*HEADER    PEPTIDE/RNA                             13-APR-18   6D2U              
*TITLE     SOLUTION STRUCTURE OF A ULTRA-HIGH AFFINITY MACROCYCLE BOUND TO HIV-1 
*TITLE    2 TAR RNA                                                              
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO;   
*COMPND   3 CHAIN: A;                                                            
*COMPND   4 ENGINEERED: YES;                                                     
*COMPND   5 MOL_ID: 2;                                                           
*COMPND   6 MOLECULE: RNA (29-MER);                                              
*COMPND   7 CHAIN: B;                                                            
*COMPND   8 ENGINEERED: YES                                                      
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 ORGANISM_SCIENTIFIC: SYNTHETIC CONSTRUCT;                            
*SOURCE   3 ORGANISM_TAXID: 32630;                                               
*SOURCE   4 EXPRESSION_SYSTEM: SYNTHETIC CONSTRUCT;                              
*SOURCE   5 EXPRESSION_SYSTEM_TAXID: 32630;                                      
*SOURCE   6 MOL_ID: 2;                                                           
*SOURCE   7 ORGANISM_SCIENTIFIC: SYNTHETIC CONSTRUCT;                            
*SOURCE   8 ORGANISM_TAXID: 32630;                                               
*SOURCE   9 EXPRESSION_SYSTEM: SYNTHETIC CONSTRUCT;                              
*SOURCE  10 EXPRESSION_SYSTEM_TAXID: 32630                                       
*KEYWDS    MACROCYCLE INHIBITOR, COMPLEX, HIV-1 TAR, TAT, P-TEFB, RNA, PEPTIDE-  
*KEYWDS   2 RNA COMPLEX                                                          
*EXPDTA    SOLUTION NMR                                                          
*NUMMDL    10                                                                    
*AUTHOR    M.D.SHORTRIDGE,G.VARANI                                               
*REVDAT   1   12-DEC-18 6D2U    0                                                
# Restraints file 1: mds_181_tar_intermolecularnoes.tbl
!-------------------------------------------------------------------------!
!Intermolecular NOE Table for HIV TAR bound to JB181 peptide !
!Updated 053016 mds
!RNA,   29mer GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
!JB181, 14mer DAB VAL ARG THR ARG LYS GLY ARG ARG ILE NOR ILE DPR PRO
!DAB= L-Diamino Butyric Acid
!NOR= L-2-Amino-4-guanidinobutyric acid
!DPR= D-Proline

!! NOE binning !!
!! 100ms
!medium     3.5 1.2 1.2
!weak       4.5 1.6 1.6
!! 300ms
!weak       4.5 1.6 1.6
!very weak  5.0 2.0 2.0

!TOTAL intermolecular NOES  = 92
!H2O             =  
!D2O             = 

!------------------------------------------------------------------------!
!!*** H2O NOESY ***!!
!------------------------------------------------------------------------!
!G21
 assign ( resid  1 and name HD# ) ( resid 21 and name H8   ) 3.5 1.2 1.2

!A22
 assign ( resid  1 and name HD# ) ( resid 22 and name H8   ) 4.5 1.6 1.6

!U23 
 assign ( resid  3 and name HG#  ) ( resid 23 and name H3   ) 4.5 1.6 1.6
 assign ( resid  5 and name HB#  ) ( resid 23 and name H3   ) 4.5 1.6 1.6
 assign ( resid  5 and name HG#  ) ( resid 23 and name H3   ) 4.5 1.6 1.6
 assign ( resid  5 and name HD#  ) ( resid 23 and name H3   ) 4.5 1.6 1.6
 assign ( resid  5 and name HE   ) ( resid 23 and name H3   ) 4.5 1.6 1.6
 assign ( resid 10 and name HD#  ) ( resid 23 and name H3   ) 4.5 1.6 1.6
 assign ( resid 10 and name HG1# ) ( resid 23 and name H3   ) 4.5 1.6 1.6


!C24
 assign ( resid  7 and name HN   ) ( resid 24 and name H5   ) 4.5 1.6 1.6

!U25
 assign ( resid  6 and name HN   ) ( resid 25 and name H5   ) 4.5 1.6 1.6
 assign ( resid  5 and name HE   ) ( resid 25 and name H5   ) 4.5 1.6 1.6

!G26 
 assign ( resid  3 and name HH1# ) ( resid 26 and name H1   ) 5.0 2.0 2.0
 assign ( resid  3 and name HH2# ) ( resid 26 and name H1   ) 5.0 2.0 2.0

!G28
 assign ( resid  5 and name HE   ) ( resid 28 and name H8   ) 4.5 1.6 1.6
! assign ( resid  5 and name HH2# ) ( resid 28 and name H8   ) 4.5 1.6 1.6
! assign ( resid  5 and name HH1# ) ( resid 28 and name H1'  ) 4.5 1.6 1.6

!U38 
 assign ( resid 10 and name HD1# ) ( resid 38 and name H3   ) 4.5 1.6 1.6


!-----------------------------------------------------------------------!
!!*** D2O NOESY ***!!
!-----------------------------------------------------------------------!
!G21
 assign ( resid  1 and name HG#  ) ( resid 21 and name H8   ) 4.5 1.6 1.6

!************************************************************************!
!A22
 assign ( resid  1 and name HB#  ) ( resid 22 and name H8   ) 5.0 2.0 2.0
 assign ( resid  1 and name HG#  ) ( resid 22 and name H8   ) 5.0 2.0 2.0
 assign ( resid  3 and name HG#  ) ( resid 22 and name H8   ) 5.0 2.0 2.0
 assign ( resid  3 and name HB#  ) ( resid 22 and name H8   ) 4.5 1.6 1.6

!*************************************************************************!
!U23
 
 assign ( resid  3 and name HB#  ) ( resid 23 and name H5   ) 4.5 1.6 1.6
 assign ( resid  3 and name HG#  ) ( resid 23 and name H5   ) 5.0 2.0 2.0
 assign ( resid  3 and name HD#  ) ( resid 23 and name H5   ) 4.5 1.6 1.6
 assign ( resid  5 and name HB#  ) ( resid 23 and name H5   ) 4.5 1.6 1.6
 assign ( resid  5 and name HD#  ) ( resid 23 and name H5   ) 4.5 1.6 1.6
 assign ( resid 10 and name HD#  ) ( resid 23 and name H5   ) 3.5 1.5 1.5
 assign ( resid 10 and name HG1# ) ( resid 23 and name H5   ) 5.0 2.0 2.0
 assign ( resid 10 and name HG2# ) ( resid 23 and name H5   ) 4.5 1.6 1.6
 assign ( resid 12 and name HD#  ) ( resid 23 and name H5   ) 4.5 1.6 1.6
 assign ( resid 12 and name HG2# ) ( resid 23 and name H5   ) 4.5 1.6 1.6
 assign ( resid 12 and name HG12 ) ( resid 23 and name H5   ) 4.5 1.6 1.6

 assign ( resid  3 and name HD# ) ( resid 23 and name H6   ) 4.5 1.6 1.6
 assign ( resid  5 and name HG#  ) ( resid 23 and name H6   ) 4.5 1.6 1.6
 assign ( resid  5 and name HB#  ) ( resid 23 and name H6   ) 5.0 2.0 2.0
 assign ( resid  5 and name HD#  ) ( resid 23 and name H6   ) 4.5 1.6 1.6
! assign ( resid  8 and name HG#  ) ( resid 23 and name H6   ) 4.5 1.6 1.6
 assign ( resid 10 and name HD#  ) ( resid 23 and name H6   ) 4.5 1.6 1.6
 assign ( resid 10 and name HG2# ) ( resid 23 and name H6   ) 4.5 1.6 1.6
 assign ( resid 12 and name HD#  ) ( resid 23 and name H6   ) 4.5 1.6 1.6

! assign ( resid  5 and name HG#  ) ( resid 23 and name H1'  ) 5.0 2.0 2.0
 assign ( resid  5 and name HB#  ) ( resid 23 and name H1'  ) 5.0 2.0 2.0
! assign ( resid  5 and name HD#  ) ( resid 23 and name H1'  ) 5.0 2.0 2.0
!assign ( resid 10 and name HG2# ) ( resid 23 and name H1'  ) 5.0 2.0 2.0

!*************************************************************************!
!C24
 assign ( resid  4 and name HG2# ) ( resid 24 and name H6   ) 4.5 1.6 1.6
 assign ( resid  6 and name HA   ) ( resid 24 and name H6   ) 4.5 1.6 1.6
 assign ( resid  6 and name HD#  ) ( resid 24 and name H6   ) 4.5 1.6 1.6
 assign ( resid  6 and name HB#  ) ( resid 24 and name H6   ) 3.5 1.2 1.2
 assign ( resid  6 and name HG#  ) ( resid 24 and name H6   ) 4.5 1.6 1.6
 assign ( resid  6 and name HE#  ) ( resid 24 and name H6   ) 3.5 1.2 1.2
 assign ( resid  7 and name HA1  ) ( resid 24 and name H6   ) 5.0 2.0 2.0

 assign ( resid  4 and name HB   ) ( resid 24 and name H5  ) 5.0 2.0 2.0
 assign ( resid  4 and name HG2# ) ( resid 24 and name H5  ) 4.5 1.6 1.6
 assign ( resid  7 and name HA#  ) ( resid 24 and name H5  ) 4.5 1.6 1.6
 assign ( resid  6 and name HA   ) ( resid 24 and name H5  ) 5.0 2.0 2.0
 assign ( resid  6 and name HE#  ) ( resid 24 and name H5  ) 4.5 1.6 1.6
 assign ( resid  6 and name HD#  ) ( resid 24 and name H5  ) 4.5 1.6 1.6
 assign ( resid  6 and name HG#  ) ( resid 24 and name H5  ) 4.5 1.6 1.6
 assign ( resid  6 and name HB#  ) ( resid 24 and name H5  ) 4.5 1.6 1.6
  
!*************************************************************************!
!U25
!assign ( resid  4 and name HG2# ) ( resid 25 and name H5   ) 5.0 2.0 2.0
 assign ( resid  5 and name HG#  ) ( resid 25 and name H5   ) 5.0 2.0 2.0

!assign ( resid 10 and name HD#  ) ( resid 25 and name H6   ) 5.0 2.0 2.0

!*************************************************************************!
!C30
! assign ( resid  8 and name HG#  ) ( resid 30 and name H1'  ) 4.5 1.6 1.6
 assign ( resid  8 and name HG#  ) ( resid 30 and name H6   ) 4.5 1.6 1.6

!*************************************************************************! 
!G32
! assign ( resid  8 and name HD1  ) ( resid 32 and name H8   ) 4.5 1.6 1.6
! assign ( resid  8 and name HD2  ) ( resid 32 and name H8   ) 4.5 1.6 1.6

!************************************************************************!
!G33
!assign ( resid  8 and name HD1  ) ( resid 33 and name H8   ) 4.5 1.6 1.6
!assign ( resid  8 and name HD2  ) ( resid 33 and name H8   ) 4.5 1.6 1.6
!assign ( resid  8 and name HB1  ) ( resid 33 and name H8   ) 5.0 2.0 2.0
!assign ( resid  8 and name HB2  ) ( resid 33 and name H8   ) 5.0 2.0 2.0

!************************************************************************!
!G34
 assign ( resid  8 and name HB#  ) ( resid 34 and name H8   ) 4.5 1.6 1.6
 assign ( resid  8 and name HG#  ) ( resid 34 and name H8   ) 4.5 1.6 1.6
 assign ( resid  8 and name HD#  ) ( resid 34 and name H8   ) 4.5 1.6 1.6
! assign ( resid  9 and name HD#  ) ( resid 34 and name H8   ) 4.5 1.6 1.6
 assign ( resid 10 and name HB   ) ( resid 34 and name H8   ) 4.5 1.6 1.6
 assign ( resid 10 and name HG1# ) ( resid 34 and name H8   ) 4.5 1.6 1.6
 assign ( resid 10 and name HG2# ) ( resid 34 and name H8   ) 2.5 0.7 0.7
 assign ( resid 10 and name HD#  ) ( resid 34 and name H8   ) 3.5 1.2 1.2
! assign ( resid 12 and name HD#  ) ( resid 34 and name H8   ) 4.5 1.6 1.6
! assign ( resid 12 and name HG2# ) ( resid 34 and name H8   ) 4.5 1.6 1.6

!assign ( resid  8 and name HG#  ) ( resid 34 and name H1'  ) 4.5 1.6 1.6
! assign ( resid  9 and name HD#  ) ( resid 34 and name H1'  ) 5.0 2.0 2.0
 assign ( resid 10 and name HD#  ) ( resid 34 and name H1'  ) 4.5 1.6 1.6
 assign ( resid 10 and name HG2# ) ( resid 34 and name H1'  ) 4.5 1.6 1.6

! assign ( resid  8 and name HG1  ) ( resid 34 and name H2'' ) 5.0 2.0 2.0
! assign ( resid  8 and name HG2  ) ( resid 34 and name H2'' ) 5.0 2.0 2.0

!************************************************************************!
!A35
! assign ( resid  2 and name HG#  ) ( resid 35 and name H2   ) 4.5 1.6 1.6
! assign ( resid  2 and name HB   ) ( resid 35 and name H2   ) 5.0 2.0 2.0
 assign ( resid 11 and name HG#  ) ( resid 35 and name H2   ) 5.0 2.0 2.0
 assign ( resid 13 and name HB#  ) ( resid 35 and name H2   ) 4.5 1.6 1.6
 assign ( resid 13 and name HG#  ) ( resid 35 and name H2   ) 4.5 1.6 1.6
 assign ( resid 13 and name HD#  ) ( resid 35 and name H2   ) 4.5 1.6 1.6
! assign ( resid 14 and name HB1  ) ( resid 35 and name H2   ) 5.0 2.0 2.0
! assign ( resid 14 and name HD2  ) ( resid 35 and name H2   ) 4.5 1.6 1.6
! assign ( resid 14 and name HD1  ) ( resid 35 and name H2   ) 4.5 1.6 1.6

! assign ( resid  2 and name HG1# ) ( resid 35 and name H8   ) 5.0 2.0 2.0
 assign ( resid 11 and name HB#  ) ( resid 35 and name H8   ) 4.5 1.6 1.6
 assign ( resid 11 and name HG#  ) ( resid 35 and name H8   ) 4.5 1.6 1.6
 assign ( resid 13 and name HD#  ) ( resid 35 and name H8   ) 5.0 2.0 2.0
 assign ( resid 13 and name HB#  ) ( resid 35 and name H8   ) 5.0 2.0 2.0
 assign ( resid 13 and name HG#  ) ( resid 35 and name H8   ) 5.0 2.0 2.0

!assign ( resid  3 and name HB1  ) ( resid 35 and name H1'  ) 5.0 2.0 2.0
 assign ( resid 11 and name HB#  ) ( resid 35 and name H1'  ) 4.5 1.6 1.6
 assign ( resid 11 and name HG#  ) ( resid 35 and name H1'  ) 4.5 1.6 1.6
 assign ( resid 12 and name HG2# ) ( resid 35 and name H1'  ) 4.5 1.6 1.6
! assign ( resid  2 and name HG#  ) ( resid 35 and name H1'  ) 4.5 1.6 1.6
 assign ( resid 13 and name HB#  ) ( resid 35 and name H1'  ) 4.5 1.6 1.6
 assign ( resid 13 and name HG#  ) ( resid 35 and name H1'  ) 4.5 1.6 1.6
 assign ( resid 13 and name HD#  ) ( resid 35 and name H1'  ) 4.5 1.6 1.6

!**************************************************************************!
!G36
 assign ( resid 10 and name HG2# ) ( resid 36 and name H8   ) 3.5 1.2 1.2
 assign ( resid 10 and name HD#  ) ( resid 36 and name H8   ) 4.5 1.6 1.6
 assign ( resid 12 and name HD#  ) ( resid 36 and name H8   ) 4.5 1.6 1.6

!**************************************************************************!
!C37
 assign ( resid 10 and name HG2# ) ( resid 37 and name H5   ) 4.5 1.6 1.6
 assign ( resid 12 and name HD#  ) ( resid 37 and name H5   ) 4.5 1.6 1.6
 assign ( resid 12 and name HG2# ) ( resid 37 and name H5   ) 4.5 1.6 1.6

!**************************************************************************!
!U38
 assign ( resid 12 and name HD#  ) ( resid 38 and name H5   ) 5.0 2.0 2.0
 assign ( resid 12 and name HG2# ) ( resid 38 and name H5   ) 5.0 2.0 2.0

!**************************************************************************!
!C39
 assign ( resid 12 and name HD#  ) ( resid 39 and name H5   ) 5.0 2.0 2.0
assign ( resid 12 and name HG2# ) ( resid 39 and name H5   ) 5.0 2.0 2.0 
# Restraints file 2: mds_JB181_072616.tbl
!-------------------------------------------------------------------------!
!PEPTIDE NOE Table for HIV TAR bound to JB181 peptide, HN assignments from 800MHz waterNOESY (100ms) !
!Updated 072616 mds
!RNA,   29mer GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
!JB181, 14mer DAB VAL ARG THR ARG LYS GLY ARG ARG ILE NOR ILE DPR PRO
!DAB= L-Diamino Butyric Acid
!NOR= L-2-Amino-4-guanidinobutyric acid
!DPR= D-Proline

!!NOTE: If two sterospecific atoms have same intensity used sum averaging with soft square !!
!! NOE binning !!
!strong     2.5 0.7 0.7
!medium     3.5 1.2 1.2
!weak       4.5 1.6 1.6
!very weak  5.0 2.0 2.0

!TOTAL PEPTIDE NOES               = 294
!long range   =        (i-j > 6)  =       
!short range  =    (2 > i-j < 5)  =  
!sequential   =         (i to j)  =  
!intraresidue =         (i to i)  = 

!------------------------------------------------------------------------!

!!***BACKBONE NOE***!!

!HN-HA
 assign ( resid  1 and name HN   ) ( resid 14 and name HA   ) 3.5 1.2 1.2
 assign ( resid  2 and name HN   ) ( resid  1 and name HA   ) 2.5 0.7 0.7
 assign ( resid  3 and name HN   ) ( resid  2 and name HA   ) 2.5 0.7 0.7
 assign ( resid  4 and name HN   ) ( resid  3 and name HA   ) 2.5 0.7 0.7
 assign ( resid  5 and name HN   ) ( resid  4 and name HA   ) 2.5 0.7 0.7
 assign ( resid  6 and name HN   ) ( resid  5 and name HA   ) 3.5 1.2 1.2
 assign ( resid  7 and name HN   ) ( resid  6 and name HA   ) 3.5 1.2 1.2
 assign ( resid  8 and name HN   ) ( resid  7 and name HA1  ) 3.5 1.2 1.2
 assign ( resid  8 and name HN   ) ( resid  7 and name HA2  ) 3.5 1.2 1.2
 assign ( resid  9 and name HN   ) ( resid  8 and name HA   ) 2.5 0.7 0.7
 assign ( resid 10 and name HN   ) ( resid  9 and name HA   ) 2.5 0.7 0.7
 assign ( resid 11 and name HN   ) ( resid 10 and name HA   ) 2.5 0.7 0.7
 assign ( resid 12 and name HN   ) ( resid 11 and name HA   ) 2.5 0.7 0.7

 assign ( resid  1 and name HN   ) ( resid  1 and name HA   ) 3.5 1.2 1.2
 assign ( resid  2 and name HN   ) ( resid  2 and name HA   ) 3.5 1.2 1.2
 assign ( resid  3 and name HN   ) ( resid  3 and name HA   ) 3.5 1.2 1.2
 assign ( resid  4 and name HN   ) ( resid  4 and name HA   ) 3.5 1.2 1.2
 assign ( resid  5 and name HN   ) ( resid  5 and name HA   ) 3.5 1.2 1.2
 assign ( resid  6 and name HN   ) ( resid  6 and name HA   ) 3.5 1.6 1.6
 assign ( resid  7 and name HN   ) ( resid  7 and name HA1  ) 3.5 1.6 1.6
 assign ( resid  7 and name HN   ) ( resid  7 and name HA2  ) 3.5 1.6 1.6
 assign ( resid  8 and name HN   ) ( resid  8 and name HA   ) 3.5 1.6 1.6
 assign ( resid  9 and name HN   ) ( resid  9 and name HA   ) 3.5 1.2 1.2
 assign ( resid 10 and name HN   ) ( resid 10 and name HA   ) 3.5 1.2 1.2
 assign ( resid 11 and name HN   ) ( resid 11 and name HA   ) 3.5 1.2 1.2
 assign ( resid 12 and name HN   ) ( resid 12 and name HA   ) 3.5 1.2 1.2

!HN-HN
 assign ( resid  1 and name HN   ) ( resid  2 and name HN   ) 4.5 1.6 1.6
 assign ( resid  2 and name HN   ) ( resid  3 and name HN   ) 4.5 1.6 1.6
 assign ( resid  3 and name HN   ) ( resid  4 and name HN   ) 4.5 1.6 1.6
 assign ( resid  4 and name HN   ) ( resid  5 and name HN   ) 4.5 1.6 1.6
 assign ( resid  5 and name HN   ) ( resid  6 and name HN   ) 4.5 1.6 1.6
 assign ( resid  6 and name HN   ) ( resid  7 and name HN   ) 3.5 1.2 1.2
 assign ( resid  7 and name HN   ) ( resid  6 and name HN   ) 4.5 1.6 1.6
 assign ( resid  8 and name HN   ) ( resid  7 and name HN   ) 3.5 1.2 1.2
 assign ( resid  8 and name HN   ) ( resid  9 and name HN   ) 4.5 1.6 1.6
 assign ( resid  9 and name HN   ) ( resid 10 and name HN   ) 4.5 1.6 1.6
 assign ( resid 10 and name HN   ) ( resid 11 and name HN   ) 4.5 1.6 1.6
 assign ( resid 11 and name HN   ) ( resid 12 and name HN   ) 4.5 1.6 1.6


!CROSS STRAND HN-HA
 assign ( resid 12 and name HN   ) ( resid  2 and name HA   ) 3.5 1.2 1.2
 assign ( resid 11 and name HA   ) ( resid  3 and name HN   ) 3.5 1.2 1.2
 assign ( resid  5 and name HN   ) ( resid  9 and name HA   ) 4.5 1.6 1.6
 assign ( resid 10 and name HN   ) ( resid  4 and name HA   ) 3.5 1.2 1.2

!CROSS STRAND HN-HN
 assign ( resid  1 and name HN   ) ( resid 12 and name HN   ) 3.5 1.2 1.2
 assign ( resid  3 and name HN   ) ( resid 10 and name HN   ) 3.5 1.2 1.2
 assign ( resid  5 and name HN   ) ( resid  8 and name HN   ) 3.5 1.2 1.2

!CROSS STRAND HA-HA
 assign ( resid  2 and name HA   ) ( resid 11 and name HA   ) 3.5 1.2 1.2
 assign ( resid  4 and name HA   ) ( resid  9 and name HA   ) 3.5 1.2 1.2

!----------------------------------------------------------------------------!
!!*** Side Chain NOEs *** !! 

!DAB 1
 assign ( resid  1 and name HN   ) ( resid 14 and name HA   ) 4.5 1.6 1.6
 assign ( resid  1 and name HN   ) ( resid 14 and name HD1  ) 3.5 1.2 1.2
 assign ( resid  1 and name HN   ) ( resid 14 and name HD2  ) 3.5 1.2 1.2
 assign ( resid  1 and name HN   ) ( resid 12 and name HG2# ) 4.5 1.6 1.6
 assign ( resid  1 and name HN   ) ( resid 12 and name HD#  ) 4.5 1.6 1.6
 assign ( resid  1 and name HN   ) ( resid  2 and name HG## ) 4.5 1.6 1.6
 assign ( resid  1 and name HN   ) ( resid 11 and name HB#  ) 4.5 1.6 1.6

 assign ( resid  1 and name HB#  ) ( resid  1 and name HA   ) 2.5 0.7 0.7

!assign ( resid  1 and name HG1  ) ( resid  2 and name HN   ) 2.5 0.7 0.7
!assign ( resid  1 and name HG2  ) ( resid  2 and name HN   ) 4.5 1.6 1.6
 assign ( resid  1 and name HG1  ) ( resid  1 and name HA   ) 4.5 1.6 1.6
 assign ( resid  1 and name HG#  ) ( resid  1 and name HA   ) 4.5 1.6 1.6

 assign ( resid  1 and name HD#  ) ( resid 12 and name HD#  ) 4.5 1.6 1.6
 assign ( resid  1 and name HD#  ) ( resid 12 and name HG2# ) 4.5 1.6 1.6
 assign ( resid  1 and name HD#  ) ( resid  2 and name HG#  ) 4.5 1.6 1.6
 assign ( resid  1 and name HD#  ) ( resid 12 and name HB   ) 4.5 1.6 1.6
 assign ( resid  1 and name HD#  ) ( resid  1 and name HB#  ) 3.5 1.2 1.2
 assign ( resid  1 and name HD#  ) ( resid  2 and name HN   ) 4.5 1.6 1.6

!VAL 2
 assign ( resid  2 and name HN   ) ( resid  1 and name HB1  ) 2.5 0.7 0.7 

 assign ( resid  2 and name HA   ) ( resid  2 and name HB   ) 2.5 0.7 0.7
 assign ( resid  2 and name HA   ) ( resid  2 and name HG## ) 2.5 0.7 0.7

 assign ( resid  2 and name HB   ) ( resid  2 and name HN   ) 3.5 1.2 1.2
 assign ( resid  2 and name HB   ) ( resid  3 and name HN   ) 3.5 1.2 1.2
 assign ( resid  2 and name HB   ) ( resid 11 and name HD   ) 3.5 1.2 1.2
 assign ( resid  2 and name HG## ) ( resid 11 and name HD   ) 4.5 1.6 1.6

 assign ( resid  2 and name HG## ) ( resid  4 and name HA   ) 5.0 2.0 2.0
 assign ( resid  2 and name HG## ) ( resid 11 and name HG#  ) 4.5 1.6 1.6

!ARG 3 
 assign ( resid  3 and name HN   ) ( resid 10 and name HG2# ) 3.5 1.2 1.2
 assign ( resid  3 and name HN   ) ( resid 10 and name HD#  ) 3.5 1.2 1.2
 assign ( resid  3 and name HN   ) ( resid 10 and name HG12 ) 3.5 1.2 1.2
 assign ( resid  3 and name HN   ) ( resid  3 and name HG2  ) 4.5 1.6 1.6
 assign ( resid  3 and name HN   ) ( resid  3 and name HB2  ) 3.5 1.2 1.2

!assign ( resid  3 and name HA   ) ( resid  3 and name HE   ) 4.5 1.6 1.6
 assign ( resid  3 and name HA   ) ( resid  4 and name HB   ) 4.5 1.6 1.6
 assign ( resid  3 and name HA   ) ( resid  4 and name HG2# ) 4.5 1.6 1.6
 assign ( resid  3 and name HA   ) ( resid  2 and name HG##  ) 4.5 1.6 1.6

 assign ( resid  3 and name HB#  ) ( resid  3 and name HA   ) 2.5 0.7 0.7
 assign ( resid  3 and name HB#  ) ( resid  3 and name HD#  ) 2.5 0.7 0.7

 assign ( resid  3 and name HG1  ) ( resid  3 and name HA   ) 3.5 1.2 1.2
 assign ( resid  3 and name HG1  ) ( resid  3 and name HB2  ) 3.5 1.2 1.2
 assign ( resid  3 and name HG1  ) ( resid  3 and name HD#  ) 2.5 0.7 0.7

 assign ( resid  3 and name HG2  ) ( resid  3 and name HA   ) 3.5 1.2 1.2
 assign ( resid  3 and name HG2  ) ( resid  3 and name HB2  ) 2.5 0.7 0.7
 assign ( resid  3 and name HG2  ) ( resid  3 and name HD#  ) 2.5 0.7 0.7

 assign ( resid  3 and name HD#  ) ( resid  3 and name HA   ) 4.5 1.6 1.6

!assign ( resid  3 and name HE   ) ( resid  3 and name HN   ) 4.5 1.6 1.6


!THR 4
 assign ( resid  4 and name HN   ) ( resid  4 and name HG2# ) 3.5 1.2 1.2
 assign ( resid  4 and name HN   ) ( resid  5 and name HG2  ) 4.5 1.6 1.6
 assign ( resid  4 and name HN   ) ( resid  4 and name HB   ) 3.5 1.2 1.2

 assign ( resid  4 and name HA   ) ( resid  4 and name HB   ) 2.5 0.7 0.7
 assign ( resid  4 and name HA   ) ( resid  3 and name HB#  ) 4.5 1.6 1.6
 assign ( resid  4 and name HA   ) ( resid  3 and name HG2  ) 4.5 1.6 1.6
 assign ( resid  4 and name HA   ) ( resid  3 and name HG1  ) 4.5 1.6 1.6
 assign ( resid  4 and name HA   ) ( resid 10 and name HD#  ) 4.5 1.6 1.6

 assign ( resid  4 and name HB   ) ( resid  4 and name HG2# ) 2.5 0.7 0.7
 assign ( resid  4 and name HB   ) ( resid  5 and name HN   ) 4.5 1.6 1.6
 assign ( resid  4 and name HB   ) ( resid  9 and name HA   ) 3.5 1.6 1.6

 assign ( resid  4 and name HG2# ) ( resid  4 and name HN   ) 3.5 1.2 1.2 
 assign ( resid  4 and name HG2# ) ( resid  4 and name HA   ) 2.5 0.7 0.7
 assign ( resid  4 and name HG2# ) ( resid  4 and name HB   ) 2.5 0.7 0.7
 assign ( resid  4 and name HG2# ) ( resid  7 and name HA1  ) 4.5 1.6 1.6
 assign ( resid  4 and name HG2# ) ( resid  7 and name HA2  ) 4.5 1.6 1.6
 assign ( resid  4 and name HG2# ) ( resid  7 and name HN   ) 4.5 1.6 1.6
 assign ( resid  4 and name HG2# ) ( resid  8 and name HA   ) 4.5 1.6 1.6
 assign ( resid  4 and name HG2# ) ( resid  2 and name HG## ) 4.5 1.6 1.6

 assign ( resid  4 and name HG2# ) ( resid  9 and name HB2  ) 4.5 1.6 1.6
 assign ( resid  4 and name HG2# ) ( resid  9 and name HB1  ) 3.5 1.2 1.2

!ARG 5
 assign ( resid  5 and name HN   ) ( resid  4 and name HB#  ) 3.5 1.2 1.2
 assign ( resid  5 and name HN   ) ( resid  8 and name HB2  ) 4.5 1.6 1.6
! assign ( resid  5 and name HN   ) ( resid 10 and name HB   ) 4.5 1.6 1.6
 assign ( resid  5 and name HN   ) ( resid  8 and name HG1  ) 4.5 1.6 1.6
 assign ( resid  5 and name HN   ) ( resid  6 and name HB1  ) 4.5 1.6 1.6
 assign ( resid  5 and name HN   ) ( resid 10 and name HG12 ) 4.5 1.6 1.6
 assign ( resid  5 and name HN   ) ( resid  4 and name HG2# ) 3.5 1.2 1.2
 assign ( resid  5 and name HN   ) ( resid 10 and name HG2# ) 3.5 1.2 1.2
 assign ( resid  5 and name HN   ) ( resid 10 and name HD#  ) 4.5 1.6 1.6

 assign ( resid  5 and name HB1  ) ( resid  5 and name HN   ) 4.5 1.6 1.6
 assign ( resid  5 and name HB1  ) ( resid  5 and name HA   ) 3.5 1.2 1.2
 assign ( resid  5 and name HB2  ) ( resid  5 and name HA   ) 3.5 1.2 1.2
 assign ( resid  5 and name HB2  ) ( resid  5 and name HD#  ) 3.5 1.2 1.2

 assign ( resid  5 and name HG2  ) ( resid  5 and name HD#  ) 2.5 0.7 0.7
 assign ( resid  5 and name HG1  ) ( resid  5 and name HD#  ) 2.5 0.7 0.7
 assign ( resid  5 and name HG1  ) ( resid  5 and name HB#  ) 2.5 0.7 0.7
 assign ( resid  5 and name HG1  ) ( resid  5 and name HN   ) 4.5 1.6 1.6
 assign ( resid  5 and name HG1  ) ( resid  5 and name HA   ) 3.5 1.2 1.2
 assign ( resid  5 and name HG2  ) ( resid  5 and name HA   ) 3.5 1.2 1.2

 assign ( resid  5 and name HD#  ) ( resid  5 and name HN   ) 4.5 1.6 1.6

 assign ( resid  5 and name HE   ) ( resid  5 and name HN   ) 4.5 1.6 1.6
 assign ( resid  5 and name HE   ) ( resid 10 and name HG1# ) 4.5 1.6 1.6
 assign ( resid  5 and name HE   ) ( resid 10 and name HG2# ) 3.5 1.2 1.2
 assign ( resid  5 and name HE   ) ( resid  3 and name HB#  ) 4.5 1.6 1.6
! assign ( resid  5 and name HE   ) ( resid 10 and name HB   ) 4.5 1.6 1.6
 assign ( resid  5 and name HE   ) ( resid  5 and name HG2  ) 3.5 1.2 1.2
 assign ( resid  5 and name HE   ) ( resid  5 and name HG1  ) 4.5 1.2 1.2 

!LYS 6
 assign ( resid  6 and name HN   ) ( resid  4 and name HG2# ) 5.0 2.0 2.0
 assign ( resid  6 and name HN   ) ( resid  8 and name HG1  ) 4.5 1.6 1.6
 assign ( resid  6 and name HN   ) ( resid  6 and name HE#  ) 5.0 2.0 2.0
 assign ( resid  6 and name HN   ) ( resid  6 and name HB1  ) 3.5 1.2 1.2
 assign ( resid  6 and name HN   ) ( resid  6 and name HB2  ) 3.5 1.2 1.2
 assign ( resid  6 and name HN   ) ( resid  6 and name HG#  ) 4.5 1.6 1.6
 assign ( resid  6 and name HN   ) ( resid  6 and name HD#  ) 4.5 1.6 1.6 

 assign ( resid  6 and name HB1  ) ( resid  6 and name HA   ) 2.5 0.7 0.7
 assign ( resid  6 and name HB#  ) ( resid  6 and name HE#  ) 3.5 1.2 1.2

 assign ( resid  6 and name HG2  ) ( resid  6 and name HA   ) 3.5 1.2 1.2
 assign ( resid  6 and name HG1  ) ( resid  6 and name HA   ) 3.5 1.2 1.2
 assign ( resid  6 and name HG2  ) ( resid  6 and name HE#  ) 4.5 1.6 1.6
 assign ( resid  6 and name HG1  ) ( resid  6 and name HE#  ) 4.5 1.6 1.6
 assign ( resid  6 and name HG2  ) ( resid  6 and name HB#  ) 3.5 1.2 1.2
 assign ( resid  6 and name HG2  ) ( resid  6 and name HD1  ) 3.5 1.2 1.2
 assign ( resid  6 and name HG1  ) ( resid  6 and name HD1  ) 3.5 1.2 1.2
 assign ( resid  6 and name HG2  ) ( resid  6 and name HD2  ) 3.5 1.2 1.2
 assign ( resid  6 and name HG1  ) ( resid  6 and name HD2  ) 3.5 1.2 1.2

 assign ( resid  6 and name HD1  ) ( resid  6 and name HA   ) 4.5 1.6 1.6
 assign ( resid  6 and name HD2  ) ( resid  6 and name HA   ) 4.5 1.6 1.6
 assign ( resid  6 and name HD1  ) ( resid  6 and name HE#  ) 2.5 0.7 0.7
 assign ( resid  6 and name HD2  ) ( resid  6 and name HE#  ) 3.5 1.2 1.2
 assign ( resid  6 and name HD1  ) ( resid  6 and name HB#  ) 3.5 1.2 1.2
 assign ( resid  6 and name HD2  ) ( resid  6 and name HB#  ) 2.5 0.7 0.7

 assign ( resid  6 and name HE#  ) ( resid  6 and name HA   ) 5.0 2.0 2.0
!assign ( resid  6 and name HE1  ) ( resid  6 and name HN   ) 5.0 2.0 2.0
!assign ( resid  6 and name HE1  ) ( resid  6 and name HN   ) 5.0 2.0 2.0
!assign ( resid  6 and name HZ1  ) ( resid  6 and name HN   ) 4.5 1.6 1.6
!assign ( resid  6 and name HZ1  ) ( resid  6 and name HN   ) 5.0 2.0 2.0


!GLY 7
 assign ( resid  7 and name HN   ) ( resid  4 and name HG2# ) 3.5 1.2 1.2
 assign ( resid  7 and name HN   ) ( resid  6 and name HD#  ) 4.5 1.6 1.6
 assign ( resid  7 and name HN   ) ( resid  6 and name HB1  ) 4.5 1.6 1.6
 assign ( resid  7 and name HN   ) ( resid  8 and name HG1  ) 4.5 1.6 1.6
 assign ( resid  7 and name HN   ) ( resid  6 and name HB2  ) 4.5 1.6 1.6
 assign ( resid  7 and name HN   ) ( resid  4 and name HB   ) 4.5 1.6 1.6
 
 assign ( resid  7 and name HA1  ) ( resid  7 and name HN   ) 2.5 0.7 0.7
 assign ( resid  7 and name HA2  ) ( resid  7 and name HN   ) 2.5 0.7 0.7
 assign ( resid  7 and name HA1  ) ( resid  7 and name HA2  ) 2.5 0.7 0.7

 assign ( resid  7 and name HA1  ) ( resid  8 and name HN   ) 3.5 1.2 1.2
 assign ( resid  7 and name HA2  ) ( resid  8 and name HN   ) 3.5 1.2 1.2


!ARG 8
 assign ( resid  8 and name HN   ) ( resid  7 and name HA2  ) 2.5 0.7 0.7
 assign ( resid  8 and name HN   ) ( resid  4 and name HG2# ) 4.5 1.6 1.6
 assign ( resid  8 and name HN   ) ( resid 10 and name HD#  ) 4.5 1.6 1.6
 assign ( resid  8 and name HN   ) ( resid 10 and name HG2# ) 4.5 1.6 1.6
 assign ( resid  8 and name HN   ) ( resid  8 and name HG#  ) 3.5 1.2 1.2
 assign ( resid  8 and name HN   ) ( resid  8 and name HB#  ) 3.5 1.2 1.2
 assign ( resid  8 and name HN   ) ( resid  8 and name HD#  ) 4.5 1.6 1.6
 assign ( resid  8 and name HN   ) ( resid  6 and name HB1  ) 5.0 2.0 2.0

 assign ( resid  8 and name HB1  ) ( resid  8 and name HA   ) 3.5 1.2 1.2
 assign ( resid  8 and name HB2  ) ( resid  8 and name HA   ) 3.5 1.2 1.2
 assign ( resid  8 and name HB2  ) ( resid  8 and name HD#  ) 3.5 1.2 1.2

 assign ( resid  8 and name HG1  ) ( resid  8 and name HA   ) 4.5 1.6 1.6
 assign ( resid  8 and name HG2  ) ( resid  8 and name HA   ) 4.5 1.6 1.6
 assign ( resid  8 and name HG1  ) ( resid  8 and name HD#  ) 3.5 1.2 1.2
 assign ( resid  8 and name HG2  ) ( resid  8 and name HD#  ) 3.5 1.2 1.2
 assign ( resid  8 and name HG1  ) ( resid  8 and name HB2  ) 2.5 0.7 0.7
 assign ( resid  8 and name HG2  ) ( resid  8 and name HB2  ) 2.5 0.7 0.7

 assign ( resid  8 and name HD#  ) ( resid  8 and name HA   ) 4.5 1.6 1.6

 assign ( resid  8 and name HE   ) ( resid  5 and name HD#  ) 4.5 1.6 1.6
 assign ( resid  8 and name HE   ) ( resid  8 and name HD#  ) 3.5 1.2 1.2 
 assign ( resid  8 and name HE   ) ( resid  8 and name HB#  ) 4.5 1.6 1.6
 assign ( resid  8 and name HE   ) ( resid  8 and name HG#  ) 4.5 1.6 1.6
 assign ( resid  8 and name HE   ) ( resid 10 and name HG2# ) 4.5 1.6 1.6
 assign ( resid  8 and name HE   ) ( resid 10 and name HD#  ) 4.5 1.6 1.6


!ARG 9
 assign ( resid 9 and name  HN   ) ( resid 10 and name HD#  ) 4.5 1.6 1.6
 assign ( resid 9 and name  HN   ) ( resid 10 and name HG2# ) 3.5 1.2 1.2
 assign ( resid 9 and name  HN   ) ( resid 10 and name HG12 ) 4.5 1.6 1.6

 assign ( resid  9 and name HB#  ) ( resid  9 and name HA   ) 3.5 1.2 1.2
 assign ( resid  9 and name HB#  ) ( resid  9 and name HD#  ) 2.5 0.7 0.7

 assign ( resid  9 and name HG#  ) ( resid  9 and name HD#  ) 2.5 0.7 0.7

 assign ( resid  9 and name HG1  ) ( resid  9 and name HA   ) 4.5 1.6 1.6
 assign ( resid  9 and name HG1  ) ( resid  9 and name HD#  ) 3.5 1.2 1.2
 assign ( resid  9 and name HG1  ) ( resid  9 and name HB2  ) 2.5 0.7 0.7
!assign ( resid  9 and name HG1  ) ( resid  9 and name HB1  ) 2.5 0.7 0.7
!assign ( resid  9 and name HG1  ) ( resid  9 and name HB2  ) 2.5 0.7 0.7

 assign ( resid  9 and name HG2  ) ( resid  9 and name HA   ) 4.5 1.6 1.6
 assign ( resid  9 and name HG2  ) ( resid  9 and name HD#  ) 3.5 1.2 1.2
 assign ( resid  9 and name HG2  ) ( resid  9 and name HB2  ) 2.5 0.7 0.7

 assign ( resid  9 and name HD#  ) ( resid  9 and name HA   ) 4.5 1.6 1.6


!ILE 10
 assign ( resid 10 and name HN   ) ( resid  9 and name HB1  ) 3.5 1.2 1.2
 assign ( resid 10 and name HN   ) ( resid  9 and name HB2  ) 3.5 1.2 1.2
 assign ( resid 10 and name HN   ) ( resid  3 and name HB2  ) 4.5 1.6 1.6
 assign ( resid 10 and name HN   ) ( resid  3 and name HB1  ) 3.5 1.2 1.2
 assign ( resid 10 and name HN   ) ( resid 10 and name HB   ) 3.5 1.2 1.2
 assign ( resid 10 and name HN   ) ( resid  3 and name HG2  ) 4.5 1.6 1.6
 assign ( resid 10 and name HN   ) ( resid 10 and name HG12 ) 3.5 1.2 1.2
 assign ( resid 10 and name HN   ) ( resid 10 and name HG11 ) 4.5 1.6 1.6
 assign ( resid 10 and name HN   ) ( resid 10 and name HG2# ) 3.5 1.2 1.2
 assign ( resid 10 and name HN   ) ( resid 10 and name HD#  ) 3.5 1.2 1.2

 assign ( resid 10 and name HA   ) ( resid 10 and name HB   ) 2.5 0.7 0.7
 assign ( resid 10 and name HA   ) ( resid 10 and name HG2# ) 2.5 0.7 0.7
 assign ( resid 10 and name HA   ) ( resid 10 and name HG1# ) 3.5 1.2 1.2
 assign ( resid 10 and name HA   ) ( resid 10 and name HD#  ) 3.5 1.2 1.2
!assign ( resid 10 and name HA   ) ( resid 12 and name HB   ) 4.5 1.6 1.6
 assign ( resid 10 and name HA   ) ( resid 12 and name HD#  ) 4.5 1.6 1.6
 assign ( resid 10 and name HA   ) ( resid 12 and name HG2# ) 5.0 2.0 2.0

 assign ( resid 10 and name HB   ) ( resid 10 and name HG1# ) 2.5 0.7 0.7
 assign ( resid 10 and name HB   ) ( resid 10 and name HG2# ) 2.5 0.7 0.7
 assign ( resid 10 and name HB   ) ( resid 10 and name HD#  ) 3.5 1.2 1.2

 assign ( resid 10 and name HG1# ) ( resid 10 and name HD#  ) 2.5 0.7 0.7
 assign ( resid 10 and name HG1# ) ( resid 10 and name HG2# ) 2.5 0.7 0.7

 assign ( resid 10 and name HG2# ) ( resid  3 and name HD#  ) 5.0 2.0 2.0
 assign ( resid 10 and name HG2# ) ( resid  4 and name HA   ) 4.5 1.6 1.6
 assign ( resid 10 and name HG2# ) ( resid 10 and name HD#  ) 2.5 0.7 0.7

 assign ( resid 10 and name HD#  ) ( resid  2 and name HA   ) 5.0 2.0 2.0
 assign ( resid 10 and name HD#  ) ( resid  4 and name HA   ) 4.5 1.6 1.6


!NOR 11
 assign ( resid 11 and name HB1  ) ( resid 11 and name HA   ) 2.5 0.7 0.7
 assign ( resid 11 and name HB2  ) ( resid 11 and name HA   ) 2.5 0.7 0.7
 assign ( resid 11 and name HB1  ) ( resid 11 and name HB2  ) 2.5 0.7 0.7
 assign ( resid 11 and name HB1  ) ( resid 11 and name HG2  ) 3.5 1.2 1.2
 assign ( resid 11 and name HB2  ) ( resid 11 and name HG2  ) 3.5 1.2 1.2
 assign ( resid 11 and name HB1  ) ( resid 11 and name HG1  ) 3.5 1.2 1.2
 assign ( resid 11 and name HB2  ) ( resid 11 and name HG1  ) 3.5 1.2 1.2
!assign ( resid 11 and name HB2  ) ( resid 14 and name HA   ) 4.5 1.6 1.5

 assign ( resid 11 and name HG2  ) ( resid 11 and name HG1  ) 2.5 0.7 0.7
 assign ( resid 11 and name HG1  ) ( resid 11 and name HA   ) 4.5 1.6 1.6
 assign ( resid 11 and name HG2  ) ( resid 11 and name HA   ) 4.5 1.6 1.6

 assign ( resid 11 and name HD   ) ( resid 11 and name HB1  ) 4.5 1.6 1.6
 assign ( resid 11 and name HD   ) ( resid 11 and name HB2  ) 4.5 1.6 1.6
 assign ( resid 11 and name HD   ) ( resid 11 and name HG2  ) 3.5 1.2 1.2
 assign ( resid 11 and name HD   ) ( resid 11 and name HG1  ) 4.5 1.6 1.6
 assign ( resid 11 and name HD   ) ( resid  2 and name HB   ) 3.5 1.2 1.2
 assign ( resid 11 and name HD   ) ( resid  2 and name HG## ) 4.5 1.6 1.6

!ILE 12
 assign ( resid 12 and name HN   ) ( resid  2 and name HB   ) 3.5 1.2 1.2
 assign ( resid 12 and name HN   ) ( resid  2 and name HG#  ) 3.5 1.2 1.2
 assign ( resid 12 and name HN   ) ( resid 12 and name HD#  ) 3.5 1.2 1.2
 assign ( resid 12 and name HN   ) ( resid 12 and name HG2# ) 3.5 1.2 1.2
 assign ( resid 12 and name HN   ) ( resid 13 and name HD1  ) 4.5 1.6 1.6
 assign ( resid 12 and name HN   ) ( resid 13 and name HD2  ) 4.5 1.6 1.6
 assign ( resid 12 and name HN   ) ( resid 11 and name HB2  ) 4.5 1.6 1.6
 assign ( resid 12 and name HN   ) ( resid 11 and name HG1  ) 4.5 1.6 1.6
 assign ( resid 12 and name HN   ) ( resid 11 and name HG2  ) 4.5 1.6 1.6

 assign ( resid 12 and name HB   ) ( resid 12 and name HA   ) 2.5 0.7 0.7
 assign ( resid 12 and name HB   ) ( resid 13 and name HD1  ) 4.5 1.6 1.6

 assign ( resid 12 and name HG2# ) ( resid 12 and name HA   ) 2.5 0.7 0.7
 assign ( resid 12 and name HG1# ) ( resid 12 and name HA   ) 3.5 1.2 1.2
 assign ( resid 12 and name HG2# ) ( resid 12 and name HB   ) 2.5 1.0 1.2
 assign ( resid 12 and name HG1# ) ( resid 12 and name HB   ) 3.5 1.2 1.2
!assign ( resid 12 and name HG21 ) ( resid 13 and name HD1  ) 2.5 0.7 0.7
!assign ( resid 12 and name HG21 ) ( resid 13 and name HD2  ) 3.5 1.2 1.2
 assign ( resid 12 and name HG2# ) ( resid 10 and name HG2# ) 4.5 1.6 1.6
 assign ( resid 12 and name HG2# ) ( resid 10 and name HB   ) 5.0 2.0 2.0
 assign ( resid 12 and name HG#  ) ( resid 10 and name HA   ) 5.0 2.0 2.0
 assign ( resid 12 and name HG2# ) ( resid  3 and name HD#  ) 5.0 2.0 2.0

 assign ( resid 12 and name HD#  ) ( resid  2 and name HA   ) 5.0 2.0 2.0
 assign ( resid 12 and name HD#  ) ( resid  3 and name HD#  ) 3.5 1.2 1.2
 assign ( resid 12 and name HD#  ) ( resid 13 and name HD#  ) 3.5 1.2 1.2
 assign ( resid 12 and name HD#  ) ( resid 12 and name HA   ) 4.5 1.6 1.6
 assign ( resid 12 and name HD#  ) ( resid 12 and name HB   ) 3.5 1.2 1.2
 assign ( resid 12 and name HD#  ) ( resid 12 and name HG1# ) 2.5 0.7 0.7
 assign ( resid 12 and name HD#  ) ( resid 12 and name HG2# ) 2.5 0.7 0.7

!D-PRO 13
 assign ( resid 13 and name HA   ) ( resid 13 and name HD1  ) 3.5 1.2 1.2
 assign ( resid 13 and name HA   ) ( resid 13 and name HD2  ) 3.5 1.2 1.2

 assign ( resid 13 and name HB2  ) ( resid 13 and name HB1  ) 2.5 0.7 0.7
 assign ( resid 13 and name HB2  ) ( resid 13 and name HD1  ) 3.5 1.2 1.2
 assign ( resid 13 and name HB2  ) ( resid 13 and name HD2  ) 3.5 1.2 1.2
 assign ( resid 13 and name HB1  ) ( resid 13 and name HD1  ) 4.5 1.6 1.6
 assign ( resid 13 and name HB1  ) ( resid 13 and name HD2  ) 5.0 2.0 2.0

 assign ( resid 13 and name HG1  ) ( resid 13 and name HD1  ) 3.5 1.2 1.2
 assign ( resid 13 and name HG1  ) ( resid 13 and name HD2  ) 2.5 0.7 0.7
 assign ( resid 13 and name HG2  ) ( resid 13 and name HD2  ) 2.5 0.7 0.7
 assign ( resid 13 and name HG2  ) ( resid 13 and name HD1  ) 2.5 0.7 0.7

!PRO 14
 assign ( resid 14 and name HA   ) ( resid  1 and name HN   ) 3.5 1.2 1.2

 assign ( resid 14 and name HB2  ) ( resid  1 and name HA   ) 4.5 1.6 1.6
 assign ( resid 14 and name HB1  ) ( resid  1 and name HA   ) 4.5 1.6 1.6
 assign ( resid 14 and name HB2  ) ( resid 14 and name HD2  ) 3.2 1.2 1.2
 assign ( resid 14 and name HB1  ) ( resid 14 and name HD2  ) 4.5 1.6 1.6
 assign ( resid 14 and name HB2  ) ( resid 14 and name HD1  ) 4.5 1.6 1.6

 assign ( resid 14 and name HG1  ) ( resid 14 and name HD2  ) 3.5 1.2 1.2
 assign ( resid 14 and name HG1  ) ( resid 14 and name HD1  ) 2.5 0.7 0.7
 assign ( resid 14 and name HG2  ) ( resid 14 and name HD2  ) 2.5 0.7 0.7

 assign ( resid 14 and name HD2  ) ( resid 14 and name HD1  ) 2.5 0.7 0.7

# Restraints file 3: rna_noesy_mds_081116.tbl
!-------------------------------------------------------------------------!
!RNA NOE Table for HIV TAR bound to JB181 peptide !
!Updated 073016 mds
!RNA,   29mer GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
!JB181, 14mer DAB VAL ARG THR ARG LYS GLY ARG ARG ILE NOR ILE DPR PRO
!DAB= L-Diamino Butyric Acid
!NOR= L-2-Amino-4-guanidinobutyric acid
!DPR= D-Proline

!! NOE binning !!
!strong     2.5 0.7 0.7
!medium     3.5 1.2 1.2
!weak       4.5 1.6 1.6
!very weak  5.0 2.0 2.0

!------------------------------------------------------------------------! 

!!*** H2O NOESY ***!!
!******************************************!
!! STEM REGIONS G17-A22, G26-C29, G36-C45 !!
!******************************************!
!G17
 assign ( resid 17 and name H1   ) ( resid 18 and name H1  ) 4.5 1.6 1.6
 assign ( resid 45 and name H41  ) ( resid 17 and name H1  ) 4.5 1.6 1.6
 assign ( resid 45 and name H42  ) ( resid 17 and name H1  ) 4.5 1.6 1.6

!G18
 assign ( resid 18 and name H1   ) ( resid 43 and name H1  ) 4.5 1.6 1.6
 assign ( resid 18 and name H1   ) ( resid 18 and name H1' ) 4.5 1.6 1.6
 assign ( resid 18 and name H1   ) ( resid 18 and name H21 ) 3.5 1.6 1.6
 assign ( resid 18 and name H1   ) ( resid 18 and name H22 ) 3.5 1.6 1.6
 assign ( resid 19 and name H1'  ) ( resid 18 and name H1  ) 3.5 1.6 1.6
 assign ( resid 44 and name H42  ) ( resid 18 and name H1  ) 3.5 1.2 1.2
 assign ( resid 44 and name H41  ) ( resid 18 and name H1  ) 2.5 0.7 0.7
 assign ( resid 45 and name H1'  ) ( resid 18 and name H1  ) 3.5 1.6 1.6
 assign ( resid 45 and name H5   ) ( resid 18 and name H1  ) 4.5 1.6 1.6

!A22
 assign ( resid 22 and name H2   ) ( resid 41 and name H6  ) 4.5 1.6 1.6
 assign ( resid 22 and name H2   ) ( resid 22 and name H61 ) 4.5 1.6 1.6

!G21
 assign ( resid 21 and name H1   ) ( resid 20 and name H2  ) 3.5 1.2 1.2
 assign ( resid 21 and name H1   ) ( resid 22 and name H2  ) 3.5 1.2 1.2
 assign ( resid 21 and name H1   ) ( resid 42 and name H3  ) 3.5 1.2 1.2
 assign ( resid 21 and name H21  ) ( resid 21 and name H1  ) 3.5 1.2 1.2
 assign ( resid 21 and name H22  ) ( resid 21 and name H1  ) 3.5 1.2 1.2
 assign ( resid 22 and name H2   ) ( resid 21 and name H1  ) 3.5 1.2 1.2
 assign ( resid 22 and name H1'  ) ( resid 21 and name H1  ) 3.5 1.2 1.2
 assign ( resid 20 and name H2   ) ( resid 21 and name H1  ) 4.5 1.6 1.6
 assign ( resid 40 and name H3   ) ( resid 21 and name H1  ) 4.5 1.6 1.6
! assign ( resid 40 and name H5   ) ( resid 21 and name H1  ) 4.5 1.6 1.6
 assign ( resid 41 and name H5   ) ( resid 21 and name H1  ) 4.5 1.6 1.6
 assign ( resid 41 and name H42  ) ( resid 21 and name H1  ) 3.5 1.2 1.2
 assign ( resid 41 and name H41  ) ( resid 21 and name H1  ) 2.5 0.7 0.7

!C24

!U25

!G26
 assign ( resid 22 and name H2   ) ( resid 26 and name H1  ) 4.5 1.6 1.6
 assign ( resid 23 and name H5   ) ( resid 26 and name H1  ) 4.5 1.6 1.6
 assign ( resid 26 and name H1   ) ( resid 26 and name H21 ) 3.5 1.2 1.2
 assign ( resid 26 and name H1   ) ( resid 26 and name H22 ) 3.5 1.2 1.2
 assign ( resid 27 and name H2   ) ( resid 26 and name H1  ) 4.5 1.6 1.6
 assign ( resid 27 and name H1'  ) ( resid 26 and name H1  ) 3.5 1.2 1.2
 assign ( resid 38 and name H3   ) ( resid 26 and name H1  ) 4.5 1.6 1.6
! assign ( resid 38 and name H5   ) ( resid 26 and name H1  ) 4.5 1.6 1.6
 assign ( resid 39 and name H6   ) ( resid 26 and name H1  ) 4.5 1.6 1.6
 assign ( resid 39 and name H42  ) ( resid 26 and name H1  ) 3.5 1.2 1.2
 assign ( resid 39 and name H41  ) ( resid 26 and name H1  ) 2.5 0.7 0.7
 assign ( resid 40 and name H3   ) ( resid 26 and name H1  ) 3.5 1.2 1.2
 assign ( resid 40 and name H1'  ) ( resid 26 and name H1  ) 3.5 1.2 1.2
 assign ( resid 40 and name H5   ) ( resid 26 and name H1  ) 4.5 1.6 1.6

!A27
 assign ( resid 27 and name H2'  ) ( resid 27 and name H1' ) 3.5 1.2 1.2
 assign ( resid 27 and name H2'  ) ( resid 27 and name H2'') 3.5 1.2 1.2
 assign ( resid 27 and name H2'  ) ( resid 28 and name H8  ) 3.5 1.2 1.2
 assign ( resid 27 and name H2'  ) ( resid 28 and name H4' ) 4.5 1.2 1.2
 assign ( resid 28 and name H8   ) ( resid 27 and name H62 ) 4.5 1.2 1.2

!G28
! assign ( resid 23 and name H5   ) ( resid 28 and name H1  ) 4.5 1.6 1.6
 assign ( resid 27 and name H61  ) ( resid 28 and name H1  ) 4.5 1.6 1.6
 assign ( resid 28 and name H21  ) ( resid 28 and name H1  ) 3.5 1.2 1.2
 assign ( resid 28 and name H22  ) ( resid 28 and name H1  ) 3.5 1.2 1.2
 assign ( resid 29 and name H42  ) ( resid 28 and name H1  ) 4.5 1.6 1.6
 assign ( resid 29 and name H41  ) ( resid 28 and name H1  ) 3.5 1.2 1.2
 assign ( resid 29 and name H42  ) ( resid 28 and name H8  ) 4.5 1.6 1.6
 assign ( resid 29 and name H1'  ) ( resid 28 and name H1  ) 3.5 1.2 1.2
 assign ( resid 28 and name H1   ) ( resid 36 and name H1  ) 3.5 1.2 1.2
 assign ( resid 28 and name H1   ) ( resid 27 and name H2  ) 3.5 1.2 1.2
 assign ( resid 28 and name H1   ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 28 and name H1   ) ( resid 28 and name H1' ) 4.5 1.6 1.6
 assign ( resid 37 and name H41  ) ( resid 28 and name H1  ) 3.5 1.2 1.2
 assign ( resid 37 and name H42  ) ( resid 28 and name H1  ) 4.5 1.6 1.6
 assign ( resid 37 and name H5   ) ( resid 28 and name H1  ) 4.5 1.6 1.6
 assign ( resid 38 and name H1'  ) ( resid 28 and name H1  ) 3.5 1.2 1.2

!C29
 assign ( resid 29 and name H41  ) ( resid 29 and name H42 ) 2.5 0.7 0.7
 assign ( resid 29 and name H41  ) ( resid 29 and name H5  ) 3.5 1.2 1.2
 assign ( resid 29 and name H42  ) ( resid 29 and name H5  ) 3.5 1.2 1.2
 assign ( resid 29 and name H41  ) ( resid 37 and name H41 ) 4.5 1.6 1.6
 assign ( resid 29 and name H42  ) ( resid 37 and name H41 ) 4.5 1.6 1.6
! assign ( resid 29 and name H42  ) ( resid 38 and name H6  ) 4.5 1.6 1.6
! assign ( resid 29 and name H6   ) ( resid 37 and name H42 ) 4.5 1.6 1.6

!G36
 assign ( resid 29 and name H1'  ) ( resid 36 and name H1  ) 4.5 1.6 1.6
 assign ( resid 29 and name H41  ) ( resid 36 and name H1  ) 3.5 1.2 1.2
 assign ( resid 30 and name H1'  ) ( resid 36 and name H1  ) 3.5 1.2 1.2
 assign ( resid 29 and name H42  ) ( resid 36 and name H1  ) 4.5 1.6 1.6
! assign ( resid 23 and name H5   ) ( resid 36 and name H1  ) 4.5 1.6 1.6
 assign ( resid 36 and name H21  ) ( resid 36 and name H1  ) 3.5 1.2 1.2
 assign ( resid 36 and name H22  ) ( resid 36 and name H1  ) 3.5 1.2 1.2
 assign ( resid 37 and name H1'  ) ( resid 36 and name H1  ) 3.5 1.6 1.6
 assign ( resid 37 and name H41  ) ( resid 36 and name H1  ) 4.5 1.6 1.6
 assign ( resid 37 and name H42  ) ( resid 36 and name H1  ) 4.5 1.6 1.6

!C39
 assign ( resid 39 and name H41  ) ( resid 39 and name H6  ) 4.5 1.6 1.6
 assign ( resid 39 and name H42  ) ( resid 39 and name H6  ) 3.5 1.2 1.2

!U40
 assign ( resid 22 and name H2   ) ( resid 40 and name H3  ) 2.5 0.7 0.7
 assign ( resid 22 and name H61  ) ( resid 40 and name H3  ) 3.5 1.2 1.2
 assign ( resid 22 and name H62  ) ( resid 40 and name H3  ) 3.5 1.2 1.2
 assign ( resid 39 and name H41  ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 39 and name H42  ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 41 and name H41  ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 41 and name H42  ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 41 and name H5   ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 41 and name H1'  ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 40 and name H1'  ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 40 and name H5   ) ( resid 40 and name H3  ) 4.5 1.6 1.6
 assign ( resid 39 and name H5   ) ( resid 40 and name H3  ) 4.5 1.6 1.6

!U42
 assign ( resid 20 and name H2   ) ( resid 42 and name H3  ) 2.5 0.7 0.7
 assign ( resid 20 and name H1'  ) ( resid 42 and name H3  ) 4.5 1.6 1.6
 assign ( resid 20 and name H61  ) ( resid 42 and name H3  ) 3.5 1.2 1.2
 assign ( resid 20 and name H62  ) ( resid 42 and name H3  ) 3.5 1.2 1.2
 assign ( resid 21 and name H21  ) ( resid 42 and name H3  ) 4.5 1.6 1.6
 assign ( resid 21 and name H1'  ) ( resid 42 and name H3  ) 4.5 1.6 1.6
 assign ( resid 41 and name H41  ) ( resid 42 and name H3  ) 4.5 1.6 1.6
 assign ( resid 41 and name H42  ) ( resid 42 and name H3  ) 4.5 1.6 1.6
 assign ( resid 41 and name H5   ) ( resid 42 and name H3  ) 4.5 1.6 1.6
 assign ( resid 42 and name H3   ) ( resid 43 and name H1  ) 4.5 1.6 1.6
 assign ( resid 43 and name H1'  ) ( resid 42 and name H3  ) 4.5 1.6 1.6
 
!G43
 assign ( resid 19 and name H42  ) ( resid 43 and name H1  ) 3.5 1.2 1.2
 assign ( resid 19 and name H41  ) ( resid 43 and name H1  ) 2.5 0.7 0.7
 assign ( resid 43 and name H21  ) ( resid 43 and name H1  ) 3.5 1.2 1.2
 assign ( resid 43 and name H22  ) ( resid 43 and name H1  ) 3.5 1.2 1.2
 assign ( resid 44 and name H41  ) ( resid 43 and name H1  ) 4.5 1.6 1.6
 assign ( resid 44 and name H42  ) ( resid 43 and name H1  ) 4.5 1.6 1.6

!*****************************!
! BASE Triple -U23-A27-U28-   !
!*****************************!
!U23
 assign ( resid 23 and name H3   ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 23 and name H3   ) ( resid 25 and name H5  ) 4.5 1.6 1.6
 assign ( resid 23 and name H3   ) ( resid 26 and name H1  ) 4.5 1.2 1.2
 assign ( resid 23 and name H3   ) ( resid 27 and name H8  ) 2.5 0.7 0.7
 assign ( resid 23 and name H3   ) ( resid 27 and name H1' ) 4.5 1.6 1.6
 assign ( resid 23 and name H3   ) ( resid 27 and name H8  ) 2.5 0.7 0.7
 assign ( resid 23 and name H3   ) ( resid 27 and name H62 ) 3.5 1.2 1.2 
 assign ( resid 23 and name H3   ) ( resid 27 and name H61 ) 3.5 1.2 1.2
 assign ( resid 23 and name H3   ) ( resid 29 and name H42 ) 4.5 1.6 1.6
 assign ( resid 23 and name H3   ) ( resid 37 and name H41 ) 4.5 1.6 1.6
 assign ( resid 23 and name H3   ) ( resid 37 and name H42 ) 4.5 1.6 1.6
 assign ( resid 23 and name H3   ) ( resid 39 and name H41 ) 4.5 1.6 1.6
 assign ( resid 23 and name H3   ) ( resid 39 and name H42 ) 4.5 1.6 1.6

!U38
 assign ( resid 27 and name H2   ) ( resid 38 and name H3  ) 2.5 0.7 0.7
 assign ( resid 27 and name H62  ) ( resid 38 and name H3  ) 3.5 1.2 1.2
 assign ( resid 27 and name H61  ) ( resid 38 and name H3  ) 3.5 1.2 1.2
 assign ( resid 27 and name H1'  ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 37 and name H42  ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 37 and name H41  ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 38 and name H5   ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 38 and name H6   ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 38 and name H1'  ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 39 and name H42  ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 39 and name H41  ) ( resid 38 and name H3  ) 4.5 1.6 1.6
 assign ( resid 39 and name H6   ) ( resid 38 and name H3  ) 4.5 1.6 1.6

!***********************!
!!Terminal Loop C30-A35!!
!***********************!
!! Iminios missing/exchange !!
!C30
!U31
!G32
!G33

!G34
! found imino peak in 1D 1H maybe G17?


!!-----------------------------------------------------------------------!!
!!*** D2O NOESY ***!!
!!-----------------------------------------------------------------------!!

!!Helical stems!!

!*******************!
!   Sugar to Base   !
!*******************!
!H1' to H2
 assign ( resid 20 and name H1'  ) ( resid 20 and name H2  ) 4.5 1.6 1.6
 assign ( resid 21 and name H1'  ) ( resid 20 and name H2  ) 3.5 1.2 1.2
 assign ( resid 43 and name H1'  ) ( resid 20 and name H2  ) 3.5 1.2 1.2

 assign ( resid 22 and name H1'  ) ( resid 22 and name H2  ) 4.5 1.6 1.6
 assign ( resid 26 and name H1'  ) ( resid 22 and name H2  ) 4.5 1.6 1.6
 assign ( resid 41 and name H1'  ) ( resid 22 and name H2  ) 3.5 1.2 1.2

 assign ( resid 27 and name H1'  ) ( resid 27 and name H2  ) 4.5 1.6 1.6
 assign ( resid 28 and name H1'  ) ( resid 27 and name H2  ) 3.5 1.2 1.2
 assign ( resid 39 and name H1'  ) ( resid 27 and name H2  ) 3.5 1.2 1.2

!H1' to H5
 assign ( resid 18 and name H1'  ) ( resid 19 and name H5  ) 4.5 1.6 1.6
 assign ( resid 19 and name H1'  ) ( resid 19 and name H5  ) 5.0 3.2 2.0

 assign ( resid 36 and name H1'  ) ( resid 37 and name H5  ) 4.5 1.6 1.6
 assign ( resid 37 and name H1'  ) ( resid 37 and name H5  ) 5.0 3.2 2.0
 assign ( resid 39 and name H1'  ) ( resid 39 and name H5  ) 4.5 1.6 1.6
 assign ( resid 43 and name H1'  ) ( resid 44 and name H5  ) 4.5 1.6 1.6


!H1' to H6/8 walk
 assign ( resid 17 and name H1'  ) ( resid 17 and name H8  ) 3.5 1.2 1.2
 assign ( resid 17 and name H1'  ) ( resid 18 and name H8  ) 4.5 1.6 1.6
 assign ( resid 18 and name H1'  ) ( resid 18 and name H8  ) 3.5 1.2 1.2
 assign ( resid 18 and name H1'  ) ( resid 19 and name H6  ) 4.5 1.6 1.6
 assign ( resid 19 and name H1'  ) ( resid 19 and name H6  ) 3.5 1.2 1.2
 assign ( resid 19 and name H1'  ) ( resid 20 and name H8  ) 4.5 1.6 1.6
 assign ( resid 20 and name H1'  ) ( resid 20 and name H8  ) 3.5 1.2 1.2
 assign ( resid 20 and name H1'  ) ( resid 21 and name H8  ) 4.5 1.6 1.6
 assign ( resid 21 and name H1'  ) ( resid 21 and name H8  ) 3.5 1.2 1.2
 assign ( resid 21 and name H1'  ) ( resid 22 and name H8  ) 4.5 1.6 1.6
 assign ( resid 22 and name H1'  ) ( resid 22 and name H8  ) 3.5 1.2 1.2
 assign ( resid 22 and name H1'  ) ( resid 26 and name H8  ) 3.5 1.2 1.2

 assign ( resid 26 and name H1'  ) ( resid 26 and name H8  ) 3.5 1.2 1.2
 assign ( resid 26 and name H1'  ) ( resid 27 and name H8  ) 4.5 1.6 1.6
 assign ( resid 27 and name H1'  ) ( resid 27 and name H8  ) 3.5 1.2 1.2
 assign ( resid 27 and name H1'  ) ( resid 28 and name H8  ) 3.5 1.2 1.2
 assign ( resid 28 and name H1'  ) ( resid 28 and name H8  ) 3.5 1.2 1.2
 assign ( resid 28 and name H1'  ) ( resid 29 and name H6  ) 4.5 1.6 1.6
 assign ( resid 29 and name H1'  ) ( resid 29 and name H6  ) 3.5 1.2 1.2

 assign ( resid 36 and name H1'  ) ( resid 36 and name H8  ) 3.5 1.2 1.2
 assign ( resid 36 and name H1'  ) ( resid 37 and name H6  ) 4.5 1.6 1.6
 assign ( resid 37 and name H1'  ) ( resid 37 and name H6  ) 3.5 1.2 1.2
 assign ( resid 37 and name H1'  ) ( resid 38 and name H6  ) 4.5 1.6 1.6
 assign ( resid 38 and name H1'  ) ( resid 38 and name H6  ) 3.5 1.2 1.2
 assign ( resid 38 and name H1'  ) ( resid 39 and name H6  ) 4.5 1.6 1.6
 assign ( resid 39 and name H1'  ) ( resid 39 and name H6  ) 3.5 1.2 1.2
 assign ( resid 39 and name H1'  ) ( resid 40 and name H6  ) 4.5 1.6 1.6
 assign ( resid 40 and name H1'  ) ( resid 40 and name H6  ) 3.5 1.2 1.2
 assign ( resid 40 and name H1'  ) ( resid 41 and name H6  ) 4.5 1.6 1.6
 assign ( resid 41 and name H1'  ) ( resid 41 and name H6  ) 3.5 1.2 1.2
 assign ( resid 41 and name H1'  ) ( resid 42 and name H6  ) 4.5 1.6 1.6
 assign ( resid 42 and name H1'  ) ( resid 42 and name H6  ) 3.5 1.2 1.2 
 assign ( resid 42 and name H1'  ) ( resid 43 and name H8  ) 4.5 1.6 1.6
 assign ( resid 43 and name H1'  ) ( resid 43 and name H8  ) 3.5 1.2 1.2
 assign ( resid 43 and name H1'  ) ( resid 44 and name H6  ) 4.5 1.6 1.6
 assign ( resid 44 and name H1'  ) ( resid 44 and name H6  ) 3.5 1.2 1.2 
 assign ( resid 44 and name H1'  ) ( resid 45 and name H6  ) 4.5 1.6 1.6
 assign ( resid 45 and name H1'  ) ( resid 45 and name H6  ) 3.5 1.2 1.2

!H2' to H2/H5
 assign ( resid 18 and name H2'' ) ( resid 19 and name H5  ) 3.5 1.2 1.2
 assign ( resid 19 and name H2'' ) ( resid 19 and name H5  ) 5.0 3.2 2.0
 assign ( resid 20 and name H2'' ) ( resid 20 and name H2  ) 4.5 1.6 1.6
 assign ( resid 29 and name H2'' ) ( resid 29 and name H5  ) 5.0 3.2 2.0

 assign ( resid 36 and name H2'' ) ( resid 37 and name H5  ) 4.6 1.6 1.6
 assign ( resid 37 and name H2'' ) ( resid 38 and name H5  ) 3.5 1.2 1.2
 assign ( resid 39 and name H2'' ) ( resid 40 and name H5  ) 3.5 1.2 1.2
 assign ( resid 40 and name H2'' ) ( resid 41 and name H5  ) 3.5 1.2 1.2
 assign ( resid 41 and name H2'' ) ( resid 41 and name H5  ) 5.0 2.0 2.0
 assign ( resid 41 and name H2'' ) ( resid 42 and name H5  ) 3.5 1.2 1.2
 assign ( resid 43 and name H2'' ) ( resid 44 and name H5  ) 3.5 1.2 1.2
 assign ( resid 44 and name H2'' ) ( resid 45 and name H5  ) 3.5 1.2 1.2
 assign ( resid 45 and name H2'' ) ( resid 45 and name H5  ) 5.0 1.0 1.0

!H2' H6/H8
 assign ( resid 17 and name H2'' ) ( resid 17 and name H8  ) 3.5 1.2 1.2
 assign ( resid 17 and name H2'' ) ( resid 18 and name H8  ) 2.5 0.7 0.7
 assign ( resid 18 and name H2'' ) ( resid 18 and name H8  ) 4.5 1.6 1.6
 assign ( resid 18 and name H2'' ) ( resid 19 and name H6  ) 2.5 0.7 0.7
 assign ( resid 19 and name H2'' ) ( resid 20 and name H8  ) 2.5 0.7 0.7
 assign ( resid 20 and name H2'' ) ( resid 20 and name H8  ) 4.5 1.6 1.6
 assign ( resid 20 and name H2'' ) ( resid 21 and name H8  ) 2.5 0.7 0.7
 assign ( resid 21 and name H2'' ) ( resid 21 and name H8  ) 4.5 1.6 1.6
 assign ( resid 21 and name H2'' ) ( resid 22 and name H8  ) 2.5 0.7 0.7
 assign ( resid 22 and name H2'' ) ( resid 22 and name H8  ) 4.5 1.6 1.6

 assign ( resid 26 and name H2'' ) ( resid 26 and name H8  ) 4.5 1.6 1.6
 assign ( resid 26 and name H2'' ) ( resid 27 and name H8  ) 2.5 0.7 0.7
 assign ( resid 27 and name H2'' ) ( resid 27 and name H8  ) 5.0 3.2 2.0
 assign ( resid 27 and name H2'' ) ( resid 28 and name H8  ) 2.5 0.7 0.7
 assign ( resid 28 and name H2'' ) ( resid 28 and name H8  ) 5.0 3.2 2.0
 assign ( resid 28 and name H2'' ) ( resid 29 and name H6  ) 2.5 0.7 0.7

 assign ( resid 36 and name H2'' ) ( resid 37 and name H6  ) 3.5 1.6 1.6
 assign ( resid 37 and name H2'' ) ( resid 38 and name H6  ) 2.5 0.7 0.7
 assign ( resid 38 and name H2'' ) ( resid 39 and name H6  ) 2.5 0.7 0.7
 assign ( resid 39 and name H2'' ) ( resid 39 and name H6  ) 3.5 1.2 1.2
 assign ( resid 39 and name H2'' ) ( resid 40 and name H6  ) 2.5 0.7 0.7
 assign ( resid 40 and name H2'' ) ( resid 40 and name H6  ) 4.5 1.6 1.6
 assign ( resid 40 and name H2'' ) ( resid 41 and name H6  ) 2.5 0.7 0.7
 assign ( resid 41 and name H2'' ) ( resid 41 and name H6  ) 4.5 1.6 1.6
 assign ( resid 41 and name H2'' ) ( resid 42 and name H6  ) 2.5 0.7 0.7
 assign ( resid 42 and name H2'' ) ( resid 42 and name H6  ) 4.5 1.6 1.6
 assign ( resid 43 and name H2'' ) ( resid 43 and name H8  ) 5.0 2.0 2.0
 assign ( resid 43 and name H2'' ) ( resid 44 and name H6  ) 2.5 0.7 0.7
 assign ( resid 44 and name H2'' ) ( resid 45 and name H6  ) 2.5 0.7 0.7
 assign ( resid 45 and name H2'' ) ( resid 45 and name H6  ) 2.5 1.0 1.0

! H3' to H5/H2
 assign ( resid 18 and name H3'  ) ( resid 19 and name H5  ) 3.5 1.2 1.2
 assign ( resid 19 and name H3'  ) ( resid 19 and name H5  ) 4.5 1.6 1.6


 assign ( resid 36 and name H3'  ) ( resid 37 and name H5  ) 4.5 1.6 1.6
 assign ( resid 37 and name H3'  ) ( resid 37 and name H5  ) 4.5 1.6 1.6
 assign ( resid 39 and name H3'  ) ( resid 39 and name H5  ) 4.5 1.6 1.6
 assign ( resid 39 and name H3'  ) ( resid 40 and name H5  ) 3.5 1.2 1.2
 assign ( resid 40 and name H3'  ) ( resid 41 and name H5  ) 3.5 1.2 1.2 
 assign ( resid 41 and name H3'  ) ( resid 42 and name H5  ) 4.5 1.6 1.6
 assign ( resid 42 and name H3'  ) ( resid 42 and name H5  ) 5.0 2.0 2.0
 assign ( resid 43 and name H3'  ) ( resid 44 and name H5  ) 3.5 1.2 1.2

! H3' to H6/H8
 assign ( resid 17 and name H3'  ) ( resid 17 and name H8  ) 3.5 1.2 1.2
 assign ( resid 17 and name H3'  ) ( resid 18 and name H8  ) 3.5 1.2 1.2
 assign ( resid 19 and name H3'  ) ( resid 19 and name H6  ) 4.5 1.6 1.6
 assign ( resid 19 and name H3'  ) ( resid 20 and name H8  ) 3.5 1.2 1.2
 assign ( resid 20 and name H3'  ) ( resid 20 and name H8  ) 3.5 1.2 1.2
 assign ( resid 20 and name H3'  ) ( resid 21 and name H8  ) 3.5 1.2 1.2
 assign ( resid 21 and name H3'  ) ( resid 21 and name H8  ) 3.5 1.2 1.2
 assign ( resid 21 and name H3'  ) ( resid 22 and name H8  ) 3.5 1.2 1.2
 assign ( resid 22 and name H3'  ) ( resid 22 and name H8  ) 3.5 1.2 1.2
 assign ( resid 22 and name H3'  ) ( resid 26 and name H8  ) 5.0 3.2 2.0

 assign ( resid 26 and name H3'  ) ( resid 26 and name H8  ) 3.5 1.2 1.2
 assign ( resid 26 and name H3'  ) ( resid 27 and name H8  ) 3.5 1.2 1.2
 assign ( resid 27 and name H3'  ) ( resid 27 and name H8  ) 5.0 3.2 2.0
 assign ( resid 28 and name H3'  ) ( resid 28 and name H8  ) 4.5 1.6 1.6
 assign ( resid 28 and name H3'  ) ( resid 29 and name H6  ) 4.5 1.6 1.6

 assign ( resid 37 and name H3'  ) ( resid 37 and name H6  ) 3.5 1.2 1.2
 assign ( resid 37 and name H3'  ) ( resid 38 and name H6  ) 3.5 1.2 1.2
 assign ( resid 38 and name H3'  ) ( resid 39 and name H6  ) 3.5 1.2 1.2
 assign ( resid 39 and name H3'  ) ( resid 39 and name H6  ) 3.5 1.2 1.2
 assign ( resid 39 and name H3'  ) ( resid 40 and name H6  ) 3.5 1.2 1.2
 assign ( resid 41 and name H3'  ) ( resid 42 and name H6  ) 4.5 1.6 1.6
 assign ( resid 42 and name H3'  ) ( resid 42 and name H6  ) 3.5 1.2 1.2
 assign ( resid 42 and name H3'  ) ( resid 43 and name H8  ) 3.5 1.2 1.2
 assign ( resid 43 and name H3'  ) ( resid 43 and name H8  ) 3.5 1.2 1.2
 assign ( resid 44 and name H3'  ) ( resid 44 and name H6  ) 3.5 1.2 1.2
 assign ( resid 45 and name H3'  ) ( resid 45 and name H6  ) 3.5 1.2 1.2

! H4' to H2

! H4' to H5
! assign ( resid 29 and name H4'  ) ( resid 29 and name H5  ) 5.0 3.2 2.0

! H4' to H6/H8
 assign ( resid 17 and name H4'  ) ( resid 17 and name H8  ) 4.5 1.6 1.6
 assign ( resid 19 and name H4'  ) ( resid 19 and name H6  ) 4.5 1.6 1.6
 assign ( resid 22 and name H4'  ) ( resid 22 and name H8  ) 4.5 2.7 1.0
 assign ( resid 22 and name H4'  ) ( resid 26 and name H8  ) 5.0 3.2 2.0

 assign ( resid 29 and name H4'  ) ( resid 29 and name H6  ) 5.0 3.2 2.0

 assign ( resid 37 and name H4'  ) ( resid 37 and name H6  ) 4.5 1.6 1.6
 assign ( resid 38 and name H4'  ) ( resid 38 and name H6  ) 3.5 1.2 1.2
 assign ( resid 39 and name H4'  ) ( resid 39 and name H6  ) 4.5 1.6 1.6
 assign ( resid 40 and name H4'  ) ( resid 40 and name H6  ) 5.0 3.2 2.0
 assign ( resid 42 and name H4'  ) ( resid 42 and name H6  ) 4.5 1.6 1.6
 assign ( resid 43 and name H4'  ) ( resid 43 and name H8  ) 3.5 1.2 1.2
 assign ( resid 44 and name H4'  ) ( resid 44 and name H6  ) 5.0 2.0 2.0
 assign ( resid 45 and name H4'  ) ( resid 45 and name H6  ) 4.5 1.6 1.6

! H5'/5'' to H2

! H5'/5'' to H5
! assign ( resid 39 and name H5'' ) ( resid 39 and name H5 ) 5.0 2.0 2.0
 assign ( resid 39 and name H5'' ) ( resid 40 and name H5  ) 5.0 2.0 2.0
 assign ( resid 45 and name H5'' ) ( resid 45 and name H5  ) 5.0 2.0 2.0
 assign ( resid 45 and name H5'  ) ( resid 45 and name H5  ) 5.0 2.0 2.0

! H5'/5'' to H6/H8
 assign ( resid 17 and name H5'  ) ( resid 17 and name H8  ) 4.5 1.6 1.6
 assign ( resid 17 and name H5'' ) ( resid 17 and name H8  ) 4.5 1.6 1.6
 assign ( resid 19 and name H5'  ) ( resid 19 and name H6  ) 4.5 1.6 1.6
 assign ( resid 20 and name H5'  ) ( resid 20 and name H8  ) 5.0 2.0 2.0
 assign ( resid 20 and name H5'' ) ( resid 20 and name H8  ) 5.0 2.0 2.0
 assign ( resid 21 and name H5'' ) ( resid 21 and name H8  ) 3.5 1.2 1.2

 assign ( resid 27 and name H5'  ) ( resid 27 and name H8  ) 4.5 1.6 1.6
 assign ( resid 27 and name H5'' ) ( resid 27 and name H8  ) 4.5 1.6 1.6
 assign ( resid 29 and name H5'  ) ( resid 29 and name H6  ) 4.5 1.6 1.6

 assign ( resid 38 and name H5'' ) ( resid 38 and name H6  ) 5.0 3.2 2.0
 assign ( resid 39 and name H5'  ) ( resid 39 and name H6  ) 3.5 1.2 1.2
 assign ( resid 39 and name H5'' ) ( resid 39 and name H6  ) 4.5 1.6 1.6
 assign ( resid 41 and name H5'  ) ( resid 41 and name H6  ) 5.0 2.0 2.0
 assign ( resid 41 and name H5'' ) ( resid 41 and name H6  ) 5.0 2.0 2.0
 assign ( resid 43 and name H5'  ) ( resid 43 and name H8  ) 5.0 2.0 2.0
 assign ( resid 44 and name H5'  ) ( resid 44 and name H6  ) 5.0 2.0 2.0
 assign ( resid 45 and name H5'  ) ( resid 45 and name H6  ) 5.0 2.0 2.0

!******************!
!   Base to Base   !
!******************!
!H5 to H5 
 assign ( resid 39 and name H5   ) ( resid 40 and name H5  ) 4.5 1.6 1.6

!H5 to H6
 assign ( resid 19 and name H5   ) ( resid 19 and name H6  ) 2.5 0.7 0.7

 assign ( resid 29 and name H5   ) ( resid 29 and name H6  ) 2.5 0.7 0.7

 assign ( resid 37 and name H5   ) ( resid 37 and name H6  ) 2.5 0.7 0.7
 assign ( resid 38 and name H5   ) ( resid 38 and name H6  ) 2.5 0.7 0.7
 assign ( resid 39 and name H5   ) ( resid 39 and name H6  ) 2.5 0.7 0.7
 assign ( resid 40 and name H5   ) ( resid 40 and name H6  ) 2.5 0.7 0.7
 assign ( resid 41 and name H5   ) ( resid 41 and name H6  ) 2.5 0.7 0.7
 assign ( resid 42 and name H5   ) ( resid 42 and name H6  ) 2.5 0.7 0.7
 assign ( resid 44 and name H5   ) ( resid 44 and name H6  ) 2.5 0.7 0.7
 assign ( resid 45 and name H5   ) ( resid 45 and name H6  ) 2.5 0.7 0.7

!H5 to H6/H8
 assign ( resid 19 and name H5   ) ( resid 20 and name H8  ) 4.5 1.6 1.6

 assign ( resid 28 and name H8   ) ( resid 29 and name H5  ) 5.0 2.0 2.0
 assign ( resid 29 and name H6   ) ( resid 30 and name H5  ) 4.5 1.6 1.6

 assign ( resid 36 and name H8   ) ( resid 37 and name H5  ) 4.5 1.6 1.6
 assign ( resid 39 and name H6   ) ( resid 40 and name H5  ) 4.5 1.6 1.6
 assign ( resid 40 and name H6   ) ( resid 41 and name H5  ) 4.5 1.6 1.6
 assign ( resid 41 and name H6   ) ( resid 42 and name H5  ) 4.5 1.6 1.6
 assign ( resid 43 and name H8   ) ( resid 42 and name H5  ) 4.5 1.6 1.6

!H6/8 to H6/H8  
 assign ( resid 17 and name H8   ) ( resid 18 and name H8  ) 4.5 1.6 1.6
 assign ( resid 19 and name H6   ) ( resid 20 and name H8  ) 4.5 1.6 1.6
 assign ( resid 20 and name H8   ) ( resid 21 and name H8  ) 4.5 1.6 1.6
 assign ( resid 21 and name H8   ) ( resid 22 and name H8  ) 4.5 1.6 1.6
 
 assign ( resid 36 and name H8   ) ( resid 37 and name H6  ) 4.5 1.6 1.6
 assign ( resid 38 and name H6   ) ( resid 39 and name H6  ) 4.5 1.6 1.6
 assign ( resid 39 and name H6   ) ( resid 40 and name H6  ) 4.5 1.6 1.6
 assign ( resid 42 and name H6   ) ( resid 43 and name H8  ) 4.5 1.6 1.6
 assign ( resid 43 and name H8   ) ( resid 44 and name H6  ) 4.5 1.6 1.6

!H5/6/8 to H2
 assign ( resid 22 and name H2   ) ( resid 26 and name H8  ) 4.5 1.6 1.6

 assign ( resid 27 and name H2   ) ( resid 28 and name H8  ) 4.5 1.6 1.6

!********************!
!   Sugar to Sugar   !
!********************!
!H1' to H2'
 assign ( resid 17 and name H2'' ) ( resid 17 and name H1' ) 2.5 0.7 0.7
 assign ( resid 17 and name H2'' ) ( resid 18 and name H1' ) 4.5 1.6 1.6
 assign ( resid 18 and name H2'' ) ( resid 18 and name H1' ) 2.5 0.7 0.7
 assign ( resid 18 and name H2'' ) ( resid 19 and name H1' ) 4.5 1.6 1.6
 assign ( resid 19 and name H2'' ) ( resid 19 and name H1' ) 2.5 0.7 0.7
 assign ( resid 19 and name H2'' ) ( resid 20 and name H1' ) 4.5 1.6 1.6
 assign ( resid 20 and name H2'' ) ( resid 20 and name H1' ) 2.5 0.7 0.7
 assign ( resid 20 and name H2'' ) ( resid 21 and name H1' ) 4.5 1.6 1.6
 assign ( resid 21 and name H2'' ) ( resid 21 and name H1' ) 2.5 0.7 0.7
 assign ( resid 21 and name H2'' ) ( resid 22 and name H1' ) 4.5 1.6 1.6
 assign ( resid 22 and name H2'' ) ( resid 22 and name H1' ) 2.5 0.7 0.7

 assign ( resid 26 and name H2'' ) ( resid 26 and name H1' ) 2.5 0.7 0.7
 assign ( resid 26 and name H2'' ) ( resid 27 and name H1' ) 4.5 1.6 1.6
 assign ( resid 27 and name H2'' ) ( resid 27 and name H1' ) 2.5 0.7 0.7
 assign ( resid 28 and name H2'' ) ( resid 28 and name H1' ) 2.5 0.7 0.7
 assign ( resid 28 and name H2'' ) ( resid 29 and name H1' ) 4.5 1.6 1.6
 assign ( resid 29 and name H2'' ) ( resid 29 and name H1' ) 2.5 0.7 0.7

 assign ( resid 36 and name H2'' ) ( resid 36 and name H1' ) 2.5 0.7 0.7
 assign ( resid 36 and name H2'' ) ( resid 37 and name H1' ) 4.5 1.6 1.6
 assign ( resid 37 and name H2'' ) ( resid 37 and name H1' ) 2.5 0.7 0.7
 assign ( resid 37 and name H2'' ) ( resid 38 and name H1' ) 4.5 1.6 1.6
 assign ( resid 38 and name H2'' ) ( resid 38 and name H1' ) 2.5 0.7 0.7
 assign ( resid 38 and name H2'' ) ( resid 39 and name H1' ) 4.5 1.6 1.6
 assign ( resid 39 and name H2'' ) ( resid 39 and name H1' ) 2.5 0.7 0.7
 assign ( resid 40 and name H2'' ) ( resid 40 and name H1' ) 2.5 0.7 0.7
 assign ( resid 41 and name H2'' ) ( resid 41 and name H1' ) 2.5 0.7 0.7
 assign ( resid 41 and name H2'' ) ( resid 42 and name H1' ) 4.5 1.6 1.6
 assign ( resid 42 and name H2'' ) ( resid 42 and name H1' ) 2.5 0.7 0.7
 assign ( resid 42 and name H2'' ) ( resid 43 and name H1' ) 4.5 1.6 1.6
 assign ( resid 43 and name H2'' ) ( resid 43 and name H1' ) 2.5 0.7 0.7
 assign ( resid 43 and name H2'' ) ( resid 44 and name H1' ) 5.0 2.0 2.0
 assign ( resid 44 and name H2'' ) ( resid 44 and name H1' ) 2.5 0.7 0.7
 assign ( resid 44 and name H2'' ) ( resid 45 and name H1' ) 4.5 1.6 1.6
 assign ( resid 45 and name H2'' ) ( resid 45 and name H1' ) 2.5 0.7 0.7

!H1' to H3'
 assign ( resid 17 and name H3'  ) ( resid 17 and name H1' ) 4.5 1.6 1.6
 assign ( resid 18 and name H3'  ) ( resid 18 and name H1' ) 3.5 1.2 1.2
 assign ( resid 19 and name H3'  ) ( resid 19 and name H1' ) 3.5 1.2 1.2
 assign ( resid 20 and name H3'  ) ( resid 20 and name H1' ) 3.5 1.2 1.2
 assign ( resid 21 and name H3'  ) ( resid 21 and name H1' ) 4.5 1.6 1.6
 assign ( resid 22 and name H3'  ) ( resid 22 and name H1' ) 4.5 1.6 1.6

 assign ( resid 26 and name H3'  ) ( resid 26 and name H1' ) 3.5 1.2 1.2
 assign ( resid 27 and name H3'  ) ( resid 27 and name H1' ) 5.0 3.2 2.0
 assign ( resid 28 and name H3'  ) ( resid 28 and name H1' ) 4.5 1.6 1.6
 assign ( resid 29 and name H3'  ) ( resid 29 and name H1' ) 4.5 1.6 1.6

 assign ( resid 36 and name H3'  ) ( resid 36 and name H1' ) 4.5 1.6 1.6
 assign ( resid 37 and name H3'  ) ( resid 37 and name H1' ) 4.5 1.6 1.6
 assign ( resid 39 and name H3'  ) ( resid 39 and name H1' ) 3.5 1.2 1.2
 assign ( resid 40 and name H3'  ) ( resid 40 and name H1' ) 3.5 1.2 1.2
 assign ( resid 43 and name H3'  ) ( resid 43 and name H1' ) 3.5 1.2 1.2
 assign ( resid 44 and name H3'  ) ( resid 44 and name H1' ) 4.5 1.6 1.6
 assign ( resid 45 and name H3'  ) ( resid 45 and name H1' ) 3.5 1.2 1.2
 
!H1' to H4'
 assign ( resid 17 and name H4'  ) ( resid 17 and name H1' ) 3.5 1.2 1.2
 assign ( resid 18 and name H4'  ) ( resid 18 and name H1' ) 3.5 1.2 1.2
 assign ( resid 19 and name H4'  ) ( resid 19 and name H1' ) 3.5 1.2 1.2
 assign ( resid 20 and name H4'  ) ( resid 20 and name H1' ) 3.5 1.2 1.2
 assign ( resid 21 and name H4'  ) ( resid 21 and name H1' ) 4.5 1.6 1.6
 assign ( resid 22 and name H4'  ) ( resid 22 and name H1' ) 4.5 1.6 1.6
 
 assign ( resid 27 and name H4'  ) ( resid 27 and name H1' ) 5.0 3.2 2.0
 assign ( resid 29 and name H4'  ) ( resid 29 and name H1' ) 4.5 1.6 1.6

 assign ( resid 36 and name H4'  ) ( resid 36 and name H1' ) 4.5 1.6 1.6
 assign ( resid 38 and name H4'  ) ( resid 38 and name H1' ) 3.5 1.2 1.2
 assign ( resid 39 and name H4'  ) ( resid 39 and name H1' ) 3.5 1.2 1.2
 assign ( resid 43 and name H4'  ) ( resid 43 and name H1' ) 3.5 1.2 1.2
 assign ( resid 44 and name H4'  ) ( resid 44 and name H1' ) 3.5 1.2 1.2
 assign ( resid 45 and name H4'  ) ( resid 45 and name H1' ) 4.5 1.6 1.6

!H1' to H5'/H5''
 assign ( resid 17 and name H5'' ) ( resid 17 and name H1' ) 5.0 3.2 2.0
 assign ( resid 18 and name H5'  ) ( resid 18 and name H1' ) 5.0 3.2 2.0
 assign ( resid 20 and name H5'' ) ( resid 20 and name H1' ) 5.0 2.0 2.0
 assign ( resid 22 and name H5'' ) ( resid 22 and name H1' ) 5.0 2.0 2.0

 assign ( resid 29 and name H5'  ) ( resid 29 and name H1' ) 5.0 3.2 2.0
 assign ( resid 29 and name H5'' ) ( resid 29 and name H1' ) 5.0 3.2 2.0

 assign ( resid 36 and name H5'  ) ( resid 36 and name H1' ) 5.0 3.2 2.0
 assign ( resid 38 and name H5'  ) ( resid 38 and name H1' ) 5.0 3.2 2.0
 assign ( resid 38 and name H5'' ) ( resid 38 and name H1' ) 5.0 3.2 2.0
 assign ( resid 39 and name H5'  ) ( resid 39 and name H1' ) 4.5 1.6 1.6
 assign ( resid 39 and name H5'' ) ( resid 39 and name H1' ) 4.5 1.6 1.6
 assign ( resid 41 and name H5'' ) ( resid 41 and name H1' ) 5.0 2.0 2.0
 assign ( resid 41 and name H5'  ) ( resid 41 and name H1' ) 5.0 2.0 2.0
 assign ( resid 43 and name H5'  ) ( resid 43 and name H1' ) 5.0 2.0 2.0
 assign ( resid 45 and name H5'' ) ( resid 45 and name H1' ) 5.0 2.0 2.0
 assign ( resid 45 and name H5'  ) ( resid 45 and name H1' ) 5.0 2.0 2.0

!H2' to H3'
! all missing???  H2'-H3' should be med/strong in 3' endo??
!H2' to H4'
! all missing???  H2'-H4' should be weak/med in 3' endo??
!H2' to H5'/H5''
! all missing???  H2'-H5'/H5'' should be weak in 3' endo??
!H3' to H4'
! all missing???  H2'-H5'/H5'' should be weak in 3' endo??
!H3' to H5'/H5''
! all missing???  H2'-H5'/H5'' should be weak in 3' endo??
!H4' to H5'/H5''
! all missing???  H2'-H5'/H5'' should be weak in 3' endo??


!**************!
!   UCU Bulge  !
!**************!

!!U23!!
 assign ( resid 22 and name H2'' ) ( resid 23 and name H1' ) 4.5 1.6 1.6
!assign ( resid 22 and name H3'  ) ( resid 23 and name H1' ) 5.0 2.0 2.0
!assign ( resid 22 and name H4'  ) ( resid 23 and name H1' ) 5.0 2.0 2.0

 assign ( resid 23 and name H5   ) ( resid 23 and name H6  ) 2.5 0.7 0.7
 assign ( resid 23 and name H6   ) ( resid 22 and name H2  ) 4.5 1.6 1.6
 assign ( resid 23 and name H1'  ) ( resid 26 and name H8  ) 3.5 1.2 1.2
 assign ( resid 23 and name H2'' ) ( resid 23 and name H1' ) 2.5 0.7 0.7
 assign ( resid 23 and name H3'  ) ( resid 23 and name H1' ) 3.5 1.2 1.2
 assign ( resid 23 and name H4'  ) ( resid 23 and name H1' ) 4.5 1.6 1.6
 assign ( resid 23 and name H5'' ) ( resid 23 and name H1' ) 5.0 3.2 2.0
 assign ( resid 23 and name H5'' ) ( resid 23 and name H6  ) 3.5 1.2 1.2

 assign ( resid 26 and name H2'' ) ( resid 23 and name H1' ) 3.5 1.2 1.2
 assign ( resid 26 and name H3'  ) ( resid 23 and name H1' ) 3.5 1.2 1.2

!!C24!!
 assign ( resid 24 and name H5   ) ( resid 24 and name H6  ) 2.5 0.7 0.7
! assign ( resid 24 and name H6   ) ( resid 25 and name H6  ) 4.5 1.6 1.6
 assign ( resid 24 and name H1'  ) ( resid 24 and name H6  ) 4.5 1.6 1.6 !! overlap with H5/H6 !!
 assign ( resid 24 and name H2'' ) ( resid 24 and name H1' ) 2.5 0.7 0.7
!assign ( resid 24 and name H2'' ) ( resid 25 and name H1' ) 5.0 2.0 2.0
 assign ( resid 24 and name H3'  ) ( resid 24 and name H1' ) 4.5 1.6 1.6
 assign ( resid 24 and name H5'  ) ( resid 24 and name H1' ) 4.6 1.2 1.2

 assign ( resid 24 and name H3'  ) ( resid 24 and name H6  ) 4.5 1.6 1.6
 assign ( resid 24 and name H4'  ) ( resid 24 and name H6  ) 4.5 1.6 1.6
 assign ( resid 24 and name H5'' ) ( resid 24 and name H6  ) 3.5 1.2 1.2

! assign ( resid 25 and name H5'  ) ( resid 24 and name H1' ) 5.0 2.0 2.0

!!U25!!
 assign ( resid 25 and name H5   ) ( resid 25 and name H6  ) 2.5 0.7 0.7
 assign ( resid 25 and name H1'  ) ( resid 25 and name H6  ) 2.5 0.7 0.7
 assign ( resid 25 and name H2'' ) ( resid 25 and name H1' ) 2.5 0.7 0.7
 assign ( resid 25 and name H3'  ) ( resid 25 and name H1' ) 4.5 1.6 1.6
 assign ( resid 25 and name H5'  ) ( resid 25 and name H1' ) 5.0 2.0 2.0
 assign ( resid 25 and name H5'' ) ( resid 25 and name H1' ) 4.5 1.6 1.6
 assign ( resid 25 and name H3'  ) ( resid 25 and name H6  ) 4.5 1.6 1.6


!****************!
! Terminal loop  !
!****************!
!C30
 assign ( resid 29 and name H6   ) ( resid 30 and name H6  ) 4.5 1.6 1.6
 assign ( resid 29 and name H1'  ) ( resid 30 and name H6  ) 4.5 1.6 1.6
 assign ( resid 29 and name H2'' ) ( resid 30 and name H6  ) 3.5 1.6 1.6
 assign ( resid 29 and name H3'  ) ( resid 30 and name H6  ) 3.5 1.6 1.6
! assign ( resid 29 and name H5'' ) ( resid 30 and name H6  ) 4.5 1.6 1.6
! assign ( resid 29 and name H5'  ) ( resid 30 and name H6  ) 4.5 1.6 1.6

 assign ( resid 30 and name H5   ) ( resid 30 and name H6  ) 2.5 0.7 0.7

 assign ( resid 30 and name H2'' ) ( resid 30 and name H1' ) 2.5 0.7 0.7
 assign ( resid 30 and name H2'' ) ( resid 30 and name H6  ) 3.5 1.2 1.2
 assign ( resid 30 and name H2'' ) ( resid 31 and name H5  ) 5.0 2.0 2.0
 assign ( resid 30 and name H2'' ) ( resid 31 and name H6  ) 3.5 1.2 1.2
 assign ( resid 30 and name H2'' ) ( resid 31 and name H1' ) 5.0 2.0 2.0

 assign ( resid 30 and name H3'  ) ( resid 30 and name H1' ) 5.0 3.2 2.0
 assign ( resid 30 and name H4'  ) ( resid 30 and name H1' ) 5.0 3.2 2.0
 assign ( resid 30 and name H5'  ) ( resid 30 and name H1' ) 5.0 3.2 2.0
 assign ( resid 30 and name H5'' ) ( resid 30 and name H6  ) 5.0 3.2 2.0

!U31
! assign ( resid 29 and name H6   ) ( resid 31 and name H6  ) 4.5 1.6 1.6
 assign ( resid 31 and name H5   ) ( resid 31 and name H6  ) 2.5 0.7 0.7

 assign ( resid 31 and name H2'' ) ( resid 31 and name H1' ) 2.5 0.7 0.7
 assign ( resid 31 and name H2'' ) ( resid 31 and name H5  ) 4.5 1.6 1.6 
 assign ( resid 31 and name H2'' ) ( resid 31 and name H6  ) 2.5 0.7 0.7

 assign ( resid 31 and name H3'  ) ( resid 31 and name H5  ) 5.0 2.0 2.0

!G32
 assign ( resid 32 and name H8   ) ( resid 30 and name H2' ) 4.5 1.6 1.6 
 assign ( resid 32 and name H8   ) ( resid 31 and name H2' ) 4.5 1.6 1.6

 assign ( resid 32 and name H1'  ) ( resid 33 and name H8  ) 4.5 1.6 1.6

 assign ( resid 32 and name H2'' ) ( resid 32 and name H8  ) 3.5 1.2 1.2
 assign ( resid 32 and name H4'  ) ( resid 32 and name H8  ) 5.0 3.2 2.0
 assign ( resid 32 and name H5'  ) ( resid 32 and name H8  ) 4.5 1.6 1.6
 assign ( resid 32 and name H5'' ) ( resid 32 and name H8  ) 4.5 1.6 1.6

 assign ( resid 32 and name H2'' ) ( resid 32 and name H1' ) 2.5 0.7 0.7
 assign ( resid 32 and name H4'  ) ( resid 32 and name H1' ) 5.0 3.2 2.0
 assign ( resid 32 and name H5'  ) ( resid 32 and name H1' ) 4.5 1.6 1.6
 assign ( resid 32 and name H5'' ) ( resid 32 and name H1' ) 4.5 1.6 1.6

!G33
 assign ( resid 33 and name H2'' ) ( resid 33 and name H1' ) 2.5 0.7 0.7
 assign ( resid 33 and name H4'  ) ( resid 33 and name H1' ) 3.5 1.2 1.2
 assign ( resid 33 and name H5'' ) ( resid 33 and name H1' ) 4.5 1.6 1.6

 assign ( resid 33 and name H1'  ) ( resid 34 and name H8  ) 4.5 1.6 1.6

!G34
 assign ( resid 34 and name H1'  ) ( resid 34 and name H8  ) 4.5 1.6 1.6
 assign ( resid 34 and name H1'  ) ( resid 35 and name H8  ) 5.0 2.0 2.0
 assign ( resid 34 and name H1'  ) ( resid 36 and name H8  ) 3.5 1.2 1.2
 assign ( resid 34 and name H2'' ) ( resid 34 and name H8  ) 3.5 1.2 1.2
 assign ( resid 34 and name H3'  ) ( resid 34 and name H8  ) 4.5 1.6 1.6
 assign ( resid 34 and name H4'  ) ( resid 34 and name H8  ) 4.5 1.6 1.6
 assign ( resid 34 and name H5'  ) ( resid 34 and name H8  ) 5.0 3.2 3.2
! assign ( resid 34 and name H8   ) ( resid 35 and name H8  ) 4.5 1.6 1.6
 assign ( resid 34 and name H8   ) ( resid 36 and name H8  ) 4.5 1.6 1.6

 assign ( resid 34 and name H2'' ) ( resid 34 and name H1' ) 2.5 0.7 0.7
 assign ( resid 34 and name H3'  ) ( resid 34 and name H1' ) 5.0 3.2 2.0
 assign ( resid 34 and name H4'  ) ( resid 34 and name H1' ) 4.5 1.6 1.6
 assign ( resid 34 and name H5'  ) ( resid 34 and name H1' ) 5.0 3.2 3.2

!A35
 assign ( resid 35 and name H8   ) ( resid 36 and name H8  ) 4.5 1.6 1.6
!assign ( resid 35 and name H2   ) ( resid ?? and name H8  ) 4.5 1.6 1.6
!assign ( resid 35 and name H2   ) ( resid ?? and name H6  ) 4.5 1.6 1.6

!assign ( resid 31 and name H1'  ) ( resid 35 and name H2  ) 4.5 1.6 1.6 
!assign ( resid ?? and name H1'  ) ( resid 35 and name H2  ) 3.5 1.2 1.2

 assign ( resid 35 and name H1'  ) ( resid 35 and name H8  ) 2.5 0.7 0.7
 assign ( resid 35 and name H1'  ) ( resid 36 and name H8  ) 4.5 1.6 1.6
 assign ( resid 35 and name H1'  ) ( resid 35 and name H2'') 4.5 1.6 1.6
 assign ( resid 35 and name H1'  ) ( resid 35 and name H3' ) 4.5 1.6 1.6

 assign ( resid 35 and name H2'' ) ( resid 35 and name H8  ) 4.5 1.6 1.6
 assign ( resid 35 and name H3'  ) ( resid 35 and name H8  ) 4.5 1.6 1.6

 assign ( resid 35 and name H4'  ) ( resid 35 and name H1' ) 3.5 1.2 1.2
 assign ( resid 35 and name H5'  ) ( resid 35 and name H1' ) 4.5 1.6 1.6
 assign ( resid 35 and name H5'' ) ( resid 35 and name H1' ) 4.5 1.6 1.6

# Restraints file 4: TAR_181_hbond.tbl
!amino acid to nucleic base
!for Arg 5 to G28  (turned off for initial folding)

 assign ( resid 5 and name HH12 ) ( resid 28 and name N7 ) 1.73 0.2 0.2
 assign ( resid 5 and name NH1  ) ( resid 28 and name N7 ) 2.87 0.2 0.2
 assign ( resid 5 and name HH22 ) ( resid 28 and name O6 ) 1.86 0.2 0.2
 assign ( resid 5 and name NH2  ) ( resid 28 and name O6 ) 2.81 0.2 0.2 

!Arg 3 to G26
! assign ( resid  3 and name HH12 ) ( resid 26 and name O6 ) 3.5 1.6 1.6
! assign ( resid  3 and name HH22 ) ( resid 26 and name N7 ) 3.5 1.6 1.6

!Arg 8 to G34  (turned off for initial folding)

! assign ( resid 8 and name HH1# ) ( resid 34 and name O6 ) 1.73 0.2 0.2
! assign ( resid 8 and name NH1  ) ( resid 34 and name O6 ) 2.87 0.2 0.2
! assign ( resid 8 and name HE   ) ( resid 34 and name N7 ) 1.86 0.2 0.2
! assign ( resid 8 and name NE   ) ( resid 34 and name N7 ) 2.81 0.2 0.2


!Lys 6 to U25 (not quite sure??? possible??)
 assign ( resid 6 and name HZ#  ) ( resid 25 and name O4 )  1.86 0.2 0.2
 assign ( resid 6 and name NZ   ) ( resid 25 and name O4 )  2.87 0.2 0.2


!
! Base pairing for HIV TAR in complex with JB181 peptide
! Taken from data collected at 4C on the 500MHz instrument
! using noesyesgpph pulse sequence with 300ms 
  

! for G17/ C45  base pair 
 assign ( resid 17 and name N1 ) ( resid 45 and name N3) 2.87 0.2 0.2
 assign ( resid 17 and name H1 ) ( resid 45 and name N3) 1.86 0.2 0.2
 assign ( resid 17 and name O6 ) ( resid 45 and name N4) 2.81 0.2 0.2
 assign ( resid 17 and name N2 ) ( resid 45 and name O2) 2.81 0.2 0.2
 assign ( resid 17 and name N2 ) ( resid 45 and name N3) 3.58 0.2 0.2
 assign ( resid 17 and name O6 ) ( resid 45 and name N3) 3.63 0.2 0.2


! for G18/ C44  base pair 
 assign ( resid 18 and name N1) ( resid 44 and name N3) 2.87 0.2 0.2
 assign ( resid 18 and name H1) ( resid 44 and name N3) 1.86 0.2 0.2
 assign ( resid 18 and name O6) ( resid 44 and name N4) 2.81 0.2 0.2
 assign ( resid 18 and name N2) ( resid 44 and name O2) 2.81 0.2 0.2
 assign ( resid 18 and name N2) ( resid 44 and name N3) 3.58 0.2 0.2
 assign ( resid 18 and name O6) ( resid 44 and name N3) 3.63 0.2 0.2

! for G43/ C19  base pair 
 assign ( resid 19 and name N3) ( resid 43 and name N1) 2.87 0.2 0.2
 assign ( resid 19 and name N3) ( resid 43 and name H1) 1.86 0.2 0.2
 assign ( resid 19 and name N4) ( resid 43 and name O6) 2.81 0.2 0.2
 assign ( resid 19 and name O2) ( resid 43 and name N2) 2.81 0.2 0.2
 assign ( resid 19 and name N3) ( resid 43 and name N2) 3.58 0.2 0.2
 assign ( resid 19 and name N3) ( resid 43 and name O6) 3.63 0.2 0.2
 
! for A20/ U42 base pair
 assign ( resid 20 and name N1)  (resid 42 and name N3)    2.73 0.2 0.2
 assign ( resid 20 and name N6)  (resid 42 and name O4)    2.92 0.2 0.2
 assign ( resid 20 and name N1)  (resid 42 and name H3)    1.73 0.2 0.2

! for G21/ C41  base pair 
 assign ( resid 21 and name N1) ( resid 41 and name N3) 2.87 0.2 0.2
 assign ( resid 21 and name H1) ( resid 41 and name N3) 1.86 0.2 0.2
 assign ( resid 21 and name O6) ( resid 41 and name N4) 2.81 0.2 0.2
 assign ( resid 21 and name N2) ( resid 41 and name O2) 2.81 0.2 0.2
 assign ( resid 21 and name N2) ( resid 41 and name N3) 3.58 0.2 0.2
 assign ( resid 21 and name O6) ( resid 41 and name N3) 3.63 0.2 0.2


! for A22/ U40 base pair
 assign ( resid 22 and name N1)  (resid 40 and name N3)    2.73 0.2 0.2
 assign ( resid 22 and name N6)  (resid 40 and name O4)    2.92 0.2 0.2
 assign ( resid 22 and name N1)  (resid 40 and name H3)    1.73 0.2 0.2

! for G26/ C39  base pair 
 assign ( resid 26 and name N1) ( resid 39 and name N3) 2.87 0.2 0.2
 assign ( resid 26 and name H1) ( resid 39 and name N3) 1.86 0.2 0.2
 assign ( resid 26 and name O6) ( resid 39 and name N4) 2.81 0.2 0.2
 assign ( resid 26 and name N2) ( resid 39 and name O2) 2.81 0.2 0.2
 assign ( resid 26 and name N2) ( resid 39 and name N3) 3.58 0.2 0.2
 assign ( resid 26 and name O6) ( resid 39 and name N3) 3.63 0.2 0.2

! for U23/ A27 base pair
  assign ( resid 27 and name N7)  (resid 23 and name H3) 1.73 0.2 0.2
  assign ( resid 27 and name N7)  (resid 23 and name N3) 2.73 0.2 0.2
  assign ( resid 27 and name H62)  (resid 23 and name O4) 1.86 0.2 0.2
  assign ( resid 27 and name N6)  (resid 23 and name O4) 2.73 0.2 0.2

! for A27/ U38 base pair
  assign ( resid 27 and name H61) (resid 38 and name O4)    1.73 0.2 0.2
  assign ( resid 27 and name N1)  (resid 38 and name N3)    2.73 0.2 0.2
  assign ( resid 27 and name N6)  (resid 38 and name O4)    2.92 0.2 0.2
  assign ( resid 27 and name N1)  (resid 38 and name H3)    1.73 0.2 0.2

! for G28/ C37  base pair 
 assign ( resid 28 and name N1) ( resid 37 and name N3) 2.87 0.2 0.2
 assign ( resid 28 and name H1) ( resid 37 and name N3) 1.86 0.2 0.2
 assign ( resid 28 and name O6) ( resid 37 and name N4) 2.81 0.2 0.2
 assign ( resid 28 and name N2) ( resid 37 and name O2) 2.81 0.2 0.2
 assign ( resid 28 and name N2) ( resid 37 and name N3) 3.58 0.2 0.2
 assign ( resid 28 and name O6) ( resid 37 and name N3) 3.63 0.2 0.2

! for G36/ C29  base pair 
 assign ( resid 29 and name N3) ( resid 36 and name N1) 2.87 0.2 0.2
 assign ( resid 29 and name N3) ( resid 36 and name H1) 1.86 0.2 0.2
 assign ( resid 29 and name N4) ( resid 36 and name O6) 2.81 0.2 0.2
 assign ( resid 29 and name O2) ( resid 36 and name N2) 2.81 0.2 0.2
 assign ( resid 29 and name N3) ( resid 36 and name N2) 3.58 0.2 0.2
 assign ( resid 29 and name N3) ( resid 36 and name O6) 3.63 0.2 0.2


! for C30/G34  #may be here, need high res water noesy 
 assign ( resid 30 and name N3) ( resid 34 and name N1) 2.87 0.2 0.2
 assign ( resid 30 and name N3) ( resid 34 and name H1) 1.86 0.2 0.2
 assign ( resid 30 and name N4) ( resid 34 and name O6) 2.81 0.2 0.2
 assign ( resid 30 and name O2) ( resid 34 and name N2) 2.81 0.2 0.2
 assign ( resid 30 and name N3) ( resid 34 and name N2) 3.58 0.2 0.2
 assign ( resid 30 and name N3) ( resid 34 and name O6) 3.63 0.2 0.2


! U31 - G34
!assign (residue 31 and name H3) (residue 34 and name O6)  1.9 0.1 0.30
!assign (residue 31 and name N3) (residue 34 and name O6)  3.0 0.28 0.08
!assign (residue 31 and name O2) (residue 34 and name H1)  1.9 0.1 0.30
!assign (residue 31 and name O2) (residue 34 and name N1)  3.0 0.28 0.08


  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1    H1   DAB   1           H        DAB   1  -3.082  -9.140  -1.919
    2    HA   DAB   1           HA       DAB   1  -3.771  -8.279  -4.683
    3    HB2  DAB   1           HB2      DAB   1  -3.826  -6.714  -2.092
    4    HB3  DAB   1           HB3      DAB   1  -4.185  -6.051  -3.686
    5    HG2  DAB   1           HG2      DAB   1  -5.720  -8.162  -2.162
    6    HG3  DAB   1           HG3      DAB   1  -6.305  -6.602  -2.742
    7    HD1  DAB   1           HD1      DAB   1  -5.977  -9.101  -4.164
    8    HD2  DAB   1           HD2      DAB   1  -5.451  -7.726  -5.010
    9    HD3  DAB   1           HD3      DAB   1  -7.051  -7.819  -4.453
   10    H    VAL   2           H        VAL   2  -2.457  -6.712  -5.701
   11    HA   VAL   2           HA       VAL   2   0.227  -6.411  -4.567
   12    HB   VAL   2           HB       VAL   2   0.604  -7.927  -6.256
   13   HG11  VAL   2          HG11      VAL   2  -0.444  -7.617  -8.541
   14   HG12  VAL   2          HG12      VAL   2  -1.400  -6.299  -7.863
   15   HG13  VAL   2          HG13      VAL   2  -1.607  -7.942  -7.256
   16   HG21  VAL   2          HG21      VAL   2   0.881  -5.327  -7.789
   17   HG22  VAL   2          HG22      VAL   2   1.923  -6.748  -7.849
   18   HG23  VAL   2          HG23      VAL   2   1.926  -5.714  -6.421
   19    H    ARG   3           H        ARG   3   1.292  -4.489  -4.675
   20    HA   ARG   3           HA       ARG   3  -0.029  -2.317  -6.148
   21    HB2  ARG   3           HB2      ARG   3  -0.033  -2.725  -3.220
   22    HB3  ARG   3           HB3      ARG   3   0.435  -1.107  -3.737
   23    HG2  ARG   3           HG2      ARG   3  -1.600  -0.671  -4.732
   24    HG3  ARG   3           HG3      ARG   3  -1.960  -2.361  -5.020
   25    HD2  ARG   3           HD2      ARG   3  -3.189  -2.449  -3.127
   26    HD3  ARG   3           HD3      ARG   3  -1.807  -1.949  -2.172
   27    HE   ARG   3           HE       ARG   3  -3.184   0.197  -3.557
   28   HH11  ARG   3          HH11      ARG   3  -3.938   1.820  -2.174
   29   HH12  ARG   3          HH12      ARG   3  -4.083   1.510  -0.476
   30   HH21  ARG   3          HH21      ARG   3  -2.866  -1.729  -0.697
   31   HH22  ARG   3          HH22      ARG   3  -3.473  -0.500   0.362
   32    H    THR   4           H        THR   4   1.299  -0.636  -6.659
   33    HA   THR   4           HA       THR   4   4.112  -1.006  -5.947
   34    HB   THR   4           HB       THR   4   2.956   0.114  -8.493
   35    HG1  THR   4           HG1      THR   4   2.929  -2.126  -8.404
   36   HG21  THR   4          HG21      THR   4   5.335   0.225  -9.227
   37   HG22  THR   4          HG22      THR   4   5.832  -0.197  -7.590
   38   HG23  THR   4          HG23      THR   4   4.992   1.324  -7.893
   39    H    ARG   5           H        ARG   5   5.389   0.808  -5.470
   40    HA   ARG   5           HA       ARG   5   3.868   3.284  -4.922
   41    HB2  ARG   5           HB2      ARG   5   6.164   2.372  -3.220
   42    HB3  ARG   5           HB3      ARG   5   4.892   3.509  -2.820
   43    HG2  ARG   5           HG2      ARG   5   4.402   0.573  -3.326
   44    HG3  ARG   5           HG3      ARG   5   4.678   1.237  -1.718
   45    HD2  ARG   5           HD2      ARG   5   2.329   1.525  -3.528
   46    HD3  ARG   5           HD3      ARG   5   2.374   1.330  -1.781
   47    HE   ARG   5           HE       ARG   5   2.491   3.805  -3.235
   48   HH11  ARG   5          HH11      ARG   5   2.567   5.694  -1.934
   49   HH12  ARG   5          HH12      ARG   5   2.940   5.553  -0.235
   50   HH21  ARG   5          HH21      ARG   5   3.233   2.090  -0.361
   51   HH22  ARG   5          HH22      ARG   5   3.319   3.500   0.639
   52    H    LYS   6           H        LYS   6   4.663   4.172  -6.843
   53    HA   LYS   6           HA       LYS   6   6.458   4.666  -8.384
   54    HB2  LYS   6           HB2      LYS   6   5.232   6.584  -7.090
   55    HB3  LYS   6           HB3      LYS   6   6.799   6.783  -6.303
   56    HG2  LYS   6           HG2      LYS   6   7.635   6.616  -8.861
   57    HG3  LYS   6           HG3      LYS   6   6.016   7.264  -9.137
   58    HD2  LYS   6           HD2      LYS   6   6.727   8.925  -7.176
   59    HD3  LYS   6           HD3      LYS   6   8.349   8.513  -7.724
   60    HE2  LYS   6           HE2      LYS   6   7.566  10.514  -8.893
   61    HE3  LYS   6           HE1      LYS   6   7.705   9.188 -10.047
   62    HZ1  LYS   6           HZ1      LYS   6   5.232  10.213  -8.753
   63    HZ2  LYS   6           HZ2      LYS   6   5.291   8.771  -9.649
   64    HZ3  LYS   6           HZ3      LYS   6   5.628  10.254 -10.405
   65    H    GLY   7           H        GLY   7   7.752   2.699  -7.388
   66    HA2  GLY   7           HA2      GLY   7  10.317   2.803  -7.535
   67    HA3  GLY   7           HA3      GLY   7  10.174   3.693  -6.026
   68    H    ARG   8           H        ARG   8   8.368   2.370  -4.603
   69    HA   ARG   8           HA       ARG   8   9.648  -0.204  -4.129
   70    HB2  ARG   8           HB2      ARG   8   7.560   0.899  -2.290
   71    HB3  ARG   8           HB3      ARG   8   8.972  -0.065  -1.922
   72    HG2  ARG   8           HG2      ARG   8  10.285   1.758  -1.566
   73    HG3  ARG   8           HG3      ARG   8   9.711   2.559  -3.026
   74    HD2  ARG   8           HD2      ARG   8   7.924   2.405  -0.617
   75    HD3  ARG   8           HD3      ARG   8   9.200   3.615  -0.693
   76    HE   ARG   8           HE       ARG   8   6.732   3.721  -2.095
   77   HH11  ARG   8          HH11      ARG   8   6.464   5.370  -3.629
   78   HH12  ARG   8          HH12      ARG   8   7.851   6.158  -4.303
   79   HH21  ARG   8          HH21      ARG   8  10.132   4.303  -2.467
   80   HH22  ARG   8          HH22      ARG   8   9.925   5.554  -3.648
   81    H    ARG   9           H        ARG   9   8.747  -1.941  -5.053
   82    HA   ARG   9           HA       ARG   9   5.953  -1.969  -5.784
   83    HB2  ARG   9           HB2      ARG   9   7.175  -2.866  -7.556
   84    HB3  ARG   9           HB3      ARG   9   8.298  -3.683  -6.478
   85    HG2  ARG   9           HG2      ARG   9   6.722  -5.394  -5.955
   86    HG3  ARG   9           HG3      ARG   9   5.381  -4.478  -6.640
   87    HD2  ARG   9           HD2      ARG   9   6.329  -4.708  -8.879
   88    HD3  ARG   9           HD3      ARG   9   7.725  -5.558  -8.221
   89    HE   ARG   9           HE       ARG   9   6.391  -7.463  -7.942
   90   HH11  ARG   9          HH11      ARG   9   4.494  -8.641  -8.350
   91   HH12  ARG   9          HH12      ARG   9   3.063  -7.816  -8.874
   92   HH21  ARG   9          HH21      ARG   9   4.536  -4.676  -8.822
   93   HH22  ARG   9          HH22      ARG   9   3.088  -5.570  -9.142
   94    H    ILE  10           H        ILE  10   4.513  -2.527  -4.200
   95    HA   ILE  10           HA       ILE  10   5.405  -4.678  -2.349
   96    HB   ILE  10           HB       ILE  10   4.447  -3.549  -0.565
   97   HG12  ILE  10          HG12      ILE  10   2.840  -1.967  -2.606
   98   HG13  ILE  10          HG13      ILE  10   2.198  -3.149  -1.448
   99   HG21  ILE  10          HG21      ILE  10   5.656  -1.609  -0.543
  100   HG22  ILE  10          HG22      ILE  10   4.915  -1.013  -2.025
  101   HG23  ILE  10          HG23      ILE  10   6.244  -2.166  -2.106
  102   HD11  ILE  10          HD11      ILE  10   3.230  -1.675   0.373
  103   HD12  ILE  10          HD12      ILE  10   1.814  -1.010  -0.453
  104   HD13  ILE  10          HD13      ILE  10   3.433  -0.454  -0.880
  105    H    4J5  11           H        NOR  11   3.265  -5.371  -1.066
  106    HA   4J5  11           HA       NOR  11   0.954  -5.657  -2.691
  107    HD   4J5  11           HD       NOR  11   3.161 -10.276  -2.928
  108    HB2  4J5  11           HB2      NOR  11   1.162  -7.791  -3.530
  109    HB3  4J5  11           HB3      NOR  11   2.871  -7.437  -3.425
  110    HG2  4J5  11           HG2      NOR  11   2.976  -8.604  -1.283
  111    HG3  4J5  11           HG3      NOR  11   1.234  -8.853  -1.292
  112   HH11  4J5  11          HH11      NOR  11  -0.100  -9.292  -2.453
  113   HH12  4J5  11          HH12      NOR  11  -0.780 -10.656  -3.275
  114   HH21  4J5  11          HH21      NOR  11   2.294 -12.147  -3.887
  115   HH22  4J5  11          HH22      NOR  11   0.578 -12.278  -4.084
  116    H    ILE  12           H        ILE  12  -0.765  -6.740  -1.661
  117    HA   ILE  12           HA       ILE  12  -0.341  -7.052   1.240
  118    HB   ILE  12           HB       ILE  12  -3.101  -6.476   0.693
  119   HG12  ILE  12          HG12      ILE  12  -2.047  -5.361  -1.403
  120   HG13  ILE  12          HG13      ILE  12  -3.052  -4.346  -0.378
  121   HG21  ILE  12          HG21      ILE  12  -0.845  -5.005   2.081
  122   HG22  ILE  12          HG22      ILE  12  -2.101  -6.003   2.819
  123   HG23  ILE  12          HG23      ILE  12  -2.518  -4.443   2.107
  124   HD11  ILE  12          HD11      ILE  12  -0.158  -4.436   0.307
  125   HD12  ILE  12          HD12      ILE  12  -1.284  -3.085   0.357
  126   HD13  ILE  12          HD13      ILE  12  -0.588  -3.603  -1.180
  127    HA   DPR  13           HA       DPR  13  -2.238 -11.036   1.465
  128    HB2  DPR  13           HB2      DPR  13  -0.541 -12.630   1.589
  129    HB3  DPR  13           HB3      DPR  13   0.395 -11.864   0.286
  130    HG2  DPR  13           HG2      DPR  13   0.086 -11.044   3.130
  131    HG3  DPR  13           HG3      DPR  13   1.532 -11.042   2.105
  132    HD2  DPR  13           HD2      DPR  13  -0.036  -8.810   2.618
  133    HD3  DPR  13           HD3      DPR  13   1.051  -8.980   1.222
  134    HA   PRO  14           HA       PRO  14  -3.100 -12.395  -2.765
  135    HB2  PRO  14           HB2      PRO  14  -5.842 -11.593  -2.722
  136    HB3  PRO  14           HB3      PRO  14  -5.181 -13.174  -2.272
  137    HG2  PRO  14           HG2      PRO  14  -6.400 -11.397  -0.531
  138    HG3  PRO  14           HG3      PRO  14  -5.329 -12.726  -0.059
  139    HD2  PRO  14           HD2      PRO  14  -4.671  -9.811  -0.408
  140    HD3  PRO  14           HD3      PRO  14  -4.155 -10.943   0.860
  141    H5'    G  17           H5'        G  17 -16.210  -2.401  15.856
  142   H5''    G  17          H5''        G  17 -14.596  -3.085  15.590
  143    H4'    G  17           H4'        G  17 -16.230  -4.835  15.301
  144    H3'    G  17           H3'        G  17 -15.032  -3.913  12.667
  145    H2'    G  17          H2''        G  17 -16.251  -5.633  11.624
  146   HO2'    G  17           H2'        G  17 -16.197  -6.742  14.195
  147    H1'    G  17           H1'        G  17 -18.541  -5.376  13.149
  148    H8     G  17           H8         G  17 -17.430  -1.891  12.310
  149    H1     G  17           H1         G  17 -20.312  -4.902   7.435
  150    H21    G  17           H21        G  17 -20.523  -7.039   7.875
  151    H22    G  17           H22        G  17 -19.962  -7.750   9.371
  152   HO5'    G  17           H5T        G  17 -16.143  -1.519  13.801
  153    H5'    G  18           H5'        G  18 -14.757  -7.990  12.717
  154   H5''    G  18          H5''        G  18 -13.193  -8.653  12.202
  155    H4'    G  18           H4'        G  18 -15.012  -9.623  10.883
  156    H3'    G  18           H3'        G  18 -13.323  -7.701   9.231
  157    H2'    G  18          H2''        G  18 -14.622  -8.355   7.387
  158   HO2'    G  18           H2'        G  18 -15.374 -10.322   7.183
  159    H1'    G  18           H1'        G  18 -17.027  -8.559   8.753
  160    H8     G  18           H8         G  18 -15.245  -5.332   9.684
  161    H1     G  18           H1         G  18 -18.316  -5.043   4.072
  162    H21    G  18           H21        G  18 -18.937  -7.079   3.435
  163    H22    G  18           H22        G  18 -18.605  -8.502   4.397
  164    H5'    C  19           H5'        C  19 -13.619 -11.231   7.094
  165   H5''    C  19          H5''        C  19 -12.120 -11.789   6.326
  166    H4'    C  19           H4'        C  19 -13.924 -11.604   4.673
  167    H3'    C  19           H3'        C  19 -11.822  -9.432   4.273
  168    H2'    C  19          H2''        C  19 -13.028  -8.808   2.358
  169   HO2'    C  19           H2'        C  19 -14.961 -10.528   2.016
  170    H1'    C  19           H1'        C  19 -15.559  -9.319   3.416
  171    H41    C  19           H41        C  19 -14.835  -3.012   3.547
  172    H42    C  19           H42        C  19 -13.977  -3.126   5.067
  173    H5     C  19           H5         C  19 -13.361  -5.234   6.077
  174    H6     C  19           H6         C  19 -13.391  -7.665   5.804
  175    H5'    A  20           H5'        A  20 -12.452 -11.156   0.585
  176   H5''    A  20          H5''        A  20 -10.975 -11.522  -0.324
  177    H4'    A  20           H4'        A  20 -12.488 -10.194  -1.701
  178    H3'    A  20           H3'        A  20 -10.090  -8.554  -0.797
  179    H2'    A  20          H2''        A  20 -10.920  -6.819  -2.147
  180   HO2'    A  20           H2'        A  20 -12.714  -8.689  -3.335
  181    H1'    A  20           H1'        A  20 -13.614  -7.255  -1.636
  182    H8     A  20           H8         A  20 -11.594  -7.340   1.586
  183    H61    A  20           H61        A  20 -12.304  -1.192   1.664
  184    H62    A  20           H62        A  20 -11.814  -2.593   2.590
  185    H2     A  20           H2         A  20 -13.567  -2.681  -2.351
  186    H5'    G  21           H5'        G  21 -10.393  -8.167  -4.937
  187   H5''    G  21          H5''        G  21  -8.846  -8.228  -5.802
  188    H4'    G  21           H4'        G  21 -10.053  -6.196  -6.387
  189    H3'    G  21           H3'        G  21  -7.652  -5.575  -4.624
  190    H2'    G  21          H2''        G  21  -8.173  -3.313  -4.916
  191   HO2'    G  21           H2'        G  21  -9.413  -4.250  -7.266
  192    H1'    G  21           H1'        G  21 -10.957  -3.640  -5.019
  193    H8     G  21           H8         G  21  -9.333  -5.400  -2.058
  194    H1     G  21           H1         G  21 -10.235   0.858  -1.217
  195    H21    G  21           H21        G  21 -10.788   1.832  -3.134
  196    H22    G  21           H22        G  21 -10.946   0.923  -4.619
  197    H5'    A  22           H5'        A  22  -7.493  -2.943  -7.724
  198   H5''    A  22          H5''        A  22  -5.910  -2.823  -8.516
  199    H4'    A  22           H4'        A  22  -6.657  -0.598  -7.858
  200    H3'    A  22           H3'        A  22  -4.376  -1.617  -6.133
  201    H2'    A  22          H2''        A  22  -4.435   0.445  -5.004
  202   HO2'    A  22           H2'        A  22  -5.010   2.325  -5.976
  203    H1'    A  22           H1'        A  22  -7.235   0.952  -5.369
  204    H8     A  22           H8         A  22  -6.499  -2.403  -3.747
  205    H61    A  22           H61        A  22  -6.489   0.566   1.645
  206    H62    A  22           H62        A  22  -6.474  -0.984   0.835
  207    H2     A  22           H2         A  22  -6.547   3.658  -1.649
  208    H5'    U  23           H5'        U  23  -3.224   2.201  -8.121
  209   H5''    U  23          H5''        U  23  -1.878   1.910  -9.244
  210    H4'    U  23           H4'        U  23  -1.589   4.049  -8.094
  211    H3'    U  23           H3'        U  23   0.392   1.925  -7.199
  212    H2'    U  23          H2''        U  23   1.325   3.489  -5.757
  213   HO2'    U  23           H2'        U  23   1.652   4.987  -7.539
  214    H1'    U  23           H1'        U  23  -1.025   5.103  -5.476
  215    H3     U  23           H3         U  23   0.504   4.450  -1.269
  216    H5     U  23           H5         U  23  -1.076   0.738  -2.330
  217    H6     U  23           H6         U  23  -1.341   1.570  -4.596
  218    H5'    C  24           H5'        C  24   1.543   4.898 -10.990
  219   H5''    C  24          H5''        C  24   3.054   4.264 -11.647
  220    H4'    C  24           H4'        C  24   2.706   6.892 -10.181
  221    H3'    C  24           H3'        C  24   2.355   6.407 -12.971
  222    H2'    C  24          H2''        C  24   4.587   6.314 -13.539
  223   HO2'    C  24           H2'        C  24   4.654   8.191 -14.510
  224    H1'    C  24           H1'        C  24   5.371   8.131 -11.265
  225    H41    C  24           H41        C  24  10.948   5.546 -13.071
  226    H42    C  24           H42        C  24  10.406   3.998 -12.461
  227    H5     C  24           H5         C  24   8.190   3.612 -11.621
  228    H6     C  24           H6         C  24   6.006   4.622 -11.183
  229    H5'    U  25           H5'        U  25   0.426   6.210 -12.438
  230   H5''    U  25          H5''        U  25  -1.288   6.526 -12.596
  231    H4'    U  25           H4'        U  25  -0.861   4.985 -10.756
  232    H3'    U  25           H3'        U  25  -2.460   7.260 -10.436
  233    H2'    U  25          H2''        U  25  -0.968   8.512  -9.125
  234   HO2'    U  25           H2'        U  25  -1.675   6.686  -7.070
  235    H1'    U  25           H1'        U  25   0.084   6.006  -7.826
  236    H3     U  25           H3         U  25   2.769  10.453  -9.053
  237    H5     U  25           H5         U  25   3.590   7.993  -5.709
  238    H6     U  25           H6         U  25   1.838   6.513  -6.464
  239    H5'    G  26           H5'        G  26  -5.557   7.884  -7.603
  240   H5''    G  26          H5''        G  26  -3.998   8.612  -8.029
  241    H4'    G  26           H4'        G  26  -4.795   9.562  -5.955
  242    H3'    G  26           H3'        G  26  -2.450   7.679  -5.521
  243    H2'    G  26          H2''        G  26  -2.484   8.278  -3.273
  244   HO2'    G  26           H2'        G  26  -3.320  10.179  -2.537
  245    H1'    G  26           H1'        G  26  -5.250   8.554  -3.066
  246    H8     G  26           H8         G  26  -5.115   5.201  -4.523
  247    H1     G  26           H1         G  26  -2.768   5.421   1.442
  248    H21    G  26           H21        G  26  -2.303   7.553   1.985
  249    H22    G  26           H22        G  26  -2.596   8.872   0.875
  250    H5'    A  27           H5'        A  27  -1.708  11.233  -3.559
  251   H5''    A  27          H5''        A  27  -0.124  11.945  -3.894
  252    H4'    A  27           H4'        A  27  -0.608  11.986  -1.490
  253    H3'    A  27           H3'        A  27   1.589   9.959  -2.102
  254    H2'    A  27          H2''        A  27   1.783   9.733   0.239
  255   HO2'    A  27           H2'        A  27   0.899  11.236   1.690
  256    H1'    A  27           H1'        A  27  -0.941   9.945   0.792
  257    H8     A  27           H8         A  27  -0.247   7.513  -2.062
  258    H61    A  27           H61        A  27   0.612   3.320   2.435
  259    H62    A  27           H62        A  27   0.438   3.582   0.707
  260    H2     A  27           H2         A  27   0.351   7.376   4.317
  261    H5'    G  28           H5'        G  28   2.897  12.585   0.840
  262   H5''    G  28          H5''        G  28   4.607  13.035   0.761
  263    H4'    G  28           H4'        G  28   4.050  12.157   2.964
  264    H3'    G  28           H3'        G  28   5.803  10.180   1.453
  265    H2'    G  28          H2''        G  28   5.774   8.875   3.390
  266   HO2'    G  28           H2'        G  28   5.199   9.758   5.435
  267    H1'    G  28           H1'        G  28   3.184   9.593   4.224
  268    H8     G  28           H8         G  28   3.404   8.386   0.610
  269    H1     G  28           H1         G  28   3.273   3.675   4.920
  270    H21    G  28           H21        G  28   3.547   4.470   6.961
  271    H22    G  28           H22        G  28   3.743   6.178   7.275
  272    H5'    C  29           H5'        C  29   7.293  10.702   5.207
  273   H5''    C  29          H5''        C  29   9.046  10.920   5.346
  274    H4'    C  29           H4'        C  29   8.266   9.131   6.836
  275    H3'    C  29           H3'        C  29   9.926   8.045   4.529
  276    H2'    C  29          H2''        C  29   9.684   5.922   5.495
  277   HO2'    C  29           H2'        C  29   9.029   7.295   7.915
  278    H1'    C  29           H1'        C  29   7.123   6.364   6.628
  279    H41    C  29           H41        C  29   6.308   2.245   1.868
  280    H42    C  29           H42        C  29   6.278   3.570   0.721
  281    H5     C  29           H5         C  29   6.744   5.851   1.333
  282    H6     C  29           H6         C  29   7.351   7.351   3.171
  283    H5'    C  30           H5'        C  30  11.291   6.479   8.050
  284   H5''    C  30          H5''        C  30  13.043   6.553   8.325
  285    H4'    C  30           H4'        C  30  12.205   4.265   8.638
  286    H3'    C  30           H3'        C  30  13.917   4.571   6.143
  287    H2'    C  30          H2''        C  30  13.719   2.251   5.847
  288   HO2'    C  30           H2'        C  30  13.170   0.849   7.514
  289    H1'    C  30           H1'        C  30  11.086   2.048   6.828
  290    H41    C  30           H41        C  30  10.706   1.387   0.528
  291    H42    C  30           H42        C  30  10.678   3.126   0.338
  292    H5     C  30           H5         C  30  11.010   4.657   2.166
  293    H6     C  30           H6         C  30  11.425   4.842   4.555
  294    H5'    U  31           H5'        U  31  18.357   2.182   6.628
  295   H5''    U  31          H5''        U  31  17.494   2.972   5.290
  296    H4'    U  31           H4'        U  31  17.174   0.082   6.178
  297    H3'    U  31           H3'        U  31  19.075   1.194   4.350
  298    H2'    U  31          H2''        U  31  17.771   1.299   2.474
  299   HO2'    U  31           H2'        U  31  18.169  -0.455   1.389
  300    H1'    U  31           H1'        U  31  15.772  -0.717   3.392
  301    H3     U  31           H3         U  31  12.682   0.767   0.488
  302    H5     U  31           H5         U  31  14.873   4.259   1.361
  303    H6     U  31           H6         U  31  16.249   2.946   2.864
  304    H5'    G  32           H5'        G  32  19.912  -4.370   3.662
  305   H5''    G  32          H5''        G  32  20.246  -3.932   1.971
  306    H4'    G  32           H4'        G  32  18.744  -5.810   1.973
  307    H3'    G  32           H3'        G  32  18.046  -3.510   0.601
  308    H2'    G  32          H2''        G  32  16.491  -2.681   2.177
  309   HO2'    G  32           H2'        G  32  14.427  -3.260   1.505
  310    H1'    G  32           H1'        G  32  15.491  -5.441   2.859
  311    H8     G  32           H8         G  32  17.054  -2.261   4.511
  312    H1     G  32           H1         G  32  11.812  -4.590   7.376
  313    H21    G  32           H21        G  32  11.103  -6.403   6.314
  314    H22    G  32           H22        G  32  11.911  -7.041   4.899
  315    H5'    G  33           H5'        G  33  14.328  -5.107   0.138
  316   H5''    G  33          H5''        G  33  14.094  -5.954  -1.401
  317    H4'    G  33           H4'        G  33  12.130  -4.524  -0.879
  318    H3'    G  33           H3'        G  33  13.464  -4.461  -3.345
  319    H2'    G  33          H2''        G  33  14.566  -2.423  -3.076
  320   HO2'    G  33           H2'        G  33  12.220  -2.199  -4.351
  321    H1'    G  33           H1'        G  33  12.285  -1.234  -1.513
  322    H8     G  33           H8         G  33  15.645  -1.999   0.080
  323    H1     G  33           H1         G  33  15.127   4.041  -2.000
  324    H21    G  33           H21        G  33  13.294   4.269  -3.228
  325    H22    G  33           H22        G  33  12.195   2.943  -3.532
  326    H5'    G  34           H5'        G  34  12.077  -6.282  -2.107
  327   H5''    G  34          H5''        G  34  11.254  -7.720  -2.688
  328    H4'    G  34           H4'        G  34  11.180  -7.686  -0.251
  329    H3'    G  34           H3'        G  34   8.881  -7.984  -1.804
  330    H2'    G  34          H2''        G  34   7.940  -5.906  -1.477
  331   HO2'    G  34           H2'        G  34   7.112  -6.277   1.053
  332    H1'    G  34           H1'        G  34   8.987  -5.660   1.334
  333    H8     G  34           H8         G  34   8.016  -3.837  -1.927
  334    H1     G  34           H1         G  34   9.706   0.094   2.797
  335    H21    G  34           H21        G  34  10.498  -1.063   4.531
  336    H22    G  34           H22        G  34  10.675  -2.803   4.500
  337    H5'    A  35           H5'        A  35   7.466 -11.401   2.753
  338   H5''    A  35          H5''        A  35   6.854 -11.573   1.098
  339    H4'    A  35           H4'        A  35   7.391  -8.942   2.515
  340    H3'    A  35           H3'        A  35   5.132 -10.500   2.913
  341    H2'    A  35          H2''        A  35   4.328 -10.444   0.692
  342   HO2'    A  35           H2'        A  35   2.811  -8.722   0.525
  343    H1'    A  35           H1'        A  35   5.230  -7.594   0.337
  344    H8     A  35           H8         A  35   5.374  -7.065  -2.195
  345    H61    A  35           H61        A  35   4.780 -12.189  -5.681
  346    H62    A  35           H62        A  35   4.903 -10.444  -5.710
  347    H2     A  35           H2         A  35   4.965 -13.411  -1.375
  348    H5'    G  36           H5'        G  36   6.108  -7.842   5.715
  349   H5''    G  36          H5''        G  36   4.800  -7.909   6.909
  350    H4'    G  36           H4'        G  36   6.429  -6.299   7.642
  351    H3'    G  36           H3'        G  36   3.936  -4.943   6.558
  352    H2'    G  36          H2''        G  36   4.884  -2.911   7.197
  353   HO2'    G  36           H2'        G  36   6.735  -2.882   8.655
  354    H1'    G  36           H1'        G  36   7.551  -3.630   6.705
  355    H8     G  36           H8         G  36   5.539  -4.453   3.616
  356    H1     G  36           H1         G  36   6.907   1.790   4.221
  357    H21    G  36           H21        G  36   7.702   2.224   6.235
  358    H22    G  36           H22        G  36   7.892   0.979   7.447
  359    H5'    C  37           H5'        C  37   4.582  -3.269  10.333
  360   H5''    C  37          H5''        C  37   3.104  -3.177  11.306
  361    H4'    C  37           H4'        C  37   4.174  -0.991  11.241
  362    H3'    C  37           H3'        C  37   1.667  -1.035   9.502
  363    H2'    C  37          H2''        C  37   2.027   1.292   9.254
  364   HO2'    C  37           H2'        C  37   2.856   1.150  11.740
  365    H1'    C  37           H1'        C  37   4.821   1.142   9.147
  366    H41    C  37           H41        C  37   2.869   1.993   3.173
  367    H42    C  37           H42        C  37   2.570   0.281   3.000
  368    H5     C  37           H5         C  37   2.767  -1.278   4.851
  369    H6     C  37           H6         C  37   3.237  -1.489   7.248
  370    H5'    U  38           H5'        U  38   1.079   2.226  11.989
  371   H5''    U  38          H5''        U  38  -0.569   2.354  12.631
  372    H4'    U  38           H4'        U  38   0.053   4.412  11.471
  373    H3'    U  38           H3'        U  38  -2.001   2.854   9.846
  374    H2'    U  38          H2''        U  38  -1.969   4.643   8.341
  375   HO2'    U  38           H2'        U  38  -1.353   6.717   8.903
  376    H1'    U  38           H1'        U  38   0.746   5.338   8.731
  377    H3     U  38           H3         U  38   0.288   4.524   4.268
  378    H5     U  38           H5         U  38   0.376   0.714   6.081
  379    H6     U  38           H6         U  38   0.186   1.810   8.233
  380    H5'    C  39           H5'        C  39  -3.331   6.759  10.289
  381   H5''    C  39          H5''        C  39  -5.069   6.973  10.570
  382    H4'    C  39           H4'        C  39  -4.295   8.298   8.648
  383    H3'    C  39           H3'        C  39  -6.099   6.012   7.749
  384    H2'    C  39          H2''        C  39  -5.846   6.842   5.581
  385   HO2'    C  39           H2'        C  39  -5.372   8.984   5.140
  386    H1'    C  39           H1'        C  39  -3.253   7.918   5.961
  387    H41    C  39           H41        C  39  -2.748   3.125   1.841
  388    H42    C  39           H42        C  39  -2.781   1.949   3.136
  389    H5     C  39           H5         C  39  -3.149   2.564   5.464
  390    H6     C  39           H6         C  39  -3.646   4.441   6.984
  391    H5'    U  40           H5'        U  40  -7.286   9.438   5.920
  392   H5''    U  40          H5''        U  40  -9.028   9.769   5.869
  393    H4'    U  40           H4'        U  40  -8.045   9.851   3.611
  394    H3'    U  40           H3'        U  40  -9.872   7.448   3.989
  395    H2'    U  40          H2''        U  40  -9.501   6.946   1.724
  396   HO2'    U  40           H2'        U  40  -9.105   8.436   0.235
  397    H1'    U  40           H1'        U  40  -6.830   7.717   1.647
  398    H3     U  40           H3         U  40  -6.920   3.184   0.802
  399    H5     U  40           H5         U  40  -7.387   3.565   4.980
  400    H6     U  40           H6         U  40  -7.635   5.949   4.680
  401    H5'    C  41           H5'        C  41 -11.013   9.489   0.512
  402   H5''    C  41          H5''        C  41 -12.760   9.717   0.300
  403    H4'    C  41           H4'        C  41 -11.793   8.673  -1.689
  404    H3'    C  41           H3'        C  41 -13.480   6.695  -0.100
  405    H2'    C  41          H2''        C  41 -13.087   5.175  -1.861
  406   HO2'    C  41           H2'        C  41 -11.771   6.988  -3.527
  407    H1'    C  41           H1'        C  41 -10.454   5.917  -2.322
  408    H41    C  41           H41        C  41 -10.149   0.640   1.240
  409    H42    C  41           H42        C  41 -10.378   1.601   2.683
  410    H5     C  41           H5         C  41 -10.900   3.936   2.634
  411    H6     C  41           H6         C  41 -11.287   5.886   1.200
  412    H5'    U  42           H5'        U  42 -14.822   6.427  -3.993
  413   H5''    U  42          H5''        U  42 -16.587   6.389  -4.173
  414    H4'    U  42           H4'        U  42 -15.576   4.448  -5.272
  415    H3'    U  42           H3'        U  42 -17.043   3.642  -2.726
  416    H2'    U  42          H2''        U  42 -16.560   1.417  -3.319
  417   HO2'    U  42           H2'        U  42 -15.997   0.791  -5.388
  418    H1'    U  42           H1'        U  42 -14.026   1.927  -4.366
  419    H3     U  42           H3         U  42 -13.363  -0.790  -0.744
  420    H5     U  42           H5         U  42 -13.951   3.059   0.861
  421    H6     U  42           H6         U  42 -14.644   3.797  -1.340
  422    H5'    G  43           H5'        G  43 -18.443   1.182  -5.757
  423   H5''    G  43          H5''        G  43 -20.194   0.901  -5.744
  424    H4'    G  43           H4'        G  43 -18.998  -1.225  -5.735
  425    H3'    G  43           H3'        G  43 -20.296  -0.690  -3.033
  426    H2'    G  43          H2''        G  43 -19.543  -2.814  -2.396
  427   HO2'    G  43           H2'        G  43 -18.559  -3.712  -4.797
  428    H1'    G  43           H1'        G  43 -17.143  -2.746  -3.815
  429    H8     G  43           H8         G  43 -17.710   0.437  -1.794
  430    H1     G  43           H1         G  43 -15.392  -4.421   1.657
  431    H21    G  43           H21        G  43 -15.530  -6.324   0.485
  432    H22    G  43           H22        G  43 -16.176  -6.369  -1.139
  433    H5'    C  44           H5'        C  44 -21.405  -4.502  -4.247
  434   H5''    C  44          H5''        C  44 -23.103  -4.922  -3.962
  435    H4'    C  44           H4'        C  44 -21.630  -6.606  -2.975
  436    H3'    C  44           H3'        C  44 -22.977  -4.923  -0.826
  437    H2'    C  44          H2''        C  44 -21.953  -6.348   0.737
  438   HO2'    C  44           H2'        C  44 -21.142  -8.166  -1.281
  439    H1'    C  44           H1'        C  44 -19.584  -6.730  -0.695
  440    H41    C  44           H41        C  44 -18.199  -2.620   3.966
  441    H42    C  44           H42        C  44 -18.837  -1.301   3.009
  442    H5     C  44           H5         C  44 -19.957  -1.630   0.894
  443    H6     C  44           H6         C  44 -20.751  -3.301  -0.712
  444    H5'    C  45           H5'        C  45 -23.515  -8.873   0.162
  445   H5''    C  45          H5''        C  45 -25.171  -9.307   0.630
  446    H4'    C  45           H4'        C  45 -23.592 -10.041   2.350
  447    H3'    C  45           H3'        C  45 -25.276  -7.670   3.201
  448   HO3'    C  45           H3T        C  45 -26.624  -9.226   3.817
  449    H2'    C  45          H2''        C  45 -24.251  -7.737   5.284
  450   HO2'    C  45           H2'        C  45 -24.012 -10.471   4.693
  451    H1'    C  45           H1'        C  45 -21.765  -8.805   4.369
  452    H41    C  45           H41        C  45 -20.568  -2.733   6.086
  453    H42    C  45           H42        C  45 -21.286  -2.200   4.590
  454    H5     C  45           H5         C  45 -22.360  -3.653   3.034
  455    H6     C  45           H6         C  45 -23.046  -5.950   2.564
  Start of MODEL    2
    1    H1   DAB   1           H        DAB   1  -3.460  -8.740  -1.154
    2    HA   DAB   1           HA       DAB   1  -4.046  -7.942  -3.961
    3    HB2  DAB   1           HB2      DAB   1  -3.617  -5.815  -1.953
    4    HB3  DAB   1           HB3      DAB   1  -4.839  -5.949  -3.216
    5    HG2  DAB   1           HG2      DAB   1  -6.028  -7.659  -1.827
    6    HG3  DAB   1           HG3      DAB   1  -4.841  -7.400  -0.549
    7    HD1  DAB   1           HD1      DAB   1  -6.768  -6.079  -0.110
    8    HD2  DAB   1           HD2      DAB   1  -6.725  -5.387  -1.660
    9    HD3  DAB   1           HD3      DAB   1  -5.500  -5.034  -0.536
   10    H    VAL   2           H        VAL   2  -2.550  -6.705  -5.089
   11    HA   VAL   2           HA       VAL   2   0.138  -6.521  -3.915
   12    HB   VAL   2           HB       VAL   2   1.167  -7.403  -5.800
   13   HG11  VAL   2          HG11      VAL   2  -0.239  -9.032  -4.404
   14   HG12  VAL   2          HG12      VAL   2   0.250  -9.583  -6.005
   15   HG13  VAL   2          HG13      VAL   2  -1.393  -9.002  -5.737
   16   HG21  VAL   2          HG21      VAL   2   0.113  -6.228  -7.585
   17   HG22  VAL   2          HG22      VAL   2  -1.480  -6.855  -7.161
   18   HG23  VAL   2          HG23      VAL   2  -0.276  -7.922  -7.883
   19    H    ARG   3           H        ARG   3   1.175  -4.585  -4.119
   20    HA   ARG   3           HA       ARG   3   0.263  -2.783  -6.280
   21    HB2  ARG   3           HB2      ARG   3   0.234  -2.199  -3.315
   22    HB3  ARG   3           HB3      ARG   3   0.217  -0.937  -4.546
   23    HG2  ARG   3           HG2      ARG   3  -2.014  -1.162  -4.419
   24    HG3  ARG   3           HG3      ARG   3  -1.790  -2.554  -5.455
   25    HD2  ARG   3           HD2      ARG   3  -3.147  -3.314  -3.645
   26    HD3  ARG   3           HD3      ARG   3  -1.532  -3.942  -3.330
   27    HE   ARG   3           HE       ARG   3  -1.519  -2.670  -1.401
   28   HH11  ARG   3          HH11      ARG   3  -2.213  -1.005  -0.036
   29   HH12  ARG   3          HH12      ARG   3  -3.445   0.092  -0.565
   30   HH21  ARG   3          HH21      ARG   3  -3.740  -1.354  -3.706
   31   HH22  ARG   3          HH22      ARG   3  -4.313  -0.108  -2.649
   32    H    THR   4           H        THR   4   1.663  -0.831  -6.388
   33    HA   THR   4           HA       THR   4   4.230  -1.045  -5.132
   34    HB   THR   4           HB       THR   4   4.371  -2.570  -7.139
   35    HG1  THR   4           HG1      THR   4   6.307  -1.500  -7.925
   36   HG21  THR   4          HG21      THR   4   2.887  -0.822  -8.442
   37   HG22  THR   4          HG22      THR   4   4.117  -1.755  -9.295
   38   HG23  THR   4          HG23      THR   4   4.448  -0.091  -8.813
   39    H    ARG   5           H        ARG   5   5.724   0.751  -5.857
   40    HA   ARG   5           HA       ARG   5   4.473   3.033  -7.081
   41    HB2  ARG   5           HB2      ARG   5   4.883   4.441  -4.955
   42    HB3  ARG   5           HB3      ARG   5   3.438   3.436  -5.016
   43    HG2  ARG   5           HG2      ARG   5   5.357   1.720  -3.947
   44    HG3  ARG   5           HG3      ARG   5   5.754   3.267  -3.213
   45    HD2  ARG   5           HD2      ARG   5   3.087   1.832  -3.157
   46    HD3  ARG   5           HD3      ARG   5   4.173   2.119  -1.803
   47    HE   ARG   5           HE       ARG   5   2.777   4.268  -3.251
   48   HH11  ARG   5          HH11      ARG   5   2.142   5.992  -1.906
   49   HH12  ARG   5          HH12      ARG   5   2.451   5.910  -0.191
   50   HH21  ARG   5          HH21      ARG   5   3.918   2.777  -0.355
   51   HH22  ARG   5          HH22      ARG   5   3.436   4.085   0.666
   52    H    LYS   6           H        LYS   6   6.050   4.038  -8.162
   53    HA   LYS   6           HA       LYS   6   8.216   4.457  -8.898
   54    HB2  LYS   6           HB2      LYS   6   7.873   5.536  -6.140
   55    HB3  LYS   6           HB3      LYS   6   9.462   5.644  -6.883
   56    HG2  LYS   6           HG2      LYS   6   8.819   7.273  -8.334
   57    HG3  LYS   6           HG3      LYS   6   7.299   6.464  -8.712
   58    HD2  LYS   6           HD2      LYS   6   6.455   7.241  -6.423
   59    HD3  LYS   6           HD3      LYS   6   7.888   8.258  -6.339
   60    HE2  LYS   6           HE2      LYS   6   7.121   9.272  -8.585
   61    HE3  LYS   6           HE1      LYS   6   5.587   8.437  -8.312
   62    HZ1  LYS   6           HZ1      LYS   6   6.465   9.834  -5.989
   63    HZ2  LYS   6           HZ2      LYS   6   4.988   9.942  -6.824
   64    HZ3  LYS   6           HZ3      LYS   6   6.317  10.878  -7.318
   65    H    GLY   7           H        GLY   7   8.239   1.861  -8.612
   66    HA2  GLY   7           HA2      GLY   7   9.910   0.250  -8.596
   67    HA3  GLY   7           HA3      GLY   7  10.923   1.337  -7.660
   68    H    ARG   8           H        ARG   8   8.799   1.809  -5.693
   69    HA   ARG   8           HA       ARG   8   9.431  -0.362  -3.929
   70    HB2  ARG   8           HB2      ARG   8   7.488   1.928  -3.629
   71    HB3  ARG   8           HB3      ARG   8   7.904   0.833  -2.342
   72    HG2  ARG   8           HG2      ARG   8  10.086   1.711  -2.138
   73    HG3  ARG   8           HG3      ARG   8  10.076   2.342  -3.789
   74    HD2  ARG   8           HD2      ARG   8   7.990   3.461  -2.002
   75    HD3  ARG   8           HD3      ARG   8   9.648   3.882  -1.586
   76    HE   ARG   8           HE       ARG   8   8.206   4.689  -3.989
   77   HH11  ARG   8          HH11      ARG   8   9.286   6.264  -5.224
   78   HH12  ARG   8          HH12      ARG   8  10.948   6.625  -4.892
   79   HH21  ARG   8          HH21      ARG   8  11.206   4.328  -2.309
   80   HH22  ARG   8          HH22      ARG   8  12.036   5.529  -3.243
   81    H    ARG   9           H        ARG   9   8.617  -2.282  -4.594
   82    HA   ARG   9           HA       ARG   9   5.801  -2.541  -5.333
   83    HB2  ARG   9           HB2      ARG   9   7.844  -4.740  -5.167
   84    HB3  ARG   9           HB3      ARG   9   6.352  -4.717  -6.102
   85    HG2  ARG   9           HG2      ARG   9   7.942  -2.448  -6.923
   86    HG3  ARG   9           HG3      ARG   9   8.974  -3.874  -6.923
   87    HD2  ARG   9           HD2      ARG   9   6.269  -3.744  -8.277
   88    HD3  ARG   9           HD3      ARG   9   7.812  -3.534  -9.102
   89    HE   ARG   9           HE       ARG   9   8.215  -5.899  -7.962
   90   HH11  ARG   9          HH11      ARG   9   7.488  -7.914  -8.688
   91   HH12  ARG   9          HH12      ARG   9   6.028  -8.022  -9.614
   92   HH21  ARG   9          HH21      ARG   9   5.415  -4.610  -9.532
   93   HH22  ARG   9          HH22      ARG   9   4.854  -6.149 -10.091
   94    H    ILE  10           H        ILE  10   4.342  -2.773  -3.730
   95    HA   ILE  10           HA       ILE  10   5.204  -4.359  -1.366
   96    HB   ILE  10           HB       ILE  10   3.901  -2.924   0.028
   97   HG12  ILE  10          HG12      ILE  10   2.698  -2.104  -2.579
   98   HG13  ILE  10          HG13      ILE  10   1.948  -2.220  -0.988
   99   HG21  ILE  10          HG21      ILE  10   5.155  -0.898  -0.220
  100   HG22  ILE  10          HG22      ILE  10   5.269  -1.105  -1.972
  101   HG23  ILE  10          HG23      ILE  10   6.179  -2.171  -0.890
  102   HD11  ILE  10          HD11      ILE  10   2.035   0.115  -1.536
  103   HD12  ILE  10          HD12      ILE  10   3.721  -0.029  -2.052
  104   HD13  ILE  10          HD13      ILE  10   3.309  -0.174  -0.342
  105    H    4J5  11           H        NOR  11   3.968  -6.031  -0.796
  106    HA   4J5  11           HA       NOR  11   1.426  -6.357  -2.233
  107    HD   4J5  11           HD       NOR  11   3.893 -10.150  -3.093
  108    HB2  4J5  11           HB2      NOR  11   2.963  -8.660  -1.075
  109    HB3  4J5  11           HB3      NOR  11   1.713  -8.680  -2.322
  110    HG2  4J5  11           HG2      NOR  11   3.293  -7.356  -3.804
  111    HG3  4J5  11           HG3      NOR  11   4.551  -7.618  -2.606
  112   HH11  4J5  11          HH11      NOR  11   4.137  -7.463  -5.288
  113   HH12  4J5  11          HH12      NOR  11   4.544  -8.452  -6.648
  114   HH21  4J5  11          HH21      NOR  11   4.410 -11.427  -4.872
  115   HH22  4J5  11          HH22      NOR  11   4.701 -10.695  -6.414
  116    H    ILE  12           H        ILE  12  -0.385  -6.621  -1.205
  117    HA   ILE  12           HA       ILE  12  -0.236  -6.814   1.747
  118    HB   ILE  12           HB       ILE  12  -2.831  -5.929   0.945
  119   HG12  ILE  12          HG12      ILE  12  -1.542  -5.294  -1.205
  120   HG13  ILE  12          HG13      ILE  12  -2.434  -4.008  -0.398
  121   HG21  ILE  12          HG21      ILE  12  -2.023  -3.816   2.115
  122   HG22  ILE  12          HG22      ILE  12  -0.454  -4.605   2.274
  123   HG23  ILE  12          HG23      ILE  12  -1.876  -5.305   3.050
  124   HD11  ILE  12          HD11      ILE  12   0.445  -4.469   0.328
  125   HD12  ILE  12          HD12      ILE  12  -0.503  -2.985   0.417
  126   HD13  ILE  12          HD13      ILE  12   0.048  -3.588  -1.146
  127    HA   DPR  13           HA       DPR  13  -2.551 -10.517   2.086
  128    HB2  DPR  13           HB2      DPR  13  -1.085 -12.322   2.257
  129    HB3  DPR  13           HB3      DPR  13  -0.139 -11.806   0.844
  130    HG2  DPR  13           HG2      DPR  13  -0.049 -10.827   3.641
  131    HG3  DPR  13           HG3      DPR  13   1.257 -11.014   2.459
  132    HD2  DPR  13           HD2      DPR  13  -0.057  -8.611   3.078
  133    HD3  DPR  13           HD3      DPR  13   0.966  -8.897   1.655
  134    HA   PRO  14           HA       PRO  14  -3.919 -12.044  -1.917
  135    HB2  PRO  14           HB2      PRO  14  -6.444 -11.047  -1.926
  136    HB3  PRO  14           HB3      PRO  14  -5.957 -12.404  -0.891
  137    HG2  PRO  14           HG2      PRO  14  -6.335  -9.535  -0.199
  138    HG3  PRO  14           HG3      PRO  14  -6.746 -10.986   0.730
  139    HD2  PRO  14           HD2      PRO  14  -4.495  -9.448   1.193
  140    HD3  PRO  14           HD3      PRO  14  -4.646 -11.166   1.630
  141    H5'    G  17           H5'        G  17 -15.988  -2.399  15.798
  142   H5''    G  17          H5''        G  17 -14.383  -3.097  15.526
  143    H4'    G  17           H4'        G  17 -16.037  -4.829  15.245
  144    H3'    G  17           H3'        G  17 -14.833  -3.940  12.601
  145    H2'    G  17          H2''        G  17 -16.093  -5.626  11.553
  146   HO2'    G  17           H2'        G  17 -17.304  -6.929  13.518
  147    H1'    G  17           H1'        G  17 -18.369  -5.347  13.100
  148    H8     G  17           H8         G  17 -17.197  -1.879  12.260
  149    H1     G  17           H1         G  17 -20.221  -4.795   7.419
  150    H21    G  17           H21        G  17 -20.475  -6.927   7.845
  151    H22    G  17           H22        G  17 -19.909  -7.665   9.326
  152   HO5'    G  17           H5T        G  17 -14.431  -2.215  13.429
  153    H5'    G  18           H5'        G  18 -14.681  -8.035  12.628
  154   H5''    G  18          H5''        G  18 -13.139  -8.745  12.119
  155    H4'    G  18           H4'        G  18 -14.973  -9.656  10.785
  156    H3'    G  18           H3'        G  18 -13.232  -7.765   9.146
  157    H2'    G  18          H2''        G  18 -14.549  -8.364   7.291
  158   HO2'    G  18           H2'        G  18 -16.205 -10.209   7.933
  159    H1'    G  18           H1'        G  18 -16.958  -8.542   8.661
  160    H8     G  18           H8         G  18 -15.101  -5.357   9.602
  161    H1     G  18           H1         G  18 -18.247  -4.952   4.040
  162    H21    G  18           H21        G  18 -18.916  -6.968   3.390
  163    H22    G  18           H22        G  18 -18.600  -8.407   4.335
  164    H5'    C  19           H5'        C  19 -13.651 -11.249   6.982
  165   H5''    C  19          H5''        C  19 -12.175 -11.850   6.208
  166    H4'    C  19           H4'        C  19 -13.967 -11.593   4.560
  167    H3'    C  19           H3'        C  19 -11.815  -9.467   4.175
  168    H2'    C  19          H2''        C  19 -13.020  -8.797   2.265
  169   HO2'    C  19           H2'        C  19 -14.965 -10.413   1.829
  170    H1'    C  19           H1'        C  19 -15.560  -9.277   3.327
  171    H41    C  19           H41        C  19 -14.734  -2.975   3.502
  172    H42    C  19           H42        C  19 -13.854  -3.118   5.007
  173    H5     C  19           H5         C  19 -13.261  -5.241   5.991
  174    H6     C  19           H6         C  19 -13.327  -7.670   5.701
  175    H5'    A  20           H5'        A  20 -12.503 -11.162   0.508
  176   H5''    A  20          H5''        A  20 -11.042 -11.543  -0.420
  177    H4'    A  20           H4'        A  20 -12.554 -10.190  -1.770
  178    H3'    A  20           H3'        A  20 -10.125  -8.581  -0.882
  179    H2'    A  20          H2''        A  20 -10.953  -6.835  -2.230
  180   HO2'    A  20           H2'        A  20 -13.022  -8.354  -3.353
  181    H1'    A  20           H1'        A  20 -13.640  -7.242  -1.673
  182    H8     A  20           H8         A  20 -11.547  -7.344   1.516
  183    H61    A  20           H61        A  20 -12.196  -1.194   1.608
  184    H62    A  20           H62        A  20 -11.697  -2.602   2.516
  185    H2     A  20           H2         A  20 -13.589  -2.670  -2.372
  186    H5'    G  21           H5'        G  21 -10.504  -8.183  -5.020
  187   H5''    G  21          H5''        G  21  -8.979  -8.261  -5.920
  188    H4'    G  21           H4'        G  21 -10.185  -6.221  -6.484
  189    H3'    G  21           H3'        G  21  -7.741  -5.601  -4.775
  190    H2'    G  21          H2''        G  21  -8.255  -3.332  -5.072
  191   HO2'    G  21           H2'        G  21 -10.105  -4.026  -7.128
  192    H1'    G  21           H1'        G  21 -11.041  -3.652  -5.083
  193    H8     G  21           H8         G  21  -9.350  -5.441  -2.172
  194    H1     G  21           H1         G  21 -10.220   0.810  -1.230
  195    H21    G  21           H21        G  21 -10.789   1.816  -3.121
  196    H22    G  21           H22        G  21 -10.975   0.930  -4.617
  197    H5'    A  22           H5'        A  22  -7.672  -2.973  -7.835
  198   H5''    A  22          H5''        A  22  -6.115  -2.815  -8.667
  199    H4'    A  22           H4'        A  22  -6.907  -0.615  -7.978
  200    H3'    A  22           H3'        A  22  -4.535  -1.579  -6.335
  201    H2'    A  22          H2''        A  22  -4.577   0.446  -5.182
  202   HO2'    A  22           H2'        A  22  -5.872   1.442  -7.514
  203    H1'    A  22           H1'        A  22  -7.387   0.900  -5.415
  204    H8     A  22           H8         A  22  -6.550  -2.479  -3.891
  205    H61    A  22           H61        A  22  -6.338   0.445   1.531
  206    H62    A  22           H62        A  22  -6.377  -1.102   0.714
  207    H2     A  22           H2         A  22  -6.437   3.550  -1.749
  208    H5'    U  23           H5'        U  23  -3.580   2.416  -7.827
  209   H5''    U  23          H5''        U  23  -2.519   2.107  -9.213
  210    H4'    U  23           H4'        U  23  -1.844   4.181  -8.201
  211    H3'    U  23           H3'        U  23  -0.024   1.907  -8.312
  212    H2'    U  23          H2''        U  23   0.623   1.946  -6.099
  213   HO2'    U  23           H2'        U  23   1.709   4.356  -5.879
  214    H1'    U  23           H1'        U  23  -0.292   4.769  -5.657
  215    H3     U  23           H3         U  23  -0.316   4.414  -1.258
  216    H5     U  23           H5         U  23  -1.379   0.565  -2.391
  217    H6     U  23           H6         U  23  -1.129   1.234  -4.713
  218    H5'    C  24           H5'        C  24   3.617   5.164  -7.231
  219   H5''    C  24          H5''        C  24   1.971   5.458  -7.779
  220    H4'    C  24           H4'        C  24   3.287   7.382  -8.347
  221    H3'    C  24           H3'        C  24   1.974   6.009 -10.425
  222    H2'    C  24          H2''        C  24   3.878   5.175 -11.498
  223   HO2'    C  24           H2'        C  24   3.811   6.391 -13.211
  224    H1'    C  24           H1'        C  24   5.493   7.585 -10.660
  225    H41    C  24           H41        C  24  10.353   3.748 -12.131
  226    H42    C  24           H42        C  24   9.422   2.322 -11.733
  227    H5     C  24           H5         C  24   7.128   2.417 -10.985
  228    H6     C  24           H6         C  24   5.296   3.880 -10.319
  229    H5'    U  25           H5'        U  25   0.534   6.123 -12.041
  230   H5''    U  25          H5''        U  25  -1.158   6.601 -12.219
  231    H4'    U  25           H4'        U  25  -0.687   4.887 -10.416
  232    H3'    U  25           H3'        U  25  -2.574   6.968 -10.297
  233    H2'    U  25          H2''        U  25  -1.430   8.355  -8.804
  234   HO2'    U  25           H2'        U  25  -2.187   6.388  -6.903
  235    H1'    U  25           H1'        U  25  -0.250   5.988  -7.391
  236    H3     U  25           H3         U  25   1.963  10.737  -8.315
  237    H5     U  25           H5         U  25   2.893   8.284  -5.007
  238    H6     U  25           H6         U  25   1.359   6.636  -5.888
  239    H5'    G  26           H5'        G  26  -6.104   7.011  -7.446
  240   H5''    G  26          H5''        G  26  -4.774   8.090  -7.907
  241    H4'    G  26           H4'        G  26  -5.660   8.784  -5.771
  242    H3'    G  26           H3'        G  26  -2.955   7.441  -5.423
  243    H2'    G  26          H2''        G  26  -3.073   7.921  -3.163
  244   HO2'    G  26           H2'        G  26  -4.186   9.645  -2.357
  245    H1'    G  26           H1'        G  26  -5.882   7.742  -2.951
  246    H8     G  26           H8         G  26  -4.578   4.563  -4.492
  247    H1     G  26           H1         G  26  -3.589   4.982   1.815
  248    H21    G  26           H21        G  26  -4.063   7.063   2.518
  249    H22    G  26           H22        G  26  -4.569   8.317   1.407
  250    H5'    A  27           H5'        A  27  -2.949  11.026  -3.321
  251   H5''    A  27          H5''        A  27  -1.503  12.009  -3.564
  252    H4'    A  27           H4'        A  27  -2.006  11.853  -1.190
  253    H3'    A  27           H3'        A  27   0.465  10.194  -1.858
  254    H2'    A  27          H2''        A  27   0.688   9.831   0.448
  255   HO2'    A  27           H2'        A  27  -0.778  12.201   0.618
  256    H1'    A  27           H1'        A  27  -2.026   9.650   1.013
  257    H8     A  27           H8         A  27  -1.193   7.469  -1.976
  258    H61    A  27           H61        A  27   0.351   3.209   2.269
  259    H62    A  27           H62        A  27   0.040   3.500   0.563
  260    H2     A  27           H2         A  27  -0.190   7.110   4.338
  261    H5'    G  28           H5'        G  28   1.380  12.767   1.318
  262   H5''    G  28          H5''        G  28   3.006  13.464   1.259
  263    H4'    G  28           H4'        G  28   2.621  12.405   3.419
  264    H3'    G  28           H3'        G  28   4.587  10.740   1.782
  265    H2'    G  28          H2''        G  28   4.798   9.391   3.690
  266   HO2'    G  28           H2'        G  28   3.404  10.632   5.583
  267    H1'    G  28           H1'        G  28   2.140   9.647   4.533
  268    H8     G  28           H8         G  28   2.446   8.715   0.843
  269    H1     G  28           H1         G  28   3.142   3.772   4.834
  270    H21    G  28           H21        G  28   3.348   4.458   6.911
  271    H22    G  28           H22        G  28   3.310   6.152   7.340
  272    H5'    C  29           H5'        C  29   6.200  11.219   5.525
  273   H5''    C  29          H5''        C  29   7.922  11.629   5.548
  274    H4'    C  29           H4'        C  29   7.491   9.683   6.965
  275    H3'    C  29           H3'        C  29   9.002   8.916   4.434
  276    H2'    C  29          H2''        C  29   9.064   6.730   5.237
  277   HO2'    C  29           H2'        C  29   8.278   7.185   7.849
  278    H1'    C  29           H1'        C  29   6.653   6.898   6.781
  279    H41    C  29           H41        C  29   5.429   2.741   2.152
  280    H42    C  29           H42        C  29   5.153   4.059   1.033
  281    H5     C  29           H5         C  29   5.561   6.373   1.588
  282    H6     C  29           H6         C  29   6.346   7.903   3.330
  283    H5'    C  30           H5'        C  30  10.969   7.183   7.571
  284   H5''    C  30          H5''        C  30  12.699   7.571   7.651
  285    H4'    C  30           H4'        C  30  12.434   5.172   7.851
  286    H3'    C  30           H3'        C  30  13.929   6.304   5.635
  287    H2'    C  30          H2''        C  30  12.838   5.186   3.933
  288   HO2'    C  30           H2'        C  30  14.404   3.728   3.786
  289    H1'    C  30           H1'        C  30  11.711   3.070   5.729
  290    H41    C  30           H41        C  30   7.276   2.695   1.206
  291    H42    C  30           H42        C  30   7.595   4.335   0.685
  292    H5     C  30           H5         C  30   9.185   5.754   1.717
  293    H6     C  30           H6         C  30  10.867   5.946   3.445
  294    H5'    U  31           H5'        U  31  14.995   2.396   5.222
  295   H5''    U  31          H5''        U  31  16.736   2.060   5.316
  296    H4'    U  31           H4'        U  31  15.808   1.149   3.251
  297    H3'    U  31           H3'        U  31  18.067   2.764   3.201
  298    H2'    U  31          H2''        U  31  17.211   4.715   2.257
  299   HO2'    U  31           H2'        U  31  16.622   3.729  -0.177
  300    H1'    U  31           H1'        U  31  15.026   3.453   0.710
  301    H3     U  31           H3         U  31  12.531   7.152   0.598
  302    H5     U  31           H5         U  31  14.816   7.707   4.095
  303    H6     U  31           H6         U  31  15.775   5.509   3.746
  304    H5'    G  32           H5'        G  32  16.220   2.000  -0.392
  305   H5''    G  32          H5''        G  32  16.871   0.671  -1.339
  306    H4'    G  32           H4'        G  32  15.542   2.584  -2.524
  307    H3'    G  32           H3'        G  32  17.436   0.772  -3.496
  308    H2'    G  32          H2''        G  32  19.305   2.158  -3.433
  309   HO2'    G  32           H2'        G  32  19.593   3.079  -5.487
  310    H1'    G  32           H1'        G  32  17.723   4.601  -4.196
  311    H8     G  32           H8         G  32  19.131   4.283  -0.688
  312    H1     G  32           H1         G  32  23.053   7.312  -4.770
  313    H21    G  32           H21        G  32  22.310   7.098  -6.850
  314    H22    G  32           H22        G  32  20.854   6.210  -7.239
  315    H5'    G  33           H5'        G  33  16.023  -0.729  -5.791
  316   H5''    G  33          H5''        G  33  14.354  -0.692  -6.397
  317    H4'    G  33           H4'        G  33  14.929  -2.980  -5.988
  318    H3'    G  33           H3'        G  33  12.694  -1.858  -4.744
  319    H2'    G  33          H2''        G  33  13.636  -1.695  -2.585
  320   HO2'    G  33           H2'        G  33  12.266  -3.045  -1.739
  321    H1'    G  33           H1'        G  33  15.071  -4.305  -2.966
  322    H8     G  33           H8         G  33  17.132  -1.220  -2.573
  323    H1     G  33           H1         G  33  15.946  -4.142   2.999
  324    H21    G  33           H21        G  33  14.397  -5.708   2.715
  325    H22    G  33           H22        G  33  13.655  -6.023   1.163
  326    H5'    G  34           H5'        G  34  12.883  -5.361  -2.782
  327   H5''    G  34          H5''        G  34  11.782  -6.642  -3.318
  328    H4'    G  34           H4'        G  34  12.106  -6.491  -0.818
  329    H3'    G  34           H3'        G  34   9.753  -7.073  -2.178
  330    H2'    G  34          H2''        G  34   8.671  -5.054  -1.922
  331   HO2'    G  34           H2'        G  34   7.469  -5.067   0.110
  332    H1'    G  34           H1'        G  34   9.786  -4.511   0.786
  333    H8     G  34           H8         G  34   8.854  -3.021  -2.682
  334    H1     G  34           H1         G  34   9.537   1.257   2.004
  335    H21    G  34           H21        G  34  10.309   0.291   3.840
  336    H22    G  34           H22        G  34  10.671  -1.419   3.922
  337    H5'    A  35           H5'        A  35   6.694  -8.690  -1.442
  338   H5''    A  35          H5''        A  35   7.075  -7.050  -0.878
  339    H4'    A  35           H4'        A  35   4.750  -7.446  -0.444
  340    H3'    A  35           H3'        A  35   6.437  -6.740   1.614
  341    H2'    A  35          H2''        A  35   6.584  -8.738   2.731
  342   HO2'    A  35           H2'        A  35   3.950  -8.549   3.584
  343    H1'    A  35           H1'        A  35   3.819  -9.592   2.000
  344    H8     A  35           H8         A  35   7.475 -10.630   2.213
  345    H61    A  35           H61        A  35   5.428 -16.456   2.293
  346    H62    A  35           H62        A  35   6.822 -15.416   2.482
  347    H2     A  35           H2         A  35   1.949 -13.749   1.448
  348    H5'    G  36           H5'        G  36   6.296  -6.388   3.768
  349   H5''    G  36          H5''        G  36   4.662  -6.617   4.415
  350    H4'    G  36           H4'        G  36   6.154  -6.308   6.258
  351    H3'    G  36           H3'        G  36   4.182  -4.186   5.661
  352    H2'    G  36          H2''        G  36   5.243  -2.438   6.735
  353   HO2'    G  36           H2'        G  36   6.205  -4.504   8.387
  354    H1'    G  36           H1'        G  36   7.877  -3.076   6.526
  355    H8     G  36           H8         G  36   6.657  -3.937   3.098
  356    H1     G  36           H1         G  36   7.018   2.430   4.208
  357    H21    G  36           H21        G  36   7.287   2.814   6.376
  358    H22    G  36           H22        G  36   7.369   1.522   7.552
  359    H5'    C  37           H5'        C  37   4.659  -3.494   9.604
  360   H5''    C  37          H5''        C  37   3.162  -3.581  10.557
  361    H4'    C  37           H4'        C  37   4.192  -1.386  10.835
  362    H3'    C  37           H3'        C  37   1.708  -1.249   9.067
  363    H2'    C  37          H2''        C  37   1.984   1.107   9.129
  364   HO2'    C  37           H2'        C  37   3.341   2.120  10.617
  365    H1'    C  37           H1'        C  37   4.746   1.071   8.912
  366    H41    C  37           H41        C  37   2.575   2.164   3.043
  367    H42    C  37           H42        C  37   2.372   0.448   2.776
  368    H5     C  37           H5         C  37   2.711  -1.201   4.525
  369    H6     C  37           H6         C  37   3.255  -1.530   6.893
  370    H5'    U  38           H5'        U  38   1.072   1.675  11.848
  371   H5''    U  38          H5''        U  38  -0.577   1.748  12.493
  372    H4'    U  38           H4'        U  38   0.047   3.892  11.494
  373    H3'    U  38           H3'        U  38  -2.000   2.458   9.745
  374    H2'    U  38          H2''        U  38  -1.979   4.362   8.384
  375   HO2'    U  38           H2'        U  38  -1.278   5.620  10.769
  376    H1'    U  38           H1'        U  38   0.729   5.009   8.790
  377    H3     U  38           H3         U  38   0.192   4.444   4.286
  378    H5     U  38           H5         U  38   0.298   0.541   5.880
  379    H6     U  38           H6         U  38   0.133   1.510   8.092
  380    H5'    C  39           H5'        C  39  -3.231   6.307  10.418
  381   H5''    C  39          H5''        C  39  -4.974   6.575  10.609
  382    H4'    C  39           H4'        C  39  -4.015   7.936   8.782
  383    H3'    C  39           H3'        C  39  -5.881   5.772   7.689
  384    H2'    C  39          H2''        C  39  -5.447   6.661   5.567
  385   HO2'    C  39           H2'        C  39  -4.790   9.034   6.995
  386    H1'    C  39           H1'        C  39  -2.810   7.550   6.147
  387    H41    C  39           H41        C  39  -2.299   2.729   2.029
  388    H42    C  39           H42        C  39  -2.597   1.562   3.298
  389    H5     C  39           H5         C  39  -3.180   2.194   5.563
  390    H6     C  39           H6         C  39  -3.645   4.089   7.060
  391    H5'    U  40           H5'        U  40  -6.857   9.272   5.847
  392   H5''    U  40          H5''        U  40  -8.579   9.698   5.825
  393    H4'    U  40           H4'        U  40  -7.645   9.758   3.557
  394    H3'    U  40           H3'        U  40  -9.553   7.423   3.960
  395    H2'    U  40          H2''        U  40  -9.263   6.912   1.691
  396   HO2'    U  40           H2'        U  40  -8.087   9.491   1.368
  397    H1'    U  40           H1'        U  40  -6.585   7.593   1.535
  398    H3     U  40           H3         U  40  -6.832   3.067   0.700
  399    H5     U  40           H5         U  40  -7.123   3.460   4.891
  400    H6     U  40           H6         U  40  -7.304   5.857   4.599
  401    H5'    C  41           H5'        C  41 -10.672   9.485   0.499
  402   H5''    C  41          H5''        C  41 -12.413   9.769   0.312
  403    H4'    C  41           H4'        C  41 -11.505   8.678  -1.680
  404    H3'    C  41           H3'        C  41 -13.244   6.764  -0.066
  405    H2'    C  41          H2''        C  41 -12.909   5.205  -1.795
  406   HO2'    C  41           H2'        C  41 -11.932   7.360  -3.392
  407    H1'    C  41           H1'        C  41 -10.266   5.889  -2.330
  408    H41    C  41           H41        C  41 -10.007   0.590   1.205
  409    H42    C  41           H42        C  41 -10.196   1.546   2.658
  410    H5     C  41           H5         C  41 -10.662   3.893   2.628
  411    H6     C  41           H6         C  41 -11.048   5.858   1.214
  412    H5'    U  42           H5'        U  42 -14.587   6.510  -3.969
  413   H5''    U  42          H5''        U  42 -16.349   6.525  -4.157
  414    H4'    U  42           H4'        U  42 -15.394   4.556  -5.253
  415    H3'    U  42           H3'        U  42 -16.886   3.781  -2.708
  416    H2'    U  42          H2''        U  42 -16.453   1.542  -3.297
  417   HO2'    U  42           H2'        U  42 -15.667   1.020  -5.435
  418    H1'    U  42           H1'        U  42 -13.917   1.994  -4.369
  419    H3     U  42           H3         U  42 -13.287  -0.770  -0.780
  420    H5     U  42           H5         U  42 -13.804   3.069   0.871
  421    H6     U  42           H6         U  42 -14.496   3.844  -1.318
  422    H5'    G  43           H5'        G  43 -18.331   1.349  -5.752
  423   H5''    G  43          H5''        G  43 -20.088   1.110  -5.742
  424    H4'    G  43           H4'        G  43 -18.941  -1.045  -5.739
  425    H3'    G  43           H3'        G  43 -20.224  -0.493  -3.030
  426    H2'    G  43          H2''        G  43 -19.518  -2.634  -2.394
  427   HO2'    G  43           H2'        G  43 -19.504  -3.113  -5.172
  428    H1'    G  43           H1'        G  43 -17.123  -2.620  -3.831
  429    H8     G  43           H8         G  43 -17.613   0.560  -1.784
  430    H1     G  43           H1         G  43 -15.353  -4.364   1.614
  431    H21    G  43           H21        G  43 -15.540  -6.255   0.434
  432    H22    G  43           H22        G  43 -16.200  -6.277  -1.186
  433    H5'    C  44           H5'        C  44 -21.391  -4.287  -4.256
  434   H5''    C  44          H5''        C  44 -23.094  -4.683  -3.973
  435    H4'    C  44           H4'        C  44 -21.642  -6.394  -2.997
  436    H3'    C  44           H3'        C  44 -22.964  -4.709  -0.826
  437    H2'    C  44          H2''        C  44 -21.951  -6.152   0.726
  438   HO2'    C  44           H2'        C  44 -20.874  -8.144  -0.221
  439    H1'    C  44           H1'        C  44 -19.597  -6.567  -0.724
  440    H41    C  44           H41        C  44 -18.089  -2.530   3.959
  441    H42    C  44           H42        C  44 -18.711  -1.191   3.023
  442    H5     C  44           H5         C  44 -19.852  -1.476   0.911
  443    H6     C  44           H6         C  44 -20.707  -3.115  -0.697
  444    H5'    C  45           H5'        C  45 -23.534  -8.670   0.155
  445   H5''    C  45          H5''        C  45 -25.189  -9.089   0.633
  446    H4'    C  45           H4'        C  45 -23.602  -9.854   2.327
  447    H3'    C  45           H3'        C  45 -25.262  -7.484   3.217
  448   HO3'    C  45           H3T        C  45 -26.651  -9.046   3.484
  449    H2'    C  45          H2''        C  45 -24.216  -7.568   5.287
  450   HO2'    C  45           H2'        C  45 -23.621  -9.414   6.234
  451    H1'    C  45           H1'        C  45 -21.750  -8.651   4.340
  452    H41    C  45           H41        C  45 -20.453  -2.613   6.087
  453    H42    C  45           H42        C  45 -21.188  -2.056   4.608
  454    H5     C  45           H5         C  45 -22.300  -3.481   3.052
  455    H6     C  45           H6         C  45 -23.025  -5.765   2.573
  Start of MODEL    3
    1    H1   DAB   1           H        DAB   1  -2.444  -9.197  -1.644
    2    HA   DAB   1           HA       DAB   1  -3.290  -8.183  -4.315
    3    HB2  DAB   1           HB2      DAB   1  -2.964  -6.593  -1.765
    4    HB3  DAB   1           HB3      DAB   1  -3.713  -6.063  -3.271
    5    HG2  DAB   1           HG2      DAB   1  -4.726  -8.203  -1.379
    6    HG3  DAB   1           HG3      DAB   1  -5.492  -6.659  -1.751
    7    HD1  DAB   1           HD1      DAB   1  -6.590  -8.262  -3.045
    8    HD2  DAB   1           HD2      DAB   1  -5.139  -8.993  -3.537
    9    HD3  DAB   1           HD3      DAB   1  -5.554  -7.454  -4.121
   10    H    VAL   2           H        VAL   2  -1.938  -6.843  -5.472
   11    HA   VAL   2           HA       VAL   2   0.822  -6.545  -4.459
   12    HB   VAL   2           HB       VAL   2   0.998  -8.172  -6.154
   13   HG11  VAL   2          HG11      VAL   2  -0.076  -7.832  -8.397
   14   HG12  VAL   2          HG12      VAL   2  -0.894  -6.415  -7.740
   15   HG13  VAL   2          HG13      VAL   2  -1.238  -8.014  -7.084
   16   HG21  VAL   2          HG21      VAL   2   2.396  -7.116  -7.738
   17   HG22  VAL   2          HG22      VAL   2   2.444  -6.018  -6.359
   18   HG23  VAL   2          HG23      VAL   2   1.423  -5.644  -7.748
   19    H    ARG   3           H        ARG   3   1.622  -4.529  -4.392
   20    HA   ARG   3           HA       ARG   3   0.400  -2.498  -6.154
   21    HB2  ARG   3           HB2      ARG   3   0.470  -2.586  -3.169
   22    HB3  ARG   3           HB3      ARG   3   0.653  -1.030  -3.963
   23    HG2  ARG   3           HG2      ARG   3  -1.526  -0.931  -4.487
   24    HG3  ARG   3           HG3      ARG   3  -1.538  -2.552  -5.154
   25    HD2  ARG   3           HD2      ARG   3  -3.030  -2.744  -3.367
   26    HD3  ARG   3           HD3      ARG   3  -1.536  -3.346  -2.674
   27    HE   ARG   3           HE       ARG   3  -1.421  -1.404  -1.341
   28   HH11  ARG   3          HH11      ARG   3  -2.405   0.434  -0.441
   29   HH12  ARG   3          HH12      ARG   3  -3.842   1.078  -1.164
   30   HH21  ARG   3          HH21      ARG   3  -3.919  -1.278  -3.708
   31   HH22  ARG   3          HH22      ARG   3  -4.687   0.110  -3.028
   32    H    THR   4           H        THR   4   1.698  -0.811  -6.697
   33    HA   THR   4           HA       THR   4   4.493  -1.059  -5.863
   34    HB   THR   4           HB       THR   4   3.600  -0.094  -8.569
   35    HG1  THR   4           HG1      THR   4   4.796  -2.582  -8.127
   36   HG21  THR   4          HG21      THR   4   5.983  -0.607  -9.126
   37   HG22  THR   4          HG22      THR   4   6.268  -0.962  -7.424
   38   HG23  THR   4          HG23      THR   4   5.818   0.669  -7.921
   39    H    ARG   5           H        ARG   5   5.690   0.760  -5.498
   40    HA   ARG   5           HA       ARG   5   4.187   3.309  -5.428
   41    HB2  ARG   5           HB2      ARG   5   6.292   2.637  -3.396
   42    HB3  ARG   5           HB3      ARG   5   4.990   3.803  -3.286
   43    HG2  ARG   5           HG2      ARG   5   4.493   0.824  -3.440
   44    HG3  ARG   5           HG3      ARG   5   4.698   1.671  -1.908
   45    HD2  ARG   5           HD2      ARG   5   2.510   1.966  -3.950
   46    HD3  ARG   5           HD3      ARG   5   2.366   1.672  -2.220
   47    HE   ARG   5           HE       ARG   5   2.732   4.214  -3.513
   48   HH11  ARG   5          HH11      ARG   5   2.760   6.032  -2.160
   49   HH12  ARG   5          HH12      ARG   5   2.909   5.827  -0.435
   50   HH21  ARG   5          HH21      ARG   5   3.043   2.360  -0.616
   51   HH22  ARG   5          HH22      ARG   5   3.062   3.742   0.432
   52    H    LYS   6           H        LYS   6   5.229   3.651  -7.513
   53    HA   LYS   6           HA       LYS   6   7.351   3.806  -8.759
   54    HB2  LYS   6           HB2      LYS   6   5.809   5.734  -8.842
   55    HB3  LYS   6           HB3      LYS   6   6.650   6.428  -7.451
   56    HG2  LYS   6           HG2      LYS   6   8.609   6.832  -8.674
   57    HG3  LYS   6           HG3      LYS   6   8.225   5.599  -9.869
   58    HD2  LYS   6           HD2      LYS   6   7.941   7.932 -10.748
   59    HD3  LYS   6           HD3      LYS   6   6.479   6.959 -10.847
   60    HE2  LYS   6           HE2      LYS   6   5.649   8.026  -8.756
   61    HE3  LYS   6           HE1      LYS   6   7.096   9.032  -8.708
   62    HZ1  LYS   6           HZ1      LYS   6   5.404   8.981 -11.111
   63    HZ2  LYS   6           HZ2      LYS   6   6.446  10.204 -10.548
   64    HZ3  LYS   6           HZ3      LYS   6   4.953   9.922  -9.762
   65    H    GLY   7           H        GLY   7   8.682   2.502  -7.272
   66    HA2  GLY   7           HA2      GLY   7  11.128   3.014  -6.859
   67    HA3  GLY   7           HA3      GLY   7  10.527   4.176  -5.683
   68    H    ARG   8           H        ARG   8   8.275   2.042  -5.236
   69    HA   ARG   8           HA       ARG   8   9.819   0.021  -3.809
   70    HB2  ARG   8           HB2      ARG   8   7.617   1.279  -2.238
   71    HB3  ARG   8           HB3      ARG   8   9.075   0.477  -1.695
   72    HG2  ARG   8           HG2      ARG   8  10.433   2.388  -2.093
   73    HG3  ARG   8           HG3      ARG   8   9.205   3.155  -3.095
   74    HD2  ARG   8           HD2      ARG   8   8.328   2.560  -0.338
   75    HD3  ARG   8           HD3      ARG   8   9.620   3.751  -0.463
   76    HE   ARG   8           HE       ARG   8   6.909   4.220  -1.083
   77   HH11  ARG   8          HH11      ARG   8   6.344   6.119  -2.184
   78   HH12  ARG   8          HH12      ARG   8   7.536   6.969  -3.108
   79   HH21  ARG   8          HH21      ARG   8  10.089   4.746  -2.367
   80   HH22  ARG   8          HH22      ARG   8   9.651   6.192  -3.212
   81    H    ARG   9           H        ARG   9   9.025  -1.814  -4.582
   82    HA   ARG   9           HA       ARG   9   6.264  -2.042  -5.413
   83    HB2  ARG   9           HB2      ARG   9   7.132  -4.475  -5.933
   84    HB3  ARG   9           HB3      ARG   9   7.560  -3.134  -6.993
   85    HG2  ARG   9           HG2      ARG   9   9.734  -2.995  -6.173
   86    HG3  ARG   9           HG3      ARG   9   9.313  -3.768  -4.643
   87    HD2  ARG   9           HD2      ARG   9   9.027  -5.316  -7.203
   88    HD3  ARG   9           HD3      ARG   9  10.620  -5.146  -6.466
   89    HE   ARG   9           HE       ARG   9   8.929  -5.949  -4.424
   90   HH11  ARG   9          HH11      ARG   9   8.726  -8.137  -3.868
   91   HH12  ARG   9          HH12      ARG   9   9.094  -9.361  -5.035
   92   HH21  ARG   9          HH21      ARG   9   9.925  -7.097  -7.531
   93   HH22  ARG   9          HH22      ARG   9   9.774  -8.771  -7.115
   94    H    ILE  10           H        ILE  10   4.766  -2.459  -3.869
   95    HA   ILE  10           HA       ILE  10   5.666  -4.196  -1.630
   96    HB   ILE  10           HB       ILE  10   4.311  -2.959  -0.175
   97   HG12  ILE  10          HG12      ILE  10   2.980  -1.845  -2.671
   98   HG13  ILE  10          HG13      ILE  10   2.234  -2.877  -1.441
   99   HG21  ILE  10          HG21      ILE  10   4.874  -0.591  -1.848
  100   HG22  ILE  10          HG22      ILE  10   6.255  -1.668  -1.673
  101   HG23  ILE  10          HG23      ILE  10   5.472  -0.999  -0.244
  102   HD11  ILE  10          HD11      ILE  10   3.251  -0.048  -1.083
  103   HD12  ILE  10          HD12      ILE  10   2.728  -1.080   0.246
  104   HD13  ILE  10          HD13      ILE  10   1.575  -0.591  -0.997
  105    H    4J5  11           H        NOR  11   4.671  -6.037  -1.245
  106    HA   4J5  11           HA       NOR  11   2.175  -6.583  -2.726
  107    HD   4J5  11           HD       NOR  11   1.195  -8.021  -3.657
  108    HB2  4J5  11           HB2      NOR  11   3.989  -8.093  -3.395
  109    HB3  4J5  11           HB3      NOR  11   4.250  -8.520  -1.704
  110    HG2  4J5  11           HG2      NOR  11   2.919 -10.230  -2.880
  111    HG3  4J5  11           HG3      NOR  11   2.039  -9.504  -1.538
  112   HH11  4J5  11          HH11      NOR  11   1.564 -11.411  -3.078
  113   HH12  4J5  11          HH12      NOR  11   0.275 -11.880  -4.135
  114   HH21  4J5  11          HH21      NOR  11  -0.488  -8.636  -5.084
  115   HH22  4J5  11          HH22      NOR  11  -0.887 -10.312  -5.267
  116    H    ILE  12           H        ILE  12   0.392  -6.881  -1.579
  117    HA   ILE  12           HA       ILE  12   0.670  -7.240   1.334
  118    HB   ILE  12           HB       ILE  12  -1.987  -6.433   0.324
  119   HG12  ILE  12          HG12      ILE  12   0.490  -4.839  -0.304
  120   HG13  ILE  12          HG13      ILE  12  -0.980  -5.037  -1.259
  121   HG21  ILE  12          HG21      ILE  12  -1.067  -6.495   2.733
  122   HG22  ILE  12          HG22      ILE  12  -1.952  -5.043   2.251
  123   HG23  ILE  12          HG23      ILE  12  -0.188  -5.026   2.302
  124   HD11  ILE  12          HD11      ILE  12  -1.092  -2.823  -0.419
  125   HD12  ILE  12          HD12      ILE  12  -0.539  -3.318   1.181
  126   HD13  ILE  12          HD13      ILE  12  -2.159  -3.753   0.632
  127    HA   DPR  13           HA       DPR  13  -1.276 -11.209   1.413
  128    HB2  DPR  13           HB2      DPR  13   0.414 -12.861   1.209
  129    HB3  DPR  13           HB3      DPR  13   1.269 -11.942  -0.057
  130    HG2  DPR  13           HG2      DPR  13   1.107 -11.403   2.876
  131    HG3  DPR  13           HG3      DPR  13   2.506 -11.345   1.787
  132    HD2  DPR  13           HD2      DPR  13   0.999  -9.124   2.533
  133    HD3  DPR  13           HD3      DPR  13   2.028  -9.221   1.092
  134    HA   PRO  14           HA       PRO  14  -2.679 -12.433  -2.691
  135    HB2  PRO  14           HB2      PRO  14  -5.289 -11.717  -2.530
  136    HB3  PRO  14           HB3      PRO  14  -4.625 -13.099  -1.636
  137    HG2  PRO  14           HG2      PRO  14  -5.257 -10.352  -0.677
  138    HG3  PRO  14           HG3      PRO  14  -5.500 -11.913   0.124
  139    HD2  PRO  14           HD2      PRO  14  -3.387 -10.218   0.672
  140    HD3  PRO  14           HD3      PRO  14  -3.353 -11.976   0.946
  141    H5'    G  17           H5'        G  17 -16.203  -2.290  15.845
  142   H5''    G  17          H5''        G  17 -14.589  -2.977  15.582
  143    H4'    G  17           H4'        G  17 -16.228  -4.725  15.300
  144    H3'    G  17           H3'        G  17 -15.023  -3.822  12.667
  145    H2'    G  17          H2''        G  17 -16.242  -5.542  11.632
  146   HO2'    G  17           H2'        G  17 -17.020  -7.300  12.714
  147    H1'    G  17           H1'        G  17 -18.535  -5.277  13.153
  148    H8     G  17           H8         G  17 -17.412  -1.799  12.284
  149    H1     G  17           H1         G  17 -20.290  -4.841   7.429
  150    H21    G  17           H21        G  17 -20.510  -6.974   7.885
  151    H22    G  17           H22        G  17 -19.957  -7.674   9.389
  152   HO5'    G  17           H5T        G  17 -14.357  -1.811  13.841
  153    H5'    G  18           H5'        G  18 -14.750  -7.912  12.747
  154   H5''    G  18          H5''        G  18 -13.183  -8.574  12.235
  155    H4'    G  18           H4'        G  18 -14.999  -9.548  10.911
  156    H3'    G  18           H3'        G  18 -13.310  -7.637   9.252
  157    H2'    G  18          H2''        G  18 -14.608  -8.309   7.413
  158   HO2'    G  18           H2'        G  18 -16.211 -10.165   7.985
  159    H1'    G  18           H1'        G  18 -17.012  -8.500   8.774
  160    H8     G  18           H8         G  18 -15.229  -5.270   9.694
  161    H1     G  18           H1         G  18 -18.288  -5.006   4.074
  162    H21    G  18           H21        G  18 -18.905  -7.048   3.444
  163    H22    G  18           H22        G  18 -18.578  -8.464   4.416
  164    H5'    C  19           H5'        C  19 -13.594 -11.195   7.140
  165   H5''    C  19          H5''        C  19 -12.090 -11.743   6.375
  166    H4'    C  19           H4'        C  19 -13.894 -11.569   4.718
  167    H3'    C  19           H3'        C  19 -11.801  -9.400   4.303
  168    H2'    C  19          H2''        C  19 -13.012  -8.788   2.385
  169   HO2'    C  19           H2'        C  19 -14.385 -10.146   1.318
  170    H1'    C  19           H1'        C  19 -15.538  -9.289   3.450
  171    H41    C  19           H41        C  19 -14.797  -2.992   3.554
  172    H42    C  19           H42        C  19 -13.942  -3.098   5.076
  173    H5     C  19           H5         C  19 -13.327  -5.201   6.095
  174    H6     C  19           H6         C  19 -13.367  -7.633   5.832
  175    H5'    A  20           H5'        A  20 -12.431 -11.161   0.616
  176   H5''    A  20          H5''        A  20 -10.947 -11.519  -0.289
  177    H4'    A  20           H4'        A  20 -12.465 -10.189  -1.666
  178    H3'    A  20           H3'        A  20 -10.063  -8.553  -0.777
  179    H2'    A  20          H2''        A  20 -10.897  -6.818  -2.117
  180   HO2'    A  20           H2'        A  20 -12.019  -7.145  -3.903
  181    H1'    A  20           H1'        A  20 -13.590  -7.254  -1.610
  182    H8     A  20           H8         A  20 -11.569  -7.327   1.613
  183    H61    A  20           H61        A  20 -12.276  -1.181   1.667
  184    H62    A  20           H62        A  20 -11.791  -2.579   2.599
  185    H2     A  20           H2         A  20 -13.534  -2.684  -2.345
  186    H5'    G  21           H5'        G  21 -10.404  -8.184  -4.916
  187   H5''    G  21          H5''        G  21  -8.863  -8.246  -5.793
  188    H4'    G  21           H4'        G  21 -10.077  -6.207  -6.365
  189    H3'    G  21           H3'        G  21  -7.656  -5.599  -4.635
  190    H2'    G  21          H2''        G  21  -8.164  -3.334  -4.907
  191   HO2'    G  21           H2'        G  21  -9.878  -4.082  -7.070
  192    H1'    G  21           H1'        G  21 -10.957  -3.652  -4.997
  193    H8     G  21           H8         G  21  -9.302  -5.402  -2.047
  194    H1     G  21           H1         G  21 -10.210   0.854  -1.208
  195    H21    G  21           H21        G  21 -10.782   1.825  -3.121
  196    H22    G  21           H22        G  21 -10.955   0.913  -4.602
  197    H5'    A  22           H5'        A  22  -7.548  -2.960  -7.711
  198   H5''    A  22          H5''        A  22  -5.977  -2.850  -8.531
  199    H4'    A  22           H4'        A  22  -6.697  -0.620  -7.865
  200    H3'    A  22           H3'        A  22  -4.416  -1.658  -6.147
  201    H2'    A  22          H2''        A  22  -4.443   0.434  -5.044
  202   HO2'    A  22           H2'        A  22  -6.024   1.568  -7.124
  203    H1'    A  22           H1'        A  22  -7.245   0.945  -5.393
  204    H8     A  22           H8         A  22  -6.454  -2.397  -3.752
  205    H61    A  22           H61        A  22  -6.462   0.586   1.633
  206    H62    A  22           H62        A  22  -6.444  -0.964   0.824
  207    H2     A  22           H2         A  22  -6.566   3.671  -1.662
  208    H5'    U  23           H5'        U  23  -3.205   2.121  -8.162
  209   H5''    U  23          H5''        U  23  -1.863   1.826  -9.285
  210    H4'    U  23           H4'        U  23  -1.536   3.930  -8.082
  211    H3'    U  23           H3'        U  23   0.407   1.748  -7.249
  212    H2'    U  23          H2''        U  23   1.342   3.234  -5.745
  213   HO2'    U  23           H2'        U  23   1.638   4.727  -7.643
  214    H1'    U  23           H1'        U  23  -0.971   4.974  -5.558
  215    H3     U  23           H3         U  23   0.503   4.481  -1.312
  216    H5     U  23           H5         U  23  -0.950   0.690  -2.272
  217    H6     U  23           H6         U  23  -1.323   1.481  -4.547
  218    H5'    C  24           H5'        C  24   3.363   5.131  -9.350
  219   H5''    C  24          H5''        C  24   1.733   5.317 -10.010
  220    H4'    C  24           H4'        C  24   3.126   6.792 -11.232
  221    H3'    C  24           H3'        C  24   1.861   4.695 -12.638
  222    H2'    C  24          H2''        C  24   3.742   3.611 -13.389
  223   HO2'    C  24           H2'        C  24   3.182   4.378 -15.354
  224    H1'    C  24           H1'        C  24   5.386   6.133 -13.383
  225    H41    C  24           H41        C  24   9.765   1.463 -13.685
  226    H42    C  24           H42        C  24   9.312   0.948 -12.077
  227    H5     C  24           H5         C  24   7.476   1.898 -10.858
  228    H6     C  24           H6         C  24   5.683   3.564 -10.891
  229    H5'    U  25           H5'        U  25  -0.115   4.511 -12.309
  230   H5''    U  25          H5''        U  25  -1.613   5.417 -12.469
  231    H4'    U  25           H4'        U  25  -1.234   4.072 -10.310
  232    H3'    U  25           H3'        U  25  -2.699   6.420 -10.694
  233    H2'    U  25          H2''        U  25  -1.179   7.906  -9.711
  234   HO2'    U  25           H2'        U  25  -2.537   6.648  -7.547
  235    H1'    U  25           H1'        U  25  -0.320   5.822  -7.708
  236    H3     U  25           H3         U  25   2.651   9.626  -9.993
  237    H5     U  25           H5         U  25   3.289   8.081  -6.099
  238    H6     U  25           H6         U  25   1.461   6.568  -6.487
  239    H5'    G  26           H5'        G  26  -5.760   7.813  -7.439
  240   H5''    G  26          H5''        G  26  -4.216   8.531  -7.936
  241    H4'    G  26           H4'        G  26  -4.917   9.515  -5.851
  242    H3'    G  26           H3'        G  26  -2.568   7.639  -5.463
  243    H2'    G  26          H2''        G  26  -2.519   8.246  -3.222
  244   HO2'    G  26           H2'        G  26  -4.378  10.352  -3.669
  245    H1'    G  26           H1'        G  26  -5.257   8.501  -2.895
  246    H8     G  26           H8         G  26  -5.108   5.153  -4.429
  247    H1     G  26           H1         G  26  -2.732   5.379   1.523
  248    H21    G  26           H21        G  26  -2.307   7.522   2.069
  249    H22    G  26           H22        G  26  -2.623   8.841   0.965
  250    H5'    A  27           H5'        A  27  -1.798  11.239  -3.551
  251   H5''    A  27          H5''        A  27  -0.210  11.937  -3.905
  252    H4'    A  27           H4'        A  27  -0.678  11.983  -1.485
  253    H3'    A  27           H3'        A  27   1.538   9.980  -2.102
  254    H2'    A  27          H2''        A  27   1.736   9.741   0.227
  255   HO2'    A  27           H2'        A  27   0.128  12.064   0.528
  256    H1'    A  27           H1'        A  27  -0.980   9.944   0.803
  257    H8     A  27           H8         A  27  -0.264   7.523  -2.058
  258    H61    A  27           H61        A  27   0.630   3.351   2.456
  259    H62    A  27           H62        A  27   0.453   3.610   0.726
  260    H2     A  27           H2         A  27   0.342   7.405   4.321
  261    H5'    G  28           H5'        G  28   2.786  12.619   0.849
  262   H5''    G  28          H5''        G  28   4.502  13.063   0.799
  263    H4'    G  28           H4'        G  28   3.903  12.158   2.990
  264    H3'    G  28           H3'        G  28   5.703  10.215   1.495
  265    H2'    G  28          H2''        G  28   5.639   8.879   3.411
  266   HO2'    G  28           H2'        G  28   5.245  11.337   4.660
  267    H1'    G  28           H1'        G  28   3.030   9.551   4.198
  268    H8     G  28           H8         G  28   3.331   8.442   0.565
  269    H1     G  28           H1         G  28   3.197   3.634   4.775
  270    H21    G  28           H21        G  28   3.419   4.397   6.836
  271    H22    G  28           H22        G  28   3.575   6.105   7.179
  272    H5'    C  29           H5'        C  29   7.068  10.643   5.311
  273   H5''    C  29          H5''        C  29   8.812  10.921   5.490
  274    H4'    C  29           H4'        C  29   8.084   9.033   6.881
  275    H3'    C  29           H3'        C  29   9.843   8.155   4.563
  276    H2'    C  29          H2''        C  29   9.675   5.974   5.397
  277   HO2'    C  29           H2'        C  29   8.773   5.846   7.731
  278    H1'    C  29           H1'        C  29   7.102   6.274   6.608
  279    H41    C  29           H41        C  29   6.392   2.159   1.842
  280    H42    C  29           H42        C  29   6.263   3.497   0.717
  281    H5     C  29           H5         C  29   6.627   5.781   1.339
  282    H6     C  29           H6         C  29   7.191   7.295   3.174
  283    H5'    C  30           H5'        C  30  11.238   6.220   7.829
  284   H5''    C  30          H5''        C  30  12.891   6.625   8.344
  285    H4'    C  30           H4'        C  30  12.601   4.182   8.201
  286    H3'    C  30           H3'        C  30  14.418   5.398   6.102
  287    H2'    C  30          H2''        C  30  14.804   3.302   5.225
  288   HO2'    C  30           H2'        C  30  15.122   1.563   6.418
  289    H1'    C  30           H1'        C  30  12.324   2.114   6.046
  290    H41    C  30           H41        C  30  12.505   1.989  -0.253
  291    H42    C  30           H42        C  30  11.791   3.585  -0.297
  292    H5     C  30           H5         C  30  11.469   4.939   1.674
  293    H6     C  30           H6         C  30  11.710   5.020   4.097
  294    H5'    U  31           H5'        U  31  16.185   2.364   7.572
  295   H5''    U  31          H5''        U  31  17.858   2.471   8.153
  296    H4'    U  31           H4'        U  31  17.549   0.727   6.412
  297    H3'    U  31           H3'        U  31  19.709   2.441   6.475
  298    H2'    U  31          H2''        U  31  19.034   3.943   4.779
  299   HO2'    U  31           H2'        U  31  19.638   2.702   2.645
  300    H1'    U  31           H1'        U  31  17.715   1.810   3.140
  301    H3     U  31           H3         U  31  15.499   4.830   0.651
  302    H5     U  31           H5         U  31  15.767   6.736   4.400
  303    H6     U  31           H6         U  31  16.965   4.800   5.229
  304    H5'    G  32           H5'        G  32  17.759  -1.001   4.797
  305   H5''    G  32          H5''        G  32  17.538  -1.971   6.261
  306    H4'    G  32           H4'        G  32  16.810  -3.272   4.321
  307    H3'    G  32           H3'        G  32  18.654  -4.283   6.118
  308    H2'    G  32          H2''        G  32  20.586  -3.941   4.888
  309   HO2'    G  32           H2'        G  32  20.857  -5.861   3.418
  310    H1'    G  32           H1'        G  32  19.306  -4.544   2.246
  311    H8     G  32           H8         G  32  20.173  -0.984   3.231
  312    H1     G  32           H1         G  32  24.853  -4.018   0.029
  313    H21    G  32           H21        G  32  24.370  -6.185  -0.145
  314    H22    G  32           H22        G  32  22.905  -6.873   0.521
  315    H5'    G  33           H5'        G  33  16.261  -3.722   6.360
  316   H5''    G  33          H5''        G  33  14.897  -4.179   7.373
  317    H4'    G  33           H4'        G  33  14.183  -2.401   5.890
  318    H3'    G  33           H3'        G  33  12.792  -4.767   6.087
  319    H2'    G  33          H2''        G  33  13.538  -5.763   4.106
  320   HO2'    G  33           H2'        G  33  11.174  -4.698   3.925
  321    H1'    G  33           H1'        G  33  13.489  -3.178   2.577
  322    H8     G  33           H8         G  33  15.644  -6.308   3.537
  323    H1     G  33           H1         G  33  16.384  -4.153  -2.452
  324    H21    G  33           H21        G  33  15.209  -2.288  -2.744
  325    H22    G  33           H22        G  33  14.243  -1.580  -1.469
  326    H5'    G  34           H5'        G  34   8.117  -4.781   4.638
  327   H5''    G  34          H5''        G  34   9.332  -5.990   5.067
  328    H4'    G  34           H4'        G  34   8.142  -6.730   3.126
  329    H3'    G  34           H3'        G  34  10.923  -6.484   3.092
  330    H2'    G  34          H2''        G  34  11.075  -4.600   1.733
  331   HO2'    G  34           H2'        G  34  10.411  -6.378  -0.386
  332    H1'    G  34           H1'        G  34   8.669  -5.408   0.119
  333    H8     G  34           H8         G  34   7.650  -3.309  -0.999
  334    H1     G  34           H1         G  34  11.547   0.581   2.124
  335    H21    G  34           H21        G  34  12.657  -0.511   3.698
  336    H22    G  34           H22        G  34  12.452  -2.227   3.966
  337    H5'    A  35           H5'        A  35   8.673 -11.081   2.880
  338   H5''    A  35          H5''        A  35   8.248 -11.284   1.166
  339    H4'    A  35           H4'        A  35   8.206  -8.700   2.706
  340    H3'    A  35           H3'        A  35   6.180 -10.552   2.828
  341    H2'    A  35          H2''        A  35   5.631 -10.551   0.549
  342   HO2'    A  35           H2'        A  35   3.884  -9.480   1.885
  343    H1'    A  35           H1'        A  35   6.102  -7.587   0.310
  344    H8     A  35           H8         A  35   6.707  -6.999  -2.194
  345    H61    A  35           H61        A  35   6.691 -12.111  -5.744
  346    H62    A  35           H62        A  35   6.789 -10.364  -5.753
  347    H2     A  35           H2         A  35   6.307 -13.349  -1.460
  348    H5'    G  36           H5'        G  36   6.396  -7.878   5.788
  349   H5''    G  36          H5''        G  36   4.966  -8.011   6.829
  350    H4'    G  36           H4'        G  36   6.408  -6.255   7.662
  351    H3'    G  36           H3'        G  36   3.929  -5.093   6.359
  352    H2'    G  36          H2''        G  36   4.711  -2.989   6.918
  353   HO2'    G  36           H2'        G  36   6.016  -4.367   9.002
  354    H1'    G  36           H1'        G  36   7.466  -3.619   6.851
  355    H8     G  36           H8         G  36   5.737  -4.467   3.560
  356    H1     G  36           H1         G  36   7.393   1.713   4.161
  357    H21    G  36           H21        G  36   7.954   2.168   6.234
  358    H22    G  36           H22        G  36   7.950   0.952   7.490
  359    H5'    C  37           H5'        C  37   4.425  -3.395  10.133
  360   H5''    C  37          H5''        C  37   2.921  -3.290  11.068
  361    H4'    C  37           H4'        C  37   4.047  -1.115  11.054
  362    H3'    C  37           H3'        C  37   1.550  -1.086   9.312
  363    H2'    C  37          H2''        C  37   1.949   1.236   9.089
  364   HO2'    C  37           H2'        C  37   4.004   1.813  10.623
  365    H1'    C  37           H1'        C  37   4.744   1.047   8.969
  366    H41    C  37           H41        C  37   2.799   1.963   3.004
  367    H42    C  37           H42        C  37   2.482   0.255   2.821
  368    H5     C  37           H5         C  37   2.650  -1.317   4.663
  369    H6     C  37           H6         C  37   3.106  -1.545   7.060
  370    H5'    U  38           H5'        U  38   1.041   2.119  11.922
  371   H5''    U  38          H5''        U  38  -0.601   2.250  12.585
  372    H4'    U  38           H4'        U  38   0.032   4.340  11.481
  373    H3'    U  38           H3'        U  38  -2.048   2.854   9.824
  374    H2'    U  38          H2''        U  38  -2.019   4.709   8.390
  375   HO2'    U  38           H2'        U  38  -0.467   6.377   9.984
  376    H1'    U  38           H1'        U  38   0.714   5.323   8.720
  377    H3     U  38           H3         U  38   0.125   4.559   4.274
  378    H5     U  38           H5         U  38   0.160   0.728   6.057
  379    H6     U  38           H6         U  38   0.051   1.813   8.218
  380    H5'    C  39           H5'        C  39  -3.379   6.715  10.376
  381   H5''    C  39          H5''        C  39  -5.124   6.909  10.635
  382    H4'    C  39           H4'        C  39  -4.330   8.241   8.712
  383    H3'    C  39           H3'        C  39  -6.116   5.949   7.796
  384    H2'    C  39          H2''        C  39  -5.836   6.785   5.631
  385   HO2'    C  39           H2'        C  39  -4.916   9.030   5.423
  386    H1'    C  39           H1'        C  39  -3.248   7.853   6.044
  387    H41    C  39           H41        C  39  -2.686   3.090   1.917
  388    H42    C  39           H42        C  39  -2.739   1.897   3.196
  389    H5     C  39           H5         C  39  -3.151   2.484   5.527
  390    H6     C  39           H6         C  39  -3.673   4.361   7.052
  391    H5'    U  40           H5'        U  40  -7.284   9.402   5.971
  392   H5''    U  40          H5''        U  40  -9.029   9.725   5.902
  393    H4'    U  40           H4'        U  40  -8.019   9.828   3.652
  394    H3'    U  40           H3'        U  40  -9.851   7.426   3.988
  395    H2'    U  40          H2''        U  40  -9.457   6.943   1.721
  396   HO2'    U  40           H2'        U  40  -8.637   9.655   1.569
  397    H1'    U  40           H1'        U  40  -6.787   7.700   1.677
  398    H3     U  40           H3         U  40  -6.889   3.170   0.818
  399    H5     U  40           H5         U  40  -7.386   3.547   4.993
  400    H6     U  40           H6         U  40  -7.621   5.929   4.697
  401    H5'    C  41           H5'        C  41 -10.958   9.496   0.514
  402   H5''    C  41          H5''        C  41 -12.706   9.718   0.292
  403    H4'    C  41           H4'        C  41 -11.723   8.669  -1.693
  404    H3'    C  41           H3'        C  41 -13.422   6.693  -0.120
  405    H2'    C  41          H2''        C  41 -13.015   5.177  -1.892
  406   HO2'    C  41           H2'        C  41 -13.105   7.329  -3.387
  407    H1'    C  41           H1'        C  41 -10.378   5.911  -2.313
  408    H41    C  41           H41        C  41 -10.115   0.641   1.250
  409    H42    C  41           H42        C  41 -10.348   1.603   2.693
  410    H5     C  41           H5         C  41 -10.872   3.939   2.639
  411    H6     C  41           H6         C  41 -11.245   5.886   1.200
  412    H5'    U  42           H5'        U  42 -14.754   6.431  -4.026
  413   H5''    U  42          H5''        U  42 -16.520   6.386  -4.203
  414    H4'    U  42           H4'        U  42 -15.504   4.436  -5.291
  415    H3'    U  42           H3'        U  42 -16.981   3.643  -2.750
  416    H2'    U  42          H2''        U  42 -16.494   1.415  -3.332
  417   HO2'    U  42           H2'        U  42 -15.752   0.854  -5.437
  418    H1'    U  42           H1'        U  42 -13.958   1.915  -4.371
  419    H3     U  42           H3         U  42 -13.317  -0.784  -0.738
  420    H5     U  42           H5         U  42 -13.897   3.074   0.848
  421    H6     U  42           H6         U  42 -14.580   3.803  -1.357
  422    H5'    G  43           H5'        G  43 -18.365   1.172  -5.789
  423   H5''    G  43          H5''        G  43 -20.118   0.892  -5.779
  424    H4'    G  43           H4'        G  43 -18.917  -1.239  -5.750
  425    H3'    G  43           H3'        G  43 -20.232  -0.696  -3.063
  426    H2'    G  43          H2''        G  43 -19.476  -2.817  -2.409
  427   HO2'    G  43           H2'        G  43 -19.539  -3.309  -5.160
  428    H1'    G  43           H1'        G  43 -17.071  -2.751  -3.814
  429    H8     G  43           H8         G  43 -17.654   0.440  -1.812
  430    H1     G  43           H1         G  43 -15.345  -4.403   1.668
  431    H21    G  43           H21        G  43 -15.479  -6.310   0.504
  432    H22    G  43           H22        G  43 -16.113  -6.363  -1.126
  433    H5'    C  44           H5'        C  44 -21.340  -4.516  -4.272
  434   H5''    C  44          H5''        C  44 -23.041  -4.928  -3.981
  435    H4'    C  44           H4'        C  44 -21.567  -6.609  -2.975
  436    H3'    C  44           H3'        C  44 -22.921  -4.915  -0.842
  437    H2'    C  44          H2''        C  44 -21.900  -6.332   0.733
  438   HO2'    C  44           H2'        C  44 -21.877  -8.140  -1.412
  439    H1'    C  44           H1'        C  44 -19.527  -6.718  -0.689
  440    H41    C  44           H41        C  44 -18.165  -2.585   3.950
  441    H42    C  44           H42        C  44 -18.794  -1.271   2.984
  442    H5     C  44           H5         C  44 -19.908  -1.610   0.866
  443    H6     C  44           H6         C  44 -20.698  -3.291  -0.730
  444    H5'    C  45           H5'        C  45 -23.465  -8.870   0.157
  445   H5''    C  45          H5''        C  45 -25.123  -9.289   0.636
  446    H4'    C  45           H4'        C  45 -23.542 -10.010   2.362
  447    H3'    C  45           H3'        C  45 -25.222  -7.629   3.200
  448   HO3'    C  45           H3T        C  45 -25.487 -10.361   3.013
  449    H2'    C  45          H2''        C  45 -24.204  -7.710   5.287
  450   HO2'    C  45           H2'        C  45 -23.000  -9.690   5.900
  451    H1'    C  45           H1'        C  45 -21.714  -8.762   4.375
  452    H41    C  45           H41        C  45 -20.558  -2.677   6.069
  453    H42    C  45           H42        C  45 -21.271  -2.156   4.568
  454    H5     C  45           H5         C  45 -22.335  -3.619   3.016
  455    H6     C  45           H6         C  45 -23.005  -5.921   2.554
  Start of MODEL    4
    1    H1   DAB   1           H        DAB   1  -3.338  -8.787  -0.835
    2    HA   DAB   1           HA       DAB   1  -4.211  -7.604  -3.418
    3    HB2  DAB   1           HB2      DAB   1  -3.650  -6.359  -0.720
    4    HB3  DAB   1           HB3      DAB   1  -3.909  -5.416  -2.189
    5    HG2  DAB   1           HG2      DAB   1  -5.853  -7.329  -0.870
    6    HG3  DAB   1           HG3      DAB   1  -6.034  -5.585  -1.062
    7    HD1  DAB   1           HD1      DAB   1  -5.718  -6.231  -3.577
    8    HD2  DAB   1           HD2      DAB   1  -7.241  -6.297  -2.831
    9    HD3  DAB   1           HD3      DAB   1  -6.336  -7.718  -3.039
   10    H    VAL   2           H        VAL   2  -2.776  -6.480  -4.699
   11    HA   VAL   2           HA       VAL   2   0.062  -6.538  -3.877
   12    HB   VAL   2           HB       VAL   2  -0.187  -8.334  -5.417
   13   HG11  VAL   2          HG11      VAL   2  -2.383  -7.411  -6.335
   14   HG12  VAL   2          HG12      VAL   2  -1.298  -8.113  -7.535
   15   HG13  VAL   2          HG13      VAL   2  -1.409  -6.361  -7.363
   16   HG21  VAL   2          HG21      VAL   2   1.677  -6.521  -5.686
   17   HG22  VAL   2          HG22      VAL   2   0.791  -6.064  -7.141
   18   HG23  VAL   2          HG23      VAL   2   1.449  -7.692  -6.985
   19    H    ARG   3           H        ARG   3   1.098  -4.616  -3.948
   20    HA   ARG   3           HA       ARG   3   0.137  -2.634  -5.919
   21    HB2  ARG   3           HB2      ARG   3   0.752  -1.683  -3.162
   22    HB3  ARG   3           HB3      ARG   3  -0.311  -1.011  -4.370
   23    HG2  ARG   3           HG2      ARG   3  -1.036  -3.628  -3.041
   24    HG3  ARG   3           HG3      ARG   3  -1.314  -2.103  -2.222
   25    HD2  ARG   3           HD2      ARG   3  -2.314  -2.619  -5.022
   26    HD3  ARG   3           HD3      ARG   3  -3.264  -3.001  -3.591
   27    HE   ARG   3           HE       ARG   3  -2.675  -0.362  -4.623
   28   HH11  ARG   3          HH11      ARG   3  -3.589   1.356  -3.475
   29   HH12  ARG   3          HH12      ARG   3  -4.317   1.069  -1.930
   30   HH21  ARG   3          HH21      ARG   3  -3.579  -2.320  -1.929
   31   HH22  ARG   3          HH22      ARG   3  -4.312  -1.020  -1.050
   32    H    THR   4           H        THR   4   1.657  -0.957  -6.343
   33    HA   THR   4           HA       THR   4   4.309  -1.366  -5.239
   34    HB   THR   4           HB       THR   4   3.697  -1.588  -8.187
   35    HG1  THR   4           HG1      THR   4   5.193  -3.521  -7.524
   36   HG21  THR   4          HG21      THR   4   6.233  -0.988  -6.725
   37   HG22  THR   4          HG22      THR   4   5.667  -0.391  -8.284
   38   HG23  THR   4          HG23      THR   4   6.309  -2.027  -8.148
   39    H    ARG   5           H        ARG   5   4.953   0.557  -4.599
   40    HA   ARG   5           HA       ARG   5   3.952   2.938  -5.862
   41    HB2  ARG   5           HB2      ARG   5   5.852   3.366  -3.668
   42    HB3  ARG   5           HB3      ARG   5   4.202   3.929  -3.847
   43    HG2  ARG   5           HG2      ARG   5   4.708   1.038  -3.134
   44    HG3  ARG   5           HG3      ARG   5   4.750   2.285  -1.898
   45    HD2  ARG   5           HD2      ARG   5   2.439   1.769  -3.784
   46    HD3  ARG   5           HD3      ARG   5   2.482   1.369  -2.072
   47    HE   ARG   5           HE       ARG   5   2.020   3.935  -3.204
   48   HH11  ARG   5          HH11      ARG   5   1.830   5.697  -1.769
   49   HH12  ARG   5          HH12      ARG   5   2.350   5.520  -0.115
   50   HH21  ARG   5          HH21      ARG   5   3.271   2.193  -0.526
   51   HH22  ARG   5          HH22      ARG   5   3.139   3.516   0.585
   52    H    LYS   6           H        LYS   6   5.811   4.765  -5.702
   53    HA   LYS   6           HA       LYS   6   7.348   4.606  -7.904
   54    HB2  LYS   6           HB2      LYS   6   7.110   6.581  -6.373
   55    HB3  LYS   6           HB3      LYS   6   8.364   5.855  -5.365
   56    HG2  LYS   6           HG2      LYS   6  10.042   6.266  -6.898
   57    HG3  LYS   6           HG3      LYS   6   8.980   6.093  -8.291
   58    HD2  LYS   6           HD2      LYS   6   8.773   8.416  -6.366
   59    HD3  LYS   6           HD3      LYS   6   9.841   8.452  -7.761
   60    HE2  LYS   6           HE2      LYS   6   8.118   8.760  -9.234
   61    HE3  LYS   6           HE1      LYS   6   7.042   7.658  -8.373
   62    HZ1  LYS   6           HZ1      LYS   6   7.547   9.912  -6.777
   63    HZ2  LYS   6           HZ2      LYS   6   6.071   9.371  -7.424
   64    HZ3  LYS   6           HZ3      LYS   6   7.057  10.428  -8.318
   65    H    GLY   7           H        GLY   7   7.977   2.336  -7.963
   66    HA2  GLY   7           HA2      GLY   7   9.755   0.872  -8.142
   67    HA3  GLY   7           HA3      GLY   7  10.742   2.001  -7.219
   68    H    ARG   8           H        ARG   8   7.960   1.614  -5.488
   69    HA   ARG   8           HA       ARG   8   9.242  -0.418  -3.777
   70    HB2  ARG   8           HB2      ARG   8   7.244   1.771  -3.269
   71    HB3  ARG   8           HB3      ARG   8   7.472   0.479  -2.105
   72    HG2  ARG   8           HG2      ARG   8   9.748   1.144  -1.675
   73    HG3  ARG   8           HG3      ARG   8   9.791   2.163  -3.117
   74    HD2  ARG   8           HD2      ARG   8   7.720   2.799  -1.074
   75    HD3  ARG   8           HD3      ARG   8   9.396   3.160  -0.668
   76    HE   ARG   8           HE       ARG   8   7.781   4.572  -2.570
   77   HH11  ARG   8          HH11      ARG   8   8.809   6.258  -3.693
   78   HH12  ARG   8          HH12      ARG   8  10.538   6.334  -3.743
   79   HH21  ARG   8          HH21      ARG   8  10.987   3.477  -1.833
   80   HH22  ARG   8          HH22      ARG   8  11.770   4.762  -2.692
   81    H    ARG   9           H        ARG   9   8.593  -2.277  -4.762
   82    HA   ARG   9           HA       ARG   9   5.860  -2.831  -5.429
   83    HB2  ARG   9           HB2      ARG   9   6.648  -5.062  -5.973
   84    HB3  ARG   9           HB3      ARG   9   7.767  -3.872  -6.640
   85    HG2  ARG   9           HG2      ARG   9   8.933  -4.218  -4.244
   86    HG3  ARG   9           HG3      ARG   9   8.150  -5.792  -4.389
   87    HD2  ARG   9           HD2      ARG   9   9.185  -6.063  -6.634
   88    HD3  ARG   9           HD3      ARG   9  10.030  -4.535  -6.403
   89    HE   ARG   9           HE       ARG   9  10.678  -7.073  -5.168
   90   HH11  ARG   9          HH11      ARG   9  12.546  -7.070  -3.881
   91   HH12  ARG   9          HH12      ARG   9  13.253  -5.566  -3.391
   92   HH21  ARG   9          HH21      ARG   9  10.889  -3.621  -5.018
   93   HH22  ARG   9          HH22      ARG   9  12.315  -3.613  -4.035
   94    H    ILE  10           H        ILE  10   4.434  -2.875  -3.714
   95    HA   ILE  10           HA       ILE  10   5.253  -4.519  -1.382
   96    HB   ILE  10           HB       ILE  10   4.225  -2.988   0.059
   97   HG12  ILE  10          HG12      ILE  10   2.772  -1.948  -2.388
   98   HG13  ILE  10          HG13      ILE  10   2.044  -2.841  -1.052
   99   HG21  ILE  10          HG21      ILE  10   4.800  -0.806  -1.863
  100   HG22  ILE  10          HG22      ILE  10   6.108  -1.991  -1.735
  101   HG23  ILE  10          HG23      ILE  10   5.538  -1.151  -0.296
  102   HD11  ILE  10          HD11      ILE  10   1.657  -0.389  -0.914
  103   HD12  ILE  10          HD12      ILE  10   3.397  -0.143  -0.777
  104   HD13  ILE  10          HD13      ILE  10   2.529  -1.027   0.476
  105    H    4J5  11           H        NOR  11   4.034  -6.197  -0.875
  106    HA   4J5  11           HA       NOR  11   1.393  -6.353  -2.184
  107    HD   4J5  11           HD       NOR  11   2.578 -10.804  -2.475
  108    HB2  4J5  11           HB2      NOR  11   2.994  -8.018  -3.049
  109    HB3  4J5  11           HB3      NOR  11   3.248  -8.588  -1.398
  110    HG2  4J5  11           HG2      NOR  11   0.868  -9.238  -1.251
  111    HG3  4J5  11           HG3      NOR  11   0.606  -8.655  -2.891
  112   HH11  4J5  11          HH11      NOR  11  -0.511  -9.694  -3.594
  113   HH12  4J5  11          HH12      NOR  11  -0.786 -11.082  -4.591
  114   HH21  4J5  11          HH21      NOR  11   2.232 -12.586  -3.785
  115   HH22  4J5  11          HH22      NOR  11   0.767 -12.720  -4.697
  116    H    ILE  12           H        ILE  12  -0.343  -6.706  -0.986
  117    HA   ILE  12           HA       ILE  12   0.043  -7.127   1.905
  118    HB   ILE  12           HB       ILE  12  -2.627  -6.254   1.418
  119   HG12  ILE  12          HG12      ILE  12  -1.557  -5.481  -0.846
  120   HG13  ILE  12          HG13      ILE  12  -2.449  -4.285   0.092
  121   HG21  ILE  12          HG21      ILE  12  -0.147  -4.940   2.545
  122   HG22  ILE  12          HG22      ILE  12  -1.479  -5.690   3.427
  123   HG23  ILE  12          HG23      ILE  12  -1.732  -4.163   2.581
  124   HD11  ILE  12          HD11      ILE  12   0.506  -4.637   0.517
  125   HD12  ILE  12          HD12      ILE  12  -0.506  -3.229   0.855
  126   HD13  ILE  12          HD13      ILE  12  -0.094  -3.645  -0.812
  127    HA   DPR  13           HA       DPR  13  -2.052 -10.961   1.992
  128    HB2  DPR  13           HB2      DPR  13  -0.535 -12.708   1.722
  129    HB3  DPR  13           HB3      DPR  13   0.194 -11.985   0.267
  130    HG2  DPR  13           HG2      DPR  13   0.605 -11.308   3.131
  131    HG3  DPR  13           HG3      DPR  13   1.772 -11.393   1.801
  132    HD2  DPR  13           HD2      DPR  13   0.649  -9.055   2.743
  133    HD3  DPR  13           HD3      DPR  13   1.338  -9.260   1.119
  134    HA   PRO  14           HA       PRO  14  -3.957 -11.965  -1.954
  135    HB2  PRO  14           HB2      PRO  14  -6.423 -10.899  -1.518
  136    HB3  PRO  14           HB3      PRO  14  -5.874 -12.400  -0.754
  137    HG2  PRO  14           HG2      PRO  14  -6.019  -9.648   0.375
  138    HG3  PRO  14           HG3      PRO  14  -6.397 -11.205   1.134
  139    HD2  PRO  14           HD2      PRO  14  -4.048  -9.863   1.548
  140    HD3  PRO  14           HD3      PRO  14  -4.210 -11.623   1.683
  141    H5'    G  17           H5'        G  17 -16.214  -2.328  15.866
  142   H5''    G  17          H5''        G  17 -14.575  -2.966  15.639
  143    H4'    G  17           H4'        G  17 -16.156  -4.767  15.339
  144    H3'    G  17           H3'        G  17 -14.938  -3.865  12.717
  145    H2'    G  17          H2''        G  17 -16.118  -5.559  11.644
  146   HO2'    G  17           H2'        G  17 -16.518  -6.688  14.234
  147    H1'    G  17           H1'        G  17 -18.432  -5.376  13.157
  148    H8     G  17           H8         G  17 -17.368  -1.865  12.319
  149    H1     G  17           H1         G  17 -20.247  -4.900   7.453
  150    H21    G  17           H21        G  17 -20.436  -7.033   7.883
  151    H22    G  17           H22        G  17 -19.857  -7.746   9.371
  152   HO5'    G  17           H5T        G  17 -15.663  -2.102  13.307
  153    H5'    G  18           H5'        G  18 -14.704  -7.933  12.722
  154   H5''    G  18          H5''        G  18 -13.136  -8.619  12.262
  155    H4'    G  18           H4'        G  18 -14.914  -9.590  10.898
  156    H3'    G  18           H3'        G  18 -13.211  -7.674   9.264
  157    H2'    G  18          H2''        G  18 -14.475  -8.317   7.413
  158   HO2'    G  18           H2'        G  18 -15.326 -10.538   8.984
  159    H1'    G  18           H1'        G  18 -16.900  -8.555   8.753
  160    H8     G  18           H8         G  18 -15.145  -5.309   9.683
  161    H1     G  18           H1         G  18 -18.250  -5.029   4.090
  162    H21    G  18           H21        G  18 -18.864  -7.060   3.453
  163    H22    G  18           H22        G  18 -18.514  -8.487   4.402
  164    H5'    C  19           H5'        C  19 -13.532 -11.165   7.118
  165   H5''    C  19          H5''        C  19 -12.038 -11.761   6.375
  166    H4'    C  19           H4'        C  19 -13.814 -11.580   4.698
  167    H3'    C  19           H3'        C  19 -11.725  -9.407   4.289
  168    H2'    C  19          H2''        C  19 -12.920  -8.796   2.373
  169   HO2'    C  19           H2'        C  19 -14.050 -11.398   2.561
  170    H1'    C  19           H1'        C  19 -15.461  -9.317   3.426
  171    H41    C  19           H41        C  19 -14.765  -2.987   3.577
  172    H42    C  19           H42        C  19 -13.890  -3.107   5.088
  173    H5     C  19           H5         C  19 -13.258  -5.218   6.076
  174    H6     C  19           H6         C  19 -13.278  -7.645   5.793
  175    H5'    A  20           H5'        A  20 -12.376 -11.095   0.635
  176   H5''    A  20          H5''        A  20 -10.925 -11.508  -0.293
  177    H4'    A  20           H4'        A  20 -12.419 -10.177  -1.672
  178    H3'    A  20           H3'        A  20 -10.021  -8.536  -0.790
  179    H2'    A  20          H2''        A  20 -10.840  -6.814  -2.122
  180   HO2'    A  20           H2'        A  20 -12.082  -7.099  -3.870
  181    H1'    A  20           H1'        A  20 -13.544  -7.249  -1.627
  182    H8     A  20           H8         A  20 -11.514  -7.302   1.599
  183    H61    A  20           H61        A  20 -12.249  -1.168   1.660
  184    H62    A  20           H62        A  20 -11.738  -2.567   2.578
  185    H2     A  20           H2         A  20 -13.574  -2.671  -2.330
  186    H5'    G  21           H5'        G  21 -10.389  -8.126  -4.928
  187   H5''    G  21          H5''        G  21  -8.867  -8.217  -5.829
  188    H4'    G  21           H4'        G  21 -10.064  -6.180  -6.429
  189    H3'    G  21           H3'        G  21  -7.650  -5.532  -4.699
  190    H2'    G  21          H2''        G  21  -8.165  -3.279  -5.015
  191   HO2'    G  21           H2'        G  21  -9.524  -2.555  -6.689
  192    H1'    G  21           H1'        G  21 -10.957  -3.612  -5.058
  193    H8     G  21           H8         G  21  -9.312  -5.363  -2.099
  194    H1     G  21           H1         G  21 -10.219   0.887  -1.209
  195    H21    G  21           H21        G  21 -10.784   1.875  -3.102
  196    H22    G  21           H22        G  21 -10.940   0.988  -4.600
  197    H5'    A  22           H5'        A  22  -7.508  -2.875  -7.715
  198   H5''    A  22          H5''        A  22  -5.954  -2.766  -8.559
  199    H4'    A  22           H4'        A  22  -6.655  -0.536  -7.884
  200    H3'    A  22           H3'        A  22  -4.375  -1.584  -6.196
  201    H2'    A  22          H2''        A  22  -4.376   0.434  -5.035
  202   HO2'    A  22           H2'        A  22  -4.454   2.238  -6.109
  203    H1'    A  22           H1'        A  22  -7.177   1.017  -5.367
  204    H8     A  22           H8         A  22  -6.494  -2.379  -3.801
  205    H61    A  22           H61        A  22  -6.463   0.565   1.626
  206    H62    A  22           H62        A  22  -6.476  -0.981   0.809
  207    H2     A  22           H2         A  22  -6.411   3.657  -1.672
  208    H5'    U  23           H5'        U  23  -3.124   2.366  -7.909
  209   H5''    U  23          H5''        U  23  -1.948   1.949  -9.167
  210    H4'    U  23           H4'        U  23  -1.270   4.026  -8.146
  211    H3'    U  23           H3'        U  23   0.396   1.620  -7.824
  212    H2'    U  23          H2''        U  23   1.207   2.132  -5.751
  213   HO2'    U  23           H2'        U  23   2.302   4.142  -5.477
  214    H1'    U  23           H1'        U  23  -0.093   4.784  -5.520
  215    H3     U  23           H3         U  23   0.031   4.366  -1.133
  216    H5     U  23           H5         U  23  -1.335   0.611  -2.312
  217    H6     U  23           H6         U  23  -1.098   1.319  -4.616
  218    H5'    C  24           H5'        C  24   3.961   4.795  -7.229
  219   H5''    C  24          H5''        C  24   2.388   5.040  -7.985
  220    H4'    C  24           H4'        C  24   3.761   6.909  -8.536
  221    H3'    C  24           H3'        C  24   2.709   5.305 -10.617
  222    H2'    C  24          H2''        C  24   4.760   4.616 -11.514
  223   HO2'    C  24           H2'        C  24   4.011   6.202 -13.043
  224    H1'    C  24           H1'        C  24   6.067   7.155 -10.520
  225    H41    C  24           H41        C  24  11.413   3.816 -11.368
  226    H42    C  24           H42        C  24  10.586   2.304 -11.065
  227    H5     C  24           H5         C  24   8.244   2.175 -10.579
  228    H6     C  24           H6         C  24   6.179   3.432 -10.221
  229    H5'    U  25           H5'        U  25   1.066   5.310 -11.977
  230   H5''    U  25          H5''        U  25  -0.568   5.832 -12.394
  231    H4'    U  25           H4'        U  25  -0.491   4.441 -10.334
  232    H3'    U  25           H3'        U  25  -1.975   6.806 -10.567
  233    H2'    U  25          H2''        U  25  -0.688   8.150  -9.158
  234   HO2'    U  25           H2'        U  25  -1.998   8.295  -7.515
  235    H1'    U  25           H1'        U  25   0.053   5.795  -7.448
  236    H3     U  25           H3         U  25   3.027   9.989  -8.819
  237    H5     U  25           H5         U  25   3.520   7.797  -5.233
  238    H6     U  25           H6         U  25   1.753   6.326  -5.975
  239    H5'    G  26           H5'        G  26  -5.518   7.690  -7.676
  240   H5''    G  26          H5''        G  26  -4.036   8.530  -8.170
  241    H4'    G  26           H4'        G  26  -4.797   9.438  -6.068
  242    H3'    G  26           H3'        G  26  -2.341   7.705  -5.630
  243    H2'    G  26          H2''        G  26  -2.403   8.282  -3.401
  244   HO2'    G  26           H2'        G  26  -3.587  10.117  -2.652
  245    H1'    G  26           H1'        G  26  -5.196   8.515  -3.203
  246    H8     G  26           H8         G  26  -4.847   5.144  -4.573
  247    H1     G  26           H1         G  26  -2.743   5.476   1.485
  248    H21    G  26           H21        G  26  -2.416   7.614   2.042
  249    H22    G  26           H22        G  26  -2.735   8.933   0.940
  250    H5'    A  27           H5'        A  27  -1.801  11.222  -3.585
  251   H5''    A  27          H5''        A  27  -0.276  12.054  -3.902
  252    H4'    A  27           H4'        A  27  -0.715  12.018  -1.508
  253    H3'    A  27           H3'        A  27   1.513  10.054  -2.163
  254    H2'    A  27          H2''        A  27   1.708   9.710   0.115
  255   HO2'    A  27           H2'        A  27   0.354  12.188   0.396
  256    H1'    A  27           H1'        A  27  -1.022   9.994   0.734
  257    H8     A  27           H8         A  27  -0.453   7.507  -2.097
  258    H61    A  27           H61        A  27   0.259   3.309   2.397
  259    H62    A  27           H62        A  27   0.082   3.559   0.669
  260    H2     A  27           H2         A  27   0.205   7.353   4.279
  261    H5'    G  28           H5'        G  28   2.761  12.552   0.945
  262   H5''    G  28          H5''        G  28   4.453  13.064   0.889
  263    H4'    G  28           H4'        G  28   3.935  12.115   3.073
  264    H3'    G  28           H3'        G  28   5.688  10.182   1.508
  265    H2'    G  28          H2''        G  28   5.694   8.839   3.399
  266   HO2'    G  28           H2'        G  28   4.940  11.199   4.816
  267    H1'    G  28           H1'        G  28   3.097   9.531   4.270
  268    H8     G  28           H8         G  28   3.224   8.374   0.640
  269    H1     G  28           H1         G  28   3.115   3.595   4.871
  270    H21    G  28           H21        G  28   3.456   4.338   6.899
  271    H22    G  28           H22        G  28   3.718   6.033   7.237
  272    H5'    C  29           H5'        C  29   7.182  10.474   5.250
  273   H5''    C  29          H5''        C  29   8.917  10.807   5.382
  274    H4'    C  29           H4'        C  29   8.316   8.939   6.831
  275    H3'    C  29           H3'        C  29   9.905   8.016   4.418
  276    H2'    C  29          H2''        C  29   9.789   5.852   5.247
  277   HO2'    C  29           H2'        C  29   9.079   6.795   7.842
  278    H1'    C  29           H1'        C  29   7.297   6.173   6.665
  279    H41    C  29           H41        C  29   6.063   2.050   2.012
  280    H42    C  29           H42        C  29   5.888   3.382   0.886
  281    H5     C  29           H5         C  29   6.393   5.661   1.453
  282    H6     C  29           H6         C  29   7.166   7.170   3.217
  283    H5'    C  30           H5'        C  30  11.551   6.138   7.598
  284   H5''    C  30          H5''        C  30  13.241   6.551   7.946
  285    H4'    C  30           H4'        C  30  12.950   4.130   8.061
  286    H3'    C  30           H3'        C  30  14.482   5.036   5.599
  287    H2'    C  30          H2''        C  30  14.782   2.778   5.067
  288   HO2'    C  30           H2'        C  30  14.467   1.102   6.656
  289    H1'    C  30           H1'        C  30  12.300   1.860   6.143
  290    H41    C  30           H41        C  30  11.738   1.426  -0.143
  291    H42    C  30           H42        C  30  11.183   3.085  -0.186
  292    H5     C  30           H5         C  30  11.197   4.529   1.724
  293    H6     C  30           H6         C  30  11.710   4.702   4.087
  294    H5'    U  31           H5'        U  31  16.520   2.084   6.828
  295   H5''    U  31          H5''        U  31  18.161   2.396   7.431
  296    H4'    U  31           H4'        U  31  17.863   0.470   5.721
  297    H3'    U  31           H3'        U  31  20.068   2.100   6.078
  298    H2'    U  31          H2''        U  31  19.762   3.557   4.297
  299   HO2'    U  31           H2'        U  31  20.785   1.191   3.058
  300    H1'    U  31           H1'        U  31  18.550   1.486   2.505
  301    H3     U  31           H3         U  31  18.100   5.183  -0.121
  302    H5     U  31           H5         U  31  15.644   5.926   3.221
  303    H6     U  31           H6         U  31  16.573   3.941   4.260
  304    H5'    G  32           H5'        G  32  19.141   0.481   7.585
  305   H5''    G  32          H5''        G  32  19.440  -0.737   8.830
  306    H4'    G  32           H4'        G  32  17.053  -0.505   8.527
  307    H3'    G  32           H3'        G  32  18.216  -3.015   8.300
  308    H2'    G  32          H2''        G  32  18.109  -3.279   5.988
  309   HO2'    G  32           H2'        G  32  16.628  -4.838   6.736
  310    H1'    G  32           H1'        G  32  15.531  -1.783   5.720
  311    H8     G  32           H8         G  32  19.275  -1.847   4.580
  312    H1     G  32           H1         G  32  14.975  -0.734  -0.042
  313    H21    G  32           H21        G  32  12.941  -0.654   0.819
  314    H22    G  32           H22        G  32  12.638  -0.873   2.524
  315    H5'    G  33           H5'        G  33  13.756  -2.299   7.600
  316   H5''    G  33          H5''        G  33  12.917  -3.248   8.837
  317    H4'    G  33           H4'        G  33  11.399  -2.896   7.007
  318    H3'    G  33           H3'        G  33  12.022  -5.494   7.842
  319    H2'    G  33          H2''        G  33  13.222  -6.180   5.951
  320   HO2'    G  33           H2'        G  33  11.871  -7.355   4.734
  321    H1'    G  33           H1'        G  33  11.593  -4.451   4.080
  322    H8     G  33           H8         G  33  15.246  -5.283   5.270
  323    H1     G  33           H1         G  33  14.458  -4.397  -1.030
  324    H21    G  33           H21        G  33  12.351  -3.847  -1.461
  325    H22    G  33           H22        G  33  11.143  -3.702  -0.203
  326    H5'    G  34           H5'        G  34   8.931  -4.906   4.521
  327   H5''    G  34          H5''        G  34   7.439  -5.775   4.927
  328    H4'    G  34           H4'        G  34   7.700  -7.276   3.188
  329    H3'    G  34           H3'        G  34  10.462  -6.941   3.309
  330    H2'    G  34          H2''        G  34  10.575  -4.980   2.025
  331   HO2'    G  34           H2'        G  34  11.096  -7.121   0.640
  332    H1'    G  34           H1'        G  34   8.251  -5.856   0.315
  333    H8     G  34           H8         G  34   7.164  -3.777  -0.783
  334    H1     G  34           H1         G  34  10.871   0.217   2.457
  335    H21    G  34           H21        G  34  12.006  -0.904   4.024
  336    H22    G  34           H22        G  34  11.854  -2.632   4.232
  337    H5'    A  35           H5'        A  35   7.982 -11.450   2.779
  338   H5''    A  35          H5''        A  35   7.689 -11.579   1.028
  339    H4'    A  35           H4'        A  35   7.750  -8.975   2.509
  340    H3'    A  35           H3'        A  35   5.673 -10.719   2.913
  341    H2'    A  35          H2''        A  35   4.879 -10.760   0.703
  342   HO2'    A  35           H2'        A  35   3.538  -8.513   0.640
  343    H1'    A  35           H1'        A  35   5.504  -7.848   0.332
  344    H8     A  35           H8         A  35   5.726  -7.317  -2.195
  345    H61    A  35           H61        A  35   5.141 -12.459  -5.647
  346    H62    A  35           H62        A  35   5.249 -10.714  -5.683
  347    H2     A  35           H2         A  35   5.384 -13.657  -1.330
  348    H5'    G  36           H5'        G  36   6.109  -7.975   5.809
  349   H5''    G  36          H5''        G  36   4.701  -8.118   6.879
  350    H4'    G  36           H4'        G  36   6.135  -6.393   7.727
  351    H3'    G  36           H3'        G  36   3.704  -5.170   6.399
  352    H2'    G  36          H2''        G  36   4.509  -3.091   6.932
  353   HO2'    G  36           H2'        G  36   5.608  -4.444   9.124
  354    H1'    G  36           H1'        G  36   7.267  -3.776   6.960
  355    H8     G  36           H8         G  36   5.686  -4.612   3.606
  356    H1     G  36           H1         G  36   7.291   1.593   4.265
  357    H21    G  36           H21        G  36   7.772   2.050   6.343
  358    H22    G  36           H22        G  36   7.733   0.840   7.603
  359    H5'    C  37           H5'        C  37   4.248  -3.433  10.142
  360   H5''    C  37          H5''        C  37   2.771  -3.357  11.114
  361    H4'    C  37           H4'        C  37   3.879  -1.186  11.141
  362    H3'    C  37           H3'        C  37   1.400  -1.110   9.387
  363    H2'    C  37          H2''        C  37   1.809   1.195   9.177
  364   HO2'    C  37           H2'        C  37   2.603   2.337  10.772
  365    H1'    C  37           H1'        C  37   4.616   0.990   9.079
  366    H41    C  37           H41        C  37   2.762   1.893   3.069
  367    H42    C  37           H42        C  37   2.411   0.189   2.901
  368    H5     C  37           H5         C  37   2.518  -1.364   4.764
  369    H6     C  37           H6         C  37   2.951  -1.587   7.167
  370    H5'    U  38           H5'        U  38   0.950   2.117  11.900
  371   H5''    U  38          H5''        U  38  -0.665   2.281  12.612
  372    H4'    U  38           H4'        U  38  -0.039   4.359  11.512
  373    H3'    U  38           H3'        U  38  -2.128   2.901   9.850
  374    H2'    U  38          H2''        U  38  -2.103   4.752   8.435
  375   HO2'    U  38           H2'        U  38  -0.567   6.347  10.174
  376    H1'    U  38           H1'        U  38   0.642   5.348   8.754
  377    H3     U  38           H3         U  38   0.049   4.598   4.299
  378    H5     U  38           H5         U  38   0.073   0.761   6.073
  379    H6     U  38           H6         U  38  -0.039   1.838   8.237
  380    H5'    C  39           H5'        C  39  -3.375   6.771  10.277
  381   H5''    C  39          H5''        C  39  -5.094   7.029  10.607
  382    H4'    C  39           H4'        C  39  -4.342   8.346   8.666
  383    H3'    C  39           H3'        C  39  -6.206   6.108   7.792
  384    H2'    C  39          H2''        C  39  -5.946   6.867   5.625
  385   HO2'    C  39           H2'        C  39  -5.477   9.361   6.873
  386    H1'    C  39           H1'        C  39  -3.341   7.959   5.981
  387    H41    C  39           H41        C  39  -2.680   3.102   1.925
  388    H42    C  39           H42        C  39  -2.714   1.961   3.251
  389    H5     C  39           H5         C  39  -3.156   2.608   5.539
  390    H6     C  39           H6         C  39  -3.734   4.496   7.023
  391    H5'    U  40           H5'        U  40  -7.246   9.457   5.888
  392   H5''    U  40          H5''        U  40  -8.963   9.889   5.830
  393    H4'    U  40           H4'        U  40  -7.982   9.874   3.573
  394    H3'    U  40           H3'        U  40  -9.886   7.545   3.994
  395    H2'    U  40          H2''        U  40  -9.518   6.982   1.755
  396   HO2'    U  40           H2'        U  40  -8.714   8.433   0.234
  397    H1'    U  40           H1'        U  40  -6.832   7.750   1.674
  398    H3     U  40           H3         U  40  -6.884   3.239   0.755
  399    H5     U  40           H5         U  40  -7.381   3.552   4.937
  400    H6     U  40           H6         U  40  -7.676   5.928   4.674
  401    H5'    C  41           H5'        C  41 -10.935   9.521   0.474
  402   H5''    C  41          H5''        C  41 -12.666   9.819   0.247
  403    H4'    C  41           H4'        C  41 -11.744   8.699  -1.715
  404    H3'    C  41           H3'        C  41 -13.460   6.785  -0.093
  405    H2'    C  41          H2''        C  41 -13.095   5.221  -1.809
  406   HO2'    C  41           H2'        C  41 -11.985   7.274  -3.437
  407    H1'    C  41           H1'        C  41 -10.454   5.963  -2.318
  408    H41    C  41           H41        C  41 -10.106   0.672   1.237
  409    H42    C  41           H42        C  41 -10.323   1.625   2.688
  410    H5     C  41           H5         C  41 -10.832   3.966   2.648
  411    H6     C  41           H6         C  41 -11.257   5.914   1.219
  412    H5'    U  42           H5'        U  42 -14.766   6.443  -3.968
  413   H5''    U  42          H5''        U  42 -16.524   6.440  -4.185
  414    H4'    U  42           H4'        U  42 -15.548   4.472  -5.251
  415    H3'    U  42           H3'        U  42 -17.028   3.697  -2.712
  416    H2'    U  42          H2''        U  42 -16.552   1.477  -3.263
  417   HO2'    U  42           H2'        U  42 -16.348   2.495  -5.873
  418    H1'    U  42           H1'        U  42 -14.022   1.965  -4.356
  419    H3     U  42           H3         U  42 -13.333  -0.768  -0.749
  420    H5     U  42           H5         U  42 -13.930   3.065   0.886
  421    H6     U  42           H6         U  42 -14.626   3.818  -1.306
  422    H5'    G  43           H5'        G  43 -18.378   1.198  -5.720
  423   H5''    G  43          H5''        G  43 -20.127   0.925  -5.751
  424    H4'    G  43           H4'        G  43 -18.948  -1.208  -5.719
  425    H3'    G  43           H3'        G  43 -20.267  -0.672  -3.036
  426    H2'    G  43          H2''        G  43 -19.526  -2.775  -2.379
  427   HO2'    G  43           H2'        G  43 -18.470  -4.022  -4.365
  428    H1'    G  43           H1'        G  43 -17.119  -2.731  -3.801
  429    H8     G  43           H8         G  43 -17.683   0.448  -1.766
  430    H1     G  43           H1         G  43 -15.331  -4.400   1.675
  431    H21    G  43           H21        G  43 -15.453  -6.300   0.504
  432    H22    G  43           H22        G  43 -16.106  -6.355  -1.118
  433    H5'    C  44           H5'        C  44 -21.316  -4.496  -4.218
  434   H5''    C  44          H5''        C  44 -23.015  -4.934  -3.983
  435    H4'    C  44           H4'        C  44 -21.554  -6.610  -2.962
  436    H3'    C  44           H3'        C  44 -22.936  -4.943  -0.831
  437    H2'    C  44          H2''        C  44 -21.920  -6.328   0.746
  438   HO2'    C  44           H2'        C  44 -21.829  -8.166  -1.387
  439    H1'    C  44           H1'        C  44 -19.537  -6.726  -0.683
  440    H41    C  44           H41        C  44 -18.132  -2.602   3.980
  441    H42    C  44           H42        C  44 -18.770  -1.284   3.023
  442    H5     C  44           H5         C  44 -19.898  -1.618   0.914
  443    H6     C  44           H6         C  44 -20.701  -3.288  -0.686
  444    H5'    C  45           H5'        C  45 -23.414  -8.888   0.208
  445   H5''    C  45          H5''        C  45 -25.060  -9.358   0.669
  446    H4'    C  45           H4'        C  45 -23.479 -10.071   2.388
  447    H3'    C  45           H3'        C  45 -25.190  -7.733   3.269
  448   HO3'    C  45           H3T        C  45 -26.450  -9.499   3.089
  449    H2'    C  45          H2''        C  45 -24.139  -7.795   5.336
  450   HO2'    C  45           H2'        C  45 -24.455  -9.959   5.856
  451    H1'    C  45           H1'        C  45 -21.642  -8.805   4.388
  452    H41    C  45           H41        C  45 -20.525  -2.734   6.117
  453    H42    C  45           H42        C  45 -21.259  -2.196   4.629
  454    H5     C  45           H5         C  45 -22.349  -3.652   3.075
  455    H6     C  45           H6         C  45 -23.008  -5.958   2.595
  Start of MODEL    5
    1    H1   DAB   1           H        DAB   1  -2.968  -8.710  -0.836
    2    HA   DAB   1           HA       DAB   1  -3.258  -9.419  -3.638
    3    HB2  DAB   1           HB2      DAB   1  -3.972  -6.863  -3.990
    4    HB3  DAB   1           HB3      DAB   1  -5.155  -8.159  -3.811
    5    HG2  DAB   1           HG2      DAB   1  -5.695  -7.562  -1.640
    6    HG3  DAB   1           HG3      DAB   1  -4.111  -6.859  -1.321
    7    HD1  DAB   1           HD1      DAB   1  -5.989  -5.243  -1.559
    8    HD2  DAB   1           HD2      DAB   1  -6.064  -5.658  -3.203
    9    HD3  DAB   1           HD3      DAB   1  -4.657  -4.947  -2.568
   10    H    VAL   2           H        VAL   2  -2.212  -7.566  -5.016
   11    HA   VAL   2           HA       VAL   2   0.252  -6.803  -3.668
   12    HB   VAL   2           HB       VAL   2   1.481  -7.127  -5.598
   13   HG11  VAL   2          HG11      VAL   2   1.098  -9.403  -6.130
   14   HG12  VAL   2          HG12      VAL   2  -0.640  -9.259  -5.868
   15   HG13  VAL   2          HG13      VAL   2   0.466  -9.215  -4.493
   16   HG21  VAL   2          HG21      VAL   2  -1.210  -6.921  -6.949
   17   HG22  VAL   2          HG22      VAL   2   0.146  -7.690  -7.774
   18   HG23  VAL   2          HG23      VAL   2   0.261  -6.004  -7.274
   19    H    ARG   3           H        ARG   3   1.416  -4.805  -4.445
   20    HA   ARG   3           HA       ARG   3  -0.263  -2.916  -5.897
   21    HB2  ARG   3           HB2      ARG   3  -0.178  -3.003  -2.995
   22    HB3  ARG   3           HB3      ARG   3   0.419  -1.458  -3.577
   23    HG2  ARG   3           HG2      ARG   3  -1.597  -0.897  -4.588
   24    HG3  ARG   3           HG3      ARG   3  -2.116  -2.568  -4.752
   25    HD2  ARG   3           HD2      ARG   3  -3.229  -2.479  -2.797
   26    HD3  ARG   3           HD3      ARG   3  -1.796  -1.934  -1.941
   27    HE   ARG   3           HE       ARG   3  -3.175   0.114  -3.481
   28   HH11  ARG   3          HH11      ARG   3  -3.877   1.871  -2.230
   29   HH12  ARG   3          HH12      ARG   3  -3.964   1.721  -0.507
   30   HH21  ARG   3          HH21      ARG   3  -2.770  -1.539  -0.476
   31   HH22  ARG   3          HH22      ARG   3  -3.332  -0.215   0.490
   32    H    THR   4           H        THR   4   0.893  -1.210  -6.739
   33    HA   THR   4           HA       THR   4   3.782  -1.400  -6.384
   34    HB   THR   4           HB       THR   4   2.414  -0.057  -8.674
   35    HG1  THR   4           HG1      THR   4   3.381  -2.686  -8.776
   36   HG21  THR   4          HG21      THR   4   5.165  -1.190  -8.192
   37   HG22  THR   4          HG22      THR   4   4.733   0.476  -8.573
   38   HG23  THR   4          HG23      THR   4   4.579  -0.776  -9.801
   39    H    ARG   5           H        ARG   5   5.039   0.609  -6.381
   40    HA   ARG   5           HA       ARG   5   3.533   2.977  -5.587
   41    HB2  ARG   5           HB2      ARG   5   6.030   1.985  -4.225
   42    HB3  ARG   5           HB3      ARG   5   5.067   3.385  -3.769
   43    HG2  ARG   5           HG2      ARG   5   3.977   0.564  -3.816
   44    HG3  ARG   5           HG3      ARG   5   4.676   1.313  -2.379
   45    HD2  ARG   5           HD2      ARG   5   2.189   2.116  -3.878
   46    HD3  ARG   5           HD3      ARG   5   2.345   1.702  -2.180
   47    HE   ARG   5           HE       ARG   5   3.244   4.199  -3.437
   48   HH11  ARG   5          HH11      ARG   5   3.349   5.940  -2.024
   49   HH12  ARG   5          HH12      ARG   5   3.144   5.698  -0.309
   50   HH21  ARG   5          HH21      ARG   5   2.714   2.264  -0.605
   51   HH22  ARG   5          HH22      ARG   5   2.785   3.609   0.479
   52    H    LYS   6           H        LYS   6   4.236   4.734  -6.626
   53    HA   LYS   6           HA       LYS   6   5.956   4.698  -8.756
   54    HB2  LYS   6           HB2      LYS   6   4.322   6.539  -7.781
   55    HB3  LYS   6           HB3      LYS   6   5.810   7.150  -7.092
   56    HG2  LYS   6           HG2      LYS   6   6.578   6.671  -9.699
   57    HG3  LYS   6           HG3      LYS   6   4.891   7.109  -9.894
   58    HD2  LYS   6           HD2      LYS   6   6.299   9.112 -10.043
   59    HD3  LYS   6           HD3      LYS   6   5.228   9.197  -8.657
   60    HE2  LYS   6           HE2      LYS   6   7.850   7.979  -8.049
   61    HE3  LYS   6           HE1      LYS   6   7.930   9.668  -8.552
   62    HZ1  LYS   6           HZ1      LYS   6   7.482   9.988  -6.377
   63    HZ2  LYS   6           HZ2      LYS   6   6.697   8.494  -6.186
   64    HZ3  LYS   6           HZ3      LYS   6   5.882   9.800  -6.900
   65    H    GLY   7           H        GLY   7   7.673   3.310  -7.927
   66    HA2  GLY   7           HA2      GLY   7  10.122   4.326  -7.734
   67    HA3  GLY   7           HA3      GLY   7   9.572   4.546  -6.080
   68    H    ARG   8           H        ARG   8   7.962   2.209  -5.971
   69    HA   ARG   8           HA       ARG   8   9.697  -0.043  -6.517
   70    HB2  ARG   8           HB2      ARG   8   9.468  -0.704  -3.991
   71    HB3  ARG   8           HB3      ARG   8  10.761   0.359  -4.511
   72    HG2  ARG   8           HG2      ARG   8   9.981   1.562  -2.705
   73    HG3  ARG   8           HG3      ARG   8   8.971   2.265  -3.955
   74    HD2  ARG   8           HD2      ARG   8   7.329   0.299  -3.394
   75    HD3  ARG   8           HD3      ARG   8   8.239   0.217  -1.891
   76    HE   ARG   8           HE       ARG   8   6.246   2.108  -2.460
   77   HH11  ARG   8          HH11      ARG   8   6.106   4.019  -1.250
   78   HH12  ARG   8          HH12      ARG   8   7.471   4.561  -0.331
   79   HH21  ARG   8          HH21      ARG   8   9.477   1.887  -1.229
   80   HH22  ARG   8          HH22      ARG   8   9.382   3.361  -0.334
   81    H    ARG   9           H        ARG   9   8.674  -2.113  -5.878
   82    HA   ARG   9           HA       ARG   9   5.785  -1.932  -6.125
   83    HB2  ARG   9           HB2      ARG   9   6.096  -4.408  -6.867
   84    HB3  ARG   9           HB3      ARG   9   6.445  -3.108  -8.006
   85    HG2  ARG   9           HG2      ARG   9   8.785  -3.276  -7.651
   86    HG3  ARG   9           HG3      ARG   9   8.573  -4.251  -6.194
   87    HD2  ARG   9           HD2      ARG   9   7.699  -6.105  -7.510
   88    HD3  ARG   9           HD3      ARG   9   7.759  -5.131  -8.977
   89    HE   ARG   9           HE       ARG   9  10.317  -5.352  -7.668
   90   HH11  ARG   9          HH11      ARG   9  11.888  -6.561  -8.769
   91   HH12  ARG   9          HH12      ARG   9  11.416  -7.607 -10.067
   92   HH21  ARG   9          HH21      ARG   9   8.045  -6.834  -9.813
   93   HH22  ARG   9          HH22      ARG   9   9.239  -7.761 -10.659
   94    H    ILE  10           H        ILE  10   4.473  -2.697  -4.590
   95    HA   ILE  10           HA       ILE  10   5.688  -4.473  -2.577
   96    HB   ILE  10           HB       ILE  10   4.858  -3.247  -0.799
   97   HG12  ILE  10          HG12      ILE  10   3.090  -1.786  -2.782
   98   HG13  ILE  10          HG13      ILE  10   2.538  -2.924  -1.540
   99   HG21  ILE  10          HG21      ILE  10   5.196  -0.882  -2.603
  100   HG22  ILE  10          HG22      ILE  10   6.555  -2.004  -2.447
  101   HG23  ILE  10          HG23      ILE  10   5.904  -1.208  -1.014
  102   HD11  ILE  10          HD11      ILE  10   2.301  -1.043  -0.259
  103   HD12  ILE  10          HD12      ILE  10   3.421  -0.125  -1.262
  104   HD13  ILE  10          HD13      ILE  10   4.049  -1.222  -0.026
  105    H    4J5  11           H        NOR  11   3.571  -4.905  -0.954
  106    HA   4J5  11           HA       NOR  11   1.182  -5.504  -2.316
  107    HD   4J5  11           HD       NOR  11   5.073  -6.693  -2.547
  108    HB2  4J5  11           HB2      NOR  11   1.466  -8.039  -2.280
  109    HB3  4J5  11           HB3      NOR  11   2.473  -7.209  -3.468
  110    HG2  4J5  11           HG2      NOR  11   3.280  -8.254  -0.755
  111    HG3  4J5  11           HG3      NOR  11   3.839  -8.818  -2.326
  112   HH11  4J5  11          HH11      NOR  11   3.581  -7.260   0.557
  113   HH12  4J5  11          HH12      NOR  11   4.614  -6.151   1.389
  114   HH21  4J5  11          HH21      NOR  11   6.512  -5.375  -1.380
  115   HH22  4J5  11          HH22      NOR  11   6.249  -5.095   0.307
  116    H    ILE  12           H        ILE  12  -0.390  -6.581  -1.057
  117    HA   ILE  12           HA       ILE  12   0.331  -6.806   1.802
  118    HB   ILE  12           HB       ILE  12  -2.420  -6.132   1.654
  119   HG12  ILE  12          HG12      ILE  12  -1.684  -5.255  -0.708
  120   HG13  ILE  12          HG13      ILE  12  -2.584  -4.175   0.346
  121   HG21  ILE  12          HG21      ILE  12   0.098  -4.669   2.487
  122   HG22  ILE  12          HG22      ILE  12  -1.084  -5.489   3.513
  123   HG23  ILE  12          HG23      ILE  12  -1.513  -3.975   2.714
  124   HD11  ILE  12          HD11      ILE  12  -0.777  -2.814   0.737
  125   HD12  ILE  12          HD12      ILE  12  -0.298  -3.430  -0.837
  126   HD13  ILE  12          HD13      ILE  12   0.384  -4.132   0.618
  127    HA   DPR  13           HA       DPR  13  -1.186 -10.870   2.405
  128    HB2  DPR  13           HB2      DPR  13   0.276 -12.389   1.421
  129    HB3  DPR  13           HB3      DPR  13   0.309 -11.511  -0.123
  130    HG2  DPR  13           HG2      DPR  13   1.784 -10.968   2.394
  131    HG3  DPR  13           HG3      DPR  13   2.308 -10.796   0.711
  132    HD2  DPR  13           HD2      DPR  13   1.447  -8.700   2.319
  133    HD3  DPR  13           HD3      DPR  13   1.475  -8.669   0.545
  134    HA   PRO  14           HA       PRO  14  -4.858 -11.582   0.068
  135    HB2  PRO  14           HB2      PRO  14  -5.971  -8.943   0.140
  136    HB3  PRO  14           HB3      PRO  14  -6.335 -10.298   1.221
  137    HG2  PRO  14           HG2      PRO  14  -4.471  -8.027   1.601
  138    HG3  PRO  14           HG3      PRO  14  -5.419  -8.931   2.795
  139    HD2  PRO  14           HD2      PRO  14  -2.781  -9.315   2.620
  140    HD3  PRO  14           HD3      PRO  14  -3.874 -10.697   2.881
  141    H5'    G  17           H5'        G  17 -16.525  -2.355  15.889
  142   H5''    G  17          H5''        G  17 -14.897  -3.026  15.686
  143    H4'    G  17           H4'        G  17 -16.502  -4.788  15.336
  144    H3'    G  17           H3'        G  17 -15.225  -3.868  12.737
  145    H2'    G  17          H2''        G  17 -16.405  -5.578  11.645
  146   HO2'    G  17           H2'        G  17 -17.504  -6.792  13.873
  147    H1'    G  17           H1'        G  17 -18.740  -5.363  13.117
  148    H8     G  17           H8         G  17 -17.634  -1.866  12.310
  149    H1     G  17           H1         G  17 -20.413  -4.869   7.376
  150    H21    G  17           H21        G  17 -20.620  -7.006   7.795
  151    H22    G  17           H22        G  17 -20.085  -7.727   9.297
  152   HO5'    G  17           H5T        G  17 -15.759  -0.928  14.547
  153    H5'    G  18           H5'        G  18 -14.982  -7.960  12.772
  154   H5''    G  18          H5''        G  18 -13.409  -8.638  12.311
  155    H4'    G  18           H4'        G  18 -15.186  -9.593  10.930
  156    H3'    G  18           H3'        G  18 -13.443  -7.673   9.328
  157    H2'    G  18          H2''        G  18 -14.694  -8.313   7.440
  158   HO2'    G  18           H2'        G  18 -16.080 -10.165   7.508
  159    H1'    G  18           H1'        G  18 -17.134  -8.529   8.741
  160    H8     G  18           H8         G  18 -15.366  -5.304   9.714
  161    H1     G  18           H1         G  18 -18.352  -5.000   4.059
  162    H21    G  18           H21        G  18 -18.959  -7.034   3.404
  163    H22    G  18           H22        G  18 -18.643  -8.459   4.369
  164    H5'    C  19           H5'        C  19 -13.738 -11.200   7.185
  165   H5''    C  19          H5''        C  19 -12.234 -11.782   6.445
  166    H4'    C  19           H4'        C  19 -14.006 -11.584   4.767
  167    H3'    C  19           H3'        C  19 -11.880  -9.429   4.379
  168    H2'    C  19          H2''        C  19 -13.062  -8.799   2.444
  169   HO2'    C  19           H2'        C  19 -14.950 -10.387   1.918
  170    H1'    C  19           H1'        C  19 -15.609  -9.292   3.467
  171    H41    C  19           H41        C  19 -14.853  -2.986   3.602
  172    H42    C  19           H42        C  19 -14.003  -3.106   5.126
  173    H5     C  19           H5         C  19 -13.410  -5.215   6.143
  174    H6     C  19           H6         C  19 -13.437  -7.646   5.866
  175    H5'    A  20           H5'        A  20 -12.514 -11.156   0.702
  176   H5''    A  20          H5''        A  20 -11.038 -11.549  -0.199
  177    H4'    A  20           H4'        A  20 -12.527 -10.204  -1.586
  178    H3'    A  20           H3'        A  20 -10.103  -8.602  -0.681
  179    H2'    A  20          H2''        A  20 -10.898  -6.850  -2.023
  180   HO2'    A  20           H2'        A  20 -12.451  -8.854  -3.306
  181    H1'    A  20           H1'        A  20 -13.607  -7.258  -1.551
  182    H8     A  20           H8         A  20 -11.605  -7.326   1.692
  183    H61    A  20           H61        A  20 -12.289  -1.183   1.718
  184    H62    A  20           H62        A  20 -11.812  -2.582   2.652
  185    H2     A  20           H2         A  20 -13.539  -2.693  -2.293
  186    H5'    G  21           H5'        G  21 -10.427  -8.204  -4.839
  187   H5''    G  21          H5''        G  21  -8.891  -8.295  -5.720
  188    H4'    G  21           H4'        G  21 -10.078  -6.251  -6.306
  189    H3'    G  21           H3'        G  21  -7.657  -5.639  -4.561
  190    H2'    G  21          H2''        G  21  -8.153  -3.368  -4.871
  191   HO2'    G  21           H2'        G  21 -10.065  -3.909  -6.887
  192    H1'    G  21           H1'        G  21 -10.944  -3.676  -4.946
  193    H8     G  21           H8         G  21  -9.310  -5.437  -1.983
  194    H1     G  21           H1         G  21 -10.181   0.824  -1.133
  195    H21    G  21           H21        G  21 -10.721   1.806  -3.042
  196    H22    G  21           H22        G  21 -10.882   0.904  -4.530
  197    H5'    A  22           H5'        A  22  -7.493  -3.005  -7.656
  198   H5''    A  22          H5''        A  22  -5.919  -2.884  -8.465
  199    H4'    A  22           H4'        A  22  -6.667  -0.661  -7.803
  200    H3'    A  22           H3'        A  22  -4.364  -1.685  -6.090
  201    H2'    A  22          H2''        A  22  -4.396   0.366  -4.954
  202   HO2'    A  22           H2'        A  22  -5.351   2.245  -5.926
  203    H1'    A  22           H1'        A  22  -7.188   0.897  -5.309
  204    H8     A  22           H8         A  22  -6.465  -2.455  -3.706
  205    H61    A  22           H61        A  22  -6.441   0.498   1.688
  206    H62    A  22           H62        A  22  -6.441  -1.051   0.875
  207    H2     A  22           H2         A  22  -6.455   3.596  -1.610
  208    H5'    U  23           H5'        U  23  -3.225   2.161  -8.092
  209   H5''    U  23          H5''        U  23  -1.906   1.860  -9.242
  210    H4'    U  23           H4'        U  23  -1.605   4.015  -8.111
  211    H3'    U  23           H3'        U  23   0.394   1.893  -7.285
  212    H2'    U  23          H2''        U  23   1.342   3.358  -5.794
  213   HO2'    U  23           H2'        U  23   1.927   4.914  -7.321
  214    H1'    U  23           H1'        U  23  -0.967   5.083  -5.527
  215    H3     U  23           H3         U  23   0.467   4.462  -1.286
  216    H5     U  23           H5         U  23  -1.005   0.717  -2.383
  217    H6     U  23           H6         U  23  -1.251   1.539  -4.653
  218    H5'    C  24           H5'        C  24   1.200   4.121 -11.518
  219   H5''    C  24          H5''        C  24   2.733   3.476 -12.136
  220    H4'    C  24           H4'        C  24   2.014   6.349 -11.544
  221    H3'    C  24           H3'        C  24   2.039   4.936 -13.991
  222    H2'    C  24          H2''        C  24   4.349   4.858 -14.303
  223   HO2'    C  24           H2'        C  24   4.689   6.354 -15.777
  224    H1'    C  24           H1'        C  24   4.773   7.456 -12.825
  225    H41    C  24           H41        C  24  10.653   4.930 -12.968
  226    H42    C  24           H42        C  24  10.125   3.666 -11.879
  227    H5     C  24           H5         C  24   7.840   3.399 -11.174
  228    H6     C  24           H6         C  24   5.573   4.301 -11.341
  229    H5'    U  25           H5'        U  25  -1.459   7.822 -11.943
  230   H5''    U  25          H5''        U  25   0.294   7.875 -11.673
  231    H4'    U  25           H4'        U  25  -0.864   5.326 -10.853
  232    H3'    U  25           H3'        U  25  -2.595   7.409 -10.103
  233    H2'    U  25          H2''        U  25  -1.121   8.538  -8.669
  234   HO2'    U  25           H2'        U  25  -1.687   6.325  -6.971
  235    H1'    U  25           H1'        U  25   0.153   5.956  -7.804
  236    H3     U  25           H3         U  25   2.585  10.622  -8.689
  237    H5     U  25           H5         U  25   3.507   8.020  -5.495
  238    H6     U  25           H6         U  25   1.811   6.508  -6.330
  239    H5'    G  26           H5'        G  26  -5.686   7.637  -7.529
  240   H5''    G  26          H5''        G  26  -4.176   8.436  -7.997
  241    H4'    G  26           H4'        G  26  -4.977   9.394  -5.934
  242    H3'    G  26           H3'        G  26  -2.553   7.617  -5.471
  243    H2'    G  26          H2''        G  26  -2.595   8.248  -3.227
  244   HO2'    G  26           H2'        G  26  -4.541  10.220  -3.437
  245    H1'    G  26           H1'        G  26  -5.374   8.451  -3.000
  246    H8     G  26           H8         G  26  -5.156   5.093  -4.406
  247    H1     G  26           H1         G  26  -2.727   5.390   1.525
  248    H21    G  26           H21        G  26  -2.313   7.539   2.058
  249    H22    G  26           H22        G  26  -2.661   8.848   0.951
  250    H5'    A  27           H5'        A  27  -1.971  11.201  -3.509
  251   H5''    A  27          H5''        A  27  -0.427  11.989  -3.859
  252    H4'    A  27           H4'        A  27  -0.885  11.998  -1.452
  253    H3'    A  27           H3'        A  27   1.397  10.076  -2.106
  254    H2'    A  27          H2''        A  27   1.636   9.803   0.217
  255   HO2'    A  27           H2'        A  27   0.046  12.142   0.487
  256    H1'    A  27           H1'        A  27  -1.077   9.924   0.828
  257    H8     A  27           H8         A  27  -0.366   7.522  -2.064
  258    H61    A  27           H61        A  27   0.615   3.318   2.388
  259    H62    A  27           H62        A  27   0.416   3.599   0.666
  260    H2     A  27           H2         A  27   0.306   7.347   4.306
  261    H5'    G  28           H5'        G  28   2.634  12.702   0.929
  262   H5''    G  28          H5''        G  28   4.324  13.221   0.823
  263    H4'    G  28           H4'        G  28   3.853  12.286   3.025
  264    H3'    G  28           H3'        G  28   5.621  10.375   1.432
  265    H2'    G  28          H2''        G  28   5.697   9.053   3.361
  266   HO2'    G  28           H2'        G  28   4.857  11.393   4.754
  267    H1'    G  28           H1'        G  28   3.101   9.652   4.253
  268    H8     G  28           H8         G  28   3.265   8.553   0.604
  269    H1     G  28           H1         G  28   3.348   3.713   4.776
  270    H21    G  28           H21        G  28   3.676   4.456   6.821
  271    H22    G  28           H22        G  28   3.849   6.159   7.175
  272    H5'    C  29           H5'        C  29   7.305  10.808   5.154
  273   H5''    C  29          H5''        C  29   9.062  11.028   5.173
  274    H4'    C  29           H4'        C  29   8.405   9.188   6.651
  275    H3'    C  29           H3'        C  29   9.845   8.180   4.167
  276    H2'    C  29          H2''        C  29   9.657   6.023   5.026
  277   HO2'    C  29           H2'        C  29   9.679   5.578   7.172
  278    H1'    C  29           H1'        C  29   7.262   6.493   6.528
  279    H41    C  29           H41        C  29   5.614   2.407   1.971
  280    H42    C  29           H42        C  29   5.511   3.726   0.822
  281    H5     C  29           H5         C  29   6.180   5.979   1.335
  282    H6     C  29           H6         C  29   7.123   7.445   3.051
  283    H5'    C  30           H5'        C  30  11.545   6.489   7.477
  284   H5''    C  30          H5''        C  30  13.319   6.514   7.535
  285    H4'    C  30           H4'        C  30  12.523   4.250   7.929
  286    H3'    C  30           H3'        C  30  14.115   4.814   5.491
  287    H2'    C  30          H2''        C  30  13.165   3.188   4.182
  288   HO2'    C  30           H2'        C  30  13.958   1.329   4.733
  289    H1'    C  30           H1'        C  30  11.280   2.137   6.203
  290    H41    C  30           H41        C  30   7.334   2.197   1.264
  291    H42    C  30           H42        C  30   8.204   3.520   0.522
  292    H5     C  30           H5         C  30  10.083   4.576   1.485
  293    H6     C  30           H6         C  30  11.616   4.596   3.369
  294    H5'    U  31           H5'        U  31  18.630   2.823   6.381
  295   H5''    U  31          H5''        U  31  18.450   4.229   5.311
  296    H4'    U  31           H4'        U  31  19.547   2.484   4.077
  297    H3'    U  31           H3'        U  31  17.213   3.637   3.111
  298    H2'    U  31          H2''        U  31  15.739   1.864   3.519
  299   HO2'    U  31           H2'        U  31  15.429   1.432   1.476
  300    H1'    U  31           H1'        U  31  17.817  -0.246   3.020
  301    H3     U  31           H3         U  31  15.335  -3.473   4.914
  302    H5     U  31           H5         U  31  14.203  -0.043   7.088
  303    H6     U  31           H6         U  31  15.735   1.250   5.725
  304    H5'    G  32           H5'        G  32  17.226   2.388  -2.029
  305   H5''    G  32          H5''        G  32  16.359   3.877  -1.606
  306    H4'    G  32           H4'        G  32  15.235   1.073  -1.331
  307    H3'    G  32           H3'        G  32  15.476   2.464  -3.745
  308    H2'    G  32          H2''        G  32  14.010   4.217  -3.279
  309   HO2'    G  32           H2'        G  32  12.901   3.028  -4.884
  310    H1'    G  32           H1'        G  32  12.216   2.501  -1.581
  311    H8     G  32           H8         G  32  14.363   5.190  -0.013
  312    H1     G  32           H1         G  32   8.471   7.205  -1.538
  313    H21    G  32           H21        G  32   7.446   5.683  -2.790
  314    H22    G  32           H22        G  32   8.207   4.176  -3.247
  315    H5'    G  33           H5'        G  33  15.471  -1.441  -4.243
  316   H5''    G  33          H5''        G  33  14.889  -2.503  -5.538
  317    H4'    G  33           H4'        G  33  14.995  -3.807  -3.553
  318    H3'    G  33           H3'        G  33  12.516  -3.580  -4.838
  319    H2'    G  33          H2''        G  33  11.463  -2.229  -3.246
  320   HO2'    G  33           H2'        G  33  11.250  -4.325  -1.465
  321    H1'    G  33           H1'        G  33  12.975  -3.494  -0.965
  322    H8     G  33           H8         G  33  12.029  -0.109  -2.646
  323    H1     G  33           H1         G  33  12.014  -0.159   3.764
  324    H21    G  33           H21        G  33  12.674  -2.145   4.508
  325    H22    G  33           H22        G  33  13.116  -3.451   3.431
  326    H5'    G  34           H5'        G  34  12.948  -5.983  -1.120
  327   H5''    G  34          H5''        G  34  12.544  -7.685  -1.393
  328    H4'    G  34           H4'        G  34  12.221  -7.154   0.944
  329    H3'    G  34           H3'        G  34  10.169  -8.312  -0.593
  330    H2'    G  34          H2''        G  34   8.722  -6.480  -0.679
  331   HO2'    G  34           H2'        G  34   7.771  -6.467   1.755
  332    H1'    G  34           H1'        G  34   9.546  -5.478   2.036
  333    H8     G  34           H8         G  34   8.331  -4.491  -1.517
  334    H1     G  34           H1         G  34   8.833   0.347   2.617
  335    H21    G  34           H21        G  34   9.795  -0.298   4.483
  336    H22    G  34           H22        G  34  10.359  -1.936   4.736
  337    H5'    A  35           H5'        A  35   8.950 -11.156   3.015
  338   H5''    A  35          H5''        A  35   7.963 -11.855   1.711
  339    H4'    A  35           H4'        A  35   8.271  -8.970   2.509
  340    H3'    A  35           H3'        A  35   6.179 -10.757   3.068
  341    H2'    A  35          H2''        A  35   5.419 -10.978   0.854
  342   HO2'    A  35           H2'        A  35   4.359  -8.431   1.575
  343    H1'    A  35           H1'        A  35   6.102  -8.106   0.314
  344    H8     A  35           H8         A  35   6.638  -7.730  -2.260
  345    H61    A  35           H61        A  35   5.432 -12.956  -5.439
  346    H62    A  35           H62        A  35   5.804 -11.253  -5.591
  347    H2     A  35           H2         A  35   5.288 -13.873  -1.066
  348    H5'    G  36           H5'        G  36   6.734  -7.796   5.666
  349   H5''    G  36          H5''        G  36   5.386  -7.985   6.799
  350    H4'    G  36           H4'        G  36   6.786  -6.169   7.537
  351    H3'    G  36           H3'        G  36   4.202  -5.123   6.332
  352    H2'    G  36          H2''        G  36   4.888  -2.982   6.898
  353   HO2'    G  36           H2'        G  36   6.919  -3.992   8.605
  354    H1'    G  36           H1'        G  36   7.656  -3.452   6.615
  355    H8     G  36           H8         G  36   5.977  -4.399   3.334
  356    H1     G  36           H1         G  36   6.779   1.920   4.149
  357    H21    G  36           H21        G  36   7.355   2.381   6.228
  358    H22    G  36           H22        G  36   7.547   1.138   7.444
  359    H5'    C  37           H5'        C  37   4.714  -3.316  10.087
  360   H5''    C  37          H5''        C  37   3.250  -3.298  11.083
  361    H4'    C  37           H4'        C  37   4.230  -1.076  11.027
  362    H3'    C  37           H3'        C  37   1.700  -1.176   9.316
  363    H2'    C  37          H2''        C  37   1.974   1.147   9.055
  364   HO2'    C  37           H2'        C  37   4.019   1.736  10.686
  365    H1'    C  37           H1'        C  37   4.780   1.118   9.010
  366    H41    C  37           H41        C  37   2.945   2.044   2.993
  367    H42    C  37           H42        C  37   2.690   0.327   2.789
  368    H5     C  37           H5         C  37   2.877  -1.258   4.613
  369    H6     C  37           H6         C  37   3.295  -1.505   7.017
  370    H5'    U  38           H5'        U  38   1.137   2.042  11.882
  371   H5''    U  38          H5''        U  38  -0.499   2.161  12.555
  372    H4'    U  38           H4'        U  38   0.121   4.247  11.447
  373    H3'    U  38           H3'        U  38  -1.965   2.743   9.800
  374    H2'    U  38          H2''        U  38  -1.950   4.584   8.351
  375   HO2'    U  38           H2'        U  38  -1.668   6.589   9.026
  376    H1'    U  38           H1'        U  38   0.773   5.239   8.703
  377    H3     U  38           H3         U  38   0.245   4.502   4.235
  378    H5     U  38           H5         U  38   0.268   0.664   5.985
  379    H6     U  38           H6         U  38   0.107   1.728   8.156
  380    H5'    C  39           H5'        C  39  -3.275   6.645  10.363
  381   H5''    C  39          H5''        C  39  -5.010   6.857  10.660
  382    H4'    C  39           H4'        C  39  -4.246   8.224   8.773
  383    H3'    C  39           H3'        C  39  -6.042   5.953   7.802
  384    H2'    C  39          H2''        C  39  -5.790   6.849   5.655
  385   HO2'    C  39           H2'        C  39  -4.883   9.082   5.480
  386    H1'    C  39           H1'        C  39  -3.188   7.881   6.049
  387    H41    C  39           H41        C  39  -2.665   3.065   1.960
  388    H42    C  39           H42        C  39  -2.732   1.897   3.260
  389    H5     C  39           H5         C  39  -3.146   2.530   5.589
  390    H6     C  39           H6         C  39  -3.675   4.413   7.079
  391    H5'    U  40           H5'        U  40  -7.187   9.368   6.022
  392   H5''    U  40          H5''        U  40  -8.925   9.720   5.959
  393    H4'    U  40           H4'        U  40  -7.917   9.799   3.711
  394    H3'    U  40           H3'        U  40  -9.783   7.416   4.068
  395    H2'    U  40          H2''        U  40  -9.402   6.911   1.802
  396   HO2'    U  40           H2'        U  40  -8.474   8.434   0.365
  397    H1'    U  40           H1'        U  40  -6.727   7.667   1.740
  398    H3     U  40           H3         U  40  -6.839   3.143   0.841
  399    H5     U  40           H5         U  40  -7.301   3.485   5.028
  400    H6     U  40           H6         U  40  -7.560   5.876   4.749
  401    H5'    C  41           H5'        C  41 -10.855   9.477   0.563
  402   H5''    C  41          H5''        C  41 -12.595   9.738   0.328
  403    H4'    C  41           H4'        C  41 -11.622   8.667  -1.640
  404    H3'    C  41           H3'        C  41 -13.367   6.726  -0.066
  405    H2'    C  41          H2''        C  41 -12.967   5.167  -1.777
  406   HO2'    C  41           H2'        C  41 -12.252   7.438  -3.327
  407    H1'    C  41           H1'        C  41 -10.324   5.888  -2.258
  408    H41    C  41           H41        C  41 -10.048   0.621   1.323
  409    H42    C  41           H42        C  41 -10.278   1.589   2.762
  410    H5     C  41           H5         C  41 -10.775   3.928   2.703
  411    H6     C  41           H6         C  41 -11.181   5.871   1.264
  412    H5'    U  42           H5'        U  42 -14.620   6.436  -3.996
  413   H5''    U  42          H5''        U  42 -16.380   6.419  -4.226
  414    H4'    U  42           H4'        U  42 -15.364   4.457  -5.278
  415    H3'    U  42           H3'        U  42 -16.903   3.683  -2.760
  416    H2'    U  42          H2''        U  42 -16.426   1.445  -3.324
  417   HO2'    U  42           H2'        U  42 -15.213   1.677  -5.718
  418    H1'    U  42           H1'        U  42 -13.868   1.927  -4.329
  419    H3     U  42           H3         U  42 -13.297  -0.785  -0.692
  420    H5     U  42           H5         U  42 -13.909   3.063   0.902
  421    H6     U  42           H6         U  42 -14.562   3.803  -1.313
  422    H5'    G  43           H5'        G  43 -18.228   1.194  -5.811
  423   H5''    G  43          H5''        G  43 -19.980   0.924  -5.851
  424    H4'    G  43           H4'        G  43 -18.796  -1.209  -5.790
  425    H3'    G  43           H3'        G  43 -20.168  -0.643  -3.127
  426    H2'    G  43          H2''        G  43 -19.450  -2.769  -2.443
  427   HO2'    G  43           H2'        G  43 -18.577  -4.263  -4.070
  428    H1'    G  43           H1'        G  43 -17.014  -2.735  -3.808
  429    H8     G  43           H8         G  43 -17.607   0.459  -1.812
  430    H1     G  43           H1         G  43 -15.385  -4.401   1.702
  431    H21    G  43           H21        G  43 -15.513  -6.306   0.535
  432    H22    G  43           H22        G  43 -16.124  -6.351  -1.102
  433    H5'    C  44           H5'        C  44 -21.243  -4.473  -4.340
  434   H5''    C  44          H5''        C  44 -22.950  -4.893  -4.104
  435    H4'    C  44           H4'        C  44 -21.501  -6.567  -3.065
  436    H3'    C  44           H3'        C  44 -22.913  -4.879  -0.957
  437    H2'    C  44          H2''        C  44 -21.931  -6.282   0.644
  438   HO2'    C  44           H2'        C  44 -21.870  -8.110  -1.485
  439    H1'    C  44           H1'        C  44 -19.526  -6.687  -0.728
  440    H41    C  44           H41        C  44 -18.211  -2.577   3.951
  441    H42    C  44           H42        C  44 -18.824  -1.256   2.981
  442    H5     C  44           H5         C  44 -19.897  -1.581   0.840
  443    H6     C  44           H6         C  44 -20.686  -3.249  -0.773
  444    H5'    C  45           H5'        C  45 -23.456  -8.847   0.051
  445   H5''    C  45          H5''        C  45 -25.118  -9.291   0.485
  446    H4'    C  45           H4'        C  45 -23.566 -10.016   2.230
  447    H3'    C  45           H3'        C  45 -25.280  -7.660   3.059
  448   HO3'    C  45           H3T        C  45 -25.979  -9.993   2.530
  449    H2'    C  45          H2''        C  45 -24.287  -7.734   5.162
  450   HO2'    C  45           H2'        C  45 -24.682 -10.176   5.170
  451    H1'    C  45           H1'        C  45 -21.781  -8.764   4.275
  452    H41    C  45           H41        C  45 -20.654  -2.694   6.028
  453    H42    C  45           H42        C  45 -21.359  -2.159   4.526
  454    H5     C  45           H5         C  45 -22.395  -3.612   2.947
  455    H6     C  45           H6         C  45 -23.064  -5.912   2.460
  Start of MODEL    6
    1    H1   DAB   1           H        DAB   1  -2.879  -9.223  -1.623
    2    HA   DAB   1           HA       DAB   1  -3.618  -8.391  -4.388
    3    HB2  DAB   1           HB2      DAB   1  -3.680  -6.686  -1.887
    4    HB3  DAB   1           HB3      DAB   1  -4.182  -6.199  -3.507
    5    HG2  DAB   1           HG2      DAB   1  -5.437  -8.417  -1.863
    6    HG3  DAB   1           HG3      DAB   1  -6.140  -6.826  -2.152
    7    HD1  DAB   1           HD1      DAB   1  -6.826  -7.432  -4.165
    8    HD2  DAB   1           HD2      DAB   1  -6.500  -9.031  -3.700
    9    HD3  DAB   1           HD3      DAB   1  -5.339  -8.146  -4.566
   10    H    VAL   2           H        VAL   2  -2.231  -7.042  -5.501
   11    HA   VAL   2           HA       VAL   2   0.406  -6.605  -4.240
   12    HB   VAL   2           HB       VAL   2   0.743  -8.222  -5.907
   13   HG11  VAL   2          HG11      VAL   2  -0.081  -7.716  -8.291
   14   HG12  VAL   2          HG12      VAL   2  -1.081  -6.459  -7.561
   15   HG13  VAL   2          HG13      VAL   2  -1.322  -8.149  -7.114
   16   HG21  VAL   2          HG21      VAL   2   2.156  -6.015  -5.928
   17   HG22  VAL   2          HG22      VAL   2   1.313  -5.686  -7.442
   18   HG23  VAL   2          HG23      VAL   2   2.315  -7.129  -7.285
   19    H    ARG   3           H        ARG   3   1.421  -4.627  -4.424
   20    HA   ARG   3           HA       ARG   3   0.141  -2.592  -6.114
   21    HB2  ARG   3           HB2      ARG   3   0.219  -2.626  -3.126
   22    HB3  ARG   3           HB3      ARG   3   0.345  -1.085  -3.968
   23    HG2  ARG   3           HG2      ARG   3  -1.870  -1.066  -4.297
   24    HG3  ARG   3           HG3      ARG   3  -1.805  -2.585  -5.158
   25    HD2  ARG   3           HD2      ARG   3  -3.291  -2.959  -3.331
   26    HD3  ARG   3           HD3      ARG   3  -1.780  -3.743  -2.888
   27    HE   ARG   3           HE       ARG   3  -1.520  -2.171  -1.184
   28   HH11  ARG   3          HH11      ARG   3  -2.234  -0.438   0.077
   29   HH12  ARG   3          HH12      ARG   3  -3.567   0.527  -0.460
   30   HH21  ARG   3          HH21      ARG   3  -3.969  -1.227  -3.426
   31   HH22  ARG   3          HH22      ARG   3  -4.553   0.081  -2.452
   32    H    THR   4           H        THR   4   1.452  -0.800  -6.543
   33    HA   THR   4           HA       THR   4   4.227  -1.074  -5.628
   34    HB   THR   4           HB       THR   4   3.339  -0.415  -8.431
   35    HG1  THR   4           HG1      THR   4   4.299  -2.369  -8.921
   36   HG21  THR   4          HG21      THR   4   5.320   0.874  -7.817
   37   HG22  THR   4          HG22      THR   4   5.776  -0.420  -8.923
   38   HG23  THR   4          HG23      THR   4   6.103  -0.581  -7.200
   39    H    ARG   5           H        ARG   5   5.431   0.827  -5.397
   40    HA   ARG   5           HA       ARG   5   3.847   3.316  -5.547
   41    HB2  ARG   5           HB2      ARG   5   5.861   2.972  -3.378
   42    HB3  ARG   5           HB3      ARG   5   4.419   3.955  -3.409
   43    HG2  ARG   5           HG2      ARG   5   4.258   0.939  -3.418
   44    HG3  ARG   5           HG3      ARG   5   4.388   1.844  -1.914
   45    HD2  ARG   5           HD2      ARG   5   2.202   1.984  -3.984
   46    HD3  ARG   5           HD3      ARG   5   2.047   1.584  -2.281
   47    HE   ARG   5           HE       ARG   5   2.119   4.191  -3.414
   48   HH11  ARG   5          HH11      ARG   5   2.095   5.952  -1.986
   49   HH12  ARG   5          HH12      ARG   5   2.465   5.705  -0.302
   50   HH21  ARG   5          HH21      ARG   5   2.921   2.279  -0.665
   51   HH22  ARG   5          HH22      ARG   5   2.914   3.613   0.443
   52    H    LYS   6           H        LYS   6   4.879   3.980  -7.417
   53    HA   LYS   6           HA       LYS   6   6.820   4.276  -8.806
   54    HB2  LYS   6           HB2      LYS   6   5.641   6.372  -7.906
   55    HB3  LYS   6           HB3      LYS   6   7.023   6.517  -6.818
   56    HG2  LYS   6           HG2      LYS   6   8.502   6.298  -8.886
   57    HG3  LYS   6           HG3      LYS   6   7.038   6.519  -9.839
   58    HD2  LYS   6           HD2      LYS   6   7.514   8.520  -7.671
   59    HD3  LYS   6           HD3      LYS   6   8.611   8.593  -9.046
   60    HE2  LYS   6           HE2      LYS   6   6.463  10.010  -9.170
   61    HE3  LYS   6           HE1      LYS   6   6.834   9.012 -10.578
   62    HZ1  LYS   6           HZ1      LYS   6   4.611   8.570 -10.123
   63    HZ2  LYS   6           HZ2      LYS   6   4.852   8.550  -8.441
   64    HZ3  LYS   6           HZ3      LYS   6   5.416   7.263  -9.401
   65    H    GLY   7           H        GLY   7   8.083   2.416  -7.944
   66    HA2  GLY   7           HA2      GLY   7  10.516   2.187  -7.684
   67    HA3  GLY   7           HA3      GLY   7  10.425   3.384  -6.405
   68    H    ARG   8           H        ARG   8   8.483   2.584  -4.803
   69    HA   ARG   8           HA       ARG   8   9.566   0.159  -3.651
   70    HB2  ARG   8           HB2      ARG   8   7.354   1.852  -2.518
   71    HB3  ARG   8           HB3      ARG   8   8.408   0.760  -1.661
   72    HG2  ARG   8           HG2      ARG   8  10.295   2.232  -1.917
   73    HG3  ARG   8           HG3      ARG   8   9.453   3.200  -3.122
   74    HD2  ARG   8           HD2      ARG   8   8.109   2.995  -0.486
   75    HD3  ARG   8           HD3      ARG   8   9.619   3.904  -0.514
   76    HE   ARG   8           HE       ARG   8   7.137   4.791  -1.578
   77   HH11  ARG   8          HH11      ARG   8   7.133   6.692  -2.816
   78   HH12  ARG   8          HH12      ARG   8   8.609   7.269  -3.516
   79   HH21  ARG   8          HH21      ARG   8  10.535   4.679  -2.252
   80   HH22  ARG   8          HH22      ARG   8  10.533   6.130  -3.197
   81    H    ARG   9           H        ARG   9   8.834  -1.651  -4.531
   82    HA   ARG   9           HA       ARG   9   6.095  -1.946  -5.367
   83    HB2  ARG   9           HB2      ARG   9   6.766  -4.146  -6.174
   84    HB3  ARG   9           HB3      ARG   9   7.922  -2.930  -6.721
   85    HG2  ARG   9           HG2      ARG   9   9.174  -3.538  -4.491
   86    HG3  ARG   9           HG3      ARG   9   8.236  -5.028  -4.603
   87    HD2  ARG   9           HD2      ARG   9   9.964  -3.933  -6.839
   88    HD3  ARG   9           HD3      ARG   9  10.471  -5.198  -5.723
   89    HE   ARG   9           HE       ARG   9   7.979  -5.717  -7.137
   90   HH11  ARG   9          HH11      ARG   9   8.036  -7.529  -8.509
   91   HH12  ARG   9          HH12      ARG   9   9.556  -8.263  -8.900
   92   HH21  ARG   9          HH21      ARG   9  11.420  -6.036  -7.004
   93   HH22  ARG   9          HH22      ARG   9  11.472  -7.418  -8.047
   94    H    ILE  10           H        ILE  10   4.518  -2.500  -3.940
   95    HA   ILE  10           HA       ILE  10   5.359  -4.144  -1.614
   96    HB   ILE  10           HB       ILE  10   3.872  -2.930  -0.233
   97   HG12  ILE  10          HG12      ILE  10   2.763  -1.803  -2.820
   98   HG13  ILE  10          HG13      ILE  10   1.910  -2.797  -1.641
   99   HG21  ILE  10          HG21      ILE  10   5.008  -0.948  -0.188
  100   HG22  ILE  10          HG22      ILE  10   4.638  -0.578  -1.871
  101   HG23  ILE  10          HG23      ILE  10   5.968  -1.672  -1.476
  102   HD11  ILE  10          HD11      ILE  10   1.315  -0.415  -1.435
  103   HD12  ILE  10          HD12      ILE  10   3.007  -0.016  -1.152
  104   HD13  ILE  10          HD13      ILE  10   2.125  -0.999   0.018
  105    H    4J5  11           H        NOR  11   3.558  -5.394  -0.629
  106    HA   4J5  11           HA       NOR  11   1.373  -6.025  -2.423
  107    HD   4J5  11           HD       NOR  11   2.164 -10.822  -2.156
  108    HB2  4J5  11           HB2      NOR  11   3.115  -7.533  -3.278
  109    HB3  4J5  11           HB3      NOR  11   3.410  -8.122  -1.648
  110    HG2  4J5  11           HG2      NOR  11   1.008  -8.929  -1.601
  111    HG3  4J5  11           HG3      NOR  11   0.926  -8.547  -3.320
  112   HH11  4J5  11          HH11      NOR  11   2.443  -8.462  -4.668
  113   HH12  4J5  11          HH12      NOR  11   3.287  -9.522  -5.749
  114   HH21  4J5  11          HH21      NOR  11   3.238 -12.213  -3.561
  115   HH22  4J5  11          HH22      NOR  11   3.737 -11.649  -5.120
  116    H    ILE  12           H        ILE  12  -0.392  -6.659  -1.400
  117    HA   ILE  12           HA       ILE  12  -0.188  -7.099   1.509
  118    HB   ILE  12           HB       ILE  12  -2.908  -6.612   0.718
  119   HG12  ILE  12          HG12      ILE  12  -1.709  -5.517  -1.314
  120   HG13  ILE  12          HG13      ILE  12  -2.817  -4.498  -0.401
  121   HG21  ILE  12          HG21      ILE  12  -2.497  -4.528   2.131
  122   HG22  ILE  12          HG22      ILE  12  -0.819  -5.059   2.265
  123   HG23  ILE  12          HG23      ILE  12  -2.116  -6.067   2.906
  124   HD11  ILE  12          HD11      ILE  12  -1.080  -3.341   0.673
  125   HD12  ILE  12          HD12      ILE  12  -0.474  -3.542  -0.972
  126   HD13  ILE  12          HD13      ILE  12   0.105  -4.595   0.314
  127    HA   DPR  13           HA       DPR  13  -1.707 -11.190   1.506
  128    HB2  DPR  13           HB2      DPR  13   0.071 -12.692   1.323
  129    HB3  DPR  13           HB3      DPR  13   0.781 -11.836  -0.068
  130    HG2  DPR  13           HG2      DPR  13   0.858 -11.140   2.823
  131    HG3  DPR  13           HG3      DPR  13   2.139 -11.069   1.600
  132    HD2  DPR  13           HD2      DPR  13   0.678  -8.893   2.401
  133    HD3  DPR  13           HD3      DPR  13   1.457  -9.036   0.811
  134    HA   PRO  14           HA       PRO  14  -3.233 -12.504  -2.486
  135    HB2  PRO  14           HB2      PRO  14  -5.815 -11.639  -2.277
  136    HB3  PRO  14           HB3      PRO  14  -5.187 -13.060  -1.421
  137    HG2  PRO  14           HG2      PRO  14  -5.642 -10.293  -0.415
  138    HG3  PRO  14           HG3      PRO  14  -5.951 -11.851   0.375
  139    HD2  PRO  14           HD2      PRO  14  -3.761 -10.319   0.931
  140    HD3  PRO  14           HD3      PRO  14  -3.765 -12.088   1.067
  141    H5'    G  17           H5'        G  17 -16.184  -2.092  15.849
  142   H5''    G  17          H5''        G  17 -14.551  -2.753  15.655
  143    H4'    G  17           H4'        G  17 -16.151  -4.532  15.329
  144    H3'    G  17           H3'        G  17 -14.883  -3.655  12.713
  145    H2'    G  17          H2''        G  17 -16.072  -5.355  11.647
  146   HO2'    G  17           H2'        G  17 -17.006  -7.087  12.759
  147    H1'    G  17           H1'        G  17 -18.393  -5.134  13.154
  148    H8     G  17           H8         G  17 -17.319  -1.646  12.247
  149    H1     G  17           H1         G  17 -20.193  -4.772   7.436
  150    H21    G  17           H21        G  17 -20.393  -6.895   7.912
  151    H22    G  17           H22        G  17 -19.821  -7.581   9.416
  152   HO5'    G  17           H5T        G  17 -15.987  -0.972  14.068
  153    H5'    G  18           H5'        G  18 -14.665  -7.732  12.770
  154   H5''    G  18          H5''        G  18 -13.097  -8.428  12.327
  155    H4'    G  18           H4'        G  18 -14.868  -9.404  10.961
  156    H3'    G  18           H3'        G  18 -13.145  -7.515   9.315
  157    H2'    G  18          H2''        G  18 -14.407  -8.158   7.466
  158   HO2'    G  18           H2'        G  18 -15.192 -10.115   7.227
  159    H1'    G  18           H1'        G  18 -16.838  -8.398   8.801
  160    H8     G  18           H8         G  18 -15.099  -5.135   9.697
  161    H1     G  18           H1         G  18 -18.195  -4.933   4.097
  162    H21    G  18           H21        G  18 -18.797  -6.976   3.481
  163    H22    G  18           H22        G  18 -18.441  -8.390   4.448
  164    H5'    C  19           H5'        C  19 -13.484 -11.030   7.198
  165   H5''    C  19          H5''        C  19 -11.992 -11.643   6.465
  166    H4'    C  19           H4'        C  19 -13.762 -11.468   4.782
  167    H3'    C  19           H3'        C  19 -11.655  -9.317   4.347
  168    H2'    C  19          H2''        C  19 -12.848  -8.699   2.438
  169   HO2'    C  19           H2'        C  19 -14.031 -10.066   1.266
  170    H1'    C  19           H1'        C  19 -15.395  -9.223   3.482
  171    H41    C  19           H41        C  19 -14.737  -2.890   3.575
  172    H42    C  19           H42        C  19 -13.867  -2.992   5.089
  173    H5     C  19           H5         C  19 -13.229  -5.091   6.103
  174    H6     C  19           H6         C  19 -13.225  -7.522   5.834
  175    H5'    A  20           H5'        A  20 -12.332 -11.036   0.693
  176   H5''    A  20          H5''        A  20 -10.886 -11.467  -0.234
  177    H4'    A  20           H4'        A  20 -12.373 -10.132  -1.619
  178    H3'    A  20           H3'        A  20  -9.952  -8.510  -0.765
  179    H2'    A  20          H2''        A  20 -10.763  -6.776  -2.085
  180   HO2'    A  20           H2'        A  20 -12.693  -8.473  -3.290
  181    H1'    A  20           H1'        A  20 -13.478  -7.210  -1.601
  182    H8     A  20           H8         A  20 -11.451  -7.230   1.626
  183    H61    A  20           H61        A  20 -12.198  -1.099   1.637
  184    H62    A  20           H62        A  20 -11.686  -2.489   2.568
  185    H2     A  20           H2         A  20 -13.510  -2.639  -2.344
  186    H5'    G  21           H5'        G  21 -10.349  -8.108  -4.909
  187   H5''    G  21          H5''        G  21  -8.830  -8.205  -5.817
  188    H4'    G  21           H4'        G  21 -10.020  -6.164  -6.410
  189    H3'    G  21           H3'        G  21  -7.591  -5.524  -4.696
  190    H2'    G  21          H2''        G  21  -8.099  -3.269  -5.002
  191   HO2'    G  21           H2'        G  21  -9.433  -4.208  -7.313
  192    H1'    G  21           H1'        G  21 -10.896  -3.596  -5.050
  193    H8     G  21           H8         G  21  -9.242  -5.330  -2.087
  194    H1     G  21           H1         G  21 -10.169   0.922  -1.227
  195    H21    G  21           H21        G  21 -10.731   1.901  -3.126
  196    H22    G  21           H22        G  21 -10.887   1.005  -4.620
  197    H5'    A  22           H5'        A  22  -7.479  -2.875  -7.735
  198   H5''    A  22          H5''        A  22  -5.923  -2.771  -8.580
  199    H4'    A  22           H4'        A  22  -6.635  -0.533  -7.926
  200    H3'    A  22           H3'        A  22  -4.337  -1.566  -6.239
  201    H2'    A  22          H2''        A  22  -4.345   0.467  -5.097
  202   HO2'    A  22           H2'        A  22  -4.868   2.382  -6.006
  203    H1'    A  22           H1'        A  22  -7.157   1.027  -5.430
  204    H8     A  22           H8         A  22  -6.383  -2.349  -3.848
  205    H61    A  22           H61        A  22  -6.468   0.596   1.573
  206    H62    A  22           H62        A  22  -6.421  -0.951   0.758
  207    H2     A  22           H2         A  22  -6.551   3.694  -1.713
  208    H5'    U  23           H5'        U  23  -3.045   2.240  -8.314
  209   H5''    U  23          H5''        U  23  -1.659   1.892  -9.363
  210    H4'    U  23           H4'        U  23  -1.357   4.025  -8.210
  211    H3'    U  23           H3'        U  23   0.515   1.863  -7.209
  212    H2'    U  23          H2''        U  23   1.370   3.337  -5.657
  213   HO2'    U  23           H2'        U  23   1.979   4.841  -7.327
  214    H1'    U  23           H1'        U  23  -0.923   5.095  -5.593
  215    H3     U  23           H3         U  23   0.092   4.450  -1.247
  216    H5     U  23           H5         U  23  -1.396   0.741  -2.451
  217    H6     U  23           H6         U  23  -1.422   1.578  -4.742
  218    H5'    C  24           H5'        C  24   1.482   3.373 -11.412
  219   H5''    C  24          H5''        C  24   3.075   2.909 -12.046
  220    H4'    C  24           H4'        C  24   1.919   5.684 -11.694
  221    H3'    C  24           H3'        C  24   2.046   4.060 -13.985
  222    H2'    C  24          H2''        C  24   4.348   4.259 -14.395
  223   HO2'    C  24           H2'        C  24   4.242   5.496 -16.108
  224    H1'    C  24           H1'        C  24   4.440   7.039 -13.240
  225    H41    C  24           H41        C  24  10.615   5.441 -13.424
  226    H42    C  24           H42        C  24  10.341   4.235 -12.187
  227    H5     C  24           H5         C  24   8.158   3.685 -11.343
  228    H6     C  24           H6         C  24   5.761   4.197 -11.477
  229    H5'    U  25           H5'        U  25  -1.560   7.080 -12.118
  230   H5''    U  25          H5''        U  25   0.181   7.137 -11.761
  231    H4'    U  25           H4'        U  25  -1.181   4.803 -10.585
  232    H3'    U  25           H3'        U  25  -2.711   7.125 -10.231
  233    H2'    U  25          H2''        U  25  -1.179   8.336  -8.934
  234   HO2'    U  25           H2'        U  25  -1.569   6.789  -6.704
  235    H1'    U  25           H1'        U  25  -0.128   5.844  -7.641
  236    H3     U  25           H3         U  25   2.822   9.919  -9.383
  237    H5     U  25           H5         U  25   3.263   8.091  -5.591
  238    H6     U  25           H6         U  25   1.435   6.637  -6.167
  239    H5'    G  26           H5'        G  26  -5.857   7.802  -7.422
  240   H5''    G  26          H5''        G  26  -4.341   8.565  -7.939
  241    H4'    G  26           H4'        G  26  -5.077   9.563  -5.862
  242    H3'    G  26           H3'        G  26  -2.679   7.756  -5.399
  243    H2'    G  26          H2''        G  26  -2.698   8.401  -3.173
  244   HO2'    G  26           H2'        G  26  -4.621  10.342  -3.192
  245    H1'    G  26           H1'        G  26  -5.471   8.624  -2.926
  246    H8     G  26           H8         G  26  -5.304   5.276  -4.352
  247    H1     G  26           H1         G  26  -2.777   5.439   1.551
  248    H21    G  26           H21        G  26  -2.357   7.555   2.125
  249    H22    G  26           H22        G  26  -2.711   8.904   1.070
  250    H5'    A  27           H5'        A  27  -1.981  11.266  -3.404
  251   H5''    A  27          H5''        A  27  -0.449  12.062  -3.780
  252    H4'    A  27           H4'        A  27  -0.819  12.038  -1.365
  253    H3'    A  27           H3'        A  27   1.379  10.059  -2.086
  254    H2'    A  27          H2''        A  27   1.646   9.723   0.197
  255   HO2'    A  27           H2'        A  27   0.560  12.294   0.377
  256    H1'    A  27           H1'        A  27  -1.064   9.981   0.881
  257    H8     A  27           H8         A  27  -0.548   7.565  -2.019
  258    H61    A  27           H61        A  27   0.299   3.266   2.362
  259    H62    A  27           H62        A  27   0.089   3.567   0.645
  260    H2     A  27           H2         A  27   0.241   7.281   4.338
  261    H5'    G  28           H5'        G  28   2.701  12.557   0.985
  262   H5''    G  28          H5''        G  28   4.396  13.059   0.907
  263    H4'    G  28           H4'        G  28   3.886  12.096   3.094
  264    H3'    G  28           H3'        G  28   5.648  10.185   1.511
  265    H2'    G  28          H2''        G  28   5.657   8.822   3.395
  266   HO2'    G  28           H2'        G  28   4.703   9.846   5.440
  267    H1'    G  28           H1'        G  28   3.057   9.487   4.265
  268    H8     G  28           H8         G  28   3.222   8.388   0.613
  269    H1     G  28           H1         G  28   3.072   3.534   4.770
  270    H21    G  28           H21        G  28   3.401   4.259   6.818
  271    H22    G  28           H22        G  28   3.649   5.951   7.181
  272    H5'    C  29           H5'        C  29   7.106  10.510   5.258
  273   H5''    C  29          H5''        C  29   8.848  10.777   5.442
  274    H4'    C  29           H4'        C  29   8.108   8.917   6.855
  275    H3'    C  29           H3'        C  29   9.794   7.952   4.520
  276    H2'    C  29          H2''        C  29   9.559   5.788   5.334
  277   HO2'    C  29           H2'        C  29   8.533   6.345   7.842
  278    H1'    C  29           H1'        C  29   7.013   6.189   6.599
  279    H41    C  29           H41        C  29   5.938   2.162   1.813
  280    H42    C  29           H42        C  29   5.898   3.506   0.690
  281    H5     C  29           H5         C  29   6.445   5.765   1.317
  282    H6     C  29           H6         C  29   7.156   7.223   3.149
  283    H5'    C  30           H5'        C  30  10.988   6.041   7.698
  284   H5''    C  30          H5''        C  30  12.654   6.270   8.263
  285    H4'    C  30           H4'        C  30  12.059   3.900   8.303
  286    H3'    C  30           H3'        C  30  14.066   4.572   6.129
  287    H2'    C  30          H2''        C  30  14.168   2.325   5.571
  288   HO2'    C  30           H2'        C  30  13.062   1.855   8.154
  289    H1'    C  30           H1'        C  30  11.477   1.729   6.067
  290    H41    C  30           H41        C  30  12.211   2.055  -0.240
  291    H42    C  30           H42        C  30  11.623   3.701  -0.193
  292    H5     C  30           H5         C  30  11.254   4.907   1.877
  293    H6     C  30           H6         C  30  11.320   4.756   4.311
  294    H5'    U  31           H5'        U  31  15.325   1.509   9.074
  295   H5''    U  31          H5''        U  31  17.013   1.696   9.576
  296    H4'    U  31           H4'        U  31  16.537  -0.649   9.189
  297    H3'    U  31           H3'        U  31  18.550   0.685   7.506
  298    H2'    U  31          H2''        U  31  18.399  -0.621   5.616
  299   HO2'    U  31           H2'        U  31  18.412  -2.519   7.488
  300    H1'    U  31           H1'        U  31  15.873  -1.732   5.790
  301    H3     U  31           H3         U  31  14.532   0.706   2.271
  302    H5     U  31           H5         U  31  16.827   3.469   4.466
  303    H6     U  31           H6         U  31  17.195   1.749   6.121
  304    H5'    G  32           H5'        G  32  18.817  -3.630   9.324
  305   H5''    G  32          H5''        G  32  20.397  -4.419   9.181
  306    H4'    G  32           H4'        G  32  19.608  -6.055   7.818
  307    H3'    G  32           H3'        G  32  18.756  -3.995   6.168
  308    H2'    G  32          H2''        G  32  16.626  -3.688   7.079
  309   HO2'    G  32           H2'        G  32  16.624  -5.203   4.939
  310    H1'    G  32           H1'        G  32  16.266  -6.619   7.660
  311    H8     G  32           H8         G  32  16.063  -3.018   9.172
  312    H1     G  32           H1         G  32  11.710  -7.192  11.334
  313    H21    G  32           H21        G  32  12.078  -9.200  10.463
  314    H22    G  32           H22        G  32  13.389  -9.514   9.348
  315    H5'    G  33           H5'        G  33  17.482  -3.605   2.444
  316   H5''    G  33          H5''        G  33  17.154  -3.187   4.135
  317    H4'    G  33           H4'        G  33  15.254  -2.513   2.843
  318    H3'    G  33           H3'        G  33  14.908  -4.323   4.949
  319    H2'    G  33          H2''        G  33  14.444  -6.227   3.664
  320   HO2'    G  33           H2'        G  33  12.425  -5.692   4.676
  321    H1'    G  33           H1'        G  33  13.073  -4.623   1.508
  322    H8     G  33           H8         G  33  15.882  -7.265   2.182
  323    H1     G  33           H1         G  33  12.293  -8.252  -3.039
  324    H21    G  33           H21        G  33  10.831  -6.597  -3.278
  325    H22    G  33           H22        G  33  10.738  -5.258  -2.157
  326    H5'    G  34           H5'        G  34   9.255  -3.981   5.387
  327   H5''    G  34          H5''        G  34  10.301  -5.383   5.680
  328    H4'    G  34           H4'        G  34   8.453  -6.169   4.401
  329    H3'    G  34           H3'        G  34  11.035  -6.415   3.368
  330    H2'    G  34          H2''        G  34  10.870  -4.894   1.619
  331   HO2'    G  34           H2'        G  34   9.572  -7.269   0.780
  332    H1'    G  34           H1'        G  34   7.944  -5.409   1.183
  333    H8     G  34           H8         G  34   6.951  -3.330  -0.084
  334    H1     G  34           H1         G  34  12.153   0.187   1.102
  335    H21    G  34           H21        G  34  13.548  -0.936   2.388
  336    H22    G  34           H22        G  34  13.186  -2.527   3.017
  337    H5'    A  35           H5'        A  35   8.215 -10.623   1.915
  338   H5''    A  35          H5''        A  35   8.104 -10.434   0.147
  339    H4'    A  35           H4'        A  35   7.795  -8.064   1.992
  340    H3'    A  35           H3'        A  35   5.940 -10.133   2.171
  341    H2'    A  35          H2''        A  35   5.096 -10.007  -0.009
  342   HO2'    A  35           H2'        A  35   3.823  -7.704   1.106
  343    H1'    A  35           H1'        A  35   5.423  -7.025  -0.103
  344    H8     A  35           H8         A  35   5.608  -6.271  -2.598
  345    H61    A  35           H61        A  35   5.573 -11.130  -6.468
  346    H62    A  35           H62        A  35   5.512  -9.385  -6.357
  347    H2     A  35           H2         A  35   5.880 -12.657  -2.260
  348    H5'    G  36           H5'        G  36   6.180  -7.954   5.371
  349   H5''    G  36          H5''        G  36   4.813  -8.165   6.483
  350    H4'    G  36           H4'        G  36   6.285  -6.516   7.402
  351    H3'    G  36           H3'        G  36   3.818  -5.194   6.244
  352    H2'    G  36          H2''        G  36   4.649  -3.156   6.934
  353   HO2'    G  36           H2'        G  36   6.756  -3.618   8.447
  354    H1'    G  36           H1'        G  36   7.381  -3.768   6.644
  355    H8     G  36           H8         G  36   5.548  -4.606   3.442
  356    H1     G  36           H1         G  36   6.847   1.649   4.110
  357    H21    G  36           H21        G  36   7.521   2.085   6.157
  358    H22    G  36           H22        G  36   7.663   0.843   7.378
  359    H5'    C  37           H5'        C  37   4.381  -3.538   9.979
  360   H5''    C  37          H5''        C  37   2.922  -3.527  10.984
  361    H4'    C  37           H4'        C  37   3.935  -1.310  10.988
  362    H3'    C  37           H3'        C  37   1.414  -1.326   9.285
  363    H2'    C  37          H2''        C  37   1.738   0.976   9.026
  364   HO2'    C  37           H2'        C  37   3.821   1.445  10.715
  365    H1'    C  37           H1'        C  37   4.557   0.888   8.981
  366    H41    C  37           H41        C  37   2.775   1.877   2.960
  367    H42    C  37           H42        C  37   2.485   0.167   2.742
  368    H5     C  37           H5         C  37   2.623  -1.430   4.573
  369    H6     C  37           H6         C  37   3.025  -1.693   6.976
  370    H5'    U  38           H5'        U  38   0.930   1.910  11.832
  371   H5''    U  38          H5''        U  38  -0.681   2.038  12.556
  372    H4'    U  38           H4'        U  38  -0.096   4.136  11.471
  373    H3'    U  38           H3'        U  38  -2.191   2.671   9.822
  374    H2'    U  38          H2''        U  38  -2.188   4.520   8.410
  375   HO2'    U  38           H2'        U  38  -1.586   5.865  10.736
  376    H1'    U  38           H1'        U  38   0.551   5.165   8.737
  377    H3     U  38           H3         U  38  -0.027   4.487   4.268
  378    H5     U  38           H5         U  38   0.017   0.623   5.970
  379    H6     U  38           H6         U  38  -0.108   1.660   8.155
  380    H5'    C  39           H5'        C  39  -3.473   6.552  10.380
  381   H5''    C  39          H5''        C  39  -5.203   6.779  10.681
  382    H4'    C  39           H4'        C  39  -4.426   8.155   8.789
  383    H3'    C  39           H3'        C  39  -6.247   5.923   7.805
  384    H2'    C  39          H2''        C  39  -5.957   6.791   5.669
  385   HO2'    C  39           H2'        C  39  -4.745   9.134   5.971
  386    H1'    C  39           H1'        C  39  -3.352   7.835   6.117
  387    H41    C  39           H41        C  39  -2.674   3.067   1.958
  388    H42    C  39           H42        C  39  -2.773   1.890   3.248
  389    H5     C  39           H5         C  39  -3.263   2.488   5.547
  390    H6     C  39           H6         C  39  -3.847   4.347   7.061
  391    H5'    U  40           H5'        U  40  -7.307   9.337   5.996
  392   H5''    U  40          H5''        U  40  -9.031   9.746   5.933
  393    H4'    U  40           H4'        U  40  -8.021   9.836   3.689
  394    H3'    U  40           H3'        U  40  -9.922   7.487   3.995
  395    H2'    U  40          H2''        U  40  -9.515   6.983   1.757
  396   HO2'    U  40           H2'        U  40  -8.385   8.565   0.387
  397    H1'    U  40           H1'        U  40  -6.833   7.745   1.719
  398    H3     U  40           H3         U  40  -6.907   3.245   0.738
  399    H5     U  40           H5         U  40  -7.417   3.507   4.921
  400    H6     U  40           H6         U  40  -7.701   5.889   4.688
  401    H5'    C  41           H5'        C  41 -10.932   9.533   0.482
  402   H5''    C  41          H5''        C  41 -12.663   9.834   0.243
  403    H4'    C  41           H4'        C  41 -11.724   8.742  -1.729
  404    H3'    C  41           H3'        C  41 -13.475   6.820  -0.154
  405    H2'    C  41          H2''        C  41 -13.067   5.245  -1.829
  406   HO2'    C  41           H2'        C  41 -11.880   7.169  -3.532
  407    H1'    C  41           H1'        C  41 -10.429   5.998  -2.349
  408    H41    C  41           H41        C  41 -10.046   0.719   1.215
  409    H42    C  41           H42        C  41 -10.268   1.675   2.662
  410    H5     C  41           H5         C  41 -10.793   4.013   2.616
  411    H6     C  41           H6         C  41 -11.244   5.951   1.180
  412    H5'    U  42           H5'        U  42 -14.710   6.450  -4.069
  413   H5''    U  42          H5''        U  42 -16.464   6.450  -4.316
  414    H4'    U  42           H4'        U  42 -15.477   4.465  -5.340
  415    H3'    U  42           H3'        U  42 -17.011   3.720  -2.823
  416    H2'    U  42          H2''        U  42 -16.510   1.498  -3.308
  417   HO2'    U  42           H2'        U  42 -15.785   2.310  -5.946
  418    H1'    U  42           H1'        U  42 -13.972   1.976  -4.407
  419    H3     U  42           H3         U  42 -13.280  -0.724  -0.776
  420    H5     U  42           H5         U  42 -13.886   3.124   0.821
  421    H6     U  42           H6         U  42 -14.596   3.849  -1.378
  422    H5'    G  43           H5'        G  43 -18.297   1.153  -5.821
  423   H5''    G  43          H5''        G  43 -20.044   0.866  -5.868
  424    H4'    G  43           H4'        G  43 -18.850  -1.257  -5.775
  425    H3'    G  43           H3'        G  43 -20.209  -0.683  -3.117
  426    H2'    G  43          H2''        G  43 -19.454  -2.769  -2.413
  427   HO2'    G  43           H2'        G  43 -18.435  -4.166  -4.197
  428    H1'    G  43           H1'        G  43 -17.036  -2.728  -3.824
  429    H8     G  43           H8         G  43 -17.639   0.467  -1.826
  430    H1     G  43           H1         G  43 -15.261  -4.326   1.676
  431    H21    G  43           H21        G  43 -15.362  -6.237   0.524
  432    H22    G  43           H22        G  43 -16.009  -6.315  -1.099
  433    H5'    C  44           H5'        C  44 -21.207  -4.538  -4.245
  434   H5''    C  44          H5''        C  44 -22.904  -4.988  -4.012
  435    H4'    C  44           H4'        C  44 -21.433  -6.631  -2.954
  436    H3'    C  44           H3'        C  44 -22.852  -4.947  -0.857
  437    H2'    C  44          H2''        C  44 -21.829  -6.294   0.749
  438   HO2'    C  44           H2'        C  44 -21.328  -8.157  -1.357
  439    H1'    C  44           H1'        C  44 -19.434  -6.695  -0.663
  440    H41    C  44           H41        C  44 -18.074  -2.506   3.950
  441    H42    C  44           H42        C  44 -18.716  -1.205   2.974
  442    H5     C  44           H5         C  44 -19.832  -1.572   0.864
  443    H6     C  44           H6         C  44 -20.621  -3.269  -0.717
  444    H5'    C  45           H5'        C  45 -23.283  -8.888   0.237
  445   H5''    C  45          H5''        C  45 -24.926  -9.371   0.689
  446    H4'    C  45           H4'        C  45 -23.353 -10.047   2.429
  447    H3'    C  45           H3'        C  45 -25.104  -7.718   3.260
  448   HO3'    C  45           H3T        C  45 -26.445  -9.331   3.532
  449    H2'    C  45          H2''        C  45 -24.069  -7.730   5.337
  450   HO2'    C  45           H2'        C  45 -22.766  -9.673   5.951
  451    H1'    C  45           H1'        C  45 -21.554  -8.736   4.431
  452    H41    C  45           H41        C  45 -20.496  -2.629   6.073
  453    H42    C  45           H42        C  45 -21.225  -2.119   4.573
  454    H5     C  45           H5         C  45 -22.291  -3.608   3.034
  455    H6     C  45           H6         C  45 -22.928  -5.928   2.587
  Start of MODEL    7
    1    H1   DAB   1           H        DAB   1  -3.390  -8.960  -1.584
    2    HA   DAB   1           HA       DAB   1  -3.951  -8.054  -4.368
    3    HB2  DAB   1           HB2      DAB   1  -4.038  -6.460  -1.795
    4    HB3  DAB   1           HB3      DAB   1  -4.262  -5.791  -3.413
    5    HG2  DAB   1           HG2      DAB   1  -6.018  -7.774  -1.960
    6    HG3  DAB   1           HG3      DAB   1  -6.460  -6.185  -2.586
    7    HD1  DAB   1           HD1      DAB   1  -6.322  -8.713  -3.943
    8    HD2  DAB   1           HD2      DAB   1  -5.517  -7.471  -4.772
    9    HD3  DAB   1           HD3      DAB   1  -7.154  -7.297  -4.370
   10    H    VAL   2           H        VAL   2  -2.408  -6.903  -5.451
   11    HA   VAL   2           HA       VAL   2   0.207  -6.628  -4.094
   12    HB   VAL   2           HB       VAL   2   0.431  -8.308  -5.737
   13   HG11  VAL   2          HG11      VAL   2  -0.183  -7.630  -8.181
   14   HG12  VAL   2          HG12      VAL   2  -1.189  -6.401  -7.416
   15   HG13  VAL   2          HG13      VAL   2  -1.486  -8.109  -7.094
   16   HG21  VAL   2          HG21      VAL   2   1.343  -5.805  -7.168
   17   HG22  VAL   2          HG22      VAL   2   2.142  -7.376  -7.103
   18   HG23  VAL   2          HG23      VAL   2   2.110  -6.342  -5.675
   19    H    ARG   3           H        ARG   3   1.381  -4.719  -4.268
   20    HA   ARG   3           HA       ARG   3   0.256  -2.641  -6.034
   21    HB2  ARG   3           HB2      ARG   3   0.331  -2.643  -3.055
   22    HB3  ARG   3           HB3      ARG   3   0.694  -1.128  -3.877
   23    HG2  ARG   3           HG2      ARG   3  -1.445  -0.851  -4.573
   24    HG3  ARG   3           HG3      ARG   3  -1.668  -2.553  -4.940
   25    HD2  ARG   3           HD2      ARG   3  -3.035  -1.539  -2.965
   26    HD3  ARG   3           HD3      ARG   3  -2.262  -3.102  -2.741
   27    HE   ARG   3           HE       ARG   3  -0.355  -1.530  -1.781
   28   HH11  ARG   3          HH11      ARG   3  -0.244  -0.512   0.217
   29   HH12  ARG   3          HH12      ARG   3  -1.696  -0.091   1.064
   30   HH21  ARG   3          HH21      ARG   3  -3.776  -1.296  -1.443
   31   HH22  ARG   3          HH22      ARG   3  -3.716  -0.539   0.111
   32    H    THR   4           H        THR   4   1.788  -1.546  -7.034
   33    HA   THR   4           HA       THR   4   4.517  -1.769  -5.980
   34    HB   THR   4           HB       THR   4   3.788  -1.229  -8.844
   35    HG1  THR   4           HG1      THR   4   4.741  -3.704  -7.984
   36   HG21  THR   4          HG21      THR   4   6.082  -1.764  -9.290
   37   HG22  THR   4          HG22      THR   4   6.335  -2.336  -7.641
   38   HG23  THR   4          HG23      THR   4   6.084  -0.617  -7.951
   39    H    ARG   5           H        ARG   5   4.867   0.105  -4.820
   40    HA   ARG   5           HA       ARG   5   3.765   2.606  -5.661
   41    HB2  ARG   5           HB2      ARG   5   5.860   2.201  -3.558
   42    HB3  ARG   5           HB3      ARG   5   4.640   3.454  -3.649
   43    HG2  ARG   5           HG2      ARG   5   3.829   0.555  -3.398
   44    HG3  ARG   5           HG3      ARG   5   4.266   1.484  -1.970
   45    HD2  ARG   5           HD2      ARG   5   2.023   1.993  -3.915
   46    HD3  ARG   5           HD3      ARG   5   1.908   1.708  -2.182
   47    HE   ARG   5           HE       ARG   5   2.632   4.189  -3.488
   48   HH11  ARG   5          HH11      ARG   5   2.774   5.986  -2.112
   49   HH12  ARG   5          HH12      ARG   5   2.805   5.754  -0.387
   50   HH21  ARG   5          HH21      ARG   5   2.566   2.294  -0.611
   51   HH22  ARG   5          HH22      ARG   5   2.684   3.653   0.457
   52    H    LYS   6           H        LYS   6   4.829   4.218  -6.701
   53    HA   LYS   6           HA       LYS   6   6.935   3.756  -8.393
   54    HB2  LYS   6           HB2      LYS   6   5.626   5.670  -8.724
   55    HB3  LYS   6           HB3      LYS   6   5.941   6.250  -7.091
   56    HG2  LYS   6           HG2      LYS   6   7.974   7.185  -7.695
   57    HG3  LYS   6           HG3      LYS   6   8.372   5.841  -8.761
   58    HD2  LYS   6           HD2      LYS   6   8.085   7.863 -10.077
   59    HD3  LYS   6           HD3      LYS   6   6.784   6.736 -10.448
   60    HE2  LYS   6           HE2      LYS   6   5.967   9.064 -10.134
   61    HE3  LYS   6           HE1      LYS   6   5.272   7.943  -8.964
   62    HZ1  LYS   6           HZ1      LYS   6   5.972   9.860  -7.784
   63    HZ2  LYS   6           HZ2      LYS   6   7.501   9.853  -8.530
   64    HZ3  LYS   6           HZ3      LYS   6   7.087   8.635  -7.421
   65    H    GLY   7           H        GLY   7   8.341   2.457  -6.968
   66    HA2  GLY   7           HA2      GLY   7  10.759   3.047  -6.515
   67    HA3  GLY   7           HA3      GLY   7  10.103   4.150  -5.317
   68    H    ARG   8           H        ARG   8   7.945   2.176  -4.688
   69    HA   ARG   8           HA       ARG   8   9.546   0.131  -3.266
   70    HB2  ARG   8           HB2      ARG   8   7.227   1.578  -1.984
   71    HB3  ARG   8           HB3      ARG   8   8.378   0.498  -1.223
   72    HG2  ARG   8           HG2      ARG   8  10.126   2.101  -1.320
   73    HG3  ARG   8           HG3      ARG   8   9.292   3.052  -2.545
   74    HD2  ARG   8           HD2      ARG   8   7.793   2.743  -0.014
   75    HD3  ARG   8           HD3      ARG   8   9.293   3.659   0.122
   76    HE   ARG   8           HE       ARG   8   6.922   4.436  -1.396
   77   HH11  ARG   8          HH11      ARG   8   6.975   6.570  -2.165
   78   HH12  ARG   8          HH12      ARG   8   8.454   7.469  -2.114
   79   HH21  ARG   8          HH21      ARG   8  10.283   4.885  -0.697
   80   HH22  ARG   8          HH22      ARG   8  10.328   6.515  -1.282
   81    H    ARG   9           H        ARG   9   8.872  -1.814  -3.761
   82    HA   ARG   9           HA       ARG   9   6.254  -2.222  -4.899
   83    HB2  ARG   9           HB2      ARG   9   8.166  -4.471  -4.522
   84    HB3  ARG   9           HB3      ARG   9   7.061  -4.151  -5.858
   85    HG2  ARG   9           HG2      ARG   9   8.490  -2.261  -6.586
   86    HG3  ARG   9           HG3      ARG   9   9.605  -2.611  -5.263
   87    HD2  ARG   9           HD2      ARG   9  10.237  -4.688  -6.196
   88    HD3  ARG   9           HD3      ARG   9   8.845  -4.722  -7.275
   89    HE   ARG   9           HE       ARG   9  10.060  -3.444  -8.778
   90   HH11  ARG   9          HH11      ARG   9  11.884  -2.269  -9.450
   91   HH12  ARG   9          HH12      ARG   9  13.082  -1.803  -8.288
   92   HH21  ARG   9          HH21      ARG   9  11.434  -3.259  -5.607
   93   HH22  ARG   9          HH22      ARG   9  12.827  -2.363  -6.114
   94    H    ILE  10           H        ILE  10   4.572  -2.628  -3.593
   95    HA   ILE  10           HA       ILE  10   5.149  -4.250  -1.172
   96    HB   ILE  10           HB       ILE  10   3.720  -2.914   0.108
   97   HG12  ILE  10          HG12      ILE  10   2.603  -1.924  -2.529
   98   HG13  ILE  10          HG13      ILE  10   1.754  -2.893  -1.320
   99   HG21  ILE  10          HG21      ILE  10   5.812  -1.727  -0.985
  100   HG22  ILE  10          HG22      ILE  10   4.642  -0.774  -0.070
  101   HG23  ILE  10          HG23      ILE  10   4.582  -0.786  -1.831
  102   HD11  ILE  10          HD11      ILE  10   2.722  -0.047  -1.045
  103   HD12  ILE  10          HD12      ILE  10   2.075  -1.003   0.290
  104   HD13  ILE  10          HD13      ILE  10   1.051  -0.604  -1.093
  105    H    4J5  11           H        NOR  11   3.283  -5.461  -0.334
  106    HA   4J5  11           HA       NOR  11   1.159  -5.978  -2.231
  107    HD   4J5  11           HD       NOR  11   1.997 -10.253  -3.682
  108    HB2  4J5  11           HB2      NOR  11   2.802  -7.555  -3.087
  109    HB3  4J5  11           HB3      NOR  11   3.141  -8.122  -1.459
  110    HG2  4J5  11           HG2      NOR  11   0.834  -8.996  -1.282
  111    HG3  4J5  11           HG3      NOR  11   0.530  -8.500  -2.944
  112   HH11  4J5  11          HH11      NOR  11   1.836  -9.924  -0.230
  113   HH12  4J5  11          HH12      NOR  11   2.483 -11.500   0.074
  114   HH21  4J5  11          HH21      NOR  11   2.769 -12.311  -3.281
  115   HH22  4J5  11          HH22      NOR  11   3.015 -12.851  -1.655
  116    H    ILE  12           H        ILE  12  -0.662  -6.582  -1.265
  117    HA   ILE  12           HA       ILE  12  -0.556  -7.097   1.637
  118    HB   ILE  12           HB       ILE  12  -3.224  -6.438   0.915
  119   HG12  ILE  12          HG12      ILE  12  -2.047  -5.498  -1.227
  120   HG13  ILE  12          HG13      ILE  12  -3.101  -4.404  -0.333
  121   HG21  ILE  12          HG21      ILE  12  -0.971  -4.951   2.285
  122   HG22  ILE  12          HG22      ILE  12  -2.312  -5.826   3.030
  123   HG23  ILE  12          HG23      ILE  12  -2.612  -4.302   2.194
  124   HD11  ILE  12          HD11      ILE  12  -0.673  -3.640  -1.041
  125   HD12  ILE  12          HD12      ILE  12  -0.202  -4.527   0.406
  126   HD13  ILE  12          HD13      ILE  12  -1.334  -3.179   0.530
  127    HA   DPR  13           HA       DPR  13  -2.289 -11.099   1.492
  128    HB2  DPR  13           HB2      DPR  13  -0.592 -12.692   1.225
  129    HB3  DPR  13           HB3      DPR  13   0.185 -11.780  -0.092
  130    HG2  DPR  13           HG2      DPR  13   0.220 -11.272   2.839
  131    HG3  DPR  13           HG3      DPR  13   1.532 -11.174   1.651
  132    HD2  DPR  13           HD2      DPR  13   0.090  -9.001   2.558
  133    HD3  DPR  13           HD3      DPR  13   0.969  -9.056   1.017
  134    HA   PRO  14           HA       PRO  14  -3.917 -12.219  -2.517
  135    HB2  PRO  14           HB2      PRO  14  -6.415 -11.123  -2.314
  136    HB3  PRO  14           HB3      PRO  14  -5.922 -12.604  -1.472
  137    HG2  PRO  14           HG2      PRO  14  -6.111  -9.817  -0.437
  138    HG3  PRO  14           HG3      PRO  14  -6.591 -11.341   0.330
  139    HD2  PRO  14           HD2      PRO  14  -4.268 -10.068   0.942
  140    HD3  PRO  14           HD3      PRO  14  -4.439 -11.833   1.013
  141    H5'    G  17           H5'        G  17 -15.955  -2.245  15.843
  142   H5''    G  17          H5''        G  17 -14.323  -2.885  15.577
  143    H4'    G  17           H4'        G  17 -15.924  -4.681  15.325
  144    H3'    G  17           H3'        G  17 -14.744  -3.804  12.676
  145    H2'    G  17          H2''        G  17 -15.953  -5.500  11.636
  146   HO2'    G  17           H2'        G  17 -16.690  -6.628  14.137
  147    H1'    G  17           H1'        G  17 -18.240  -5.288  13.183
  148    H8     G  17           H8         G  17 -17.164  -1.791  12.309
  149    H1     G  17           H1         G  17 -20.137  -4.832   7.504
  150    H21    G  17           H21        G  17 -20.334  -6.960   7.948
  151    H22    G  17           H22        G  17 -19.739  -7.671   9.432
  152   HO5'    G  17           H5T        G  17 -14.127  -1.667  13.867
  153    H5'    G  18           H5'        G  18 -14.541  -7.875  12.703
  154   H5''    G  18          H5''        G  18 -12.987  -8.583  12.230
  155    H4'    G  18           H4'        G  18 -14.797  -9.538  10.893
  156    H3'    G  18           H3'        G  18 -13.082  -7.665   9.229
  157    H2'    G  18          H2''        G  18 -14.380  -8.267   7.399
  158   HO2'    G  18           H2'        G  18 -15.638 -10.124   7.322
  159    H1'    G  18           H1'        G  18 -16.794  -8.500   8.769
  160    H8     G  18           H8         G  18 -15.013  -5.259   9.664
  161    H1     G  18           H1         G  18 -18.199  -4.982   4.119
  162    H21    G  18           H21        G  18 -18.820  -7.014   3.492
  163    H22    G  18           H22        G  18 -18.456  -8.441   4.438
  164    H5'    C  19           H5'        C  19 -13.511 -11.164   7.094
  165   H5''    C  19          H5''        C  19 -12.045 -11.794   6.324
  166    H4'    C  19           H4'        C  19 -13.848 -11.564   4.680
  167    H3'    C  19           H3'        C  19 -11.709  -9.450   4.235
  168    H2'    C  19          H2''        C  19 -12.924  -8.802   2.346
  169   HO2'    C  19           H2'        C  19 -14.797 -10.845   2.365
  170    H1'    C  19           H1'        C  19 -15.461  -9.285   3.437
  171    H41    C  19           H41        C  19 -14.697  -2.964   3.545
  172    H42    C  19           H42        C  19 -13.797  -3.086   5.041
  173    H5     C  19           H5         C  19 -13.166  -5.201   6.027
  174    H6     C  19           H6         C  19 -13.206  -7.629   5.748
  175    H5'    A  20           H5'        A  20 -12.476 -11.097   0.597
  176   H5''    A  20          H5''        A  20 -11.055 -11.551  -0.360
  177    H4'    A  20           H4'        A  20 -12.526 -10.159  -1.705
  178    H3'    A  20           H3'        A  20 -10.069  -8.598  -0.833
  179    H2'    A  20          H2''        A  20 -10.853  -6.841  -2.154
  180   HO2'    A  20           H2'        A  20 -12.559  -8.756  -3.394
  181    H1'    A  20           H1'        A  20 -13.572  -7.235  -1.649
  182    H8     A  20           H8         A  20 -11.533  -7.289   1.570
  183    H61    A  20           H61        A  20 -12.199  -1.149   1.588
  184    H62    A  20           H62        A  20 -11.698  -2.545   2.515
  185    H2     A  20           H2         A  20 -13.550  -2.664  -2.385
  186    H5'    G  21           H5'        G  21 -10.412  -8.138  -4.965
  187   H5''    G  21          H5''        G  21  -8.888  -8.262  -5.857
  188    H4'    G  21           H4'        G  21 -10.014  -6.182  -6.429
  189    H3'    G  21           H3'        G  21  -7.594  -5.626  -4.678
  190    H2'    G  21          H2''        G  21  -8.047  -3.361  -4.945
  191   HO2'    G  21           H2'        G  21  -9.029  -2.525  -6.702
  192    H1'    G  21           H1'        G  21 -10.857  -3.630  -5.080
  193    H8     G  21           H8         G  21  -9.307  -5.393  -2.078
  194    H1     G  21           H1         G  21 -10.172   0.873  -1.244
  195    H21    G  21           H21        G  21 -10.670   1.856  -3.156
  196    H22    G  21           H22        G  21 -10.801   0.960  -4.652
  197    H5'    A  22           H5'        A  22  -7.398  -2.947  -7.705
  198   H5''    A  22          H5''        A  22  -5.835  -2.859  -8.536
  199    H4'    A  22           H4'        A  22  -6.532  -0.615  -7.879
  200    H3'    A  22           H3'        A  22  -4.268  -1.663  -6.171
  201    H2'    A  22          H2''        A  22  -4.270   0.374  -5.029
  202   HO2'    A  22           H2'        A  22  -5.885   1.850  -6.734
  203    H1'    A  22           H1'        A  22  -7.079   0.952  -5.405
  204    H8     A  22           H8         A  22  -6.333  -2.417  -3.790
  205    H61    A  22           H61        A  22  -6.505   0.574   1.606
  206    H62    A  22           H62        A  22  -6.450  -0.979   0.804
  207    H2     A  22           H2         A  22  -6.535   3.647  -1.707
  208    H5'    U  23           H5'        U  23  -3.009   2.154  -8.248
  209   H5''    U  23          H5''        U  23  -1.614   1.824  -9.293
  210    H4'    U  23           H4'        U  23  -1.364   3.984  -8.168
  211    H3'    U  23           H3'        U  23   0.568   1.867  -7.196
  212    H2'    U  23          H2''        U  23   1.409   3.314  -5.648
  213   HO2'    U  23           H2'        U  23   1.829   4.845  -7.490
  214    H1'    U  23           H1'        U  23  -0.893   5.076  -5.551
  215    H3     U  23           H3         U  23   0.214   4.450  -1.228
  216    H5     U  23           H5         U  23  -1.387   0.757  -2.390
  217    H6     U  23           H6         U  23  -1.412   1.576  -4.682
  218    H5'    C  24           H5'        C  24   3.446   5.462  -9.234
  219   H5''    C  24          H5''        C  24   1.830   5.403  -9.950
  220    H4'    C  24           H4'        C  24   3.069   6.899 -11.291
  221    H3'    C  24           H3'        C  24   2.072   4.563 -12.466
  222    H2'    C  24          H2''        C  24   4.121   3.484 -12.837
  223   HO2'    C  24           H2'        C  24   3.581   5.289 -14.894
  224    H1'    C  24           H1'        C  24   5.558   6.097 -13.251
  225    H41    C  24           H41        C  24  10.636   2.449 -12.049
  226    H42    C  24           H42        C  24   9.740   1.472 -10.908
  227    H5     C  24           H5         C  24   7.415   1.824 -10.419
  228    H6     C  24           H6         C  24   5.470   3.247 -10.829
  229    H5'    U  25           H5'        U  25  -1.208   7.255 -12.181
  230   H5''    U  25          H5''        U  25   0.469   7.508 -11.646
  231    H4'    U  25           H4'        U  25  -0.798   4.988 -10.708
  232    H3'    U  25           H3'        U  25  -2.411   7.231 -10.301
  233    H2'    U  25          H2''        U  25  -0.958   8.431  -8.895
  234   HO2'    U  25           H2'        U  25  -2.089   6.424  -7.201
  235    H1'    U  25           H1'        U  25   0.097   5.904  -7.667
  236    H3     U  25           H3         U  25   2.882  10.246  -9.023
  237    H5     U  25           H5         U  25   3.498   8.017  -5.477
  238    H6     U  25           H6         U  25   1.731   6.542  -6.189
  239    H5'    G  26           H5'        G  26  -5.644   7.709  -7.535
  240   H5''    G  26          H5''        G  26  -4.153   8.522  -8.045
  241    H4'    G  26           H4'        G  26  -4.906   9.473  -5.957
  242    H3'    G  26           H3'        G  26  -2.475   7.714  -5.506
  243    H2'    G  26          H2''        G  26  -2.513   8.322  -3.281
  244   HO2'    G  26           H2'        G  26  -4.023  10.563  -4.186
  245    H1'    G  26           H1'        G  26  -5.302   8.562  -3.060
  246    H8     G  26           H8         G  26  -5.079   5.184  -4.417
  247    H1     G  26           H1         G  26  -2.718   5.490   1.546
  248    H21    G  26           H21        G  26  -2.330   7.620   2.087
  249    H22    G  26           H22        G  26  -2.666   8.944   0.995
  250    H5'    A  27           H5'        A  27  -1.849  11.253  -3.502
  251   H5''    A  27          H5''        A  27  -0.324  12.070  -3.857
  252    H4'    A  27           H4'        A  27  -0.729  12.046  -1.448
  253    H3'    A  27           H3'        A  27   1.492  10.083  -2.125
  254    H2'    A  27          H2''        A  27   1.722   9.764   0.161
  255   HO2'    A  27           H2'        A  27   0.799  11.218   1.695
  256    H1'    A  27           H1'        A  27  -1.002  10.010   0.801
  257    H8     A  27           H8         A  27  -0.421   7.559  -2.059
  258    H61    A  27           H61        A  27   0.339   3.327   2.402
  259    H62    A  27           H62        A  27   0.161   3.601   0.675
  260    H2     A  27           H2         A  27   0.248   7.369   4.315
  261    H5'    G  28           H5'        G  28   2.748  12.596   0.952
  262   H5''    G  28          H5''        G  28   4.449  13.084   0.924
  263    H4'    G  28           H4'        G  28   3.861  12.117   3.094
  264    H3'    G  28           H3'        G  28   5.660  10.199   1.564
  265    H2'    G  28          H2''        G  28   5.597   8.838   3.447
  266   HO2'    G  28           H2'        G  28   4.642   9.826   5.474
  267    H1'    G  28           H1'        G  28   2.977   9.533   4.238
  268    H8     G  28           H8         G  28   3.276   8.394   0.601
  269    H1     G  28           H1         G  28   2.914   3.584   4.797
  270    H21    G  28           H21        G  28   3.162   4.333   6.852
  271    H22    G  28           H22        G  28   3.408   6.027   7.205
  272    H5'    C  29           H5'        C  29   6.966  10.518   5.348
  273   H5''    C  29          H5''        C  29   8.697  10.781   5.611
  274    H4'    C  29           H4'        C  29   7.884   8.930   6.996
  275    H3'    C  29           H3'        C  29   9.671   7.949   4.746
  276    H2'    C  29          H2''        C  29   9.411   5.794   5.571
  277   HO2'    C  29           H2'        C  29   8.681   7.001   8.062
  278    H1'    C  29           H1'        C  29   6.799   6.186   6.688
  279    H41    C  29           H41        C  29   6.020   2.161   1.846
  280    H42    C  29           H42        C  29   6.021   3.507   0.725
  281    H5     C  29           H5         C  29   6.513   5.771   1.384
  282    H6     C  29           H6         C  29   7.114   7.231   3.253
  283    H5'    C  30           H5'        C  30  10.687   6.080   8.052
  284   H5''    C  30          H5''        C  30  12.313   6.346   8.706
  285    H4'    C  30           H4'        C  30  11.743   3.978   8.805
  286    H3'    C  30           H3'        C  30  13.856   4.626   6.737
  287    H2'    C  30          H2''        C  30  14.053   2.384   6.246
  288   HO2'    C  30           H2'        C  30  12.746   0.919   7.864
  289    H1'    C  30           H1'        C  30  11.351   1.697   6.644
  290    H41    C  30           H41        C  30  12.234   1.733   0.376
  291    H42    C  30           H42        C  30  11.757   3.416   0.321
  292    H5     C  30           H5         C  30  11.404   4.745   2.323
  293    H6     C  30           H6         C  30  11.374   4.700   4.766
  294    H5'    U  31           H5'        U  31  15.064   1.420   9.003
  295   H5''    U  31          H5''        U  31  16.632   1.628   9.802
  296    H4'    U  31           H4'        U  31  16.542  -0.566   8.774
  297    H3'    U  31           H3'        U  31  18.589   1.310   8.070
  298    H2'    U  31          H2''        U  31  18.227   1.412   5.799
  299   HO2'    U  31           H2'        U  31  19.807   0.130   5.239
  300    H1'    U  31           H1'        U  31  16.808  -1.208   5.641
  301    H3     U  31           H3         U  31  14.923  -0.214   1.703
  302    H5     U  31           H5         U  31  15.262   3.563   3.541
  303    H6     U  31           H6         U  31  16.254   2.471   5.461
  304    H5'    G  32           H5'        G  32  21.699  -3.284   7.583
  305   H5''    G  32          H5''        G  32  22.008  -2.970   5.862
  306    H4'    G  32           H4'        G  32  21.160  -5.194   6.006
  307    H3'    G  32           H3'        G  32  19.793  -3.318   4.495
  308    H2'    G  32          H2''        G  32  18.002  -3.007   5.966
  309   HO2'    G  32           H2'        G  32  16.486  -3.851   4.794
  310    H1'    G  32           H1'        G  32  17.984  -5.876   6.842
  311    H8     G  32           H8         G  32  18.000  -2.167   8.067
  312    H1     G  32           H1         G  32  14.651  -6.271  11.676
  313    H21    G  32           H21        G  32  14.885  -8.335  10.894
  314    H22    G  32           H22        G  32  15.853  -8.700   9.484
  315    H5'    G  33           H5'        G  33  16.833  -5.987   3.976
  316   H5''    G  33          H5''        G  33  16.732  -6.640   2.328
  317    H4'    G  33           H4'        G  33  15.407  -4.032   2.582
  318    H3'    G  33           H3'        G  33  14.862  -5.566   4.842
  319    H2'    G  33          H2''        G  33  13.912  -7.400   3.779
  320   HO2'    G  33           H2'        G  33  12.213  -6.371   4.985
  321    H1'    G  33           H1'        G  33  12.612  -5.704   1.656
  322    H8     G  33           H8         G  33  15.001  -8.747   2.209
  323    H1     G  33           H1         G  33  10.560  -9.432  -2.377
  324    H21    G  33           H21        G  33   9.364  -7.570  -2.558
  325    H22    G  33           H22        G  33   9.658  -6.166  -1.556
  326    H5'    G  34           H5'        G  34   9.428  -4.187   5.767
  327   H5''    G  34          H5''        G  34  10.355  -5.680   6.014
  328    H4'    G  34           H4'        G  34   8.366  -6.355   4.932
  329    H3'    G  34           H3'        G  34  10.787  -6.753   3.640
  330    H2'    G  34          H2''        G  34  10.554  -5.191   1.933
  331   HO2'    G  34           H2'        G  34   8.639  -6.706   0.641
  332    H1'    G  34           H1'        G  34   7.598  -5.512   1.734
  333    H8     G  34           H8         G  34   6.750  -3.444   0.393
  334    H1     G  34           H1         G  34  11.979  -0.025   1.790
  335    H21    G  34           H21        G  34  13.301  -1.165   3.149
  336    H22    G  34           H22        G  34  12.894  -2.750   3.751
  337    H5'    A  35           H5'        A  35   7.766 -10.801   2.174
  338   H5''    A  35          H5''        A  35   7.826 -10.609   0.403
  339    H4'    A  35           H4'        A  35   7.526  -8.177   2.134
  340    H3'    A  35           H3'        A  35   5.609 -10.175   2.424
  341    H2'    A  35          H2''        A  35   4.756 -10.130   0.247
  342   HO2'    A  35           H2'        A  35   3.021  -9.312   1.500
  343    H1'    A  35           H1'        A  35   5.192  -7.172   0.023
  344    H8     A  35           H8         A  35   5.387  -6.517  -2.495
  345    H61    A  35           H61        A  35   5.034 -11.510  -6.183
  346    H62    A  35           H62        A  35   5.061  -9.761  -6.139
  347    H2     A  35           H2         A  35   5.346 -12.888  -1.925
  348    H5'    G  36           H5'        G  36   5.970  -7.926   5.501
  349   H5''    G  36          H5''        G  36   4.611  -8.070   6.634
  350    H4'    G  36           H4'        G  36   6.158  -6.471   7.514
  351    H3'    G  36           H3'        G  36   3.724  -5.079   6.373
  352    H2'    G  36          H2''        G  36   4.628  -3.066   7.041
  353   HO2'    G  36           H2'        G  36   6.718  -4.038   8.587
  354    H1'    G  36           H1'        G  36   7.334  -3.763   6.711
  355    H8     G  36           H8         G  36   5.455  -4.580   3.530
  356    H1     G  36           H1         G  36   6.904   1.655   4.159
  357    H21    G  36           H21        G  36   7.594   2.090   6.192
  358    H22    G  36           H22        G  36   7.716   0.856   7.424
  359    H5'    C  37           H5'        C  37   4.347  -3.403  10.083
  360   H5''    C  37          H5''        C  37   2.896  -3.355  11.098
  361    H4'    C  37           H4'        C  37   3.939  -1.153  11.067
  362    H3'    C  37           H3'        C  37   1.418  -1.168   9.375
  363    H2'    C  37          H2''        C  37   1.760   1.126   9.097
  364   HO2'    C  37           H2'        C  37   3.083   2.358  10.450
  365    H1'    C  37           H1'        C  37   4.576   1.013   9.012
  366    H41    C  37           H41        C  37   2.716   1.904   2.998
  367    H42    C  37           H42        C  37   2.416   0.192   2.816
  368    H5     C  37           H5         C  37   2.565  -1.372   4.673
  369    H6     C  37           H6         C  37   2.997  -1.595   7.074
  370    H5'    U  38           H5'        U  38   0.945   2.098  11.893
  371   H5''    U  38          H5''        U  38  -0.664   2.236  12.617
  372    H4'    U  38           H4'        U  38  -0.080   4.320  11.509
  373    H3'    U  38           H3'        U  38  -2.163   2.836   9.870
  374    H2'    U  38          H2''        U  38  -2.161   4.666   8.442
  375   HO2'    U  38           H2'        U  38  -0.671   6.313  10.173
  376    H1'    U  38           H1'        U  38   0.574   5.326   8.770
  377    H3     U  38           H3         U  38   0.007   4.599   4.305
  378    H5     U  38           H5         U  38   0.066   0.752   6.053
  379    H6     U  38           H6         U  38  -0.079   1.814   8.222
  380    H5'    C  39           H5'        C  39  -3.445   6.719  10.357
  381   H5''    C  39          H5''        C  39  -5.174   6.958  10.641
  382    H4'    C  39           H4'        C  39  -4.376   8.300   8.731
  383    H3'    C  39           H3'        C  39  -6.192   6.055   7.779
  384    H2'    C  39          H2''        C  39  -5.886   6.883   5.630
  385   HO2'    C  39           H2'        C  39  -5.470   9.333   6.974
  386    H1'    C  39           H1'        C  39  -3.282   7.942   6.082
  387    H41    C  39           H41        C  39  -2.572   3.120   1.985
  388    H42    C  39           H42        C  39  -2.689   1.960   3.289
  389    H5     C  39           H5         C  39  -3.208   2.584   5.572
  390    H6     C  39           H6         C  39  -3.801   4.462   7.058
  391    H5'    U  40           H5'        U  40  -7.234   9.422   5.888
  392   H5''    U  40          H5''        U  40  -8.954   9.846   5.818
  393    H4'    U  40           H4'        U  40  -7.946   9.874   3.570
  394    H3'    U  40           H3'        U  40  -9.853   7.544   3.940
  395    H2'    U  40          H2''        U  40  -9.464   6.985   1.715
  396   HO2'    U  40           H2'        U  40  -7.997   8.861   0.637
  397    H1'    U  40           H1'        U  40  -6.778   7.742   1.644
  398    H3     U  40           H3         U  40  -6.859   3.227   0.742
  399    H5     U  40           H5         U  40  -7.352   3.562   4.923
  400    H6     U  40           H6         U  40  -7.630   5.940   4.650
  401    H5'    C  41           H5'        C  41 -10.866   9.525   0.382
  402   H5''    C  41          H5''        C  41 -12.595   9.828   0.142
  403    H4'    C  41           H4'        C  41 -11.664   8.699  -1.813
  404    H3'    C  41           H3'        C  41 -13.412   6.815  -0.201
  405    H2'    C  41          H2''        C  41 -13.033   5.227  -1.873
  406   HO2'    C  41           H2'        C  41 -11.929   7.239  -3.556
  407    H1'    C  41           H1'        C  41 -10.387   5.946  -2.401
  408    H41    C  41           H41        C  41 -10.067   0.686   1.207
  409    H42    C  41           H42        C  41 -10.285   1.655   2.646
  410    H5     C  41           H5         C  41 -10.797   3.993   2.581
  411    H6     C  41           H6         C  41 -11.215   5.931   1.133
  412    H5'    U  42           H5'        U  42 -14.690   6.416  -4.098
  413   H5''    U  42          H5''        U  42 -16.446   6.439  -4.330
  414    H4'    U  42           H4'        U  42 -15.495   4.436  -5.352
  415    H3'    U  42           H3'        U  42 -17.002   3.726  -2.814
  416    H2'    U  42          H2''        U  42 -16.541   1.497  -3.292
  417   HO2'    U  42           H2'        U  42 -15.606   2.081  -5.896
  418    H1'    U  42           H1'        U  42 -14.012   1.935  -4.431
  419    H3     U  42           H3         U  42 -13.300  -0.759  -0.800
  420    H5     U  42           H5         U  42 -13.837   3.101   0.791
  421    H6     U  42           H6         U  42 -14.571   3.826  -1.400
  422    H5'    G  43           H5'        G  43 -18.369   1.157  -5.781
  423   H5''    G  43          H5''        G  43 -20.120   0.893  -5.809
  424    H4'    G  43           H4'        G  43 -18.951  -1.245  -5.721
  425    H3'    G  43           H3'        G  43 -20.270  -0.646  -3.051
  426    H2'    G  43          H2''        G  43 -19.532  -2.733  -2.350
  427   HO2'    G  43           H2'        G  43 -18.581  -3.707  -4.747
  428    H1'    G  43           H1'        G  43 -17.137  -2.737  -3.806
  429    H8     G  43           H8         G  43 -17.657   0.460  -1.783
  430    H1     G  43           H1         G  43 -15.285  -4.381   1.653
  431    H21    G  43           H21        G  43 -15.437  -6.287   0.495
  432    H22    G  43           H22        G  43 -16.115  -6.346  -1.117
  433    H5'    C  44           H5'        C  44 -21.328  -4.496  -4.171
  434   H5''    C  44          H5''        C  44 -23.026  -4.933  -3.924
  435    H4'    C  44           H4'        C  44 -21.556  -6.595  -2.889
  436    H3'    C  44           H3'        C  44 -22.937  -4.910  -0.772
  437    H2'    C  44          H2''        C  44 -21.905  -6.261   0.816
  438   HO2'    C  44           H2'        C  44 -20.981  -8.304   0.264
  439    H1'    C  44           H1'        C  44 -19.534  -6.694  -0.632
  440    H41    C  44           H41        C  44 -18.049  -2.552   3.987
  441    H42    C  44           H42        C  44 -18.687  -1.236   3.028
  442    H5     C  44           H5         C  44 -19.842  -1.575   0.934
  443    H6     C  44           H6         C  44 -20.682  -3.252  -0.641
  444    H5'    C  45           H5'        C  45 -23.382  -8.858   0.319
  445   H5''    C  45          H5''        C  45 -25.022  -9.337   0.788
  446    H4'    C  45           H4'        C  45 -23.429 -10.024   2.511
  447    H3'    C  45           H3'        C  45 -25.143  -7.677   3.369
  448   HO3'    C  45           H3T        C  45 -26.084  -9.500   4.595
  449    H2'    C  45          H2''        C  45 -24.085  -7.703   5.427
  450   HO2'    C  45           H2'        C  45 -23.578 -10.442   4.851
  451    H1'    C  45           H1'        C  45 -21.595  -8.747   4.480
  452    H41    C  45           H41        C  45 -20.420  -2.668   6.158
  453    H42    C  45           H42        C  45 -21.164  -2.136   4.673
  454    H5     C  45           H5         C  45 -22.278  -3.596   3.140
  455    H6     C  45           H6         C  45 -22.960  -5.900   2.686
  Start of MODEL    8
    1    H1   DAB   1           H        DAB   1  -3.175  -8.966  -1.711
    2    HA   DAB   1           HA       DAB   1  -3.781  -8.030  -4.476
    3    HB2  DAB   1           HB2      DAB   1  -3.638  -6.382  -1.939
    4    HB3  DAB   1           HB3      DAB   1  -4.049  -5.792  -3.550
    5    HG2  DAB   1           HG2      DAB   1  -5.615  -7.786  -1.891
    6    HG3  DAB   1           HG3      DAB   1  -6.113  -6.152  -2.328
    7    HD1  DAB   1           HD1      DAB   1  -6.987  -6.983  -4.166
    8    HD2  DAB   1           HD2      DAB   1  -6.411  -8.538  -3.796
    9    HD3  DAB   1           HD3      DAB   1  -5.442  -7.461  -4.683
   10    H    VAL   2           H        VAL   2  -2.268  -6.689  -5.489
   11    HA   VAL   2           HA       VAL   2   0.383  -6.552  -4.246
   12    HB   VAL   2           HB       VAL   2   1.481  -7.265  -6.186
   13   HG11  VAL   2          HG11      VAL   2  -0.013  -8.977  -4.883
   14   HG12  VAL   2          HG12      VAL   2   0.711  -9.459  -6.417
   15   HG13  VAL   2          HG13      VAL   2  -0.984  -8.975  -6.355
   16   HG21  VAL   2          HG21      VAL   2   0.012  -7.732  -8.287
   17   HG22  VAL   2          HG22      VAL   2   0.442  -6.060  -7.933
   18   HG23  VAL   2          HG23      VAL   2  -1.163  -6.665  -7.518
   19    H    ARG   3           H        ARG   3   1.427  -4.578  -4.330
   20    HA   ARG   3           HA       ARG   3   0.378  -2.629  -6.318
   21    HB2  ARG   3           HB2      ARG   3   0.945  -1.672  -3.536
   22    HB3  ARG   3           HB3      ARG   3  -0.091  -0.990  -4.760
   23    HG2  ARG   3           HG2      ARG   3  -0.806  -3.619  -3.493
   24    HG3  ARG   3           HG3      ARG   3  -1.138  -2.113  -2.673
   25    HD2  ARG   3           HD2      ARG   3  -2.126  -2.850  -5.441
   26    HD3  ARG   3           HD3      ARG   3  -3.090  -2.861  -3.976
   27    HE   ARG   3           HE       ARG   3  -2.194  -0.502  -5.447
   28   HH11  ARG   3          HH11      ARG   3  -3.092   1.449  -4.727
   29   HH12  ARG   3          HH12      ARG   3  -4.023   1.484  -3.265
   30   HH21  ARG   3          HH21      ARG   3  -3.595  -1.895  -2.614
   31   HH22  ARG   3          HH22      ARG   3  -4.312  -0.416  -2.070
   32    H    THR   4           H        THR   4   1.841  -0.993  -6.838
   33    HA   THR   4           HA       THR   4   4.483  -1.245  -5.658
   34    HB   THR   4           HB       THR   4   3.923  -1.309  -8.623
   35    HG1  THR   4           HG1      THR   4   5.473  -3.122  -7.147
   36   HG21  THR   4          HG21      THR   4   5.856   0.094  -8.290
   37   HG22  THR   4          HG22      THR   4   6.434  -1.491  -8.805
   38   HG23  THR   4          HG23      THR   4   6.527  -1.028  -7.107
   39    H    ARG   5           H        ARG   5   5.716   0.588  -5.585
   40    HA   ARG   5           HA       ARG   5   4.523   3.021  -6.652
   41    HB2  ARG   5           HB2      ARG   5   5.537   3.525  -3.976
   42    HB3  ARG   5           HB3      ARG   5   3.942   3.860  -4.638
   43    HG2  ARG   5           HG2      ARG   5   3.532   1.282  -4.255
   44    HG3  ARG   5           HG3      ARG   5   4.877   1.425  -3.120
   45    HD2  ARG   5           HD2      ARG   5   2.155   2.674  -3.046
   46    HD3  ARG   5           HD3      ARG   5   3.074   1.949  -1.742
   47    HE   ARG   5           HE       ARG   5   4.124   4.417  -2.849
   48   HH11  ARG   5          HH11      ARG   5   4.220   6.148  -1.371
   49   HH12  ARG   5          HH12      ARG   5   3.504   5.975   0.211
   50   HH21  ARG   5          HH21      ARG   5   2.438   2.726  -0.355
   51   HH22  ARG   5          HH22      ARG   5   2.536   4.024   0.792
   52    H    LYS   6           H        LYS   6   6.119   3.674  -7.979
   53    HA   LYS   6           HA       LYS   6   8.308   3.814  -8.809
   54    HB2  LYS   6           HB2      LYS   6   7.714   5.717  -6.651
   55    HB3  LYS   6           HB3      LYS   6   9.434   5.520  -6.959
   56    HG2  LYS   6           HG2      LYS   6   9.139   6.035  -9.312
   57    HG3  LYS   6           HG3      LYS   6   7.386   6.054  -9.117
   58    HD2  LYS   6           HD2      LYS   6   8.097   7.896  -7.230
   59    HD3  LYS   6           HD3      LYS   6   9.405   8.125  -8.391
   60    HE2  LYS   6           HE2      LYS   6   7.609   9.641  -8.971
   61    HE3  LYS   6           HE1      LYS   6   7.653   8.378 -10.203
   62    HZ1  LYS   6           HZ1      LYS   6   5.871   7.238  -9.064
   63    HZ2  LYS   6           HZ2      LYS   6   5.400   8.832  -9.410
   64    HZ3  LYS   6           HZ3      LYS   6   5.854   8.402  -7.827
   65    H    GLY   7           H        GLY   7   8.953   1.582  -8.399
   66    HA2  GLY   7           HA2      GLY   7  10.714   0.199  -7.824
   67    HA3  GLY   7           HA3      GLY   7  11.365   1.478  -6.808
   68    H    ARG   8           H        ARG   8   8.918   1.813  -5.306
   69    HA   ARG   8           HA       ARG   8   9.316  -0.235  -3.317
   70    HB2  ARG   8           HB2      ARG   8   7.141   1.879  -3.428
   71    HB3  ARG   8           HB3      ARG   8   7.586   0.944  -2.029
   72    HG2  ARG   8           HG2      ARG   8   9.299   2.346  -1.485
   73    HG3  ARG   8           HG3      ARG   8   9.910   2.336  -3.145
   74    HD2  ARG   8           HD2      ARG   8   9.274   4.598  -2.478
   75    HD3  ARG   8           HD3      ARG   8   8.233   4.043  -3.768
   76    HE   ARG   8           HE       ARG   8   6.425   4.120  -2.284
   77   HH11  ARG   8          HH11      ARG   8   5.499   4.641  -0.286
   78   HH12  ARG   8          HH12      ARG   8   6.516   4.962   1.077
   79   HH21  ARG   8          HH21      ARG   8   9.466   4.467  -0.696
   80   HH22  ARG   8          HH22      ARG   8   8.780   4.867   0.842
   81    H    ARG   9           H        ARG   9   8.813  -2.118  -4.536
   82    HA   ARG   9           HA       ARG   9   6.097  -2.539  -5.466
   83    HB2  ARG   9           HB2      ARG   9   7.149  -4.984  -5.679
   84    HB3  ARG   9           HB3      ARG   9   7.430  -3.738  -6.896
   85    HG2  ARG   9           HG2      ARG   9   9.569  -3.215  -6.027
   86    HG3  ARG   9           HG3      ARG   9   9.253  -4.071  -4.516
   87    HD2  ARG   9           HD2      ARG   9   9.807  -6.101  -5.412
   88    HD3  ARG   9           HD3      ARG   9   8.995  -5.760  -6.936
   89    HE   ARG   9           HE       ARG   9  11.783  -5.415  -6.384
   90   HH11  ARG   9          HH11      ARG   9  13.052  -4.487  -8.025
   91   HH12  ARG   9          HH12      ARG   9  12.287  -3.646  -9.332
   92   HH21  ARG   9          HH21      ARG   9   9.073  -4.168  -8.138
   93   HH22  ARG   9          HH22      ARG   9  10.034  -3.466  -9.397
   94    H    ILE  10           H        ILE  10   4.606  -2.714  -3.834
   95    HA   ILE  10           HA       ILE  10   5.402  -4.478  -1.571
   96    HB   ILE  10           HB       ILE  10   4.110  -3.139  -0.104
   97   HG12  ILE  10          HG12      ILE  10   2.948  -2.030  -2.644
   98   HG13  ILE  10          HG13      ILE  10   2.101  -2.575  -1.198
   99   HG21  ILE  10          HG21      ILE  10   5.284  -1.106  -1.987
  100   HG22  ILE  10          HG22      ILE  10   6.318  -2.238  -1.111
  101   HG23  ILE  10          HG23      ILE  10   5.302  -1.109  -0.221
  102   HD11  ILE  10          HD11      ILE  10   3.692  -0.054  -1.600
  103   HD12  ILE  10          HD12      ILE  10   3.240  -0.626   0.005
  104   HD13  ILE  10          HD13      ILE  10   1.985  -0.187  -1.165
  105    H    4J5  11           H        NOR  11   4.324  -6.264  -1.301
  106    HA   4J5  11           HA       NOR  11   1.765  -6.550  -2.683
  107    HD   4J5  11           HD       NOR  11   4.249 -10.238  -3.796
  108    HB2  4J5  11           HB2      NOR  11   3.181  -8.927  -1.596
  109    HB3  4J5  11           HB3      NOR  11   2.154  -8.786  -3.026
  110    HG2  4J5  11           HG2      NOR  11   4.046  -7.300  -3.998
  111    HG3  4J5  11           HG3      NOR  11   5.051  -7.938  -2.705
  112   HH11  4J5  11          HH11      NOR  11   5.100  -7.248  -5.348
  113   HH12  4J5  11          HH12      NOR  11   5.654  -8.010  -6.798
  114   HH21  4J5  11          HH21      NOR  11   4.989 -11.220  -5.698
  115   HH22  4J5  11          HH22      NOR  11   5.594 -10.248  -6.996
  116    H    ILE  12           H        ILE  12  -0.052  -6.904  -1.664
  117    HA   ILE  12           HA       ILE  12   0.076  -7.240   1.273
  118    HB   ILE  12           HB       ILE  12  -2.363  -6.115  -0.029
  119   HG12  ILE  12          HG12      ILE  12   0.357  -4.858  -0.064
  120   HG13  ILE  12          HG13      ILE  12  -1.000  -4.623  -1.164
  121   HG21  ILE  12          HG21      ILE  12  -0.874  -5.212   2.447
  122   HG22  ILE  12          HG22      ILE  12  -1.969  -6.596   2.475
  123   HG23  ILE  12          HG23      ILE  12  -2.582  -4.996   2.058
  124   HD11  ILE  12          HD11      ILE  12  -0.831  -2.579   0.006
  125   HD12  ILE  12          HD12      ILE  12  -0.529  -3.387   1.545
  126   HD13  ILE  12          HD13      ILE  12  -2.142  -3.429   0.825
  127    HA   DPR  13           HA       DPR  13  -2.282 -10.919   1.439
  128    HB2  DPR  13           HB2      DPR  13  -0.312 -11.998   2.035
  129    HB3  DPR  13           HB3      DPR  13  -0.581 -12.795   0.472
  130    HG2  DPR  13           HG2      DPR  13   1.659 -11.397   1.101
  131    HG3  DPR  13           HG3      DPR  13   1.065 -11.615  -0.552
  132    HD2  DPR  13           HD2      DPR  13   1.210  -9.169   0.997
  133    HD3  DPR  13           HD3      DPR  13   0.722  -9.387  -0.696
  134    HA   PRO  14           HA       PRO  14  -3.809 -12.197  -2.600
  135    HB2  PRO  14           HB2      PRO  14  -6.305 -11.136  -2.496
  136    HB3  PRO  14           HB3      PRO  14  -5.828 -12.555  -1.544
  137    HG2  PRO  14           HG2      PRO  14  -6.098  -9.716  -0.698
  138    HG3  PRO  14           HG3      PRO  14  -6.545 -11.198   0.162
  139    HD2  PRO  14           HD2      PRO  14  -4.236  -9.773   0.669
  140    HD3  PRO  14           HD3      PRO  14  -4.424 -11.511   0.994
  141    H5'    G  17           H5'        G  17 -15.410  -2.136  15.885
  142   H5''    G  17          H5''        G  17 -13.811  -2.824  15.553
  143    H4'    G  17           H4'        G  17 -15.456  -4.571  15.341
  144    H3'    G  17           H3'        G  17 -14.375  -3.659  12.649
  145    H2'    G  17          H2''        G  17 -15.628  -5.405  11.682
  146   HO2'    G  17           H2'        G  17 -16.659  -6.997  13.096
  147    H1'    G  17           H1'        G  17 -17.854  -5.119  13.294
  148    H8     G  17           H8         G  17 -16.784  -1.641  12.376
  149    H1     G  17           H1         G  17 -19.824  -4.705   7.629
  150    H21    G  17           H21        G  17 -20.018  -6.840   8.100
  151    H22    G  17           H22        G  17 -19.405  -7.532   9.585
  152   HO5'    G  17           H5T        G  17 -15.357  -1.044  14.045
  153    H5'    G  18           H5'        G  18 -14.036  -7.723  12.725
  154   H5''    G  18          H5''        G  18 -12.488  -8.363  12.146
  155    H4'    G  18           H4'        G  18 -14.345  -9.381  10.926
  156    H3'    G  18           H3'        G  18 -12.762  -7.447   9.179
  157    H2'    G  18          H2''        G  18 -14.136  -8.148   7.400
  158   HO2'    G  18           H2'        G  18 -15.029 -10.285   9.061
  159    H1'    G  18           H1'        G  18 -16.470  -8.352   8.868
  160    H8     G  18           H8         G  18 -14.684  -5.111   9.713
  161    H1     G  18           H1         G  18 -17.954  -4.880   4.208
  162    H21    G  18           H21        G  18 -18.591  -6.922   3.612
  163    H22    G  18           H22        G  18 -18.221  -8.336   4.574
  164    H5'    C  19           H5'        C  19 -13.059 -11.000   7.107
  165   H5''    C  19          H5''        C  19 -11.583 -11.532   6.284
  166    H4'    C  19           H4'        C  19 -13.463 -11.418   4.716
  167    H3'    C  19           H3'        C  19 -11.432  -9.205   4.180
  168    H2'    C  19          H2''        C  19 -12.743  -8.643   2.311
  169   HO2'    C  19           H2'        C  19 -14.447 -10.861   2.545
  170    H1'    C  19           H1'        C  19 -15.203  -9.156   3.503
  171    H41    C  19           H41        C  19 -14.495  -2.846   3.529
  172    H42    C  19           H42        C  19 -13.571  -2.940   5.013
  173    H5     C  19           H5         C  19 -12.909  -5.034   6.022
  174    H6     C  19           H6         C  19 -12.956  -7.469   5.785
  175    H5'    A  20           H5'        A  20 -12.178 -11.002   0.566
  176   H5''    A  20          H5''        A  20 -10.741 -11.343  -0.413
  177    H4'    A  20           H4'        A  20 -12.366 -10.079  -1.721
  178    H3'    A  20           H3'        A  20  -9.953  -8.369  -0.998
  179    H2'    A  20          H2''        A  20 -10.914  -6.677  -2.329
  180   HO2'    A  20           H2'        A  20 -12.572  -8.735  -3.391
  181    H1'    A  20           H1'        A  20 -13.545  -7.147  -1.615
  182    H8     A  20           H8         A  20 -11.352  -7.182   1.478
  183    H61    A  20           H61        A  20 -12.101  -1.038   1.526
  184    H62    A  20           H62        A  20 -11.556  -2.425   2.441
  185    H2     A  20           H2         A  20 -13.556  -2.583  -2.403
  186    H5'    G  21           H5'        G  21 -10.558  -8.081  -5.068
  187   H5''    G  21          H5''        G  21  -9.094  -8.105  -6.065
  188    H4'    G  21           H4'        G  21 -10.426  -6.119  -6.538
  189    H3'    G  21           H3'        G  21  -7.858  -5.415  -5.066
  190    H2'    G  21          H2''        G  21  -8.475  -3.170  -5.279
  191   HO2'    G  21           H2'        G  21 -10.099  -4.109  -7.419
  192    H1'    G  21           H1'        G  21 -11.248  -3.577  -5.097
  193    H8     G  21           H8         G  21  -9.306  -5.274  -2.304
  194    H1     G  21           H1         G  21 -10.246   0.972  -1.439
  195    H21    G  21           H21        G  21 -11.009   1.916  -3.307
  196    H22    G  21           H22        G  21 -11.285   0.985  -4.761
  197    H5'    A  22           H5'        A  22  -8.243  -2.821  -8.110
  198   H5''    A  22          H5''        A  22  -6.808  -2.608  -9.134
  199    H4'    A  22           H4'        A  22  -7.566  -0.433  -8.316
  200    H3'    A  22           H3'        A  22  -4.981  -1.388  -7.056
  201    H2'    A  22          H2''        A  22  -4.907   0.615  -5.834
  202   HO2'    A  22           H2'        A  22  -6.862   2.032  -7.203
  203    H1'    A  22           H1'        A  22  -7.735   1.068  -5.755
  204    H8     A  22           H8         A  22  -6.655  -2.262  -4.287
  205    H61    A  22           H61        A  22  -5.999   0.708   1.078
  206    H62    A  22           H62        A  22  -6.069  -0.846   0.277
  207    H2     A  22           H2         A  22  -6.522   3.785  -2.167
  208    H5'    U  23           H5'        U  23  -1.028   0.437  -9.036
  209   H5''    U  23          H5''        U  23  -1.443   0.036  -7.360
  210    H4'    U  23           H4'        U  23  -1.148   2.892  -8.335
  211    H3'    U  23           H3'        U  23   0.950   0.918  -7.680
  212    H2'    U  23          H2''        U  23   1.359   1.700  -5.567
  213   HO2'    U  23           H2'        U  23   2.518   3.352  -7.127
  214    H1'    U  23           H1'        U  23  -0.352   4.158  -5.889
  215    H3     U  23           H3         U  23   0.059   4.348  -1.389
  216    H5     U  23           H5         U  23  -1.465   0.526  -2.094
  217    H6     U  23           H6         U  23  -1.202   0.922  -4.457
  218    H5'    C  24           H5'        C  24   2.969   3.425 -12.062
  219   H5''    C  24          H5''        C  24   4.629   3.014 -11.607
  220    H4'    C  24           H4'        C  24   3.491   5.575 -10.549
  221    H3'    C  24           H3'        C  24   3.375   5.341 -13.332
  222    H2'    C  24          H2''        C  24   5.674   5.051 -13.709
  223   HO2'    C  24           H2'        C  24   6.611   7.268 -13.915
  224    H1'    C  24           H1'        C  24   6.416   6.961 -11.498
  225    H41    C  24           H41        C  24  11.932   3.918 -12.736
  226    H42    C  24           H42        C  24  11.233   2.442 -12.108
  227    H5     C  24           H5         C  24   8.946   2.256 -11.415
  228    H6     C  24           H6         C  24   6.815   3.432 -11.176
  229    H5'    U  25           H5'        U  25   1.678   5.094 -11.993
  230   H5''    U  25          H5''        U  25  -0.019   5.444 -12.242
  231    H4'    U  25           H4'        U  25   0.244   3.949 -10.356
  232    H3'    U  25           H3'        U  25  -1.120   6.444 -10.078
  233    H2'    U  25          H2''        U  25   0.376   7.375  -8.531
  234   HO2'    U  25           H2'        U  25  -0.158   6.208  -6.344
  235    H1'    U  25           H1'        U  25   1.075   4.614  -7.516
  236    H3     U  25           H3         U  25   5.708   6.216  -7.592
  237    H5     U  25           H5         U  25   3.140   8.523  -5.202
  238    H6     U  25           H6         U  25   1.263   7.438  -6.273
  239    H5'    G  26           H5'        G  26  -4.900   7.008  -7.848
  240   H5''    G  26          H5''        G  26  -3.463   8.008  -8.120
  241    H4'    G  26           H4'        G  26  -4.609   8.771  -6.150
  242    H3'    G  26           H3'        G  26  -2.040   7.310  -5.484
  243    H2'    G  26          H2''        G  26  -2.415   7.724  -3.251
  244   HO2'    G  26           H2'        G  26  -3.917   9.937  -4.215
  245    H1'    G  26           H1'        G  26  -5.249   7.797  -3.400
  246    H8     G  26           H8         G  26  -4.381   4.447  -4.677
  247    H1     G  26           H1         G  26  -3.412   5.084   1.617
  248    H21    G  26           H21        G  26  -3.463   7.266   2.173
  249    H22    G  26           H22        G  26  -3.731   8.512   0.975
  250    H5'    A  27           H5'        A  27  -2.109  10.941  -3.485
  251   H5''    A  27          H5''        A  27  -0.598  11.850  -3.551
  252    H4'    A  27           H4'        A  27  -1.431  11.742  -1.262
  253    H3'    A  27           H3'        A  27   1.068  10.020  -1.585
  254    H2'    A  27          H2''        A  27   0.963   9.725   0.755
  255   HO2'    A  27           H2'        A  27  -0.322  11.025   2.092
  256    H1'    A  27           H1'        A  27  -1.790   9.524   0.909
  257    H8     A  27           H8         A  27  -0.565   7.387  -1.968
  258    H61    A  27           H61        A  27   0.505   3.093   2.416
  259    H62    A  27           H62        A  27   0.402   3.401   0.675
  260    H2     A  27           H2         A  27  -0.327   6.984   4.427
  261    H5'    G  28           H5'        G  28   1.653  12.613   1.595
  262   H5''    G  28          H5''        G  28   3.291  13.263   1.736
  263    H4'    G  28           H4'        G  28   2.601  12.231   3.834
  264    H3'    G  28           H3'        G  28   4.719  10.520   2.458
  265    H2'    G  28          H2''        G  28   4.670   9.190   4.397
  266   HO2'    G  28           H2'        G  28   3.921   9.902   6.354
  267    H1'    G  28           H1'        G  28   1.931   9.433   4.856
  268    H8     G  28           H8         G  28   2.745   8.626   1.228
  269    H1     G  28           H1         G  28   2.934   3.542   5.082
  270    H21    G  28           H21        G  28   2.842   4.155   7.207
  271    H22    G  28           H22        G  28   2.723   5.832   7.685
  272    H5'    C  29           H5'        C  29   5.935  10.933   6.324
  273   H5''    C  29          H5''        C  29   7.654  11.305   6.540
  274    H4'    C  29           H4'        C  29   7.050   9.322   7.836
  275    H3'    C  29           H3'        C  29   8.776   8.627   5.434
  276    H2'    C  29          H2''        C  29   8.722   6.400   6.140
  277   HO2'    C  29           H2'        C  29   7.719   6.920   8.708
  278    H1'    C  29           H1'        C  29   6.185   6.552   7.461
  279    H41    C  29           H41        C  29   5.276   2.621   2.562
  280    H42    C  29           H42        C  29   5.116   4.001   1.495
  281    H5     C  29           H5         C  29   5.529   6.259   2.189
  282    H6     C  29           H6         C  29   6.191   7.693   4.053
  283    H5'    C  30           H5'        C  30  10.363   6.780   8.695
  284   H5''    C  30          H5''        C  30  12.080   7.143   8.964
  285    H4'    C  30           H4'        C  30  11.764   4.735   9.062
  286    H3'    C  30           H3'        C  30  13.519   5.917   7.098
  287    H2'    C  30          H2''        C  30  12.619   4.948   5.196
  288   HO2'    C  30           H2'        C  30  13.371   2.946   4.827
  289    H1'    C  30           H1'        C  30  11.203   2.760   6.675
  290    H41    C  30           H41        C  30   7.186   2.985   1.790
  291    H42    C  30           H42        C  30   7.666   4.623   1.423
  292    H5     C  30           H5         C  30   9.243   5.852   2.646
  293    H6     C  30           H6         C  30  10.752   5.828   4.530
  294    H5'    U  31           H5'        U  31  14.895   3.183   5.791
  295   H5''    U  31          H5''        U  31  16.659   3.017   5.875
  296    H4'    U  31           H4'        U  31  15.652   3.587   3.592
  297    H3'    U  31           H3'        U  31  18.131   4.392   4.537
  298    H2'    U  31          H2''        U  31  17.698   6.621   5.100
  299   HO2'    U  31           H2'        U  31  18.608   7.632   3.487
  300    H1'    U  31           H1'        U  31  15.558   7.091   3.105
  301    H3     U  31           H3         U  31  13.859  10.499   5.500
  302    H5     U  31           H5         U  31  15.447   7.985   8.484
  303    H6     U  31           H6         U  31  16.127   6.444   6.737
  304    H5'    G  32           H5'        G  32  17.475   2.114   1.604
  305   H5''    G  32          H5''        G  32  18.488   1.534   0.268
  306    H4'    G  32           H4'        G  32  16.191   1.130  -0.293
  307    H3'    G  32           H3'        G  32  17.755   2.574  -2.062
  308    H2'    G  32          H2''        G  32  16.889   4.704  -1.591
  309   HO2'    G  32           H2'        G  32  16.245   4.575  -3.688
  310    H1'    G  32           H1'        G  32  14.102   3.659  -1.168
  311    H8     G  32           H8         G  32  16.925   5.659   0.657
  312    H1     G  32           H1         G  32  11.107   8.357   0.659
  313    H21    G  32           H21        G  32   9.657   7.036  -0.383
  314    H22    G  32           H22        G  32  10.122   5.498  -1.075
  315    H5'    G  33           H5'        G  33  17.043  -0.648  -3.769
  316   H5''    G  33          H5''        G  33  16.421  -1.352  -5.273
  317    H4'    G  33           H4'        G  33  16.028  -2.922  -3.531
  318    H3'    G  33           H3'        G  33  13.850  -2.018  -5.004
  319    H2'    G  33          H2''        G  33  12.884  -0.667  -3.347
  320   HO2'    G  33           H2'        G  33  11.290  -2.185  -3.503
  321    H1'    G  33           H1'        G  33  13.755  -2.508  -1.125
  322    H8     G  33           H8         G  33  13.804   1.181  -2.394
  323    H1     G  33           H1         G  33  12.886   0.398   3.905
  324    H21    G  33           H21        G  33  13.019  -1.758   4.427
  325    H22    G  33           H22        G  33  13.325  -2.995   3.229
  326    H5'    G  34           H5'        G  34  13.252  -4.698  -1.604
  327   H5''    G  34          H5''        G  34  12.795  -6.315  -2.164
  328    H4'    G  34           H4'        G  34  12.085  -6.045   0.132
  329    H3'    G  34           H3'        G  34  10.247  -6.751  -1.904
  330    H2'    G  34          H2''        G  34   8.939  -4.845  -1.806
  331   HO2'    G  34           H2'        G  34   7.940  -5.634   0.679
  332    H1'    G  34           H1'        G  34   9.500  -4.460   1.126
  333    H8     G  34           H8         G  34   8.675  -2.749  -2.255
  334    H1     G  34           H1         G  34   8.785   1.199   2.741
  335    H21    G  34           H21        G  34   9.499   0.154   4.575
  336    H22    G  34           H22        G  34   9.975  -1.530   4.566
  337    H5'    A  35           H5'        A  35   6.803  -8.653  -1.464
  338   H5''    A  35          H5''        A  35   6.998  -6.998  -0.842
  339    H4'    A  35           H4'        A  35   4.703  -7.654  -0.490
  340    H3'    A  35           H3'        A  35   6.263  -6.857   1.668
  341    H2'    A  35          H2''        A  35   6.574  -8.879   2.682
  342   HO2'    A  35           H2'        A  35   5.394  -8.433   4.356
  343    H1'    A  35           H1'        A  35   3.918  -9.941   1.841
  344    H8     A  35           H8         A  35   7.591 -10.713   2.360
  345    H61    A  35           H61        A  35   6.031 -16.667   1.931
  346    H62    A  35           H62        A  35   7.320 -15.543   2.301
  347    H2     A  35           H2         A  35   2.451 -14.190   0.888
  348    H5'    G  36           H5'        G  36   5.803  -6.672   3.895
  349   H5''    G  36          H5''        G  36   4.129  -6.907   4.429
  350    H4'    G  36           H4'        G  36   5.494  -6.617   6.373
  351    H3'    G  36           H3'        G  36   3.598  -4.440   5.669
  352    H2'    G  36          H2''        G  36   4.593  -2.773   6.932
  353   HO2'    G  36           H2'        G  36   6.342  -3.814   8.540
  354    H1'    G  36           H1'        G  36   7.220  -3.421   6.814
  355    H8     G  36           H8         G  36   6.098  -4.140   3.306
  356    H1     G  36           H1         G  36   6.672   2.158   4.676
  357    H21    G  36           H21        G  36   6.869   2.432   6.873
  358    H22    G  36           H22        G  36   6.857   1.084   7.985
  359    H5'    C  37           H5'        C  37   3.763  -3.914   9.694
  360   H5''    C  37          H5''        C  37   2.179  -3.953  10.499
  361    H4'    C  37           H4'        C  37   3.307  -1.827  10.957
  362    H3'    C  37           H3'        C  37   0.982  -1.507   9.001
  363    H2'    C  37          H2''        C  37   1.362   0.835   9.228
  364   HO2'    C  37           H2'        C  37   2.585   1.708  10.862
  365    H1'    C  37           H1'        C  37   4.116   0.651   9.136
  366    H41    C  37           H41        C  37   2.352   2.041   3.200
  367    H42    C  37           H42        C  37   2.097   0.345   2.857
  368    H5     C  37           H5         C  37   2.240  -1.375   4.556
  369    H6     C  37           H6         C  37   2.638  -1.814   6.936
  370    H5'    U  38           H5'        U  38   0.248   1.271  11.882
  371   H5''    U  38          H5''        U  38  -1.448   1.407  12.380
  372    H4'    U  38           H4'        U  38  -0.604   3.559  11.559
  373    H3'    U  38           H3'        U  38  -2.593   2.330   9.599
  374    H2'    U  38          H2''        U  38  -2.358   4.304   8.344
  375   HO2'    U  38           H2'        U  38  -1.147   5.490  10.633
  376    H1'    U  38           H1'        U  38   0.352   4.714   8.906
  377    H3     U  38           H3         U  38   0.009   4.261   4.365
  378    H5     U  38           H5         U  38  -0.237   0.330   5.892
  379    H6     U  38           H6         U  38  -0.422   1.275   8.113
  380    H5'    C  39           H5'        C  39  -3.717   6.182  10.371
  381   H5''    C  39          H5''        C  39  -5.461   6.504  10.429
  382    H4'    C  39           H4'        C  39  -4.331   7.885   8.724
  383    H3'    C  39           H3'        C  39  -6.150   5.784   7.459
  384    H2'    C  39          H2''        C  39  -5.565   6.731   5.389
  385   HO2'    C  39           H2'        C  39  -4.442   9.011   6.660
  386    H1'    C  39           H1'        C  39  -2.954   7.515   6.143
  387    H41    C  39           H41        C  39  -2.527   2.755   1.940
  388    H42    C  39           H42        C  39  -2.911   1.586   3.184
  389    H5     C  39           H5         C  39  -3.509   2.207   5.433
  390    H6     C  39           H6         C  39  -3.920   4.087   6.947
  391    H5'    U  40           H5'        U  40  -7.009   9.344   5.625
  392   H5''    U  40          H5''        U  40  -8.727   9.769   5.525
  393    H4'    U  40           H4'        U  40  -7.686   9.881   3.306
  394    H3'    U  40           H3'        U  40  -9.603   7.530   3.586
  395    H2'    U  40          H2''        U  40  -9.216   7.092   1.300
  396   HO2'    U  40           H2'        U  40  -8.127   8.660  -0.039
  397    H1'    U  40           H1'        U  40  -6.520   7.758   1.297
  398    H3     U  40           H3         U  40  -6.771   3.244   0.325
  399    H5     U  40           H5         U  40  -7.156   3.544   4.522
  400    H6     U  40           H6         U  40  -7.329   5.945   4.280
  401    H5'    C  41           H5'        C  41 -10.770   9.623   0.166
  402   H5''    C  41          H5''        C  41 -12.519   9.868   0.008
  403    H4'    C  41           H4'        C  41 -11.629   8.779  -1.991
  404    H3'    C  41           H3'        C  41 -13.290   6.850  -0.309
  405    H2'    C  41          H2''        C  41 -12.967   5.293  -2.056
  406   HO2'    C  41           H2'        C  41 -12.771   7.576  -3.569
  407    H1'    C  41           H1'        C  41 -10.343   6.005  -2.608
  408    H41    C  41           H41        C  41  -9.941   0.781   0.984
  409    H42    C  41           H42        C  41 -10.100   1.753   2.431
  410    H5     C  41           H5         C  41 -10.615   4.095   2.383
  411    H6     C  41           H6         C  41 -11.040   6.033   0.943
  412    H5'    U  42           H5'        U  42 -14.774   6.514  -4.127
  413   H5''    U  42          H5''        U  42 -16.542   6.484  -4.235
  414    H4'    U  42           H4'        U  42 -15.582   4.520  -5.339
  415    H3'    U  42           H3'        U  42 -16.960   3.757  -2.725
  416    H2'    U  42          H2''        U  42 -16.506   1.519  -3.305
  417   HO2'    U  42           H2'        U  42 -16.424   0.843  -5.323
  418    H1'    U  42           H1'        U  42 -14.008   2.010  -4.441
  419    H3     U  42           H3         U  42 -13.247  -0.660  -0.807
  420    H5     U  42           H5         U  42 -13.763   3.216   0.766
  421    H6     U  42           H6         U  42 -14.504   3.933  -1.427
  422    H5'    G  43           H5'        G  43 -18.475   1.265  -5.652
  423   H5''    G  43          H5''        G  43 -20.221   0.985  -5.567
  424    H4'    G  43           H4'        G  43 -19.022  -1.137  -5.585
  425    H3'    G  43           H3'        G  43 -20.222  -0.582  -2.840
  426    H2'    G  43          H2''        G  43 -19.436  -2.701  -2.213
  427   HO2'    G  43           H2'        G  43 -19.302  -3.209  -5.006
  428    H1'    G  43           H1'        G  43 -17.093  -2.632  -3.716
  429    H8     G  43           H8         G  43 -17.579   0.566  -1.713
  430    H1     G  43           H1         G  43 -15.180  -4.275   1.706
  431    H21    G  43           H21        G  43 -15.361  -6.187   0.557
  432    H22    G  43           H22        G  43 -16.058  -6.244  -1.046
  433    H5'    C  44           H5'        C  44 -21.377  -4.386  -3.977
  434   H5''    C  44          H5''        C  44 -23.062  -4.801  -3.626
  435    H4'    C  44           H4'        C  44 -21.560  -6.480  -2.694
  436    H3'    C  44           H3'        C  44 -22.818  -4.788  -0.495
  437    H2'    C  44          H2''        C  44 -21.737  -6.222   1.026
  438   HO2'    C  44           H2'        C  44 -20.603  -8.126  -0.399
  439    H1'    C  44           H1'        C  44 -19.423  -6.596  -0.490
  440    H41    C  44           H41        C  44 -17.887  -2.455   4.100
  441    H42    C  44           H42        C  44 -18.565  -1.144   3.159
  442    H5     C  44           H5         C  44 -19.758  -1.489   1.089
  443    H6     C  44           H6         C  44 -20.588  -3.169  -0.489
  444    H5'    C  45           H5'        C  45 -23.332  -8.719   0.524
  445   H5''    C  45          H5''        C  45 -24.971  -9.137   1.056
  446    H4'    C  45           H4'        C  45 -23.343  -9.874   2.720
  447    H3'    C  45           H3'        C  45 -24.961  -7.471   3.617
  448   HO3'    C  45           H3T        C  45 -25.869  -9.678   3.159
  449    H2'    C  45          H2''        C  45 -23.861  -7.550   5.665
  450   HO2'    C  45           H2'        C  45 -23.126 -10.246   5.049
  451    H1'    C  45           H1'        C  45 -21.420  -8.629   4.663
  452    H41    C  45           H41        C  45 -20.171  -2.546   6.300
  453    H42    C  45           H42        C  45 -20.947  -2.019   4.830
  454    H5     C  45           H5         C  45 -22.073  -3.482   3.318
  455    H6     C  45           H6         C  45 -22.761  -5.786   2.881
  Start of MODEL    9
    1    H1   DAB   1           H        DAB   1  -3.120  -9.005  -1.280
    2    HA   DAB   1           HA       DAB   1  -3.784  -8.114  -4.039
    3    HB2  DAB   1           HB2      DAB   1  -3.520  -5.981  -2.045
    4    HB3  DAB   1           HB3      DAB   1  -4.805  -6.282  -3.206
    5    HG2  DAB   1           HG2      DAB   1  -5.557  -8.185  -1.674
    6    HG3  DAB   1           HG3      DAB   1  -4.450  -7.531  -0.471
    7    HD1  DAB   1           HD1      DAB   1  -6.828  -6.233  -1.666
    8    HD2  DAB   1           HD2      DAB   1  -5.638  -5.348  -0.836
    9    HD3  DAB   1           HD3      DAB   1  -6.516  -6.556  -0.028
   10    H    VAL   2           H        VAL   2  -2.331  -6.941  -5.206
   11    HA   VAL   2           HA       VAL   2   0.340  -6.572  -4.004
   12    HB   VAL   2           HB       VAL   2   0.546  -8.343  -5.531
   13   HG11  VAL   2          HG11      VAL   2  -0.270  -8.174  -7.851
   14   HG12  VAL   2          HG12      VAL   2  -0.901  -6.563  -7.514
   15   HG13  VAL   2          HG13      VAL   2  -1.597  -7.968  -6.707
   16   HG21  VAL   2          HG21      VAL   2   2.142  -6.292  -5.640
   17   HG22  VAL   2          HG22      VAL   2   1.350  -5.948  -7.178
   18   HG23  VAL   2          HG23      VAL   2   2.217  -7.467  -6.952
   19    H    ARG   3           H        ARG   3   1.357  -4.634  -4.242
   20    HA   ARG   3           HA       ARG   3   0.139  -2.687  -6.102
   21    HB2  ARG   3           HB2      ARG   3   0.880  -1.725  -3.387
   22    HB3  ARG   3           HB3      ARG   3  -0.303  -1.108  -4.498
   23    HG2  ARG   3           HG2      ARG   3  -0.727  -3.769  -3.138
   24    HG3  ARG   3           HG3      ARG   3  -1.057  -2.278  -2.306
   25    HD2  ARG   3           HD2      ARG   3  -2.473  -1.676  -4.413
   26    HD3  ARG   3           HD3      ARG   3  -2.415  -3.399  -4.740
   27    HE   ARG   3           HE       ARG   3  -3.744  -3.779  -2.846
   28   HH11  ARG   3          HH11      ARG   3  -5.145  -3.015  -1.241
   29   HH12  ARG   3          HH12      ARG   3  -5.189  -1.322  -0.872
   30   HH21  ARG   3          HH21      ARG   3  -2.794  -0.479  -3.222
   31   HH22  ARG   3          HH22      ARG   3  -3.864   0.112  -1.999
   32    H    THR   4           H        THR   4   1.539  -0.993  -6.707
   33    HA   THR   4           HA       THR   4   4.312  -1.375  -5.854
   34    HB   THR   4           HB       THR   4   3.432  -0.635  -8.645
   35    HG1  THR   4           HG1      THR   4   4.807  -2.956  -8.320
   36   HG21  THR   4          HG21      THR   4   5.967  -1.412  -8.943
   37   HG22  THR   4          HG22      THR   4   6.066  -0.832  -7.279
   38   HG23  THR   4          HG23      THR   4   5.539   0.255  -8.562
   39    H    ARG   5           H        ARG   5   5.330   0.418  -5.109
   40    HA   ARG   5           HA       ARG   5   3.910   2.958  -5.433
   41    HB2  ARG   5           HB2      ARG   5   6.069   2.425  -3.434
   42    HB3  ARG   5           HB3      ARG   5   4.770   3.600  -3.356
   43    HG2  ARG   5           HG2      ARG   5   4.269   0.615  -3.330
   44    HG3  ARG   5           HG3      ARG   5   4.507   1.548  -1.861
   45    HD2  ARG   5           HD2      ARG   5   2.297   1.785  -3.883
   46    HD3  ARG   5           HD3      ARG   5   2.163   1.504  -2.157
   47    HE   ARG   5           HE       ARG   5   2.594   4.046  -3.456
   48   HH11  ARG   5          HH11      ARG   5   2.506   5.854  -2.090
   49   HH12  ARG   5          HH12      ARG   5   2.553   5.635  -0.360
   50   HH21  ARG   5          HH21      ARG   5   2.726   2.171  -0.561
   51   HH22  ARG   5          HH22      ARG   5   2.659   3.541   0.502
   52    H    LYS   6           H        LYS   6   4.878   4.579  -6.497
   53    HA   LYS   6           HA       LYS   6   6.951   4.337  -8.232
   54    HB2  LYS   6           HB2      LYS   6   5.475   6.286  -8.125
   55    HB3  LYS   6           HB3      LYS   6   6.232   6.763  -6.611
   56    HG2  LYS   6           HG2      LYS   6   7.702   7.977  -7.866
   57    HG3  LYS   6           HG3      LYS   6   8.401   6.447  -8.368
   58    HD2  LYS   6           HD2      LYS   6   7.890   7.512 -10.402
   59    HD3  LYS   6           HD3      LYS   6   6.552   6.397 -10.173
   60    HE2  LYS   6           HE2      LYS   6   5.904   8.749 -10.873
   61    HE3  LYS   6           HE1      LYS   6   5.107   8.149  -9.420
   62    HZ1  LYS   6           HZ1      LYS   6   6.528  10.470  -9.643
   63    HZ2  LYS   6           HZ2      LYS   6   7.597   9.422  -8.842
   64    HZ3  LYS   6           HZ3      LYS   6   6.048   9.722  -8.193
   65    H    GLY   7           H        GLY   7   8.465   2.968  -7.151
   66    HA2  GLY   7           HA2      GLY   7  10.872   3.898  -6.568
   67    HA3  GLY   7           HA3      GLY   7  10.069   4.185  -5.034
   68    H    ARG   8           H        ARG   8   8.427   1.952  -4.975
   69    HA   ARG   8           HA       ARG   8  10.124  -0.395  -5.206
   70    HB2  ARG   8           HB2      ARG   8   9.303  -0.805  -2.648
   71    HB3  ARG   8           HB3      ARG   8  10.868  -0.120  -3.068
   72    HG2  ARG   8           HG2      ARG   8  10.096   1.454  -1.528
   73    HG3  ARG   8           HG3      ARG   8   9.551   2.172  -3.032
   74    HD2  ARG   8           HD2      ARG   8   7.377   0.763  -2.647
   75    HD3  ARG   8           HD3      ARG   8   7.941   0.640  -0.992
   76    HE   ARG   8           HE       ARG   8   7.765   3.355  -2.080
   77   HH11  ARG   8          HH11      ARG   8   6.362   4.702  -1.011
   78   HH12  ARG   8          HH12      ARG   8   5.254   4.059   0.154
   79   HH21  ARG   8          HH21      ARG   8   6.351   0.785  -0.259
   80   HH22  ARG   8          HH22      ARG   8   5.243   1.817   0.578
   81    H    ARG   9           H        ARG   9   8.940  -2.388  -4.564
   82    HA   ARG   9           HA       ARG   9   6.135  -2.138  -5.317
   83    HB2  ARG   9           HB2      ARG   9   7.497  -3.434  -6.903
   84    HB3  ARG   9           HB3      ARG   9   7.936  -4.530  -5.596
   85    HG2  ARG   9           HG2      ARG   9   5.497  -5.048  -5.275
   86    HG3  ARG   9           HG3      ARG   9   5.134  -4.066  -6.694
   87    HD2  ARG   9           HD2      ARG   9   6.052  -5.590  -8.156
   88    HD3  ARG   9           HD3      ARG   9   7.207  -6.195  -6.975
   89    HE   ARG   9           HE       ARG   9   4.399  -7.008  -7.231
   90   HH11  ARG   9          HH11      ARG   9   3.914  -8.941  -6.154
   91   HH12  ARG   9          HH12      ARG   9   5.078  -9.647  -5.083
   92   HH21  ARG   9          HH21      ARG   9   7.439  -7.159  -5.573
   93   HH22  ARG   9          HH22      ARG   9   7.073  -8.642  -4.760
   94    H    ILE  10           H        ILE  10   4.546  -2.782  -3.979
   95    HA   ILE  10           HA       ILE  10   5.363  -4.366  -1.617
   96    HB   ILE  10           HB       ILE  10   3.925  -3.076  -0.221
   97   HG12  ILE  10          HG12      ILE  10   2.994  -1.786  -2.797
   98   HG13  ILE  10          HG13      ILE  10   2.023  -2.819  -1.738
   99   HG21  ILE  10          HG21      ILE  10   5.345  -1.309  -0.114
  100   HG22  ILE  10          HG22      ILE  10   4.823  -0.703  -1.687
  101   HG23  ILE  10          HG23      ILE  10   6.091  -1.922  -1.587
  102   HD11  ILE  10          HD11      ILE  10   3.202  -0.120  -1.037
  103   HD12  ILE  10          HD12      ILE  10   2.326  -1.158   0.086
  104   HD13  ILE  10          HD13      ILE  10   1.497  -0.474  -1.311
  105    H    4J5  11           H        NOR  11   3.482  -5.428  -0.517
  106    HA   4J5  11           HA       NOR  11   1.206  -5.988  -2.164
  107    HD   4J5  11           HD       NOR  11   2.818 -10.683  -2.330
  108    HB2  4J5  11           HB2      NOR  11   2.244  -7.659  -3.329
  109    HB3  4J5  11           HB3      NOR  11   3.492  -7.849  -2.109
  110    HG2  4J5  11           HG2      NOR  11   2.050  -9.167  -0.701
  111    HG3  4J5  11           HG3      NOR  11   0.653  -8.819  -1.709
  112   HH11  4J5  11          HH11      NOR  11  -0.083  -9.022  -3.241
  113   HH12  4J5  11          HH12      NOR  11  -0.479 -10.134  -4.506
  114   HH21  4J5  11          HH21      NOR  11   2.292 -12.146  -3.962
  115   HH22  4J5  11          HH22      NOR  11   0.867 -11.903  -4.916
  116    H    ILE  12           H        ILE  12  -0.493  -6.582  -1.034
  117    HA   ILE  12           HA       ILE  12  -0.050  -7.206   1.822
  118    HB   ILE  12           HB       ILE  12  -2.776  -6.508   1.395
  119   HG12  ILE  12          HG12      ILE  12  -1.795  -5.471  -0.768
  120   HG13  ILE  12          HG13      ILE  12  -2.726  -4.404   0.273
  121   HG21  ILE  12          HG21      ILE  12  -1.663  -6.024   3.455
  122   HG22  ILE  12          HG22      ILE  12  -2.031  -4.456   2.730
  123   HG23  ILE  12          HG23      ILE  12  -0.395  -5.110   2.634
  124   HD11  ILE  12          HD11      ILE  12   0.193  -4.575   0.827
  125   HD12  ILE  12          HD12      ILE  12  -0.886  -3.184   0.892
  126   HD13  ILE  12          HD13      ILE  12  -0.279  -3.761  -0.660
  127    HA   DPR  13           HA       DPR  13  -1.993 -11.133   1.799
  128    HB2  DPR  13           HB2      DPR  13  -0.341 -12.774   1.621
  129    HB3  DPR  13           HB3      DPR  13   0.477 -11.941   0.275
  130    HG2  DPR  13           HG2      DPR  13   0.576 -11.386   3.189
  131    HG3  DPR  13           HG3      DPR  13   1.849 -11.258   1.963
  132    HD2  DPR  13           HD2      DPR  13   0.316  -9.127   2.955
  133    HD3  DPR  13           HD3      DPR  13   1.300  -9.095   1.478
  134    HA   PRO  14           HA       PRO  14  -3.488 -12.292  -2.250
  135    HB2  PRO  14           HB2      PRO  14  -6.035 -11.332  -2.079
  136    HB3  PRO  14           HB3      PRO  14  -5.481 -12.794  -1.240
  137    HG2  PRO  14           HG2      PRO  14  -5.879 -10.042  -0.182
  138    HG3  PRO  14           HG3      PRO  14  -6.230 -11.608   0.570
  139    HD2  PRO  14           HD2      PRO  14  -4.006 -10.109   1.172
  140    HD3  PRO  14           HD3      PRO  14  -4.076 -11.878   1.331
  141    H5'    G  17           H5'        G  17 -15.443  -2.330  15.849
  142   H5''    G  17          H5''        G  17 -13.796  -2.898  15.517
  143    H4'    G  17           H4'        G  17 -15.327  -4.758  15.294
  144    H3'    G  17           H3'        G  17 -14.274  -3.780  12.618
  145    H2'    G  17          H2''        G  17 -15.448  -5.515  11.586
  146   HO2'    G  17           H2'        G  17 -15.237  -6.712  14.113
  147    H1'    G  17           H1'        G  17 -17.687  -5.428  13.214
  148    H8     G  17           H8         G  17 -16.791  -1.874  12.374
  149    H1     G  17           H1         G  17 -19.787  -4.954   7.611
  150    H21    G  17           H21        G  17 -19.874  -7.099   8.021
  151    H22    G  17           H22        G  17 -19.201  -7.811   9.471
  152   HO5'    G  17           H5T        G  17 -13.714  -1.439  14.033
  153    H5'    G  18           H5'        G  18 -13.876  -7.848  12.581
  154   H5''    G  18          H5''        G  18 -12.303  -8.458  12.028
  155    H4'    G  18           H4'        G  18 -14.112  -9.487  10.748
  156    H3'    G  18           H3'        G  18 -12.557  -7.489   9.052
  157    H2'    G  18          H2''        G  18 -13.891  -8.166   7.250
  158   HO2'    G  18           H2'        G  18 -15.062 -10.302   8.671
  159    H1'    G  18           H1'        G  18 -16.237  -8.507   8.703
  160    H8     G  18           H8         G  18 -14.562  -5.211   9.593
  161    H1     G  18           H1         G  18 -17.926  -4.989   4.152
  162    H21    G  18           H21        G  18 -18.489  -7.036   3.516
  163    H22    G  18           H22        G  18 -18.042  -8.458   4.431
  164    H5'    C  19           H5'        C  19 -12.855 -10.981   6.889
  165   H5''    C  19          H5''        C  19 -11.375 -11.514   6.062
  166    H4'    C  19           H4'        C  19 -13.238 -11.375   4.480
  167    H3'    C  19           H3'        C  19 -11.223  -9.140   3.987
  168    H2'    C  19          H2''        C  19 -12.542  -8.519   2.154
  169   HO2'    C  19           H2'        C  19 -14.411 -10.400   1.948
  170    H1'    C  19           H1'        C  19 -15.012  -9.163   3.307
  171    H41    C  19           H41        C  19 -14.593  -2.820   3.512
  172    H42    C  19           H42        C  19 -13.649  -2.920   4.982
  173    H5     C  19           H5         C  19 -12.891  -5.010   5.920
  174    H6     C  19           H6         C  19 -12.798  -7.432   5.593
  175    H5'    A  20           H5'        A  20 -12.043 -10.870   0.347
  176   H5''    A  20          H5''        A  20 -10.631 -11.203  -0.676
  177    H4'    A  20           H4'        A  20 -12.283  -9.915  -1.927
  178    H3'    A  20           H3'        A  20  -9.863  -8.212  -1.223
  179    H2'    A  20          H2''        A  20 -10.844  -6.487  -2.459
  180   HO2'    A  20           H2'        A  20 -12.080  -8.602  -3.792
  181    H1'    A  20           H1'        A  20 -13.490  -7.033  -1.767
  182    H8     A  20           H8         A  20 -11.209  -7.020   1.287
  183    H61    A  20           H61        A  20 -12.183  -0.923   1.452
  184    H62    A  20           H62        A  20 -11.553  -2.304   2.321
  185    H2     A  20           H2         A  20 -13.738  -2.461  -2.441
  186    H5'    G  21           H5'        G  21 -10.617  -7.793  -5.310
  187   H5''    G  21          H5''        G  21  -9.177  -7.792  -6.348
  188    H4'    G  21           H4'        G  21 -10.530  -5.805  -6.767
  189    H3'    G  21           H3'        G  21  -7.963  -5.081  -5.300
  190    H2'    G  21          H2''        G  21  -8.613  -2.841  -5.486
  191   HO2'    G  21           H2'        G  21 -10.801  -3.149  -7.139
  192    H1'    G  21           H1'        G  21 -11.380  -3.306  -5.269
  193    H8     G  21           H8         G  21  -9.356  -5.008  -2.525
  194    H1     G  21           H1         G  21 -10.480   1.178  -1.455
  195    H21    G  21           H21        G  21 -11.276   2.153  -3.275
  196    H22    G  21           H22        G  21 -11.533   1.274  -4.764
  197    H5'    A  22           H5'        A  22  -8.408  -2.380  -8.213
  198   H5''    A  22          H5''        A  22  -6.999  -2.131  -9.264
  199    H4'    A  22           H4'        A  22  -7.778   0.022  -8.390
  200    H3'    A  22           H3'        A  22  -5.150  -0.924  -7.206
  201    H2'    A  22          H2''        A  22  -5.081   0.983  -5.882
  202   HO2'    A  22           H2'        A  22  -6.319   2.911  -6.512
  203    H1'    A  22           H1'        A  22  -7.933   1.458  -5.815
  204    H8     A  22           H8         A  22  -6.823  -1.896  -4.434
  205    H61    A  22           H61        A  22  -6.231   0.948   1.006
  206    H62    A  22           H62        A  22  -6.260  -0.589   0.169
  207    H2     A  22           H2         A  22  -6.805   4.083  -2.171
  208    H5'    U  23           H5'        U  23  -1.152   1.065  -9.227
  209   H5''    U  23          H5''        U  23  -1.463   0.454  -7.592
  210    H4'    U  23           H4'        U  23  -1.321   3.400  -8.288
  211    H3'    U  23           H3'        U  23   0.826   1.511  -7.375
  212    H2'    U  23          H2''        U  23   1.447   2.878  -5.644
  213   HO2'    U  23           H2'        U  23   2.094   4.475  -7.228
  214    H1'    U  23           H1'        U  23  -0.906   4.610  -5.706
  215    H3     U  23           H3         U  23   0.120   4.229  -1.299
  216    H5     U  23           H5         U  23  -1.433   0.492  -2.340
  217    H6     U  23           H6         U  23  -1.440   1.208  -4.651
  218    H5'    C  24           H5'        C  24   3.808   5.304  -9.347
  219   H5''    C  24          H5''        C  24   2.126   5.501  -9.861
  220    H4'    C  24           H4'        C  24   3.443   6.902 -11.263
  221    H3'    C  24           H3'        C  24   1.867   4.905 -12.399
  222    H2'    C  24          H2''        C  24   3.562   3.448 -13.063
  223   HO2'    C  24           H2'        C  24   3.983   5.455 -15.044
  224    H1'    C  24           H1'        C  24   5.504   5.677 -13.618
  225    H41    C  24           H41        C  24   9.283   0.546 -13.288
  226    H42    C  24           H42        C  24   8.952   0.410 -11.576
  227    H5     C  24           H5         C  24   7.366   1.814 -10.422
  228    H6     C  24           H6         C  24   5.739   3.624 -10.666
  229    H5'    U  25           H5'        U  25  -0.267   5.011 -12.493
  230   H5''    U  25          H5''        U  25  -1.433   6.313 -12.240
  231    H4'    U  25           H4'        U  25  -0.965   4.319 -10.446
  232    H3'    U  25           H3'        U  25  -2.473   6.714 -10.316
  233    H2'    U  25          H2''        U  25  -0.979   7.951  -9.010
  234   HO2'    U  25           H2'        U  25  -1.853   6.110  -7.009
  235    H1'    U  25           H1'        U  25   0.053   5.480  -7.644
  236    H3     U  25           H3         U  25   2.928   9.641  -9.344
  237    H5     U  25           H5         U  25   3.525   7.659  -5.655
  238    H6     U  25           H6         U  25   1.705   6.191  -6.235
  239    H5'    G  26           H5'        G  26  -5.610   7.692  -7.676
  240   H5''    G  26          H5''        G  26  -4.017   8.315  -8.150
  241    H4'    G  26           H4'        G  26  -4.778   9.473  -6.168
  242    H3'    G  26           H3'        G  26  -2.531   7.529  -5.517
  243    H2'    G  26          H2''        G  26  -2.585   8.295  -3.320
  244   HO2'    G  26           H2'        G  26  -3.356  10.273  -2.748
  245    H1'    G  26           H1'        G  26  -5.336   8.654  -3.165
  246    H8     G  26           H8         G  26  -5.333   5.293  -4.541
  247    H1     G  26           H1         G  26  -2.915   5.402   1.398
  248    H21    G  26           H21        G  26  -2.376   7.510   1.951
  249    H22    G  26           H22        G  26  -2.635   8.854   0.862
  250    H5'    A  27           H5'        A  27  -1.723  11.048  -3.652
  251   H5''    A  27          H5''        A  27  -0.130  11.747  -3.992
  252    H4'    A  27           H4'        A  27  -0.627  11.832  -1.592
  253    H3'    A  27           H3'        A  27   1.548   9.766  -2.149
  254    H2'    A  27          H2''        A  27   1.715   9.534   0.176
  255   HO2'    A  27           H2'        A  27   0.806  11.055   1.617
  256    H1'    A  27           H1'        A  27  -1.009   9.811   0.710
  257    H8     A  27           H8         A  27  -0.399   7.330  -2.127
  258    H61    A  27           H61        A  27   0.257   3.130   2.384
  259    H62    A  27           H62        A  27   0.109   3.395   0.655
  260    H2     A  27           H2         A  27   0.156   7.192   4.260
  261    H5'    G  28           H5'        G  28   2.776  12.364   0.880
  262   H5''    G  28          H5''        G  28   4.497  12.795   0.885
  263    H4'    G  28           H4'        G  28   3.815  11.924   3.064
  264    H3'    G  28           H3'        G  28   5.605   9.905   1.646
  265    H2'    G  28          H2''        G  28   5.469   8.620   3.593
  266   HO2'    G  28           H2'        G  28   4.666  11.045   4.861
  267    H1'    G  28           H1'        G  28   2.833   9.342   4.249
  268    H8     G  28           H8         G  28   3.244   8.177   0.632
  269    H1     G  28           H1         G  28   2.782   3.399   4.849
  270    H21    G  28           H21        G  28   2.961   4.164   6.906
  271    H22    G  28           H22        G  28   3.196   5.861   7.255
  272    H5'    C  29           H5'        C  29   6.879  10.293   5.473
  273   H5''    C  29          H5''        C  29   8.623  10.519   5.718
  274    H4'    C  29           H4'        C  29   7.792   8.706   7.134
  275    H3'    C  29           H3'        C  29   9.524   7.675   4.860
  276    H2'    C  29          H2''        C  29   9.229   5.527   5.697
  277   HO2'    C  29           H2'        C  29   8.749   5.135   7.894
  278    H1'    C  29           H1'        C  29   6.676   5.997   6.919
  279    H41    C  29           H41        C  29   5.619   1.851   2.274
  280    H42    C  29           H42        C  29   5.593   3.161   1.117
  281    H5     C  29           H5         C  29   6.149   5.424   1.665
  282    H6     C  29           H6         C  29   6.865   6.926   3.457
  283    H5'    C  30           H5'        C  30  10.688   5.626   8.018
  284   H5''    C  30          H5''        C  30  12.308   6.022   8.628
  285    H4'    C  30           H4'        C  30  11.985   3.598   8.617
  286    H3'    C  30           H3'        C  30  13.912   4.654   6.533
  287    H2'    C  30          H2''        C  30  14.347   2.496   5.823
  288   HO2'    C  30           H2'        C  30  14.060   0.677   7.124
  289    H1'    C  30           H1'        C  30  11.784   1.413   6.401
  290    H41    C  30           H41        C  30  12.168   1.672   0.088
  291    H42    C  30           H42        C  30  11.481   3.279   0.132
  292    H5     C  30           H5         C  30  11.128   4.507   2.173
  293    H6     C  30           H6         C  30  11.283   4.410   4.601
  294    H5'    U  31           H5'        U  31  18.665   4.029   7.938
  295   H5''    U  31          H5''        U  31  18.031   4.022   6.280
  296    H4'    U  31           H4'        U  31  19.789   2.359   6.519
  297    H3'    U  31           H3'        U  31  17.038   1.157   6.205
  298    H2'    U  31          H2''        U  31  17.951  -0.950   6.386
  299   HO2'    U  31           H2'        U  31  20.627  -0.390   6.070
  300    H1'    U  31           H1'        U  31  20.210  -0.247   7.966
  301    H3     U  31           H3         U  31  18.116  -3.646  10.182
  302    H5     U  31           H5         U  31  15.717  -0.246  10.854
  303    H6     U  31           H6         U  31  17.057   0.931   9.200
  304    H5'    G  32           H5'        G  32  19.498  -0.942   3.826
  305   H5''    G  32          H5''        G  32  19.074  -0.927   2.102
  306    H4'    G  32           H4'        G  32  19.506  -3.220   2.786
  307    H3'    G  32           H3'        G  32  17.098  -2.492   1.554
  308    H2'    G  32          H2''        G  32  15.693  -2.685   3.413
  309   HO2'    G  32           H2'        G  32  16.047  -5.475   3.023
  310    H1'    G  32           H1'        G  32  17.281  -4.963   4.572
  311    H8     G  32           H8         G  32  15.785  -1.435   5.345
  312    H1     G  32           H1         G  32  15.330  -5.754  10.061
  313    H21    G  32           H21        G  32  16.310  -7.651   9.452
  314    H22    G  32           H22        G  32  17.078  -7.851   7.893
  315    H5'    G  33           H5'        G  33  14.469  -4.366  -0.833
  316   H5''    G  33          H5''        G  33  14.612  -3.438   0.673
  317    H4'    G  33           H4'        G  33  12.381  -4.297   0.557
  318    H3'    G  33           H3'        G  33  14.022  -4.919   2.738
  319    H2'    G  33          H2''        G  33  14.389  -7.166   2.267
  320   HO2'    G  33           H2'        G  33  13.006  -8.361   3.479
  321    H1'    G  33           H1'        G  33  11.682  -7.552   1.008
  322    H8     G  33           H8         G  33  15.522  -7.961   0.423
  323    H1     G  33           H1         G  33  11.820 -12.702  -1.803
  324    H21    G  33           H21        G  33   9.680 -12.224  -1.449
  325    H22    G  33           H22        G  33   9.165 -10.746  -0.670
  326    H5'    G  34           H5'        G  34   9.238  -4.473   4.564
  327   H5''    G  34          H5''        G  34   8.789  -5.824   5.624
  328    H4'    G  34           H4'        G  34   8.082  -7.069   3.890
  329    H3'    G  34           H3'        G  34  10.754  -6.976   3.135
  330    H2'    G  34          H2''        G  34  10.654  -5.146   1.714
  331   HO2'    G  34           H2'        G  34  10.118  -5.918  -0.459
  332    H1'    G  34           H1'        G  34   7.900  -5.825   0.730
  333    H8     G  34           H8         G  34   6.754  -3.637  -0.153
  334    H1     G  34           H1         G  34  11.638  -0.064   1.873
  335    H21    G  34           H21        G  34  13.002  -1.260   3.138
  336    H22    G  34           H22        G  34  12.719  -2.951   3.480
  337    H5'    A  35           H5'        A  35   7.812 -11.372   3.060
  338   H5''    A  35          H5''        A  35   7.505 -11.603   1.325
  339    H4'    A  35           H4'        A  35   7.581  -8.909   2.712
  340    H3'    A  35           H3'        A  35   5.453 -10.691   2.966
  341    H2'    A  35          H2''        A  35   4.774 -10.698   0.726
  342   HO2'    A  35           H2'        A  35   2.960  -9.631   0.868
  343    H1'    A  35           H1'        A  35   5.536  -7.816   0.345
  344    H8     A  35           H8         A  35   6.141  -7.387  -2.162
  345    H61    A  35           H61        A  35   5.377 -12.556  -5.545
  346    H62    A  35           H62        A  35   5.671 -10.833  -5.615
  347    H2     A  35           H2         A  35   5.041 -13.625  -1.207
  348    H5'    G  36           H5'        G  36   5.885  -8.163   5.880
  349   H5''    G  36          H5''        G  36   4.460  -8.260   6.936
  350    H4'    G  36           H4'        G  36   5.980  -6.641   7.843
  351    H3'    G  36           H3'        G  36   3.609  -5.295   6.524
  352    H2'    G  36          H2''        G  36   4.465  -3.249   7.154
  353   HO2'    G  36           H2'        G  36   5.612  -4.742   9.244
  354    H1'    G  36           H1'        G  36   7.194  -3.973   7.056
  355    H8     G  36           H8         G  36   5.607  -4.818   3.729
  356    H1     G  36           H1         G  36   6.975   1.427   4.431
  357    H21    G  36           H21        G  36   7.481   1.880   6.524
  358    H22    G  36           H22        G  36   7.488   0.660   7.777
  359    H5'    C  37           H5'        C  37   4.062  -3.544  10.240
  360   H5''    C  37          H5''        C  37   2.563  -3.487  11.187
  361    H4'    C  37           H4'        C  37   3.619  -1.290  11.183
  362    H3'    C  37           H3'        C  37   1.150  -1.316   9.393
  363    H2'    C  37          H2''        C  37   1.500   0.987   9.111
  364   HO2'    C  37           H2'        C  37   2.595   2.245  10.544
  365    H1'    C  37           H1'        C  37   4.311   0.869   9.123
  366    H41    C  37           H41        C  37   2.639   1.714   3.053
  367    H42    C  37           H42        C  37   2.351   0.001   2.864
  368    H5     C  37           H5         C  37   2.455  -1.562   4.739
  369    H6     C  37           H6         C  37   2.823  -1.769   7.156
  370    H5'    U  38           H5'        U  38   0.586   1.953  11.889
  371   H5''    U  38          H5''        U  38  -1.058   2.096  12.540
  372    H4'    U  38           H4'        U  38  -0.411   4.169  11.442
  373    H3'    U  38           H3'        U  38  -2.459   2.688   9.740
  374    H2'    U  38          H2''        U  38  -2.393   4.515   8.293
  375   HO2'    U  38           H2'        U  38  -0.908   6.208   9.939
  376    H1'    U  38           H1'        U  38   0.332   5.147   8.712
  377    H3     U  38           H3         U  38  -0.099   4.380   4.242
  378    H5     U  38           H5         U  38  -0.125   0.553   6.025
  379    H6     U  38           H6         U  38  -0.327   1.638   8.180
  380    H5'    C  39           H5'        C  39  -3.667   6.611  10.227
  381   H5''    C  39          H5''        C  39  -5.404   6.883  10.467
  382    H4'    C  39           H4'        C  39  -4.520   8.246   8.618
  383    H3'    C  39           H3'        C  39  -6.384   6.071   7.569
  384    H2'    C  39          H2''        C  39  -6.024   6.960   5.445
  385   HO2'    C  39           H2'        C  39  -5.407   9.092   5.097
  386    H1'    C  39           H1'        C  39  -3.387   7.878   5.943
  387    H41    C  39           H41        C  39  -2.874   3.062   1.827
  388    H42    C  39           H42        C  39  -3.054   1.897   3.119
  389    H5     C  39           H5         C  39  -3.565   2.532   5.405
  390    H6     C  39           H6         C  39  -4.054   4.422   6.907
  391    H5'    U  40           H5'        U  40  -7.325   9.513   5.725
  392   H5''    U  40          H5''        U  40  -9.040   9.966   5.666
  393    H4'    U  40           H4'        U  40  -8.055  10.038   3.419
  394    H3'    U  40           H3'        U  40  -9.972   7.698   3.756
  395    H2'    U  40          H2''        U  40  -9.610   7.208   1.497
  396   HO2'    U  40           H2'        U  40  -9.493   8.770   0.088
  397    H1'    U  40           H1'        U  40  -6.917   7.985   1.416
  398    H3     U  40           H3         U  40  -6.989   3.513   0.323
  399    H5     U  40           H5         U  40  -7.418   3.670   4.526
  400    H6     U  40           H6         U  40  -7.722   6.061   4.350
  401    H5'    C  41           H5'        C  41 -11.140   9.779   0.299
  402   H5''    C  41          H5''        C  41 -12.888  10.050   0.142
  403    H4'    C  41           H4'        C  41 -12.038   8.969  -1.869
  404    H3'    C  41           H3'        C  41 -13.674   7.020  -0.191
  405    H2'    C  41          H2''        C  41 -13.334   5.453  -1.894
  406   HO2'    C  41           H2'        C  41 -12.557   7.636  -3.567
  407    H1'    C  41           H1'        C  41 -10.736   6.244  -2.554
  408    H41    C  41           H41        C  41 -10.081   0.966   0.958
  409    H42    C  41           H42        C  41 -10.253   1.910   2.420
  410    H5     C  41           H5         C  41 -10.825   4.243   2.415
  411    H6     C  41           H6         C  41 -11.380   6.179   1.012
  412    H5'    U  42           H5'        U  42 -15.134   6.640  -4.033
  413   H5''    U  42          H5''        U  42 -16.904   6.604  -4.166
  414    H4'    U  42           H4'        U  42 -15.936   4.641  -5.255
  415    H3'    U  42           H3'        U  42 -17.311   3.863  -2.650
  416    H2'    U  42          H2''        U  42 -16.806   1.643  -3.186
  417   HO2'    U  42           H2'        U  42 -15.801   1.502  -5.551
  418    H1'    U  42           H1'        U  42 -14.344   2.173  -4.421
  419    H3     U  42           H3         U  42 -13.404  -0.545  -0.865
  420    H5     U  42           H5         U  42 -13.971   3.280   0.799
  421    H6     U  42           H6         U  42 -14.821   4.015  -1.349
  422    H5'    G  43           H5'        G  43 -18.729   1.306  -5.612
  423   H5''    G  43          H5''        G  43 -20.473   0.981  -5.552
  424    H4'    G  43           H4'        G  43 -19.224  -1.114  -5.572
  425    H3'    G  43           H3'        G  43 -20.443  -0.614  -2.826
  426    H2'    G  43          H2''        G  43 -19.606  -2.705  -2.207
  427   HO2'    G  43           H2'        G  43 -18.793  -3.499  -4.756
  428    H1'    G  43           H1'        G  43 -17.271  -2.579  -3.747
  429    H8     G  43           H8         G  43 -17.839   0.564  -1.661
  430    H1     G  43           H1         G  43 -15.172  -4.235   1.615
  431    H21    G  43           H21        G  43 -15.298  -6.129   0.435
  432    H22    G  43           H22        G  43 -16.030  -6.189  -1.153
  433    H5'    C  44           H5'        C  44 -21.424  -4.472  -3.998
  434   H5''    C  44          H5''        C  44 -23.096  -4.968  -3.671
  435    H4'    C  44           H4'        C  44 -21.524  -6.598  -2.748
  436    H3'    C  44           H3'        C  44 -22.860  -4.997  -0.528
  437    H2'    C  44          H2''        C  44 -21.719  -6.373   0.980
  438   HO2'    C  44           H2'        C  44 -21.158  -8.156  -1.180
  439    H1'    C  44           H1'        C  44 -19.396  -6.666  -0.563
  440    H41    C  44           H41        C  44 -17.912  -2.556   4.077
  441    H42    C  44           H42        C  44 -18.642  -1.252   3.168
  442    H5     C  44           H5         C  44 -19.852  -1.598   1.109
  443    H6     C  44           H6         C  44 -20.683  -3.278  -0.470
  444    H5'    C  45           H5'        C  45 -23.156  -8.981   0.478
  445   H5''    C  45          H5''        C  45 -24.766  -9.505   1.009
  446    H4'    C  45           H4'        C  45 -23.084 -10.186   2.644
  447    H3'    C  45           H3'        C  45 -24.819  -7.901   3.615
  448   HO3'    C  45           H3T        C  45 -24.997 -10.641   3.406
  449    H2'    C  45          H2''        C  45 -23.682  -7.952   5.640
  450   HO2'    C  45           H2'        C  45 -23.621  -9.920   6.451
  451    H1'    C  45           H1'        C  45 -21.204  -8.880   4.574
  452    H41    C  45           H41        C  45 -20.184  -2.788   6.300
  453    H42    C  45           H42        C  45 -21.007  -2.262   4.857
  454    H5     C  45           H5         C  45 -22.113  -3.742   3.341
  455    H6     C  45           H6         C  45 -22.728  -6.064   2.876
  Start of MODEL   10
    1    H1   DAB   1           H        DAB   1  -3.345  -9.322  -2.037
    2    HA   DAB   1           HA       DAB   1  -3.900  -8.131  -4.703
    3    HB2  DAB   1           HB2      DAB   1  -3.668  -6.691  -2.058
    4    HB3  DAB   1           HB3      DAB   1  -4.238  -6.030  -3.589
    5    HG2  DAB   1           HG2      DAB   1  -5.568  -8.203  -1.951
    6    HG3  DAB   1           HG3      DAB   1  -6.161  -6.559  -2.197
    7    HD1  DAB   1           HD1      DAB   1  -5.622  -7.741  -4.691
    8    HD2  DAB   1           HD2      DAB   1  -7.105  -7.188  -4.078
    9    HD3  DAB   1           HD3      DAB   1  -6.613  -8.789  -3.794
   10    H    VAL   2           H        VAL   2  -2.373  -6.812  -5.671
   11    HA   VAL   2           HA       VAL   2   0.294  -6.702  -4.420
   12    HB   VAL   2           HB       VAL   2   0.658  -8.368  -5.981
   13   HG11  VAL   2          HG11      VAL   2  -0.306  -8.142  -8.348
   14   HG12  VAL   2          HG12      VAL   2  -1.313  -6.848  -7.699
   15   HG13  VAL   2          HG13      VAL   2  -1.461  -8.486  -7.061
   16   HG21  VAL   2          HG21      VAL   2   1.085  -6.036  -7.839
   17   HG22  VAL   2          HG22      VAL   2   2.130  -7.427  -7.550
   18   HG23  VAL   2          HG23      VAL   2   2.017  -6.143  -6.346
   19    H    ARG   3           H        ARG   3   1.069  -4.681  -4.195
   20    HA   ARG   3           HA       ARG   3   0.229  -2.685  -6.240
   21    HB2  ARG   3           HB2      ARG   3   0.024  -2.612  -3.249
   22    HB3  ARG   3           HB3      ARG   3   0.392  -1.119  -4.097
   23    HG2  ARG   3           HG2      ARG   3  -1.709  -0.900  -4.857
   24    HG3  ARG   3           HG3      ARG   3  -1.796  -2.563  -5.397
   25    HD2  ARG   3           HD2      ARG   3  -3.363  -2.763  -3.770
   26    HD3  ARG   3           HD3      ARG   3  -1.995  -2.905  -2.682
   27    HE   ARG   3           HE       ARG   3  -2.983  -0.205  -3.243
   28   HH11  ARG   3          HH11      ARG   3  -3.566   0.959  -1.390
   29   HH12  ARG   3          HH12      ARG   3  -3.719   0.140   0.128
   30   HH21  ARG   3          HH21      ARG   3  -2.834  -2.951  -1.156
   31   HH22  ARG   3          HH22      ARG   3  -3.301  -2.073   0.260
   32    H    THR   4           H        THR   4   1.751  -1.164  -6.767
   33    HA   THR   4           HA       THR   4   4.379  -1.443  -5.500
   34    HB   THR   4           HB       THR   4   5.147  -0.892  -8.011
   35    HG1  THR   4           HG1      THR   4   2.570  -1.518  -8.195
   36   HG21  THR   4          HG21      THR   4   6.144  -2.756  -7.051
   37   HG22  THR   4          HG22      THR   4   5.145  -3.520  -8.287
   38   HG23  THR   4          HG23      THR   4   4.598  -3.481  -6.613
   39    H    ARG   5           H        ARG   5   5.721   0.390  -5.551
   40    HA   ARG   5           HA       ARG   5   4.595   2.871  -6.568
   41    HB2  ARG   5           HB2      ARG   5   5.323   3.174  -3.725
   42    HB3  ARG   5           HB3      ARG   5   3.971   3.847  -4.622
   43    HG2  ARG   5           HG2      ARG   5   2.742   1.742  -4.436
   44    HG3  ARG   5           HG3      ARG   5   4.111   0.974  -3.642
   45    HD2  ARG   5           HD2      ARG   5   2.063   2.143  -2.296
   46    HD3  ARG   5           HD3      ARG   5   3.691   1.964  -1.643
   47    HE   ARG   5           HE       ARG   5   3.330   4.363  -3.165
   48   HH11  ARG   5          HH11      ARG   5   3.415   6.301  -1.941
   49   HH12  ARG   5          HH12      ARG   5   3.289   6.210  -0.201
   50   HH21  ARG   5          HH21      ARG   5   2.999   2.746  -0.180
   51   HH22  ARG   5          HH22      ARG   5   3.059   4.177   0.802
   52    H    LYS   6           H        LYS   6   6.361   3.432  -7.732
   53    HA   LYS   6           HA       LYS   6   8.609   3.632  -8.268
   54    HB2  LYS   6           HB2      LYS   6   7.622   5.572  -6.437
   55    HB3  LYS   6           HB3      LYS   6   9.277   5.258  -5.962
   56    HG2  LYS   6           HG2      LYS   6   9.661   6.905  -7.549
   57    HG3  LYS   6           HG3      LYS   6   9.721   5.494  -8.585
   58    HD2  LYS   6           HD2      LYS   6   8.271   7.222  -9.563
   59    HD3  LYS   6           HD3      LYS   6   7.348   5.782  -9.196
   60    HE2  LYS   6           HE2      LYS   6   6.054   6.855  -7.665
   61    HE3  LYS   6           HE1      LYS   6   7.393   7.802  -7.017
   62    HZ1  LYS   6           HZ1      LYS   6   5.969   8.298  -9.572
   63    HZ2  LYS   6           HZ2      LYS   6   7.316   9.176  -9.026
   64    HZ3  LYS   6           HZ3      LYS   6   5.854   9.234  -8.163
   65    H    GLY   7           H        GLY   7   9.015   1.342  -7.759
   66    HA2  GLY   7           HA2      GLY   7  10.702  -0.080  -7.059
   67    HA3  GLY   7           HA3      GLY   7  11.280   1.177  -5.978
   68    H    ARG   8           H        ARG   8   8.702   1.564  -4.705
   69    HA   ARG   8           HA       ARG   8   8.953  -0.470  -2.708
   70    HB2  ARG   8           HB2      ARG   8   6.801   1.649  -2.967
   71    HB3  ARG   8           HB3      ARG   8   7.150   0.703  -1.540
   72    HG2  ARG   8           HG2      ARG   8   9.167   1.836  -1.101
   73    HG3  ARG   8           HG3      ARG   8   9.340   2.373  -2.766
   74    HD2  ARG   8           HD2      ARG   8   6.892   3.352  -1.418
   75    HD3  ARG   8           HD3      ARG   8   8.399   3.952  -0.733
   76    HE   ARG   8           HE       ARG   8   7.364   4.508  -3.407
   77   HH11  ARG   8          HH11      ARG   8   8.469   6.186  -4.483
   78   HH12  ARG   8          HH12      ARG   8   9.974   6.766  -3.850
   79   HH21  ARG   8          HH21      ARG   8   9.993   4.587  -1.157
   80   HH22  ARG   8          HH22      ARG   8  10.836   5.862  -1.971
   81    H    ARG   9           H        ARG   9   8.398  -2.457  -3.401
   82    HA   ARG   9           HA       ARG   9   5.858  -2.892  -4.790
   83    HB2  ARG   9           HB2      ARG   9   6.773  -5.329  -4.730
   84    HB3  ARG   9           HB3      ARG   9   7.531  -4.166  -5.818
   85    HG2  ARG   9           HG2      ARG   9   9.356  -3.804  -4.313
   86    HG3  ARG   9           HG3      ARG   9   8.539  -4.674  -3.012
   87    HD2  ARG   9           HD2      ARG   9   8.574  -6.723  -4.507
   88    HD3  ARG   9           HD3      ARG   9   9.630  -5.823  -5.591
   89    HE   ARG   9           HE       ARG   9  10.491  -5.985  -2.808
   90   HH11  ARG   9          HH11      ARG   9  12.492  -7.012  -2.517
   91   HH12  ARG   9          HH12      ARG   9  13.214  -7.880  -3.831
   92   HH21  ARG   9          HH21      ARG   9  10.631  -7.202  -6.043
   93   HH22  ARG   9          HH22      ARG   9  12.160  -7.987  -5.828
   94    H    ILE  10           H        ILE  10   4.186  -2.768  -3.335
   95    HA   ILE  10           HA       ILE  10   4.523  -4.293  -0.805
   96    HB   ILE  10           HB       ILE  10   2.957  -2.827   0.206
   97   HG12  ILE  10          HG12      ILE  10   2.253  -2.162  -2.639
   98   HG13  ILE  10          HG13      ILE  10   1.196  -2.565  -1.298
   99   HG21  ILE  10          HG21      ILE  10   5.233  -1.887  -0.259
  100   HG22  ILE  10          HG22      ILE  10   4.007  -0.647  -0.106
  101   HG23  ILE  10          HG23      ILE  10   4.586  -1.122  -1.704
  102   HD11  ILE  10          HD11      ILE  10   0.906  -0.235  -1.608
  103   HD12  ILE  10          HD12      ILE  10   2.644   0.002  -1.832
  104   HD13  ILE  10          HD13      ILE  10   2.009  -0.384  -0.235
  105    H    4J5  11           H        NOR  11   3.537  -6.209  -0.762
  106    HA   4J5  11           HA       NOR  11   1.150  -6.574  -2.433
  107    HD   4J5  11           HD       NOR  11   2.689  -6.008  -3.408
  108    HB2  4J5  11           HB2      NOR  11   3.172  -8.590  -1.465
  109    HB3  4J5  11           HB3      NOR  11   1.624  -9.043  -2.163
  110    HG2  4J5  11           HG2      NOR  11   3.893  -8.664  -3.634
  111    HG3  4J5  11           HG3      NOR  11   2.263  -8.508  -4.279
  112   HH11  4J5  11          HH11      NOR  11   4.757  -8.215  -5.110
  113   HH12  4J5  11          HH12      NOR  11   5.648  -6.967  -5.916
  114   HH21  4J5  11          HH21      NOR  11   3.874  -4.378  -4.446
  115   HH22  4J5  11          HH22      NOR  11   5.149  -4.798  -5.540
  116    H    ILE  12           H        ILE  12  -0.725  -7.043  -1.571
  117    HA   ILE  12           HA       ILE  12  -0.819  -7.483   1.354
  118    HB   ILE  12           HB       ILE  12  -3.388  -6.766   0.196
  119   HG12  ILE  12          HG12      ILE  12  -1.797  -5.579  -1.449
  120   HG13  ILE  12          HG13      ILE  12  -2.964  -4.571  -0.606
  121   HG21  ILE  12          HG21      ILE  12  -3.150  -4.890   1.876
  122   HG22  ILE  12          HG22      ILE  12  -1.550  -5.524   2.254
  123   HG23  ILE  12          HG23      ILE  12  -2.981  -6.514   2.547
  124   HD11  ILE  12          HD11      ILE  12  -0.128  -4.972   0.381
  125   HD12  ILE  12          HD12      ILE  12  -1.303  -3.781   0.944
  126   HD13  ILE  12          HD13      ILE  12  -0.618  -3.650  -0.669
  127    HA   DPR  13           HA       DPR  13  -2.595 -11.501   1.014
  128    HB2  DPR  13           HB2      DPR  13  -0.886 -13.102   1.001
  129    HB3  DPR  13           HB3      DPR  13   0.005 -12.278  -0.299
  130    HG2  DPR  13           HG2      DPR  13  -0.162 -11.593   2.597
  131    HG3  DPR  13           HG3      DPR  13   1.250 -11.641   1.525
  132    HD2  DPR  13           HD2      DPR  13  -0.020  -9.327   2.161
  133    HD3  DPR  13           HD3      DPR  13   0.801  -9.578   0.601
  134    HA   PRO  14           HA       PRO  14  -3.677 -12.484  -3.239
  135    HB2  PRO  14           HB2      PRO  14  -6.250 -11.599  -3.264
  136    HB3  PRO  14           HB3      PRO  14  -5.748 -13.079  -2.426
  137    HG2  PRO  14           HG2      PRO  14  -6.281 -10.369  -1.320
  138    HG3  PRO  14           HG3      PRO  14  -6.714 -11.955  -0.665
  139    HD2  PRO  14           HD2      PRO  14  -4.576 -10.492   0.234
  140    HD3  PRO  14           HD3      PRO  14  -4.637 -12.265   0.303
  141    H5'    G  17           H5'        G  17 -15.618  -2.165  15.884
  142   H5''    G  17          H5''        G  17 -13.983  -2.771  15.568
  143    H4'    G  17           H4'        G  17 -15.542  -4.597  15.343
  144    H3'    G  17           H3'        G  17 -14.466  -3.655  12.661
  145    H2'    G  17          H2''        G  17 -15.650  -5.418  11.657
  146   HO2'    G  17           H2'        G  17 -16.400  -6.575  14.115
  147    H1'    G  17           H1'        G  17 -17.897  -5.266  13.264
  148    H8     G  17           H8         G  17 -16.951  -1.740  12.377
  149    H1     G  17           H1         G  17 -19.920  -4.857   7.630
  150    H21    G  17           H21        G  17 -20.033  -6.997   8.070
  151    H22    G  17           H22        G  17 -19.389  -7.693   9.539
  152   HO5'    G  17           H5T        G  17 -14.106  -1.883  13.496
  153    H5'    G  18           H5'        G  18 -14.070  -7.743  12.713
  154   H5''    G  18          H5''        G  18 -12.504  -8.367  12.160
  155    H4'    G  18           H4'        G  18 -14.322  -9.399  10.896
  156    H3'    G  18           H3'        G  18 -12.747  -7.431   9.179
  157    H2'    G  18          H2''        G  18 -14.084  -8.136   7.373
  158   HO2'    G  18           H2'        G  18 -15.609 -10.059   8.086
  159    H1'    G  18           H1'        G  18 -16.436  -8.422   8.815
  160    H8     G  18           H8         G  18 -14.728  -5.131   9.673
  161    H1     G  18           H1         G  18 -18.030  -4.964   4.190
  162    H21    G  18           H21        G  18 -18.597  -7.020   3.576
  163    H22    G  18           H22        G  18 -18.179  -8.429   4.525
  164    H5'    C  19           H5'        C  19 -13.031 -10.995   7.069
  165   H5''    C  19          H5''        C  19 -11.549 -11.521   6.249
  166    H4'    C  19           H4'        C  19 -13.415 -11.401   4.671
  167    H3'    C  19           H3'        C  19 -11.394  -9.173   4.152
  168    H2'    C  19          H2''        C  19 -12.707  -8.586   2.294
  169   HO2'    C  19           H2'        C  19 -13.920 -11.158   2.556
  170    H1'    C  19           H1'        C  19 -15.176  -9.176   3.453
  171    H41    C  19           H41        C  19 -14.650  -2.846   3.551
  172    H42    C  19           H42        C  19 -13.717  -2.933   5.028
  173    H5     C  19           H5         C  19 -12.996  -5.016   6.012
  174    H6     C  19           H6         C  19 -12.937  -7.447   5.730
  175    H5'    A  20           H5'        A  20 -12.185 -10.966   0.522
  176   H5''    A  20          H5''        A  20 -10.755 -11.303  -0.469
  177    H4'    A  20           H4'        A  20 -12.388 -10.033  -1.763
  178    H3'    A  20           H3'        A  20  -9.974  -8.328  -1.037
  179    H2'    A  20          H2''        A  20 -10.927  -6.619  -2.343
  180   HO2'    A  20           H2'        A  20 -12.027  -8.754  -3.680
  181    H1'    A  20           H1'        A  20 -13.572  -7.117  -1.660
  182    H8     A  20           H8         A  20 -11.331  -7.111   1.423
  183    H61    A  20           H61        A  20 -12.217  -0.990   1.495
  184    H62    A  20           H62        A  20 -11.627  -2.368   2.395
  185    H2     A  20           H2         A  20 -13.712  -2.557  -2.409
  186    H5'    G  21           H5'        G  21 -10.602  -7.977  -5.150
  187   H5''    G  21          H5''        G  21  -9.131  -7.996  -6.141
  188    H4'    G  21           H4'        G  21 -10.450  -5.999  -6.609
  189    H3'    G  21           H3'        G  21  -7.908  -5.296  -5.085
  190    H2'    G  21          H2''        G  21  -8.525  -3.046  -5.302
  191   HO2'    G  21           H2'        G  21 -10.603  -3.577  -7.134
  192    H1'    G  21           H1'        G  21 -11.303  -3.473  -5.165
  193    H8     G  21           H8         G  21  -9.365  -5.167  -2.353
  194    H1     G  21           H1         G  21 -10.444   1.050  -1.417
  195    H21    G  21           H21        G  21 -11.174   2.006  -3.280
  196    H22    G  21           H22        G  21 -11.408   1.095  -4.753
  197    H5'    A  22           H5'        A  22  -8.273  -2.651  -8.098
  198   H5''    A  22          H5''        A  22  -6.838  -2.407  -9.115
  199    H4'    A  22           H4'        A  22  -7.642  -0.255  -8.289
  200    H3'    A  22           H3'        A  22  -5.031  -1.162  -7.018
  201    H2'    A  22          H2''        A  22  -4.994   0.795  -5.766
  202   HO2'    A  22           H2'        A  22  -5.120   2.457  -7.106
  203    H1'    A  22           H1'        A  22  -7.837   1.245  -5.735
  204    H8     A  22           H8         A  22  -6.716  -2.091  -4.289
  205    H61    A  22           H61        A  22  -6.197   0.834   1.112
  206    H62    A  22           H62        A  22  -6.212  -0.711   0.292
  207    H2     A  22           H2         A  22  -6.787   3.933  -2.110
  208    H5'    U  23           H5'        U  23  -1.131   1.252  -9.188
  209   H5''    U  23          H5''        U  23  -1.268   0.502  -7.585
  210    H4'    U  23           H4'        U  23  -1.576   3.473  -8.104
  211    H3'    U  23           H3'        U  23   0.878   1.838  -7.513
  212    H2'    U  23          H2''        U  23   1.409   3.107  -5.665
  213   HO2'    U  23           H2'        U  23   0.554   5.538  -6.005
  214    H1'    U  23           H1'        U  23  -1.106   4.627  -5.562
  215    H3     U  23           H3         U  23   0.355   4.279  -1.255
  216    H5     U  23           H5         U  23  -1.271   0.512  -2.212
  217    H6     U  23           H6         U  23  -1.479   1.284  -4.506
  218    H5'    C  24           H5'        C  24   4.277   4.662  -8.157
  219   H5''    C  24          H5''        C  24   2.721   5.231  -8.734
  220    H4'    C  24           H4'        C  24   4.412   6.422  -9.931
  221    H3'    C  24           H3'        C  24   2.510   4.952 -11.371
  222    H2'    C  24          H2''        C  24   3.911   3.243 -12.112
  223   HO2'    C  24           H2'        C  24   5.157   4.243 -14.064
  224    H1'    C  24           H1'        C  24   6.299   5.075 -12.309
  225    H41    C  24           H41        C  24   8.944  -0.723 -12.515
  226    H42    C  24           H42        C  24   8.462  -1.002 -10.856
  227    H5     C  24           H5         C  24   7.097   0.548  -9.603
  228    H6     C  24           H6         C  24   5.892   2.670  -9.674
  229    H5'    U  25           H5'        U  25  -0.626   7.180 -12.372
  230   H5''    U  25          H5''        U  25   0.796   7.811 -11.514
  231    H4'    U  25           H4'        U  25  -0.251   5.030 -10.988
  232    H3'    U  25           H3'        U  25  -1.882   7.208 -10.417
  233    H2'    U  25          H2''        U  25  -0.433   8.311  -8.925
  234   HO2'    U  25           H2'        U  25  -1.199   6.323  -7.073
  235    H1'    U  25           H1'        U  25   0.543   5.702  -7.801
  236    H3     U  25           H3         U  25   3.403  10.096  -8.782
  237    H5     U  25           H5         U  25   3.936   7.595  -5.417
  238    H6     U  25           H6         U  25   2.190   6.175  -6.289
  239    H5'    G  26           H5'        G  26  -5.110   7.656  -7.892
  240   H5''    G  26          H5''        G  26  -3.536   8.384  -8.258
  241    H4'    G  26           H4'        G  26  -4.415   9.353  -6.233
  242    H3'    G  26           H3'        G  26  -2.087   7.487  -5.644
  243    H2'    G  26          H2''        G  26  -2.262   8.054  -3.398
  244   HO2'    G  26           H2'        G  26  -3.436  10.401  -4.442
  245    H1'    G  26           H1'        G  26  -5.041   8.436  -3.359
  246    H8     G  26           H8         G  26  -4.932   5.051  -4.718
  247    H1     G  26           H1         G  26  -2.913   5.285   1.366
  248    H21    G  26           H21        G  26  -2.415   7.399   1.925
  249    H22    G  26           H22        G  26  -2.604   8.720   0.794
  250    H5'    A  27           H5'        A  27  -1.594  11.057  -3.622
  251   H5''    A  27          H5''        A  27  -0.019  11.827  -3.841
  252    H4'    A  27           H4'        A  27  -0.680  11.857  -1.484
  253    H3'    A  27           H3'        A  27   1.648   9.929  -1.935
  254    H2'    A  27          H2''        A  27   1.694   9.668   0.407
  255   HO2'    A  27           H2'        A  27   0.625  12.209   0.344
  256    H1'    A  27           H1'        A  27  -1.059   9.772   0.787
  257    H8     A  27           H8         A  27  -0.151   7.381  -2.056
  258    H61    A  27           H61        A  27   0.561   3.181   2.463
  259    H62    A  27           H62        A  27   0.469   3.443   0.724
  260    H2     A  27           H2         A  27   0.125   7.197   4.347
  261    H5'    G  28           H5'        G  28   2.616  12.589   1.178
  262   H5''    G  28          H5''        G  28   4.303  13.130   1.198
  263    H4'    G  28           H4'        G  28   3.682  12.208   3.366
  264    H3'    G  28           H3'        G  28   5.589  10.318   1.922
  265    H2'    G  28          H2''        G  28   5.552   9.010   3.870
  266   HO2'    G  28           H2'        G  28   4.681  11.410   5.122
  267    H1'    G  28           H1'        G  28   2.883   9.558   4.554
  268    H8     G  28           H8         G  28   3.358   8.458   0.926
  269    H1     G  28           H1         G  28   3.249   3.636   5.098
  270    H21    G  28           H21        G  28   3.383   4.366   7.160
  271    H22    G  28           H22        G  28   3.488   6.069   7.541
  272    H5'    C  29           H5'        C  29   6.967  10.732   5.740
  273   H5''    C  29          H5''        C  29   8.699  11.078   5.896
  274    H4'    C  29           H4'        C  29   8.102   9.170   7.290
  275    H3'    C  29           H3'        C  29   9.748   8.346   4.856
  276    H2'    C  29          H2''        C  29   9.706   6.163   5.682
  277   HO2'    C  29           H2'        C  29   8.836   6.953   8.254
  278    H1'    C  29           H1'        C  29   7.201   6.376   7.045
  279    H41    C  29           H41        C  29   6.257   2.302   2.286
  280    H42    C  29           H42        C  29   6.054   3.647   1.180
  281    H5     C  29           H5         C  29   6.440   5.929   1.800
  282    H6     C  29           H6         C  29   7.102   7.434   3.612
  283    H5'    C  30           H5'        C  30  11.541   6.468   8.019
  284   H5''    C  30          H5''        C  30  13.236   6.920   8.300
  285    H4'    C  30           H4'        C  30  13.034   4.483   8.269
  286    H3'    C  30           H3'        C  30  14.394   5.651   5.798
  287    H2'    C  30          H2''        C  30  14.773   3.449   5.074
  288   HO2'    C  30           H2'        C  30  15.312   1.909   6.430
  289    H1'    C  30           H1'        C  30  12.436   2.326   6.254
  290    H41    C  30           H41        C  30  11.541   2.173  -0.005
  291    H42    C  30           H42        C  30  10.892   3.795   0.067
  292    H5     C  30           H5         C  30  10.955   5.154   2.033
  293    H6     C  30           H6         C  30  11.577   5.229   4.387
  294    H5'    U  31           H5'        U  31  16.864   2.767   6.821
  295   H5''    U  31          H5''        U  31  18.517   3.253   7.248
  296    H4'    U  31           H4'        U  31  18.582   1.495   5.572
  297    H3'    U  31           H3'        U  31  19.987   3.858   5.210
  298    H2'    U  31          H2''        U  31  18.642   4.839   3.562
  299   HO2'    U  31           H2'        U  31  19.295   3.742   1.420
  300    H1'    U  31           H1'        U  31  17.884   2.228   2.308
  301    H3     U  31           H3         U  31  14.478   4.067   0.037
  302    H5     U  31           H5         U  31  14.631   6.413   3.535
  303    H6     U  31           H6         U  31  16.491   5.055   4.290
  304    H5'    G  32           H5'        G  32  21.179  -1.306   6.565
  305   H5''    G  32          H5''        G  32  21.014  -0.888   4.852
  306    H4'    G  32           H4'        G  32  18.842  -0.458   6.917
  307    H3'    G  32           H3'        G  32  19.488  -3.012   5.944
  308    H2'    G  32          H2''        G  32  18.851  -2.655   3.713
  309   HO2'    G  32           H2'        G  32  16.176  -2.694   4.483
  310    H1'    G  32           H1'        G  32  16.643  -0.768   4.506
  311    H8     G  32           H8         G  32  19.847   0.024   2.532
  312    H1     G  32           H1         G  32  14.519  -0.285  -1.007
  313    H21    G  32           H21        G  32  12.814  -0.967   0.239
  314    H22    G  32           H22        G  32  12.987  -1.357   1.935
  315    H5'    G  33           H5'        G  33  15.453  -1.590   6.171
  316   H5''    G  33          H5''        G  33  14.439  -2.409   7.362
  317    H4'    G  33           H4'        G  33  13.069  -1.393   5.614
  318    H3'    G  33           H3'        G  33  12.751  -4.015   6.469
  319    H2'    G  33          H2''        G  33  13.687  -5.098   4.613
  320   HO2'    G  33           H2'        G  33  11.075  -4.364   3.723
  321    H1'    G  33           H1'        G  33  12.622  -3.063   2.665
  322    H8     G  33           H8         G  33  15.844  -4.925   3.911
  323    H1     G  33           H1         G  33  15.288  -4.252  -2.438
  324    H21    G  33           H21        G  33  13.444  -3.103  -2.915
  325    H22    G  33           H22        G  33  12.369  -2.501  -1.674
  326    H5'    G  34           H5'        G  34   7.808  -5.246   4.440
  327   H5''    G  34          H5''        G  34   9.177  -6.353   4.587
  328    H4'    G  34           H4'        G  34   8.044  -6.794   2.517
  329    H3'    G  34           H3'        G  34  10.787  -6.250   2.590
  330    H2'    G  34          H2''        G  34  10.720  -4.136   1.578
  331   HO2'    G  34           H2'        G  34  11.702  -4.806  -0.176
  332    H1'    G  34           H1'        G  34   8.366  -4.912  -0.148
  333    H8     G  34           H8         G  34   7.115  -2.770  -0.917
  334    H1     G  34           H1         G  34  10.766   0.939   2.717
  335    H21    G  34           H21        G  34  12.013  -0.298   4.079
  336    H22    G  34           H22        G  34  11.966  -2.046   4.050
  337    H5'    A  35           H5'        A  35   8.944  -8.463   3.811
  338   H5''    A  35          H5''        A  35   8.453 -10.162   3.892
  339    H4'    A  35           H4'        A  35   6.726  -8.067   4.018
  340    H3'    A  35           H3'        A  35   6.356 -10.879   3.583
  341    H2'    A  35          H2''        A  35   5.531 -10.757   1.461
  342   HO2'    A  35           H2'        A  35   3.289  -9.295   2.228
  343    H1'    A  35           H1'        A  35   4.628  -7.889   1.817
  344    H8     A  35           H8         A  35   5.136  -6.525  -0.513
  345    H61    A  35           H61        A  35   6.323 -10.621  -5.005
  346    H62    A  35           H62        A  35   5.985  -8.943  -4.648
  347    H2     A  35           H2         A  35   6.326 -12.777  -1.072
  348    H5'    G  36           H5'        G  36   6.618  -7.809   6.239
  349   H5''    G  36          H5''        G  36   5.052  -7.947   7.050
  350    H4'    G  36           H4'        G  36   6.392  -6.160   8.035
  351    H3'    G  36           H3'        G  36   4.019  -5.125   6.436
  352    H2'    G  36          H2''        G  36   4.613  -2.981   7.099
  353   HO2'    G  36           H2'        G  36   6.437  -3.820   9.066
  354    H1'    G  36           H1'        G  36   7.397  -3.472   7.271
  355    H8     G  36           H8         G  36   5.822  -4.340   3.875
  356    H1     G  36           H1         G  36   7.361   1.849   4.591
  357    H21    G  36           H21        G  36   7.840   2.297   6.674
  358    H22    G  36           H22        G  36   7.831   1.075   7.925
  359    H5'    C  37           H5'        C  37   4.114  -3.493  10.301
  360   H5''    C  37          H5''        C  37   2.559  -3.471  11.148
  361    H4'    C  37           H4'        C  37   3.616  -1.286  11.310
  362    H3'    C  37           H3'        C  37   1.246  -1.229   9.379
  363    H2'    C  37          H2''        C  37   1.592   1.107   9.271
  364   HO2'    C  37           H2'        C  37   3.219   0.797  11.599
  365    H1'    C  37           H1'        C  37   4.385   1.003   9.336
  366    H41    C  37           H41        C  37   2.827   1.978   3.273
  367    H42    C  37           H42        C  37   2.566   0.265   3.039
  368    H5     C  37           H5         C  37   2.654  -1.339   4.864
  369    H6     C  37           H6         C  37   2.945  -1.602   7.287
  370    H5'    U  38           H5'        U  38   0.497   1.887  11.990
  371   H5''    U  38          H5''        U  38  -1.183   1.995  12.547
  372    H4'    U  38           H4'        U  38  -0.492   4.097  11.516
  373    H3'    U  38           H3'        U  38  -2.460   2.615   9.712
  374    H2'    U  38          H2''        U  38  -2.360   4.475   8.293
  375   HO2'    U  38           H2'        U  38  -0.937   6.227   9.837
  376    H1'    U  38           H1'        U  38   0.336   5.123   8.815
  377    H3     U  38           H3         U  38   0.015   4.417   4.323
  378    H5     U  38           H5         U  38   0.025   0.563   6.054
  379    H6     U  38           H6         U  38  -0.250   1.611   8.220
  380    H5'    C  39           H5'        C  39  -3.726   6.498  10.203
  381   H5''    C  39          H5''        C  39  -5.468   6.756  10.408
  382    H4'    C  39           H4'        C  39  -4.557   8.110   8.572
  383    H3'    C  39           H3'        C  39  -6.393   5.910   7.512
  384    H2'    C  39          H2''        C  39  -6.013   6.796   5.381
  385   HO2'    C  39           H2'        C  39  -4.778   9.071   5.617
  386    H1'    C  39           H1'        C  39  -3.393   7.732   5.893
  387    H41    C  39           H41        C  39  -2.878   2.947   1.763
  388    H42    C  39           H42        C  39  -3.038   1.766   3.043
  389    H5     C  39           H5         C  39  -3.534   2.367   5.342
  390    H6     C  39           H6         C  39  -4.012   4.252   6.865
  391    H5'    U  40           H5'        U  40  -7.368   9.435   5.720
  392   H5''    U  40          H5''        U  40  -9.093   9.839   5.634
  393    H4'    U  40           H4'        U  40  -8.058   9.945   3.405
  394    H3'    U  40           H3'        U  40  -9.970   7.585   3.694
  395    H2'    U  40          H2''        U  40  -9.574   7.135   1.416
  396   HO2'    U  40           H2'        U  40  -8.890   9.860   1.333
  397    H1'    U  40           H1'        U  40  -6.885   7.858   1.402
  398    H3     U  40           H3         U  40  -7.009   3.367   0.370
  399    H5     U  40           H5         U  40  -7.532   3.584   4.555
  400    H6     U  40           H6         U  40  -7.782   5.984   4.344
  401    H5'    C  41           H5'        C  41 -11.118   9.692   0.228
  402   H5''    C  41          H5''        C  41 -12.867   9.945   0.047
  403    H4'    C  41           H4'        C  41 -11.968   8.849  -1.939
  404    H3'    C  41           H3'        C  41 -13.634   6.918  -0.266
  405    H2'    C  41          H2''        C  41 -13.275   5.327  -1.957
  406   HO2'    C  41           H2'        C  41 -13.057   5.849  -4.016
  407    H1'    C  41           H1'        C  41 -10.667   6.096  -2.576
  408    H41    C  41           H41        C  41 -10.105   0.869   1.014
  409    H42    C  41           H42        C  41 -10.295   1.835   2.461
  410    H5     C  41           H5         C  41 -10.856   4.169   2.413
  411    H6     C  41           H6         C  41 -11.375   6.090   0.980
  412    H5'    U  42           H5'        U  42 -15.066   6.530  -4.132
  413   H5''    U  42          H5''        U  42 -16.834   6.477  -4.268
  414    H4'    U  42           H4'        U  42 -15.841   4.510  -5.329
  415    H3'    U  42           H3'        U  42 -17.234   3.757  -2.720
  416    H2'    U  42          H2''        U  42 -16.737   1.523  -3.259
  417   HO2'    U  42           H2'        U  42 -15.832   2.120  -5.852
  418    H1'    U  42           H1'        U  42 -14.254   2.038  -4.437
  419    H3     U  42           H3         U  42 -13.403  -0.634  -0.827
  420    H5     U  42           H5         U  42 -13.995   3.210   0.782
  421    H6     U  42           H6         U  42 -14.800   3.922  -1.392
  422    H5'    G  43           H5'        G  43 -18.665   1.196  -5.675
  423   H5''    G  43          H5''        G  43 -20.407   0.879  -5.608
  424    H4'    G  43           H4'        G  43 -19.165  -1.220  -5.604
  425    H3'    G  43           H3'        G  43 -20.399  -0.679  -2.868
  426    H2'    G  43          H2''        G  43 -19.582  -2.783  -2.222
  427   HO2'    G  43           H2'        G  43 -18.609  -4.075  -4.159
  428    H1'    G  43           H1'        G  43 -17.230  -2.684  -3.726
  429    H8     G  43           H8         G  43 -17.806   0.497  -1.703
  430    H1     G  43           H1         G  43 -15.238  -4.282   1.683
  431    H21    G  43           H21        G  43 -15.378  -6.195   0.528
  432    H22    G  43           H22        G  43 -16.081  -6.264  -1.071
  433    H5'    C  44           H5'        C  44 -21.434  -4.547  -4.020
  434   H5''    C  44          H5''        C  44 -23.109  -5.015  -3.680
  435    H4'    C  44           H4'        C  44 -21.554  -6.648  -2.733
  436    H3'    C  44           H3'        C  44 -22.881  -4.998  -0.538
  437    H2'    C  44          H2''        C  44 -21.765  -6.380   0.995
  438   HO2'    C  44           H2'        C  44 -21.563  -8.185  -1.189
  439    H1'    C  44           H1'        C  44 -19.435  -6.704  -0.513
  440    H41    C  44           H41        C  44 -17.993  -2.536   4.079
  441    H42    C  44           H42        C  44 -18.705  -1.241   3.142
  442    H5     C  44           H5         C  44 -19.885  -1.608   1.067
  443    H6     C  44           H6         C  44 -20.711  -3.309  -0.494
  444    H5'    C  45           H5'        C  45 -23.254  -8.974   0.505
  445   H5''    C  45          H5''        C  45 -24.873  -9.458   1.040
  446    H4'    C  45           H4'        C  45 -23.204 -10.131   2.692
  447    H3'    C  45           H3'        C  45 -24.928  -7.815   3.609
  448   HO3'    C  45           H3T        C  45 -25.545 -10.209   3.138
  449    H2'    C  45          H2''        C  45 -23.814  -7.847   5.648
  450   HO2'    C  45           H2'        C  45 -23.625  -9.741   6.555
  451    H1'    C  45           H1'        C  45 -21.336  -8.818   4.626
  452    H41    C  45           H41        C  45 -20.284  -2.703   6.276
  453    H42    C  45           H42        C  45 -21.088  -2.200   4.814
  454    H5     C  45           H5         C  45 -22.168  -3.694   3.305
  455    H6     C  45           H6         C  45 -22.800  -6.015   2.870