.164
  142    H5'    U  14           H5'        U  14 -22.003   9.438  33.595
  143   H5''    U  14          H5''        U  14 -23.284   8.226  33.741
  144    H4'    U  14           H4'        U  14 -23.975   9.235  31.780
  145    H3'    U  14           H3'        U  14 -22.855   6.833  31.238
  146    H2'    U  14          H2''        U  14 -20.630   7.622  30.893
  147   HO2'    U  14          H2'         U  14 -20.773   8.177  28.359
  148    H1'    U  14           H1'        U  14 -21.634   9.923  29.235
  149    H3     U  14           H3         U  14 -17.081  10.495  28.915
  150    H5     U  14           H5         U  14 -18.068  11.432  32.906
  151    H6     U  14           H6         U  14 -20.305  10.590  32.480
  152    H5'    C  15           H5'        C  15 -22.286   7.159  27.609
  153   H5''    C  15          H5''        C  15 -23.537   6.486  26.546
  154    H4'    C  15           H4'        C  15 -21.413   5.619  25.844
  155    H3'    C  15           H3'        C  15 -23.461   3.886  26.418
  156    H2'    C  15          H2''        C  15 -22.739   3.229  28.554
  157   HO2'    C  15          H2'         C  15 -20.888   1.515  27.398
  158    H1'    C  15           H1'        C  15 -19.856   3.203  27.669
  159    H41    C  15           H41        C  15 -19.222   2.966  34.023
  160    H42    C  15           H42        C  15 -20.243   4.374  34.210
  161    H5     C  15           H5         C  15 -21.330   5.472  32.361
  162    H6     C  15           H6         C  15 -21.673   5.457  29.933
  163    H5'    G  16           H5'        G  16 -22.445   5.089  21.596
  164   H5''    G  16          H5''        G  16 -21.054   4.722  22.636
  165    H4'    G  16           H4'        G  16 -22.817   7.187  22.659
  166    H3'    G  16           H3'        G  16 -19.878   6.675  22.134
  167    H2'    G  16          H2''        G  16 -19.310   8.706  23.163
  168   HO2'    G  16          H2'         G  16 -21.530   9.894  23.871
  169    H1'    G  16           H1'        G  16 -21.045   8.561  25.267
  170    H8     G  16           H8         G  16 -19.211   8.158  27.038
  171    H1     G  16           H1         G  16 -16.801   3.173  23.798
  172    H21    G  16           H21        G  16 -17.898   2.905  21.887
  173    H22    G  16           H22        G  16 -19.219   3.947  21.408
  174    H5'    G  17           H5'        G  17 -17.948  10.371  19.295
  175   H5''    G  17          H5''        G  17 -17.389   8.969  20.228
  176    H4'    G  17           H4'        G  17 -17.751  11.819  21.195
  177    H3'    G  17           H3'        G  17 -15.380  10.001  20.821
  178    H2'    G  17          H2''        G  17 -14.350  10.926  22.727
  179   HO2'    G  17          H2'         G  17 -14.605  13.091  22.511
  180    H1'    G  17           H1'        G  17 -16.595  11.107  24.302
  181    H8     G  17           H8         G  17 -16.038   8.046  21.967
  182    H1     G  17           H1         G  17 -14.226   7.226  28.066
  183    H21    G  17           H21        G  17 -14.476   9.119  29.197
  184    H22    G  17           H22        G  17 -15.089  10.582  28.454
  185    H5'    C  18           H5'        C  18 -12.731  13.305  19.912
  186   H5''    C  18          H5''        C  18 -11.446  12.366  19.123
  187    H4'    C  18           H4'        C  18 -11.435  12.981  21.774
  188    H3'    C  18           H3'        C  18 -10.307  10.534  20.388
  189    H2'    C  18          H2''        C  18  -9.753   9.619  22.483
  190   HO2'    C  18          H2'         C  18 -10.020  12.299  23.411
  191    H1'    C  18           H1'        C  18 -11.970  10.517  23.878
  192    H41    C  18           H41        C  18 -13.203   4.429  22.431
  193    H42    C  18           H42        C  18 -13.966   4.954  20.945
  194    H5     C  18           H5         C  18 -13.934   7.240  20.181
  195    H6     C  18           H6         C  18 -13.165   9.515  20.675
  196    H5'    A  19           H5'        A  19  -6.615  12.686  21.976
  197   H5''    A  19          H5''        A  19  -5.381  12.750  20.702
  198    H4'    A  19           H4'        A  19  -4.509  11.659  22.728
  199    H3'    A  19           H3'        A  19  -4.841   9.957  20.249
  200    H2'    A  19          H2''        A  19  -4.091   8.058  21.414
  201   HO2'    A  19          H2'         A  19  -2.877   8.170  23.260
  202    H1'    A  19           H1'        A  19  -5.353   8.542  23.805
  203    H8     A  19           H8         A  19  -7.819   9.559  21.161
  204    H61    A  19           H61        A  19  -9.280   3.567  20.620
  205    H62    A  19           H62        A  19  -9.726   5.203  20.190
  206    H2     A  19           H2         A  19  -5.579   3.878  23.133
  207    H5'    U  20           H5'        U  20  -1.498   9.827  17.581
  208   H5''    U  20          H5''        U  20  -2.943   9.170  16.786
  209    H4'    U  20           H4'        U  20  -1.545   8.157  19.277
  210    H3'    U  20           H3'        U  20  -2.113   7.007  16.535
  211    H2'    U  20          H2''        U  20  -2.397   4.872  17.470
  212   HO2'    U  20          H2'         U  20  -0.565   5.768  19.213
  213    H1'    U  20           H1'        U  20  -3.710   5.640  19.779
  214    H3     U  20           H3         U  20  -6.273   3.310  16.572
  215    H5     U  20           H5         U  20  -7.297   7.398  16.432
  216    H6     U  20           H6         U  20  -5.358   7.863  17.816
  217    H5'    A  21           H5'        A  21   1.574   3.474  16.291
  218   H5''    A  21          H5''        A  21   0.023   2.680  15.956
  219    H4'    A  21           H4'        A  21   1.445   2.881  18.631
  220    H3'    A  21           H3'        A  21   0.875   0.603  16.721
  221    H2'    A  21          H2''        A  21   0.513  -0.845  18.535
  222   HO2'    A  21          H2'         A  21   2.385   0.690  19.689
  223    H1'    A  21           H1'        A  21  -0.756   0.952  20.212
  224    H8     A  21           H8         A  21  -2.783   1.908  17.502
  225    H61    A  21           H61        A  21  -5.339  -3.723  17.201
  226    H62    A  21           H62        A  21  -5.481  -2.049  16.719
  227    H2     A  21           H2         A  21  -1.591  -4.023  19.648
  228    H5'    U  22           H5'        U  22   3.622  -1.291  14.234
  229   H5''    U  22          H5''        U  22   2.121  -0.384  13.955
  230    H4'    U  22           H4'        U  22   2.422  -3.308  14.685
  231    H3'    U  22           H3'        U  22   1.367  -1.848  12.281
  232    H2'    U  22          H2''        U  22  -0.300  -3.503  12.029
  233   HO2'    U  22          H2'         U  22   1.497  -5.067  13.557
  234    H1'    U  22           H1'        U  22  -0.807  -3.976  14.703
  235    H3     U  22           H3         U  22  -4.348  -2.078  12.293
  236    H5     U  22           H5         U  22  -2.412   1.000  14.426
  237    H6     U  22           H6         U  22  -0.609  -0.554  14.902
  238    H5'    C  23           H5'        C  23   4.219  -5.433  11.082
  239   H5''    C  23          H5''        C  23   5.011  -5.209   9.508
  240    H4'    C  23           H4'        C  23   3.370  -7.141   9.643
  241    H3'    C  23           H3'        C  23   3.113  -4.942   7.582
  242    H2'    C  23          H2''        C  23   1.145  -5.922   6.734
  243   HO2'    C  23          H2'         C  23   1.194  -8.036   6.616
  244    H1'    C  23           H1'        C  23  -0.013  -6.565   9.121
  245    H41    C  23           H41        C  23  -1.863  -0.606   7.464
  246    H42    C  23           H42        C  23  -0.947  -0.043   8.845
  247    H5     C  23           H5         C  23   0.489  -1.474  10.148
  248    H6     C  23           H6         C  23   1.358  -3.751  10.409
  249    H5'    A  24           H5'        A  24   3.972  -8.656   4.018
  250   H5''    A  24          H5''        A  24   4.904  -7.332   3.288
  251    H4'    A  24           H4'        A  24   2.957  -8.456   1.930
  252    H3'    A  24           H3'        A  24   3.477  -5.482   2.152
  253    H2'    A  24          H2''        A  24   1.578  -5.044   0.840
  254   HO2'    A  24          H2'         A  24   1.255  -7.793   0.202
  255    H1'    A  24           H1'        A  24  -0.050  -7.039   1.847
  256    H8     A  24           H8         A  24   1.903  -5.282   4.624
  257    H61    A  24           H61        A  24  -2.761  -1.212   4.764
  258    H62    A  24           H62        A  24  -1.293  -1.749   5.550
  259    H2     A  24           H2         A  24  -3.355  -3.890   1.216
  260    H5'    G  25           H5'        G  25   3.639  -6.293  -1.844
  261   H5''    G  25          H5''        G  25   4.819  -5.488  -2.898
  262    H4'    G  25           H4'        G  25   2.510  -4.805  -3.431
  263    H3'    G  25           H3'        G  25   4.369  -2.701  -2.301
  264    H2'    G  25          H2''        G  25   2.645  -1.108  -2.401
  265   HO2'    G  25          H2'         G  25   1.687  -1.235  -4.319
  266    H1'    G  25           H1'        G  25   0.549  -2.762  -1.686
  267    H8     G  25           H8         G  25   3.758  -3.273   0.374
  268    H1     G  25           H1         G  25  -0.186   1.260   2.624
  269    H21    G  25           H21        G  25  -1.828   1.628   1.175
  270    H22    G  25           H22        G  25  -1.954   0.763  -0.340
  271    H5'    C  26           H5'        C  26   3.484  -1.068  -6.078
  272   H5''    C  26          H5''        C  26   4.797  -0.107  -6.788
  273    H4'    C  26           H4'        C  26   2.796   1.217  -5.973
  274    H3'    C  26           H3'        C  26   5.586   1.774  -4.944
  275    H2'    C  26          H2''        C  26   4.745   3.474  -3.554
  276   HO2'    C  26          H2'         C  26   2.511   4.201  -3.838
  277    H1'    C  26           H1'        C  26   2.399   2.228  -2.807
  278    H41    C  26           H41        C  26   6.641   1.176   1.870
  279    H42    C  26           H42        C  26   7.088  -0.328   1.097
  280    H5     C  26           H5         C  26   6.252  -1.004  -1.059
  281    H6     C  26           H6         C  26   4.808  -0.383  -2.941
  282    H5'    C  27           H5'        C  27   4.711   5.141  -8.139
  283   H5''    C  27          H5''        C  27   6.249   5.689  -8.837
  284    H4'    C  27           H4'        C  27   5.005   7.399  -7.429
  285    H3'    C  27           H3'        C  27   7.859   6.599  -6.818
  286    H2'    C  27          H2''        C  27   7.886   8.051  -4.969
  287   HO2'    C  27          H2'         C  27   6.057   9.417  -6.491
  288    H1'    C  27           H1'        C  27   5.304   7.609  -4.098
  289    H41    C  27           H41        C  27   9.061   3.822  -0.567
  290    H42    C  27           H42        C  27   8.895   2.557  -1.764
  291    H5     C  27           H5         C  27   7.765   2.873  -3.869
  292    H6     C  27           H6         C  27   6.553   4.469  -5.281
  293    H5'    C  28           H5'        C  28   8.298  10.707  -8.026
  294   H5''    C  28          H5''        C  28   9.698  11.044  -9.065
  295    H4'    C  28           H4'        C  28   9.868  12.128  -6.833
  296    H3'    C  28           H3'        C  28  11.894  10.007  -7.568
  297   HO3'    C  28          H3T         C  28  11.694  12.216  -8.543
  298    H2'    C  28          H2''        C  28  12.970  10.304  -5.507
  299   HO2'    C  28          H2'         C  28  12.981  12.173  -4.468
  300    H1'    C  28           H1'        C  28  10.700  10.637  -3.972
  301    H41    C  28           H41        C  28  12.403   4.494  -3.421
  302    H42    C  28           H42        C  28  11.358   4.103  -4.768
  303    H5     C  28           H5         C  28  10.222   5.770  -6.086
  304    H6     C  28           H6         C  28   9.843   8.173  -6.395
  Start of MODEL    7
    1    H5'    G   1           H5'        G   1  15.392   3.070   7.336
    2   H5''    G   1          H5''        G   1  16.570   3.967   8.313
    3    H4'    G   1           H4'        G   1  14.867   5.554   9.023
    4    H3'    G   1           H3'        G   1  12.964   3.721   7.546
    5    H2'    G   1          H2''        G   1  11.743   5.579   6.786
    6   HO2'    G   1          H2'         G   1  11.393   7.033   8.288
    7    H1'    G   1           H1'        G   1  13.868   7.286   6.349
    8    H8     G   1           H8         G   1  14.229   3.577   5.272
    9    H1     G   1           H1         G   1  12.145   7.580   0.711
   10    H21    G   1           H21        G   1  11.792   9.596   1.572
   11    H22    G   1           H22        G   1  12.068   9.957   3.262
   12   HO5'    G   1          H5T         G   1  14.838   2.040   9.049
   13    H5'    G   2           H5'        G   2  10.885   6.716  10.210
   14   H5''    G   2          H5''        G   2   9.322   6.054  10.732
   15    H4'    G   2           H4'        G   2   9.320   8.329   9.508
   16    H3'    G   2           H3'        G   2   7.547   5.996   8.748
   17    H2'    G   2          H2''        G   2   6.644   7.242   6.973
   18   HO2'    G   2          H2'         G   2   7.395   9.623   6.924
   19    H1'    G   2           H1'        G   2   8.958   8.528   6.190
   20    H8     G   2           H8         G   2   9.539   4.840   7.057
   21    H1     G   2           H1         G   2   7.625   5.883   1.023
   22    H21    G   2           H21        G   2   7.024   8.004   0.771
   23    H22    G   2           H22        G   2   7.092   9.162   2.081
   24    H5'    G   3           H5'        G   3   4.557   9.043  10.461
   25   H5''    G   3          H5''        G   3   3.256   8.140  11.264
   26    H4'    G   3           H4'        G   3   2.546   9.559   9.281
   27    H3'    G   3           H3'        G   3   1.986   6.587   9.401
   28    H2'    G   3          H2''        G   3   0.972   6.673   7.283
   29   HO2'    G   3          H2'         G   3   1.065   9.427   6.929
   30    H1'    G   3           H1'        G   3   2.690   8.480   6.104
   31    H8     G   3           H8         G   3   4.461   5.889   8.320
   32    H1     G   3           H1         G   3   3.532   4.034   2.249
   33    H21    G   3           H21        G   3   2.238   5.499   1.196
   34    H22    G   3           H22        G   3   1.604   6.928   1.982
   35    H5'    C   4           H5'        C   4  -2.094   8.563   8.315
   36   H5''    C   4          H5''        C   4  -3.158   7.679   9.429
   37    H4'    C   4           H4'        C   4  -3.765   7.713   6.905
   38    H3'    C   4           H3'        C   4  -3.693   5.226   8.629
   39    H2'    C   4          H2''        C   4  -4.255   3.901   6.771
   40   HO2'    C   4          H2'         C   4  -5.680   6.021   6.083
   41    H1'    C   4           H1'        C   4  -2.764   5.244   4.875
   42    H41    C   4           H41        C   4   0.796   0.259   6.710
   43    H42    C   4           H42        C   4   1.502   1.244   7.972
   44    H5     C   4           H5         C   4   0.755   3.477   8.478
   45    H6     C   4           H6         C   4  -0.832   5.249   7.884
   46    H5'    A   5           H5'        A   5  -8.509   6.752   6.290
   47   H5''    A   5          H5''        A   5  -9.206   5.495   7.333
   48    H4'    A   5           H4'        A   5  -9.966   5.629   4.844
   49    H3'    A   5           H3'        A   5  -9.150   3.096   6.286
   50    H2'    A   5          H2''        A   5  -9.461   1.853   4.315
   51   HO2'    A   5          H2'         A   5 -10.444   3.640   2.566
   52    H1'    A   5           H1'        A   5  -8.486   3.714   2.525
   53    H8     A   5           H8         A   5  -6.292   3.616   5.636
   54    H61    A   5           H61        A   5  -3.252  -1.018   2.877
   55    H62    A   5           H62        A   5  -3.263   0.098   4.225
   56    H2     A   5           H2         A   5  -6.928  -0.132   0.465
   57    H5'    G   6           H5'        G   6 -12.806   0.656   4.699
   58   H5''    G   6          H5''        G   6 -13.177   0.253   6.388
   59    H4'    G   6           H4'        G   6 -12.463  -1.660   4.773
   60    H3'    G   6           H3'        G   6 -11.341  -1.215   7.549
   61    H2'    G   6          H2''        G   6  -9.878  -3.033   7.270
   62   HO2'    G   6          H2'         G   6 -11.691  -3.776   5.213
   63    H1'    G   6           H1'        G   6  -9.242  -2.615   4.621
   64    H8     G   6           H8         G   6  -9.362   0.721   6.439
   65    H1     G   6           H1         G   6  -3.838  -2.451   7.198
   66    H21    G   6           H21        G   6  -4.034  -4.519   6.413
   67    H22    G   6           H22        G   6  -5.517  -5.118   5.705
   68    H5'    U   7           H5'        U   7 -12.659  -5.174   8.120
   69   H5''    U   7          H5''        U   7 -13.363  -5.356   9.740
   70    H4'    U   7           H4'        U   7 -11.180  -6.610   9.297
   71    H3'    U   7           H3'        U   7 -11.533  -4.711  11.628
   72    H2'    U   7          H2''        U   7  -9.313  -5.095  12.299
   73   HO2'    U   7          H2'         U   7  -8.648  -7.064  10.476
   74    H1'    U   7           H1'        U   7  -8.171  -5.223   9.788
   75    H3     U   7           H3         U   7  -6.677  -1.437  11.942
   76    H5     U   7           H5         U   7 -10.288  -0.344  10.061
   77    H6     U   7           H6         U   7 -10.659  -2.689   9.557
   78    H5'    G   8           H5'        G   8 -10.714  -8.422  13.439
   79   H5''    G   8          H5''        G   8 -11.621  -8.828  14.908
   80    H4'    G   8           H4'        G   8  -9.047  -8.483  15.076
   81    H3'    G   8           H3'        G   8 -10.924  -8.258  17.046
   82    H2'    G   8          H2''        G   8 -11.412  -5.967  16.826
   83   HO2'    G   8          H2'         G   8 -10.038  -6.520  18.876
   84    H1'    G   8           H1'        G   8  -8.561  -5.182  16.334
   85    H8     G   8           H8         G   8 -12.169  -5.023  14.839
   86    H1     G   8           H1         G   8  -8.647   0.306  14.242
   87    H21    G   8           H21        G   8  -6.609  -0.035  15.053
   88    H22    G   8           H22        G   8  -6.115  -1.565  15.738
   89    H5'    A   9           H5'        A   9  -7.177  -6.365  18.501
   90   H5''    A   9          H5''        A   9  -6.343  -7.660  19.382
   91    H4'    A   9           H4'        A   9  -5.843  -6.291  21.149
   92    H3'    A   9           H3'        A   9  -8.615  -5.134  20.778
   93    H2'    A   9          H2''        A   9  -7.939  -3.139  21.813
   94   HO2'    A   9          H2'         A   9  -6.910  -4.028  23.622
   95    H1'    A   9           H1'        A   9  -5.376  -3.010  20.789
   96    H8     A   9           H8         A   9  -8.640  -3.877  18.804
   97    H61    A   9           H61        A   9  -8.034   1.821  16.463
   98    H62    A   9           H62        A   9  -8.979   0.351  16.448
   99    H2     A   9           H2         A   9  -4.708   1.161  19.400
  100    H5'    U  10           H5'        U  10  -6.825  -5.485  25.615
  101   H5''    U  10          H5''        U  10  -8.189  -4.712  26.450
  102    H4'    U  10           H4'        U  10  -5.682  -3.788  26.688
  103    H3'    U  10           H3'        U  10  -8.244  -2.181  26.539
  104    H2'    U  10          H2''        U  10  -7.005  -0.185  26.552
  105   HO2'    U  10          H2'         U  10  -4.567  -0.496  26.951
  106    H1'    U  10           H1'        U  10  -4.876  -1.040  25.000
  107    H3     U  10           H3         U  10  -6.783   1.815  22.045
  108    H5     U  10           H5         U  10  -9.684  -1.212  22.493
  109    H6     U  10           H6         U  10  -8.281  -2.212  24.203
  110    H5'    G  11           H5'        G  11  -6.271  -1.069  30.272
  111   H5''    G  11          H5''        G  11  -7.366  -0.393  31.495
  112    H4'    G  11           H4'        G  11  -5.616   1.178  30.388
  113    H3'    G  11           H3'        G  11  -8.546   1.827  30.746
  114    H2'    G  11          H2''        G  11  -8.247   3.870  29.621
  115   HO2'    G  11          H2'         G  11  -6.524   4.921  30.271
  116    H1'    G  11           H1'        G  11  -6.401   3.030  27.746
  117    H8     G  11           H8         G  11  -9.059   0.368  27.930
  118    H1     G  11           H1         G  11 -10.760   5.443  24.392
  119    H21    G  11           H21        G  11  -9.334   7.112  24.721
  120    H22    G  11           H22        G  11  -7.968   6.980  25.806
  121    H5'    C  12           H5'        C  12  -9.195   3.718  35.590
  122   H5''    C  12          H5''        C  12 -10.060   3.195  34.130
  123    H4'    C  12           H4'        C  12  -9.288   5.983  35.002
  124    H3'    C  12           H3'        C  12 -11.846   4.631  34.105
  125    H2'    C  12          H2''        C  12 -12.579   6.619  33.092
  126   HO2'    C  12          H2'         C  12 -10.491   8.255  33.912
  127    H1'    C  12           H1'        C  12 -10.176   7.432  32.041
  128    H41    C  12           H41        C  12 -13.354   4.084  27.556
  129    H42    C  12           H42        C  12 -12.187   2.803  27.797
  130    H5     C  12           H5         C  12 -10.541   2.831  29.556
  131    H6     C  12           H6         C  12  -9.658   4.093  31.464
  132    H5'    U  13           H5'        U  13 -13.939   7.831  35.620
  133   H5''    U  13          H5''        U  13 -15.508   7.118  36.047
  134    H4'    U  13           H4'        U  13 -15.295   8.547  33.861
  135    H3'    U  13           H3'        U  13 -16.714   5.885  34.106
  136    H2'    U  13          H2''        U  13 -17.193   5.912  31.805
  137   HO2'    U  13          H2'         U  13 -16.496   8.116  30.733
  138    H1'    U  13           H1'        U  13 -14.830   7.052  30.926
  139    H3     U  13           H3         U  13 -14.835   2.760  29.332
  140    H5     U  13           H5         U  13 -13.583   2.437  33.345
  141    H6     U  13           H6         U  13 -14.132   4.784  33.636
  142    H5'    U  14           H5'        U  14 -20.634   9.227  34.634
  143   H5''    U  14          H5''        U  14 -21.853   7.979  34.937
  144    H4'    U  14           H4'        U  14 -22.802   8.936  33.063
  145    H3'    U  14           H3'        U  14 -21.640   6.581  32.395
  146    H2'    U  14          H2''        U  14 -19.520   7.456  31.762
  147   HO2'    U  14          H2'         U  14 -19.967   8.004  29.282
  148    H1'    U  14           H1'        U  14 -20.796   9.728  30.268
  149    H3     U  14           H3         U  14 -16.314  10.411  29.455
  150    H5     U  14           H5         U  14 -16.916  11.403  33.508
  151    H6     U  14           H6         U  14 -19.155  10.481  33.332
  152    H5'    C  15           H5'        C  15 -21.558   6.903  28.734
  153   H5''    C  15          H5''        C  15 -22.920   6.200  27.842
  154    H4'    C  15           H4'        C  15 -20.923   5.378  26.833
  155    H3'    C  15           H3'        C  15 -22.758   3.566  27.761
  156    H2'    C  15          H2''        C  15 -21.670   3.002  29.766
  157   HO2'    C  15          H2'         C  15 -19.979   1.237  28.881
  158    H1'    C  15           H1'        C  15 -18.970   3.086  28.426
  159    H41    C  15           H41        C  15 -17.239   3.123  34.573
  160    H42    C  15           H42        C  15 -18.336   4.443  34.912
  161    H5     C  15           H5         C  15 -19.817   5.386  33.262
  162    H6     C  15           H6         C  15 -20.566   5.267  30.931
  163    H5'    G  16           H5'        G  16 -22.450   5.240  23.002
  164   H5''    G  16          H5''        G  16 -20.886   4.780  23.707
  165    H4'    G  16           H4'        G  16 -22.569   7.230  24.298
  166    H3'    G  16           H3'        G  16 -19.786   6.770  23.191
  167    H2'    G  16          H2''        G  16 -18.997   8.687  24.284
  168   HO2'    G  16          H2'         G  16 -20.460  10.208  25.231
  169    H1'    G  16           H1'        G  16 -20.329   8.350  26.647
  170    H8     G  16           H8         G  16 -18.300   7.700  28.083
  171    H1     G  16           H1         G  16 -16.338   3.302  23.844
  172    H21    G  16           H21        G  16 -17.703   3.272  22.092
  173    H22    G  16           H22        G  16 -19.091   4.329  21.966
  174    H5'    G  17           H5'        G  17 -18.210  10.323  20.167
  175   H5''    G  17          H5''        G  17 -17.608   8.902  21.043
  176    H4'    G  17           H4'        G  17 -17.595  11.790  21.962
  177    H3'    G  17           H3'        G  17 -15.452   9.791  21.259
  178    H2'    G  17          H2''        G  17 -14.058  10.686  22.930
  179   HO2'    G  17          H2'         G  17 -14.866  12.710  24.034
  180    H1'    G  17           H1'        G  17 -15.999  11.110  24.839
  181    H8     G  17           H8         G  17 -15.903   7.921  22.598
  182    H1     G  17           H1         G  17 -13.408   7.262  28.472
  183    H21    G  17           H21        G  17 -13.450   9.207  29.540
  184    H22    G  17           H22        G  17 -14.091  10.665  28.811
  185    H5'    C  18           H5'        C  18 -12.834  12.970  19.842
  186   H5''    C  18          H5''        C  18 -11.707  11.981  18.890
  187    H4'    C  18           H4'        C  18 -11.237  12.672  21.466
  188    H3'    C  18           H3'        C  18 -10.461  10.117  20.033
  189    H2'    C  18          H2''        C  18  -9.602   9.262  22.048
  190   HO2'    C  18          H2'         C  18  -8.403  11.117  22.650
  191    H1'    C  18           H1'        C  18 -11.510  10.329  23.748
  192    H41    C  18           H41        C  18 -13.211   4.249  22.837
  193    H42    C  18           H42        C  18 -14.193   4.746  21.474
  194    H5     C  18           H5         C  18 -14.202   6.993  20.602
  195    H6     C  18           H6         C  18 -13.272   9.248  20.847
  196    H5'    A  19           H5'        A  19  -6.610  12.247  21.208
  197   H5''    A  19          H5''        A  19  -5.403  12.108  19.914
  198    H4'    A  19           H4'        A  19  -4.573  11.312  22.133
  199    H3'    A  19           H3'        A  19  -4.731   9.387  19.802
  200    H2'    A  19          H2''        A  19  -3.956   7.632  21.160
  201   HO2'    A  19          H2'         A  19  -2.279   9.086  22.117
  202    H1'    A  19           H1'        A  19  -5.316   8.285  23.461
  203    H8     A  19           H8         A  19  -7.751   8.904  20.674
  204    H61    A  19           H61        A  19  -8.900   2.821  20.712
  205    H62    A  19           H62        A  19  -9.416   4.381  20.112
  206    H2     A  19           H2         A  19  -5.275   3.570  23.245
  207    H5'    U  20           H5'        U  20  -1.623   9.274  17.008
  208   H5''    U  20          H5''        U  20  -3.141   8.623  16.357
  209    H4'    U  20           H4'        U  20  -1.566   7.643  18.757
  210    H3'    U  20           H3'        U  20  -2.290   6.464  16.065
  211    H2'    U  20          H2''        U  20  -2.516   4.337  17.036
  212   HO2'    U  20          H2'         U  20  -1.862   4.417  19.521
  213    H1'    U  20           H1'        U  20  -3.712   5.123  19.397
  214    H3     U  20           H3         U  20  -6.432   2.793  16.319
  215    H5     U  20           H5         U  20  -7.447   6.884  16.214
  216    H6     U  20           H6         U  20  -5.447   7.346  17.510
  217    H5'    A  21           H5'        A  21   1.528   2.963  15.817
  218   H5''    A  21          H5''        A  21  -0.006   2.125  15.510
  219    H4'    A  21           H4'        A  21   1.500   2.353  18.132
  220    H3'    A  21           H3'        A  21   0.778   0.057  16.294
  221    H2'    A  21          H2''        A  21   0.477  -1.348  18.152
  222   HO2'    A  21          H2'         A  21   2.429   0.194  19.188
  223    H1'    A  21           H1'        A  21  -0.654   0.511  19.861
  224    H8     A  21           H8         A  21  -2.764   1.436  17.166
  225    H61    A  21           H61        A  21  -5.541  -4.096  17.286
  226    H62    A  21           H62        A  21  -5.636  -2.448  16.711
  227    H2     A  21           H2         A  21  -1.719  -4.404  19.615
  228    H5'    U  22           H5'        U  22   3.203  -2.074  13.967
  229   H5''    U  22          H5''        U  22   1.695  -1.166  13.739
  230    H4'    U  22           H4'        U  22   2.031  -4.091  14.438
  231    H3'    U  22           H3'        U  22   0.830  -2.614  12.116
  232    H2'    U  22          H2''        U  22  -0.845  -4.272  11.950
  233   HO2'    U  22          H2'         U  22   1.136  -5.838  13.105
  234    H1'    U  22           H1'        U  22  -1.193  -4.767  14.643
  235    H3     U  22           H3         U  22  -4.887  -2.872  12.500
  236    H5     U  22           H5         U  22  -2.785   0.228  14.436
  237    H6     U  22           H6         U  22  -0.959  -1.328  14.802
  238    H5'    C  23           H5'        C  23   3.369  -6.225  10.762
  239   H5''    C  23          H5''        C  23   4.176  -6.077   9.188
  240    H4'    C  23           H4'        C  23   2.392  -7.845   9.269
  241    H3'    C  23           H3'        C  23   2.209  -5.544   7.314
  242    H2'    C  23          H2''        C  23   0.146  -6.347   6.512
  243   HO2'    C  23          H2'         C  23   1.176  -8.693   6.940
  244    H1'    C  23           H1'        C  23  -0.950  -7.055   8.913
  245    H41    C  23           H41        C  23  -2.614  -0.966   7.608
  246    H42    C  23           H42        C  23  -1.560  -0.488   8.920
  247    H5     C  23           H5         C  23  -0.094  -2.022  10.062
  248    H6     C  23           H6         C  23   0.678  -4.346  10.193
  249    H5'    A  24           H5'        A  24   2.407  -9.346   3.652
  250   H5''    A  24          H5''        A  24   3.515  -8.156   2.939
  251    H4'    A  24           H4'        A  24   1.485  -8.943   1.532
  252    H3'    A  24           H3'        A  24   2.257  -6.046   1.951
  253    H2'    A  24          H2''        A  24   0.410  -5.356   0.674
  254   HO2'    A  24          H2'         A  24   0.957  -7.278  -0.864
  255    H1'    A  24           H1'        A  24  -1.392  -7.267   1.541
  256    H8     A  24           H8         A  24   0.783  -5.782   4.344
  257    H61    A  24           H61        A  24  -3.699  -1.556   4.962
  258    H62    A  24           H62        A  24  -2.212  -2.188   5.633
  259    H2     A  24           H2         A  24  -4.597  -4.017   1.322
  260    H5'    G  25           H5'        G  25   2.229  -5.830  -2.187
  261   H5''    G  25          H5''        G  25   3.538  -4.748  -2.704
  262    H4'    G  25           H4'        G  25   1.152  -3.883  -3.013
  263    H3'    G  25           H3'        G  25   3.276  -2.332  -1.517
  264    H2'    G  25          H2''        G  25   1.729  -0.621  -1.061
  265   HO2'    G  25          H2'         G  25  -0.449  -0.829  -2.175
  266    H1'    G  25           H1'        G  25  -0.475  -2.208  -0.592
  267    H8     G  25           H8         G  25   2.634  -3.768   0.963
  268    H1     G  25           H1         G  25  -0.104   0.765   4.585
  269    H21    G  25           H21        G  25  -1.668   1.827   3.421
  270    H22    G  25           H22        G  25  -2.037   1.424   1.759
  271    H5'    C  26           H5'        C  26   2.239  -0.404  -5.430
  272   H5''    C  26          H5''        C  26   3.537   0.409  -6.330
  273    H4'    C  26           H4'        C  26   1.638   1.926  -5.823
  274    H3'    C  26           H3'        C  26   4.343   2.519  -4.601
  275    H2'    C  26          H2''        C  26   3.458   4.400  -3.502
  276   HO2'    C  26          H2'         C  26   1.908   4.525  -5.678
  277    H1'    C  26           H1'        C  26   1.011   3.333  -2.823
  278    H41    C  26           H41        C  26   4.794   2.620   2.288
  279    H42    C  26           H42        C  26   5.226   1.023   1.719
  280    H5     C  26           H5         C  26   4.539   0.154  -0.421
  281    H6     C  26           H6         C  26   3.291   0.628  -2.477
  282    H5'    C  27           H5'        C  27   4.095   6.071  -7.130
  283   H5''    C  27          H5''        C  27   5.749   6.541  -7.574
  284    H4'    C  27           H4'        C  27   4.517   7.993  -5.836
  285    H3'    C  27           H3'        C  27   7.299   6.872  -5.431
  286    H2'    C  27          H2''        C  27   7.391   7.827  -3.286
  287   HO2'    C  27          H2'         C  27   5.414   9.534  -4.344
  288    H1'    C  27           H1'        C  27   4.766   7.388  -2.554
  289    H41    C  27           H41        C  27   8.197   2.637   0.011
  290    H42    C  27           H42        C  27   7.853   1.660  -1.399
  291    H5     C  27           H5         C  27   6.721   2.509  -3.350
  292    H6     C  27           H6         C  27   5.673   4.477  -4.368
  293    H5'    C  28           H5'        C  28   7.210  11.138  -5.640
  294   H5''    C  28          H5''        C  28   8.372  12.106  -6.571
  295    H4'    C  28           H4'        C  28   8.332  12.871  -4.259
  296    H3'    C  28           H3'        C  28  10.827  11.382  -5.099
  297   HO3'    C  28          H3T         C  28  10.719  14.057  -4.270
  298    H2'    C  28          H2''        C  28  11.738  11.662  -2.958
  299   HO2'    C  28          H2'         C  28   9.614  13.467  -2.328
  300    H1'    C  28           H1'        C  28   9.424  11.231  -1.531
  301    H41    C  28           H41        C  28  12.521   5.634  -1.755
  302    H42    C  28           H42        C  28  11.586   5.201  -3.169
  303    H5     C  28           H5         C  28  10.089   6.728  -4.281
  304    H6     C  28           H6         C  28   9.167   8.999  -4.277
  Start of MODEL    8
    1    H5'    G   1           H5'        G   1  12.291   4.614   9.993
    2   H5''    G   1          H5''        G   1  13.435   5.344  11.134
    3    H4'    G   1           H4'        G   1  12.077   7.369  11.280
    4    H3'    G   1           H3'        G   1  10.152   5.836   9.517
    5    H2'    G   1          H2''        G   1   9.660   7.800   8.325
    6   HO2'    G   1          H2'         G   1   9.785   9.770   9.200
    7    H1'    G   1           H1'        G   1  12.193   8.888   8.307
    8    H8     G   1           H8         G   1  11.599   5.092   7.654
    9    H1     G   1           H1         G   1  12.268   8.750   2.426
   10    H21    G   1           H21        G   1  12.436  10.887   3.009
   11    H22    G   1           H22        G   1  12.386  11.411   4.677
   12   HO5'    G   1          H5T         G   1  10.938   5.419  12.133
   13    H5'    G   2           H5'        G   2   7.526   9.504  11.396
   14   H5''    G   2          H5''        G   2   5.991   8.611  11.436
   15    H4'    G   2           H4'        G   2   6.116  10.882  10.143
   16    H3'    G   2           H3'        G   2   4.843   8.336   9.113
   17    H2'    G   2          H2''        G   2   4.336   9.394   7.076
   18   HO2'    G   2          H2'         G   2   4.845  11.835   8.477
   19    H1'    G   2           H1'        G   2   6.647  10.881   6.830
   20    H8     G   2           H8         G   2   7.381   7.359   8.116
   21    H1     G   2           H1         G   2   6.866   7.776   1.734
   22    H21    G   2           H21        G   2   6.110   9.783   1.161
   23    H22    G   2           H22        G   2   5.733  11.018   2.343
   24    H5'    G   3           H5'        G   3   0.701  11.646   8.788
   25   H5''    G   3          H5''        G   3  -0.107  10.240   9.511
   26    H4'    G   3           H4'        G   3  -1.047  11.249   7.290
   27    H3'    G   3           H3'        G   3  -0.609   8.307   7.843
   28    H2'    G   3          H2''        G   3  -1.314   7.770   5.666
   29   HO2'    G   3          H2'         G   3  -2.781  10.058   5.978
   30    H1'    G   3           H1'        G   3  -0.128   9.873   4.344
   31    H8     G   3           H8         G   3   1.954   8.275   7.176
   32    H1     G   3           H1         G   3   2.822   5.679   1.373
   33    H21    G   3           H21        G   3   1.368   6.535  -0.069
   34    H22    G   3           H22        G   3   0.187   7.741   0.393
   35    H5'    C   4           H5'        C   4  -4.554   8.785   6.474
   36   H5''    C   4          H5''        C   4  -5.775   7.751   7.242
   37    H4'    C   4           H4'        C   4  -5.480   7.513   4.706
   38    H3'    C   4           H3'        C   4  -5.364   5.162   6.608
   39    H2'    C   4          H2''        C   4  -4.954   3.712   4.806
   40   HO2'    C   4          H2'         C   4  -5.114   5.114   2.598
   41    H1'    C   4           H1'        C   4  -3.327   5.393   3.328
   42    H41    C   4           H41        C   4   0.567   1.464   6.536
   43    H42    C   4           H42        C   4   0.613   2.612   7.856
   44    H5     C   4           H5         C   4  -0.750   4.597   7.928
   45    H6     C   4           H6         C   4  -2.453   5.910   6.750
   46    H5'    A   5           H5'        A   5  -9.736   4.791   3.060
   47   H5''    A   5          H5''        A   5 -10.293   3.847   4.458
   48    H4'    A   5           H4'        A   5 -10.662   2.808   2.148
   49    H3'    A   5           H3'        A   5  -9.243   1.367   4.399
   50    H2'    A   5          H2''        A   5  -8.873  -0.490   3.008
   51   HO2'    A   5          H2'         A   5 -10.499   0.546   0.934
   52    H1'    A   5           H1'        A   5  -8.330   0.873   0.675
   53    H8     A   5           H8         A   5  -6.580   2.789   3.390
   54    H61    A   5           H61        A   5  -2.046  -1.413   3.053
   55    H62    A   5           H62        A   5  -2.527   0.139   3.702
   56    H2     A   5           H2         A   5  -5.534  -2.933   0.678
   57    H5'    G   6           H5'        G   6 -11.803  -2.207   3.191
   58   H5''    G   6          H5''        G   6 -12.395  -2.543   4.831
   59    H4'    G   6           H4'        G   6 -11.035  -4.384   3.622
   60    H3'    G   6           H3'        G   6 -10.490  -3.429   6.442
   61    H2'    G   6          H2''        G   6  -8.667  -4.904   6.606
   62   HO2'    G   6          H2'         G   6 -10.171  -6.378   4.889
   63    H1'    G   6           H1'        G   6  -7.702  -4.606   4.043
   64    H8     G   6           H8         G   6  -8.750  -1.186   5.251
   65    H1     G   6           H1         G   6  -3.078  -3.073   7.579
   66    H21    G   6           H21        G   6  -2.753  -5.225   7.139
   67    H22    G   6           H22        G   6  -3.926  -6.195   6.277
   68    H5'    U   7           H5'        U   7 -11.297  -7.473   7.013
   69   H5''    U   7          H5''        U   7 -12.304  -7.901   8.411
   70    H4'    U   7           H4'        U   7  -9.972  -8.778   8.568
   71    H3'    U   7           H3'        U   7 -10.955  -6.801  10.639
   72    H2'    U   7          H2''        U   7  -8.869  -6.879  11.718
   73   HO2'    U   7          H2'         U   7  -7.836  -8.960  10.139
   74    H1'    U   7           H1'        U   7  -7.280  -7.044   9.458
   75    H3     U   7           H3         U   7  -6.539  -3.016  11.562
   76    H5     U   7           H5         U   7  -9.833  -2.392   9.005
   77    H6     U   7           H6         U   7  -9.899  -4.787   8.614
   78    H5'    G   8           H5'        G   8  -9.713 -10.100  12.743
   79   H5''    G   8          H5''        G   8 -10.766 -10.736  14.021
   80    H4'    G   8           H4'        G   8  -8.365 -10.011  14.660
   81    H3'    G   8           H3'        G   8 -10.569 -10.135  16.263
   82    H2'    G   8          H2''        G   8 -11.347  -7.930  15.975
   83   HO2'    G   8          H2'         G   8 -11.073  -7.213  17.945
   84    H1'    G   8           H1'        G   8  -8.599  -6.732  16.023
   85    H8     G   8           H8         G   8 -11.868  -7.008  13.896
   86    H1     G   8           H1         G   8  -9.044  -1.248  13.970
   87    H21    G   8           H21        G   8  -7.164  -1.338  15.146
   88    H22    G   8           H22        G   8  -6.604  -2.807  15.912
   89    H5'    A   9           H5'        A   9  -8.615  -7.268  18.355
   90   H5''    A   9          H5''        A   9  -7.109  -8.206  18.348
   91    H4'    A   9           H4'        A   9  -6.745  -7.590  20.731
   92    H3'    A   9           H3'        A   9  -9.340  -6.079  20.347
   93    H2'    A   9          H2''        A   9  -8.493  -4.274  21.591
   94   HO2'    A   9          H2'         A   9  -7.533  -5.012  23.364
   95    H1'    A   9           H1'        A   9  -5.918  -4.314  20.638
   96    H8     A   9           H8         A   9  -8.646  -4.965  17.984
   97    H61    A   9           H61        A   9  -8.535   1.158  17.077
   98    H62    A   9           H62        A   9  -9.173  -0.370  16.515
   99    H2     A   9           H2         A   9  -5.925   0.225  20.603
  100    H5'    U  10           H5'        U  10  -8.639  -6.571  25.068
  101   H5''    U  10          H5''        U  10 -10.193  -6.033  25.741
  102    H4'    U  10           H4'        U  10  -7.939  -4.689  26.221
  103    H3'    U  10           H3'        U  10 -10.688  -3.538  25.684
  104    H2'    U  10          H2''        U  10  -9.804  -1.361  25.748
  105   HO2'    U  10          H2'         U  10  -7.291  -2.294  26.688
  106    H1'    U  10           H1'        U  10  -7.391  -1.886  24.500
  107    H3     U  10           H3         U  10  -9.368   0.491  21.188
  108    H5     U  10           H5         U  10 -11.738  -2.987  21.448
  109    H6     U  10           H6         U  10 -10.418  -3.663  23.370
  110    H5'    G  11           H5'        G  11  -9.047  -2.126  29.558
  111   H5''    G  11          H5''        G  11 -10.226  -1.382  30.657
  112    H4'    G  11           H4'        G  11  -8.346   0.105  29.630
  113    H3'    G  11           H3'        G  11 -11.266   0.845  29.770
  114    H2'    G  11          H2''        G  11 -10.809   2.850  28.625
  115   HO2'    G  11          H2'         G  11  -8.853   3.829  28.654
  116    H1'    G  11           H1'        G  11  -8.887   1.894  26.889
  117    H8     G  11           H8         G  11 -11.690  -0.638  27.048
  118    H1     G  11           H1         G  11 -12.944   4.337  23.196
  119    H21    G  11           H21        G  11 -11.434   5.935  23.501
  120    H22    G  11           H22        G  11 -10.122   5.780  24.648
  121    H5'    C  12           H5'        C  12  -9.267   4.743  33.470
  122   H5''    C  12          H5''        C  12 -11.021   4.505  33.611
  123    H4'    C  12           H4'        C  12  -9.645   6.863  32.749
  124    H3'    C  12           H3'        C  12 -12.564   6.056  32.838
  125    H2'    C  12          H2''        C  12 -13.137   7.865  31.442
  126   HO2'    C  12          H2'         C  12 -10.544   8.843  32.120
  127    H1'    C  12           H1'        C  12 -11.061   7.659  29.687
  128    H41    C  12           H41        C  12 -15.959   4.117  27.492
  129    H42    C  12           H42        C  12 -15.089   2.693  28.015
  130    H5     C  12           H5         C  12 -13.055   2.788  29.303
  131    H6     C  12           H6         C  12 -11.416   4.269  30.368
  132    H5'    U  13           H5'        U  13 -13.338   9.908  33.721
  133   H5''    U  13          H5''        U  13 -14.760   9.942  34.784
  134    H4'    U  13           H4'        U  13 -15.095  10.673  32.341
  135    H3'    U  13           H3'        U  13 -16.813   8.597  33.719
  136    H2'    U  13          H2''        U  13 -18.034   8.264  31.737
  137   HO2'    U  13          H2'         U  13 -18.453   9.893  30.452
  138    H1'    U  13           H1'        U  13 -15.945   8.480  29.948
  139    H3     U  13           H3         U  13 -17.273   4.096  29.840
  140    H5     U  13           H5         U  13 -14.796   4.409  33.238
  141    H6     U  13           H6         U  13 -14.777   6.815  32.921
  142    H5'    U  14           H5'        U  14 -19.708  12.876  34.140
  143   H5''    U  14          H5''        U  14 -20.990  12.092  35.075
  144    H4'    U  14           H4'        U  14 -22.271  12.848  33.309
  145    H3'    U  14           H3'        U  14 -21.862  10.187  33.052
  146    H2'    U  14          H2''        U  14 -19.888  10.316  31.723
  147   HO2'    U  14          H2'         U  14 -20.753   9.168  30.177
  148    H1'    U  14           H1'        U  14 -21.089  12.463  29.995
  149    H3     U  14           H3         U  14 -17.007  11.707  27.991
  150    H5     U  14           H5         U  14 -16.185  13.767  31.577
  151    H6     U  14           H6         U  14 -18.504  13.447  32.215
  152    H5'    C  15           H5'        C  15 -22.815   9.731  29.504
  153   H5''    C  15          H5''        C  15 -24.479   9.207  29.185
  154    H4'    C  15           H4'        C  15 -23.010   7.746  27.989
  155    H3'    C  15           H3'        C  15 -24.845   6.669  29.716
  156    H2'    C  15          H2''        C  15 -23.386   6.276  31.520
  157   HO2'    C  15          H2'         C  15 -23.958   4.209  31.280
  158    H1'    C  15           H1'        C  15 -21.194   5.388  29.646
  159    H41    C  15           H41        C  15 -17.895   6.160  35.061
  160    H42    C  15           H42        C  15 -18.571   7.757  35.289
  161    H5     C  15           H5         C  15 -20.218   8.717  33.816
  162    H6     C  15           H6         C  15 -21.573   8.352  31.805
  163    H5'    G  16           H5'        G  16 -25.304   5.407  24.511
  164   H5''    G  16          H5''        G  16 -23.828   5.283  25.491
  165    H4'    G  16           H4'        G  16 -25.231   7.826  24.603
  166    H3'    G  16           H3'        G  16 -22.624   6.497  23.826
  167    H2'    G  16          H2''        G  16 -21.580   8.597  23.658
  168   HO2'    G  16          H2'         G  16 -22.772  10.104  22.759
  169    H1'    G  16           H1'        G  16 -22.680   9.734  25.885
  170    H8     G  16           H8         G  16 -20.372   9.758  27.072
  171    H1     G  16           H1         G  16 -19.696   3.413  26.404
  172    H21    G  16           H21        G  16 -21.399   2.584  25.246
  173    H22    G  16           H22        G  16 -22.698   3.587  24.639
  174    H5'    G  17           H5'        G  17 -21.226   8.765  19.360
  175   H5''    G  17          H5''        G  17 -20.542   7.556  20.464
  176    H4'    G  17           H4'        G  17 -20.366  10.575  20.661
  177    H3'    G  17           H3'        G  17 -18.359   8.358  20.268
  178    H2'    G  17          H2''        G  17 -16.776   9.551  21.539
  179   HO2'    G  17          H2'         G  17 -16.719  11.634  21.154
  180    H1'    G  17           H1'        G  17 -18.481  10.476  23.481
  181    H8     G  17           H8         G  17 -18.981   6.883  22.105
  182    H1     G  17           H1         G  17 -15.419   7.308  27.423
  183    H21    G  17           H21        G  17 -15.078   9.439  27.943
  184    H22    G  17           H22        G  17 -15.724  10.753  26.985
  185    H5'    C  18           H5'        C  18 -16.088  11.287  18.457
  186   H5''    C  18          H5''        C  18 -14.863  10.508  17.434
  187    H4'    C  18           H4'        C  18 -14.309  11.220  19.936
  188    H3'    C  18           H3'        C  18 -13.438   8.682  18.531
  189    H2'    C  18          H2''        C  18 -12.413   7.938  20.510
  190   HO2'    C  18          H2'         C  18 -11.259   9.745  21.112
  191    H1'    C  18           H1'        C  18 -14.286   8.918  22.299
  192    H41    C  18           H41        C  18 -15.579   2.711  21.568
  193    H42    C  18           H42        C  18 -16.757   3.132  20.343
  194    H5     C  18           H5         C  18 -17.037   5.369  19.494
  195    H6     C  18           H6         C  18 -16.248   7.686  19.633
  196    H5'    A  19           H5'        A  19  -9.446  10.921  20.099
  197   H5''    A  19          H5''        A  19  -8.426  10.637  18.673
  198    H4'    A  19           H4'        A  19  -7.403  10.056  20.943
  199    H3'    A  19           H3'        A  19  -7.537   8.092  18.646
  200    H2'    A  19          H2''        A  19  -6.541   6.427  19.977
  201   HO2'    A  19          H2'         A  19  -5.709   8.634  21.559
  202    H1'    A  19           H1'        A  19  -7.833   6.992  22.338
  203    H8     A  19           H8         A  19 -10.354   7.388  19.547
  204    H61    A  19           H61        A  19 -11.223   1.269  19.905
  205    H62    A  19           H62        A  19 -11.808   2.770  19.224
  206    H2     A  19           H2         A  19  -7.641   2.315  22.393
  207    H5'    U  20           H5'        U  20  -3.000   8.456  19.060
  208   H5''    U  20          H5''        U  20  -2.376   7.677  17.591
  209    H4'    U  20           H4'        U  20  -2.262   6.423  19.913
  210    H3'    U  20           H3'        U  20  -3.041   5.220  17.247
  211    H2'    U  20          H2''        U  20  -3.479   3.155  18.288
  212   HO2'    U  20          H2'         U  20  -2.125   2.554  19.796
  213    H1'    U  20           H1'        U  20  -4.659   4.127  20.577
  214    H3     U  20           H3         U  20  -8.288   2.455  18.415
  215    H5     U  20           H5         U  20  -7.171   5.777  16.070
  216    H6     U  20           H6         U  20  -5.222   6.041  17.492
  217    H5'    A  21           H5'        A  21   0.775   1.637  17.218
  218   H5''    A  21          H5''        A  21  -0.675   0.788  16.645
  219    H4'    A  21           H4'        A  21   0.371   0.971  19.485
  220    H3'    A  21           H3'        A  21   0.027  -1.286  17.497
  221    H2'    A  21          H2''        A  21  -0.536  -2.749  19.248
  222   HO2'    A  21          H2'         A  21   0.112  -2.454  21.312
  223    H1'    A  21           H1'        A  21  -2.003  -0.965  20.775
  224    H8     A  21           H8         A  21  -3.762   0.035  17.930
  225    H61    A  21           H61        A  21  -6.112  -5.631  17.094
  226    H62    A  21           H62        A  21  -6.253  -3.938  16.681
  227    H2     A  21           H2         A  21  -2.627  -5.968  19.897
  228    H5'    U  22           H5'        U  22   2.869  -2.911  15.297
  229   H5''    U  22          H5''        U  22   1.318  -2.119  14.949
  230    H4'    U  22           H4'        U  22   1.848  -5.063  15.414
  231    H3'    U  22           H3'        U  22   0.848  -3.461  13.080
  232    H2'    U  22          H2''        U  22  -0.596  -5.240  12.505
  233   HO2'    U  22          H2'         U  22   0.496  -7.017  14.399
  234    H1'    U  22           H1'        U  22  -1.281  -6.036  15.062
  235    H3     U  22           H3         U  22  -4.771  -4.246  12.496
  236    H5     U  22           H5         U  22  -3.375  -1.235  15.096
  237    H6     U  22           H6         U  22  -1.469  -2.650  15.605
  238    H5'    C  23           H5'        C  23   3.912  -6.657  11.782
  239   H5''    C  23          H5''        C  23   4.915  -6.259  10.372
  240    H4'    C  23           H4'        C  23   3.341  -8.174   9.995
  241    H3'    C  23           H3'        C  23   3.163  -5.681   8.291
  242    H2'    C  23          H2''        C  23   1.344  -6.596   7.103
  243   HO2'    C  23          H2'         C  23   0.746  -8.842   7.440
  244    H1'    C  23           H1'        C  23   0.009  -7.660   9.232
  245    H41    C  23           H41        C  23  -2.056  -1.627   8.272
  246    H42    C  23           H42        C  23  -1.251  -1.203   9.767
  247    H5     C  23           H5         C  23   0.181  -2.721  10.971
  248    H6     C  23           H6         C  23   1.152  -4.973  11.001
  249    H5'    A  24           H5'        A  24   4.942  -8.612   4.279
  250   H5''    A  24          H5''        A  24   5.814  -7.087   4.018
  251    H4'    A  24           H4'        A  24   4.324  -8.019   2.100
  252    H3'    A  24           H3'        A  24   4.293  -5.155   3.080
  253    H2'    A  24          H2''        A  24   2.594  -4.635   1.541
  254   HO2'    A  24          H2'         A  24   3.288  -7.097   0.257
  255    H1'    A  24           H1'        A  24   1.172  -6.998   1.728
  256    H8     A  24           H8         A  24   2.338  -5.777   5.159
  257    H61    A  24           H61        A  24  -2.898  -2.478   5.309
  258    H62    A  24           H62        A  24  -1.505  -3.012   6.222
  259    H2     A  24           H2         A  24  -2.469  -4.223   1.200
  260    H5'    G  25           H5'        G  25   4.924  -4.953  -0.915
  261   H5''    G  25          H5''        G  25   6.137  -3.831  -1.564
  262    H4'    G  25           H4'        G  25   3.853  -3.361  -2.416
  263    H3'    G  25           H3'        G  25   5.224  -1.273  -0.709
  264    H2'    G  25          H2''        G  25   3.345   0.128  -0.890
  265   HO2'    G  25          H2'         G  25   3.068  -1.174  -3.278
  266    H1'    G  25           H1'        G  25   1.399  -1.817  -0.721
  267    H8     G  25           H8         G  25   4.269  -2.477   1.717
  268    H1     G  25           H1         G  25  -0.154   1.625   3.903
  269    H21    G  25           H21        G  25  -1.564   2.160   2.273
  270    H22    G  25           H22        G  25  -1.420   1.513   0.656
  271    H5'    C  26           H5'        C  26   4.792   0.037  -4.865
  272   H5''    C  26          H5''        C  26   6.085   0.963  -5.655
  273    H4'    C  26           H4'        C  26   3.949   2.189  -5.694
  274    H3'    C  26           H3'        C  26   6.194   3.345  -4.027
  275    H2'    C  26          H2''        C  26   4.811   5.137  -3.383
  276   HO2'    C  26          H2'         C  26   3.115   5.822  -4.564
  277    H1'    C  26           H1'        C  26   2.475   3.717  -3.071
  278    H41    C  26           H41        C  26   5.185   4.161   2.713
  279    H42    C  26           H42        C  26   5.962   2.618   2.443
  280    H5     C  26           H5         C  26   5.870   1.442   0.342
  281    H6     C  26           H6         C  26   5.012   1.493  -1.954
  282    H5'    C  27           H5'        C  27   6.577   6.636  -7.064
  283   H5''    C  27          H5''        C  27   8.321   6.957  -6.985
  284    H4'    C  27           H4'        C  27   6.698   8.685  -5.932
  285    H3'    C  27           H3'        C  27   9.147   7.571  -4.545
  286    H2'    C  27          H2''        C  27   8.654   8.853  -2.637
  287   HO2'    C  27          H2'         C  27   8.128  10.851  -3.176
  288    H1'    C  27           H1'        C  27   5.904   8.578  -2.701
  289    H41    C  27           H41        C  27   8.100   4.244   1.464
  290    H42    C  27           H42        C  27   8.214   3.077   0.165
  291    H5     C  27           H5         C  27   7.821   3.632  -2.147
  292    H6     C  27           H6         C  27   7.230   5.424  -3.712
  293    H5'    C  28           H5'        C  28   9.610  11.613  -5.097
  294   H5''    C  28          H5''        C  28  10.962  12.404  -5.932
  295    H4'    C  28           H4'        C  28  10.848  13.388  -3.764
  296    H3'    C  28           H3'        C  28  13.037  11.310  -3.950
  297   HO3'    C  28          H3T         C  28  14.089  13.021  -4.621
  298    H2'    C  28          H2''        C  28  13.617  11.704  -1.714
  299   HO2'    C  28          H2'         C  28  12.609  13.545  -0.582
  300    H1'    C  28           H1'        C  28  11.053  12.005  -0.737
  301    H41    C  28           H41        C  28  12.756   5.938   0.380
  302    H42    C  28           H42        C  28  12.068   5.479  -1.161
  303    H5     C  28           H5         C  28  11.220   7.072  -2.756
  304    H6     C  28           H6         C  28  10.847   9.451  -3.218